TTM 01-E
Contents
1. 01 12 01 January UTG year 4 digit Local time zone offset from UTC in hours Local time zone offset from UTC in minutes ASCII 2 digit hex representation of the result of XORing the 8 data bits of each character between but not including the and 00 FF HEX OD OA set to zero when UTC time in ASCII string is selected Page 38 of 41 TTM 01 E User Manual 1 Edition September 2009 B 10 NMEA RMC Time Code O P on P4 About Timing Comms Definition Placeholder GPZDA hhmmss 0 a tt tt tttt N 999 99 9999 W DDMMYY E CC lt CR gt lt LF gt This string is compatible with and defined by the NMEA 0183 standard Transmission is once every second The leading edge of the start bit of the is exactly on the second 9600bd 8 bit ASCII no parity GPRMC hhmmss 00 a tt tt tttt n ggg gg gggg w 0 0 0 0 DDMMYY 0 0 E CC lt CR gt lt LF gt Content ASCII GPRMC ASCII comma UTC hour of day minute of day seconds ASCII full stop ASCII 0 Status A valid V invalid Latitude degrees minutes 00 00 0000 89 59 9999 Latitude north south N north S south Longitude degrees minutes O00 00 0000 359 59 9999 Longitude east west E east W west UTC day of month month 2 digit year ASCII E 2 digit hex representation of the result of XORing the 8 data b2. HD INTERNATIONAL TIM 01 E User Manual 1 Revision This document supports all TTM 01 E with firmware revision V1 000 TN INTERNATIONAL When you need to be certain For technical queries contact p 64 4 566 7722 e support tekroninternational com W www tekroninternational com TTM 01 E User Manual 1 Edition September 2009 This document supports all TTM 01 E with firmware revision V1 000 Revision History Revision 1 This document was first published 1st September 2009 Page 3of 41 Page 4of 41 TABLE OF CONTENTS L INTRODUCTION cs ececscecacececcccccucucecececueaeaeauauauaesesecucasacavauauaeauauausensrsnsvanavavanss 7 2 LED INDICATORS 1 ccccceccecsccecceccccuccecuccuceecueauceeaeeauseuausgenusaueueausaesunaesenseransanes 8 3 INPUTSAND OUTPUTS svarnevavnrnnnnrnsvnrnnnernrnnrnrnnnnrnsnnrnrnnnnrnsnurnrnnnnsnsrnrnnnnrnennrunne 9 3 1 Antenna Connector SMA connector rrrrrrrrrrarrnrrversersrrnernavnernnrnernrnnnvnrrnernrnnennn 9 3 2 Ethemet Port RJ 45 connector rarrnrvvvrsrnnrrrrvrersrssrrrrerernnsnrerserernssrsererrrsnsssrereren 9 DOr SN UT seserian peon a EE SENAR EAA DEN E EE Ta 10 3 4 Output OPTIONS cccecesseescceeeeeceeeesseseseeeeecseauausaeseeeeeeseceansaseueeseeeeesaesaseaesseenesseneas 11 4 INSTALLATION cccccccecccecucecccucecucauaecucaeauauseesuauausucauauauseesuauaesessvauaesenavanaenas 13 4 1 Identification 2 eee cecceceececcecaccuccucuccucaucuucucaucuc
3. cost of capital loss of profits or revenues cost of replacement power additional expenses in the use of existing software hardware equipment or facilities or claims against the user by its employees or customers resulting from the use of the information recommendations descriptions and safety notations supplied by Tekron Tekron liability is limited at its election to 1 refund of buyer s purchase price for such affected products without interest 2 repair of such products or 3 replacement of such products provided however that the buyer follows the procedures set forth herein Warranty claims must be received by Tekron within the applicable warranty period A replaced product or part thereof shall become the property of Tekron and shall be returned to Tekron at the Purchaser s expense A return material authorization number issued by Tekron must accompany all return material Page 40 of 41 TTM 01 E User Manual 1 Edition September 2009 NOTES The information in this manual may change without notice The manufacturer assumes no responsibility for any errors that may appear in this manual Ethernet is a trademark of XEROX Corporation UNIX is a registered trademark of The Open Group Windows Windows 95 Windows 98 Windows 2000 Windows NT Windows XP Windows Vista and Hyperterm are trademarks of Microsoft Corp Copyright 2009 Tekron International Ltd All rights reserved No part of the contents of this docu
