NCode™ Human miRNA Microarray V3
Contents
1. Appendix Technical Support Web Resources Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes SDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our website www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail E mail E mail tech support invitrogen com jpinfo invitrogen com eurotech invitrogen com SDS Certificate of Analysis 16 Safety Data Sheets SDSs are available on our website at www invitrogen com sds The Certificate of Analysis provides detailed quality control and product qualification information for each product Certificates of Analysis are available on our website Go to www invitrogen com support and search for the Certificate of Analysis by product lot number2. Rapid miRNA Labeling System These controls are printed as a row of five spots in duplicate on each subarray one row in the bottom of Block 1 the other row in the bottom of Block 8 see diagram below The five controls are printed in a range of concentrations from high to low to allow for normalization of differences in fluorescent signal intensities between the two capture reagents Highest 00000 Lowest intensity 00000 E B u 0l o Subarray 2 00000 Subarray 3 The image below shows a typical pattern of control spots in a block E Dye marker _ NCode Controls E Alexa Fluor Dye Controls Continued on next page Alexa Fluor Dye Controls continued Using the Alexa Fluor Dye Control Probes Following array hybridization as described in the NCode Rapid miRNA Labeling System manual scan the microarray at the scanner s recommended settings After the scan focus on each row of Alexa Fluor Dye Controls in each subarray and determine the signal intensity of each control spot in one or both dye channels For signal intensity normalization e Dye Control Spot 1 the most concentrated control should have a saturated signal e Dye Control Spot 5 the least concentrated control should be detectable e Dye Control Spots 2 4 at least one of these should have a signal intensity within the linear range of the scanner 1 000 40 000 RFUs For single color ar
3. miRNA samples Each microarray slide comes fully blocked and ready to use The NCode Human miRNA Microarray V3 has been designed and developed as part of a comprehensive suite of NCode products for miRNA labeling detection and analysis The figure below shows labeling and array hybridization using the NCode Rapid miRNA Labeling System 5 3 RNA molecule Poly A tailing reaction Alexa Fluor dye Ogg 3 Ligation of DNA polymer with 15 dye molecules Array hybridization Oligo dT bridge Continued on next page Overview continued MicroRNAs MicroRNAs miRNAs are a recently discovered class of small 19 23 nucleotide non coding RNA molecules They are cleaved from 70 110 nucleotide hairpin precursors and are believed play an important role in translation regulation and degradation of target mRNAs by binding to partially complementary sites in the 3 untranslated regions UTRs of the message Lim 2003 Recent experimental evidence suggests that the number of unique miRNAs in humans could exceed 800 though several groups have hypothesized that there may be up to 20 000 non coding RNAs that contribute to eukaryotic complexity Bentwich et al 2005 Imanishi et al 2004 Okazaki et al 2002 Though hundreds of miRNAs have been discovered in a variety of organisms little is known about their cellular function They have been implicated in regulation of developmental timing a
4. which is printed on the box Continued on next page Technical Support continued Limited Warranty Invitrogen a part of Life Technologies Corporation is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives All Invitrogen products are warranted to perform according to specifications stated on the certificate of analysis The Company will replace free of charge any product that does not meet those specifications This warranty limits the Company s liability to only the price of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions The Company reserves the right to select the method s used to analyze a product unless the Company agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore the Company makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications report it to our Technical Support Representative
5. for use with this microarray including reagents for labeling RNA samples with Alexa Fluor dyes and wash and hybridization buffers See the manual supplied with the NCode Rapid miRNA Labeling System for detailed labeling and hybridization instructions The Rapid Ligation Mixes included with the Labeling System contain 3DNA reagent manufactured under license from Genisphere Inc If you are labeling and hybridizing samples using a method other than the NCode Rapid miRNA Labeling System note that the wash and hybridization reagents must be compatible with Corning Epoxide Coated Glass Slides Scanning and Image Analysis Introduction After the final array hybridization and wash the array should be scanned immediately Materials To scan the array you will need the following Needed A standard digital microarray scanner We recommend a scanner with a bit depth of at least 16 bits pixel The GenePix 4000B Molecular Devices has been tested with NCode microarrays and includes GenePix software for analyzing the scanned image e Microarray acquisition and analysis software such as GenePix Pro Molecular Devices or ScanArray Express PerkinElmer Inc within hour of completing the final wash to minimize The array should be shielded from direct light and scanned Important photobleaching of the fluorescent labels Array Be careful to position the array slide in the proper Orientation orientation in the m
6. recommend examining the image histogram available with GenePix Pro software to determine whether the signal intensities in the two channels are comparable The GAL GenePix Array List file for the array is a tab delimited text file that contains the positions names and probe ID s of the probes on the NCode microarray in tabular format Most major microarray software applications including GenePix Pro and ScanArray can combine the information from the GAL file with the data from the scanned array to generate a results file with all the data for the experiment Note If your software does not accept files in GAL format open the file in a spreadsheet program like Microsoft Excel and reformat the information in a compatible configuration or manually correlate information with your spot intensity data Consult your microarray analysis software for details The GAL file is available on the Invitrogen web site or can be requested from Invitrogen Technical Support see page 16 On the web site follow the link from the NCode Human miRNA Microarray V3 product page in the online catalog or perform a simple search for V3 GAL file using the Search box Click on the link to open the GAL file or save it to a location on your computer Then follow the instructions provided with your microarray analysis software to combine the GAL file information with your scan data Continued on next page Scanning and Image Analysis continu
7. the web site follow the link from the V3 microarray product page in the online catalog or perform a simple search for V3 GAL file using the Search box See page 12 for more information Microarray Specifications Probe Design Microarray Printing Specifications Microarray Blocking The oligonucleotide probes printed on the NCode Human miRNA Microarray V3 were designed from human miRNA sequences from the Sanger Institute s mirBase Sequence Database Release 10 0 http microrna sanger ac uk as well as from novel human miRNAs discovered through deep sequencing and validated by qRT PCR and array profiling In addition mismatch probe sequences and probes complementary to the NCode Multi Species miRNA Microarray Control V2 are printed throughout the array Probes were designed using a proprietary algorithm that generates miRNA sequences with enhanced hybridization properties Goff et al 2005 The probes on the NCode microarray provide comparable sensitivity to wild type sequences while offering maximum specificity for discerning between closely related miRNAs and normalized melting temperatures for uniform hybridization Probes have been validated for their ability to distinguish between wild type and mismatched miRNA sequences with 2 base mismatch The NCode Human miRNA Microarray V3 is contact printed using microquill pins on Corning Epoxide Coated Glass Slides The array specifications are Total su
8. to design loop design and dye swap experiments and analyze the results A link to the software download page can be found at www invitrogen com ncode click on miRNA Data Analysis The NCode Multi Species miRNA Microarray Control V2 is a synthetic 22 nucleotide miRNA sequence that has been designed and screened as a positive control for use with NCode system This control sequence has been tested for cross reactivity with endogenous miRNAs from model organisms and is provided at a concentration compatible with endogenous miRNA expression levels The NCode Multi Species miRNA Microarray V2 includes all known mature miRNAs in the miRBase Sequence Database Release 9 0 for human mouse rat D melanogaster C elegans and Zebrafish The NCode SYBR Green miRNA qRT PCR Kit provides qualified reagents for the detection and quantitation of miRNAs in quantitative RT PCR qRT PCR This kit has been optimized for the detection and quantification of miRNA from 10 ng to 2 5 ug of total RNA using a SYBR Green detection platform The NCode SYBR GreenER miRNA qRT PCR Kit provides qualified reagents for the detection and quantitation of miRNAs in real time qRT PCR This kit has been optimized for the detection and quantification of miRNA from 10 ng to 2 5 ug of total RNA using a SYBR GreenER detection platform The NCode miRNA First Strand cDNA Synthesis Kit provides qualified reagents for the polyadenylation of miRNA