4. this combination provides an overall gain near the optimum of 22 dB For lead in lengths longer than 60 m amplification and or larger diameter lower loss cable can be supplied to order Care should be taken to ensure that the connector is not cross threaded when attaching the antenna lead in cable The connector should be tightened firmly by hand only Do NOT over tighten A Lightning Protection device may be inserted into the antenna lead A suitable device complete with additional cable connectors a connector crimping tool and mounting hardware is available as an option see section 7 2 for details Use of a Lightning Protector does not degrade the performance of the antenna system 3 2 Ethernet Port RJ45 connector TTM 01 E units are fitted with an RJ45 Ethernet interface This allows the unit to be configured over a LAN Local Area Network switch or by direct connection using an Ethernet cross over cable The TTM 01 E can be ordered with or upgraded to output NTP SNTP and also PTP via the Ethernet interface The interface supports 10 100 Mbps connectivity To the left of the antenna SMA connector is a green LED labeled LNK which provides information on the status of the Ethernet port Table 2 below provides information regarding the interpretation of the LEDs OFF Ethernet cable is not connected or a fault has been detected eS Ethernet cable is connected EEE Ethernet connectivity Packets are being detected
5. antenna cable through the bottom of the pipe until it protrudes from the top Feed the cable through the antenna mounting plinth and connect to the TNC connector on the base of the antenna radome ensuring the TNC connector is not cross threaded Finger tight is sufficient Do not over tighten Seal the connector with self amalgamating tape Align and fasten the mounting plinth to the radome using the four stainless steel mounting screws supplied Place the antenna and mount assembly complete with the cable attached squarely over the top of the mounting pipe allowing excess cable to fall back through the pipe Secure the antenna mount with the two setscrews ensuring that the antenna assembly remains firmly pressed against the end of the pipe thus providing the exterior weather seal Secure the now complete antenna assembly and pipe to the previously prepared mounting structure s Al TTM 01 E antenna installations should follow the guidelines above 4 6 Operation B E The label on the side of TTM 01 E contains the voltage rating DO NOT apply power outside of this rating Connect the antenna lead and the antenna with a good view of the sky Then connect the power source to the power input terminals on the base of the unit The polarity of the power connection is unimportant A TTL B 12 36Vdc The time required to achieve tracking and synchronization given a good view of CEEE the sky is typicall
6. lt SOH gt HEX 01 DDD Day of year range 001 365 HEX 3A hh hour O0 23 mm minute 00 2 SS Seconds 00 59 lt CR gt HEX OD lt LF gt HEX OA Interpretation lt SOH gt 112 12 34 36 lt CR gt lt LF gt day 112 time 12 34 36 Page 35 of 41 www tekroninternational com B 3 String A Time Code O P on P4 About This code is very similar in data content to the IRIG J 17 code but adds a two character field containing the year and uses 8 bit ASCII no parity data format Timing Transmitted once every second The leading edge of the start bit of the first character lt SOH gt is exactly on the second that the message describes Comms 9600bd 8 bit ASCII no parity Definition lt SOH gt DDD hh mm ss YY lt CR gt lt LF gt Placeholder Content lt SOH gt HEX 01 DDD Day of year range 001 365 HEX 3A hh hour O0 23 mm minute 00 59 SS seconds 00 59 YY year 00 99 representing the last two digits of the year lt CR gt HEX OD lt LF gt HEX OA Example Interpretation lt SOH gt 112 12 34 36 lt CR gt lt LF gt day 112 time 12 34 36 B 4 String B Time Code O P on P4 About This code substitutes a Quality indicator byte for the year field but otherwise is identical in form function and timing to String A Timing Transmitted once every second The leading edge of the start bit of the first ch