9. Invitrogen by technologies NCode Human miRNA Microarray V3 Epoxide coated glass slides printed with NCode miRNA probes TM Catalog no MIRAH3 05 Rev Date 14 July 2010 Manual part no A10459 MANO0000692 ii Table of Contents Kir Contentsand Slorase naaa V Additional Produes aee oos ae uda esca avete vi A 1 Microarray specihceatlonsa na 6 Alexa Fluor Dye Control Probes aiii 8 Sample Labeling and Hybridization Guidelines 10 Scann ne and Image Analysis eta rad 11 Troubleshootine rr 14 FAN 3 61 1111 O eem ee 16 Technical SUD PON naeh iq usse 16 Purchaser Noticas odes oret ntes ua 18 References heb ose a dia 19 111 iv Kit Contents and Storage Shipping and The NCode Human miRNA Microarray V3 is shipped in a Storage desiccated resealable plastic storage container at room temperature Upon receipt store the microarray slides in the storage container at room temperature protected from light Contents Each box contains five microarray glass slides blocked and ready to use Additional Products Additional The NCode Human miRNA Microarray V3 is part of an Products integrated microRNA expression profiling system that includes isolation labeling and array hybridization components Additional products are available separately from Invitrogen Ordering information is provided below For more information visit our website at www invitrogen com ncode or contact Techn
10. Invitrogen at DNA Oligonucleotides Order page Hcode Search Options Search for Probe and miRNA Browse Entire Collection Array Version C v4 C v2 y3 There are total 1206 results 12345 6 7 8 910 Next 1 1002 hsa mir 330 hsa miR 330 3p MIMA4T0000751 GCAAAGCACACGGCCUCGCAGAGA 2 1014 hsa mir 132 hsa miR 132 MIMATOOOO426 UAACAGUCUACAGCCAUGGUCG 2 Ame hoa mir 4247 hoa mif 424 MIA A TANANIER AC AT MIC A ACOA 4063034 ME A RA 13 Troubleshooting Coverslip stuck to array surface Low or no overall fluorescent signal intensity on the array 14 Hybridization chamber not properly sealed or humidified Inadequate volume of hybridization buffer used for coverslip size Photobleaching of the fluorescent labels Incubation temperatures during hybridization were incorrect Degraded starting material Array slide scanned in wrong orientation Make sure that the hybridization chamber is properly sealed with the correct amount of liquid prior to incubation of the hybridized array Make sure that the hybridization buffer completely covers the array surface under the coverslip Avoid direct exposure of the hybridized array and the mixes containing the fluorescent dyes to light Perform all hybridization and wash procedures in low light conditions Incubation temperatures that are too high will result in lower signal Check the temperatures of all incubators with a calibrated thermometer Us
11. barrays per slide 3 Subarray layout 8 blocks 4 rows x 2 columns Block layout 192 spots 12 rows x 16 columns Block dimensions 4 mm x 3 mm Spot center to center spacing 265 um Probes Unmodified oligonucleotides 34 44 bases long Unprinted areas of each NCode Human miRNA Microarray V3 are fully blocked by the array manufacturer to reduce background fluorescence No additional blocking steps are necessary Continued on next page Microarray Specifications continued V3 Microarray The NCode Human miRNA Microarray V3 is laid out as Layout three replicate subarrays as shown in the illustration below Consult the GAL file for the layout of the spots in each subarray see page 5 for download information Note The array is printed on the same side of the slide as mebeType Probesisubary Probe Type Probes Subarray Database Release 10 0 FEA Human miRs the barcode Subarray 1 Replicate 1 of 3 lA NCode Control Mismatch controls 76 Alexa Fluor Dye Controls Dyemarkers 8 Subarray 2 Replicate 2 of 3 Subarray 3 Replicate 3 of 3 Subarray The image below is of a single subarray Image Alexa Fluor Dye Control Probes Description and Location Position of Controls The Alexa Fluor Dye Control Probes printed on the array are designed to bind directly to the NCode Dye Normalization Control provided with the NCode
12. e isolated small RNA as starting material for labeling and hybridization and follow appropriate guidelines for handling RNA to prevent RNase contamination Always use fresh samples or samples frozen at 80 C If you are starting with total RNA analyze it by agarose ethidium bromide gel electrophoresis prior to isolation of small RNA Check the position of the slide in the scanner reposition and rescan if necessary Continued on next page Troubleshooting continued High or Wash solution uneven residue on the slide background on the array Dehydration of the hybridization buffer Improper array handling Scanner laser and or PMT settings are too high Transfer the slide quickly between wash steps and centrifuge immediately after the final wash step to quickly dry the slide Avoid exposing the slide to air between washes for more than a few seconds Improperly dried wash solution will appear as streaks on the slide This frequently appears as high background around the edges of the array coverslip Make sure that the hybridization buffer completely covers the array surface under the coverslip and that humidity is maintained during incubation Always wear powder free gloves when handling the array and avoid touching the slide surface Increasing these settings to adjust for low signal will increase array background If the fluorescent signal is too low see the troubleshooting on the previous page 15
13. ed GAL File Terminology NCode Profiler Probe Information The GAL file includes the following identifiers e Blank Buffer only control Dye marker Used to align the array in the scanner a k a landing light e Mutl Probe with a single base mismatch for the corresponding miR e Mut2 Probe with a two base mismatch for the corresponding miR e Rev Probe with the reverse sequence for the corresponding miR e Shuf Probe with a shuffled sequence for the corresponding miR NCode Profiler is a free downloadable Windows based software program for designing and analyzing two color expression profiling microarray experiments NCode Profiler can be used to design loop design or dye swap experiments and the resulting data file s can then be imported back into Profiler for analysis A link to the software download page can be found at www invitrogen com ncode click on miRNA Data Analysis Complete probe information including sequences is available in the NCode miRNA Database at http rnaidesigner invitrogen com ncode NCode miRNA Database The NCode miRNA Database contains information from Sanger mirBase Release 9 0 with additional querying capabilities to facilitate your search 1 Search probe specific information for the NCode Multi Species miRNA Microarray by selecting Search for Probe and miRNA or Browse Entire Collection You can order qRT PCR primer sequences from
14. ical Support page 16 NCode Rapid 20 reactions MIRLSRPD 20 miRNA Labeling System NCode miRNA 20 reactions MIRAS 20 Amplification System NCode Multi Species MIRAC2 01 miRNA Microarray Control V2 NCode Human Contact Invitrogen NCode Multi Species miRNA Microarray en Support to order miRNA Microarray Probe Probe Set V3 see page 16 Set V2 3 x 384 well plates MIRMPS2 01 NCode SYBR Green 500 pmol per well miRNA qRT PCR Kit NCode SYBR 10 polyadenylation 20 MIROER 100 GreenER miRNA cDNA synthesis 100 qRT PCR Kit qPCR reactions NCode miRNA First 10 polyadenylation 20 50 polyadenylation 100 Strand cDNA cDNA synthesis cDNA synthesis Synthesis Kit MIRC 10 MIRC 50 UltraPure 20X SSC Quant iT Ribogreen 200 2 000 cuvette assays R 11490 RNA Assay Kit RediPlate 96 96 well plate 8 x 12 strip R 32700 Ribogreen RNA wells Quantitation Kit vi Overview Introduction Experimental Outline Labeling and Microarray Hybridization The NCode Human miRNA Microarray V3 is supplied as a kit of five Corning Epoxide Coated Glass Slides each printed with optimized probe sequences targeting all of the known mature human miRNAs in the miRBase Sequence Database Release 10 0 http microrna sanger ac uk as well as novel human miRNAs discovered through deep sequencing and validated by qRT PCR and array profiling You can use each microarray to screen dye labeled human
15. icroarray scanner If no signal is apparent after scanning double check the orientation of the slide Consult your scanner documentation for details Note that each block in the array has a dye marker or landing light in the upper left corner that typically appears greener than other spots on the array to enable proper orientation of the slide in the scanner Scanning e Program your microarray scanner for the excitation and Guidelines emission maxima of the labeling dyes you are using If you are using the NCode Rapid miRNA Labeling System note that Alexa Fluor 3 and 5 have excitation and emission maxima identical to Alexa Fluor 546 and 647 respectively See the NCode Rapid miRNA Labeling System manual for details Guidelines are continued on the next page Continued on next page 11 Scanning and Image Analysis continued Scanning Guidelines continued GAL File Downloading the GAL Files 12 Guidelines continued from the previous page e Follow the instructions provided with your scanner to adjust the photomultiplier tube PMT settings It is important to adjust the PMT setting for each channel for maximum dynamic range and channel balance e Atypical lower limit of detection LLD is 8 times the median local background of all array features The signal background S B ratio is calculated by dividing the median signal of positive features by the median background e When scanning dual color arrays we