7. 448 Please connect powered on unit to the network then click Begin please ryde id 3 The firmware will then update Firmware Update TTM O1 E code 16448 Please connect powered on unit to the network then click Begin unloading MENNNRNEEEENEEEEE O And once complete press ok and exit the programme Firmware Update X SUCCESS Page 28 of 41 TTM 01 E User Manual 1 Edition September 2009 APPENDIX A SPECIFICATIONS A 1 GPS Antenna Physical Specifications Dimensions Diameter 90 mm Height 98 mm without connector or plinth Weight 200 g Environmental Specifications Operating Temperature Range 40 to 85 C Electrical Specifications Polarisation Right hand circular polarisation Bandwidth 1575 42 MHz 1 023 Mhz Power Supply bVadc 0 5V Current Drain 20 mA Typical 27 mA Maximum Total Gain 38 dBi Typical 30 dBi at 90 elevation Attenuation 60 dB at 1525 MHz 1625 MHz 50 MHz on centre frequency Output VWSR 1 5 Typical Output VWSR 2 5 Maximum Lightning Protection 80 V for IEC1000 4 5 standard 43mm 65mm JE mim lt gt ko l 90mm Page 29 of 41 www tekroninternational com A 2 Adjustable Antenna Mounting Bracket The steel adjustable antenna mounting bracket will assist in the dissipation of energy should the antenna be struck by lightning The mounting bracket should be securely bonded directly to the building protection earth and not connected vi
8. AN Select the serial no of the unit you would like to configure and click open TTHMO1 E Configuration Tool HER ln Address Pf O O Only required for remote compection Discovered TTM 5N 95835 ve TTM 5M 30329 fo Address Viner Time 25082009 12 20 53 p m Sync In sync Location lat 41 39 14 south lon 174 401 s Ifno TTM 01 E units are found on the Network and you are confident that the TTM 01 is connected properly check the Windows firewall settings on your PC to ensure that the programme is not being blocked Page 18 of 41 TTM 01 E User Manual 1 Edition September 2009 After a successful connection a snapshot of the current clock settings is shown on the Time tab TTMO01 E Configuration Tool Connected to SN 30329 FW 00 00 Beta oe vg 000 Refresh Set time Licensing About Help Time Outputs Network NTP PTP GPS UTC Time Local Standar Time Antenna Antenna cable delay 30 Antenna mask angl E 2 19 25 a m 2 19 25 p m fens Dest ange 25 Aug 2009 25 Aug 2009 Localisation Sync Local standard time LST is UTC 12 00 v Sync holdover time 10 gt seconds Region observes daylight savings of 60 minutes Sync holdoveris the period that the unit will hmmm stay n syne after GPS satellites are lost F On the same dates every year O Outputs report the true sync state Beginning on the last vi Sunday vi of September v at 12 00 a m vi Outputs report in syn
9. Defined Pulse option being selected for any outputs further parameters are entered to define the pulse sequence The parameters are as follows Programmable Qutpuks A User defined pulse se _Jinverted Every Pulses Hundredths Duration 37 19 37 19 Drop down menus allows the user to choose to have pulses output every second minute hour or day Specify the frequency of pulses under the Every and Pulses fields Use online help or press F1 while over the pulses area to get a list of the available values that can be entered into the Pulses box The table below shows the valid number of pulses per second which can be configured Period Every Number of Pulses Specify the Offset this is the period after the start of a new day hour minute or second to the start of the pulse Specify the Duration this is the time the pulse stays asserted Check inverted to swap the polarity of the pulse that is High and Low levels are swapped Output Offset Duration ae TT gt EE EE EEE EEE 4 Start of the t Start of the period next period 6 2 2 Serial Strings On serial equipped units T1 Sxxx serial strings are selected by using a single drop down list in the Outputs Tab Refer to Appendix B for definitions of all the serial strings supported Page 22 of 41 TTM 01 E User Manual 1 Edition S