16. is a registered trademark of PerkinElmer Inc GenePix is a registered trademark of Molecular Devices Corporation Reference Goff L A Yang M Bowers J Getts R C Padgett R W and Hart R P 2005 Rational probe optimization and enhanced detection strategy for microRNAs using microarrays RNA Biology 2 published online 2010 Life Technologies Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use The trademarks mentioned herein are the property of Life Technologies Corporation or their respective owners 19 Notes 20 invitrogen by Life technologies Corporate Headquarters 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
17. match controls for screening 1 and 2 base sequence mismatches Microarray is provided blocked and ready to use Designed and developed as part of the comprehensive NCode system The following products are available separately from Invitrogen for ordering information see page vi The NCode Rapid miRNA Labeling System is a robust and efficient system for labeling RNA samples and hybridizing the labeled miRNA to NCode microarrays for expression profiling analysis Using this kit you ligate a DNA polymer labeled with highly fluorescent Alexa Fluor dye molecules to a total RNA sample and then hybridize the labeled miRNA in the sample to an array The system is designed to ensure maximum signal and strong signal correlations The NCode miRNA Amplification System is a robust system for amplifying sense RNA molecules from minute quantities lt 30 ng of miRNA The system provides consistent and accurate 21000 fold amplification while preserving the relative abundance of the miRNA sequences in the original sample allowing you to compare relative quantities across experiments List continued on next page Continued on next page 3 Overview continued Other Products in the NCode System continued List continued from previous page NCode Profiler is a free downloadable Windows based software program for designing and analyzing two dye expression profiling microarray experiments NCode Profiler can be used
18. nd pattern formation Lagos Quintana et al 2001 restriction of differentiation potential Nakahara amp Carthew 2004 regulation of insulin secretion Stark et al 2003 and genomic rearrangements John et al 2004 Several unique physical attributes of miRNAs including their small size lack of poly adenylated tails and tendency to bind their mRNA targets with imperfect sequence homology have made them elusive and challenging to study In addition strong conservation between miRNA family members means that any detection technology must be able to distinguish between 22 base sequences that differ by only 1 2 nucleotides Recent advances in spotted oligonucleotide microarray labeling and detection have enabled the use of this high throughput technology for miRNA screening Continued on next page Overview continued Advantages of the Microarray Other Products in the NCode System The NCode Human miRNA Microarray V3 has the following advantages Offers more human miRNA probe content than any other commercially available microarray including novel content Probes are designed for uniform hybridization and maximum specificity to distinguish between closely related miRNAs Includes positive control probes for hybridization validation using the NCode Multi Species miRNA Microarray Control V2 Includes Alexa Fluor Dye Control Probes for easy normalization of signal intensities during scanning Includes mis
19. ray hybridizations Adjust the scanning settings and rescan as necessary to ensure that the signal intensity guidelines above are met For dual color array hybridizations Adjust the scanning settings in each channel and rescan as necessary to ensure that 1 the above guidelines are met and 2 the ratio of signal intensities between both channels for Dye Control Spots 24 are as close to one another as possible Important Use only those control spots for which neither channel is saturated Sample Labeling and Hybridization Guidelines Introduction Note NCode Rapid miRNA Labeling System Important 10 This section provides guidelines for hybridizing fluorescently labeled miRNA samples to the microarray e Always wear powder free latex gloves when handling microarrays e Avoid contact with the printed array surface The array surface should remain as lint free and dust free as possible e Open the slide container just prior to use and close immediately to store unused slides e NCode miRNA microarray products are designed for coverslip hybridizations with volumes of 80 ul or less This microarray has been developed and validated using the NCode Rapid miRNA Labeling System for fluorescent labeling and hybridization of miRNA samples see page vi for ordering information We strongly recommend using this system The NCode Rapid miRNA Labeling System provides reagents that have been specifically optimized
20. s Life Technologies Corporation shall have no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 17 Purchaser Notification Introduction Limited Use Label License No 279 DNA Microarrays Limited Use Label License No 281 DNA Microarrays Affy Trademarks of Other Companies 18 This product is covered by one or more Limited Use Label Licenses as set forth below For a list of additional Limited Use Label Licenses applicable to this product please visit our website at www invitrogen com By the use of this product you accept the terms and conditions of all applicable Limited Use Label Licenses This product and its use are covered by one or more of the following patents owned by Oxford Gene Technology Limited or Oxford Gene Technology IP Limited US 5 700 637 and pending patents The purchaser is licensed to practice methods and processes covered by these patents using this product for its own internal research purposes only but may not transfer data derived from the use of this product to third parties for value use this product in the provision of services to third parties for value use this product to make have made create or contribute to the creation of stand alone e
21. s from total RNA and synthesis of first strand cDNA from the tailed miRNAs for use in real time quantitative PCR qPCR SYBR Green or SYBR GreenER reagents may be purchased separately Continued on next page Overview continued TM NCode System Starting material N 2500 ng total RNA or 9 equivalent Workflow cells tissue Yes miRNA Amplification NCode miRNA Amplification System y po reci miRNA Labeling and Detection A TM LI LI miRNA Microarray m NCode n Labeling Control V2 y Pre printed Preprinted or self Self printed printed microarrays m NCode Human miRNA Microarray NCode Human ae Microarray V3 Probe Set V3 order from i custom services invitrogen com or un NCode Multi Species miRNA y Microarray Probe Set V2 Analysis of results NCode Profiler software Verification of results further analysis qRT PCR NCode SYBR Green miRNA qRT PCR Kit or NCode SYBR GreenER miRNA qRT PCR Kit or NCode miRNA First Strand cDNA Synthesis Kit z TM Microarray The NCode Human miRNA Microarray V3 has an GAL File associated GAL GenePix Array List file that lists the identities and locations of all the probes printed on the array This GAL file is available on the Invitrogen web site or can be requested from Invitrogen Technical Support see page 16 On
22. xpression database products for license sale or other transfer to a third party for value or use this product for the identification of antisense reagents or the empirical design of probes or sets of probes for using or making nucleic acid arrays Limited License This product and or components of this product are licensed by Affymetrix under certain patents owned or controlled by Affymetrix This product is licensed for research use only and is not for use in diagnostic procedures This limited license permits only the use of this product for your internal research purposes No other right express or implied is conveyed by the sale of this product In particular no right to make have made offer to sell or sell this product is implied by the sale or purchase of this product No right to make have made use import offer to sell or sell any other product in which Affymetrix has patent rights is implied by the sale or purchase of this product The purchase of this product does not by itself convey or imply the right to use such product in combination with any other product s This product is licensed for single use only The purchaser or user of this product should contact Affymetrix licensing affymetrix com to determine the availability of a separate license for other products or processes subject to Affymetrix patents 3DNA is a trademark of Genisphere Inc Corning is a registered trademark of Dow Corning Corporation ScanArray
Download Pdf Manuals
Related Search