10. Rapid Flashing Table 2 Page 90f 41 www tekroninternational com 3 3 Sync Indication Output The sync indication output reflects the state of sync Sync indication is via an opto isolator switch rated at 200 V and 150 mA When the unit is in sync with UTC time the opto isolator switch is on Figure 1 and Figure 2 below show wiring examples msn EEE SEE a NE eee Alarm Panel Annunciator i i l 200Vde max 3 100mA max i i ES INTERNATIONAL TTM 01 E i i i i TEEN EE ee Figure 1 Positive earth connection diagram Alarm Panel as a 200Vdc max 100mA max E INTERNATIONAL TTM 01 E Figure 2 Negative earth connection diagram Page 10 of 41 TTM 01 E User Manual 1 Edition September 2009 3 4 Output options TTM 01 E has three main variants TTL Serial and AM IRIG B In addition to the outputs available on these variants the TTM 01 E can be ordered with NTP SNTP or with NTP SNTP and PTP output options Table 3 below shows the main variants and orderable options Version Number of serial Number of user Number of AM NTP SNTP and output strings defined pulses or IRIG B B12X 9600 bd i outputs IRIG BOOX DC IRIG B22X Table 3 3 4 1 TTL order code T2 Txxx CMOS TTL 5V driven 150 mA push pull Each port is fully floating and isolated Output Type Ho SYN IND Digit
11. a any of the other earthed structures 42mm 400mm 175mm ko 330mm 95mm Page 30 of 41 A 3 Antenna Cable TTM 01 E User Manual 1 Edition September 2009 The TTM 01 E can be ordered with 15 30 or 60 meters of high performance LMR240 cable factory fitted with a TNC type male connector at one end and a SMA male connector at the other The TNC type connector mates with the connector on the antenna and provides a robust and weather resistant connection The smaller SMA connector mates with the connector on the TTM 01 E and is only fractionally larger in diameter than the cable itself this facilitates installation in conduit and through small apertures Custom lengths can be ordered upon request Additional charges may occur Where antenna cable distances exceed 60 meters LMR400 can be used or an in line amplifier can be installed Refer to Tekron for further advice Environmental Specifications Operating Temperature Range Electrical Specifications Attenuation 1575 42MHz Velocity of Propagation Dielectric Constant Time Delay Impedance Capacitance Inductance Shielding Effectiveness DC Resistance Inner Conductor DC Resistance Outer Conductor Voltage Withstand Jacket Spark Peak Power 40 to 85 C 38 9 dB 100 m 84 1 42 NA 3 97 nS m 50 O 79 4 pF m 0 20 uH m gt 90 dB 14 1 O 1km 12 8 O 1km 1500 VDC 5000 V RMS 5 6 KW Page 31 of 41 w
12. al pulses or Time codes IRIG B B020 B021 B022 B023 B220 B221 B222 B223 DCF 77 Digital pulses or Time codes IRIG B B020 B021 B022 B023 B220 B221 INTERNATIONAL B222 B223 DCF 77 TTM 01 E Each output is user programmable A typical application will have one output programmed for IRIG B and the other for 1 PPS Page 11 of 41 www tekroninternational com 3 4 2 Serial order code T2 Sxxx RS232 level 9 V signaling The RS232 signals A and B are not HV isolated from each other in that they share a common earth but the port as a whole is isolated Output Type Digital pulses or Time codes IRIG B B020 B021 B022 B023 B220 B221 B222 B223 DCF 77 SER B Serial time messages at 9600 baud Each output is user programmable typical application has String C on SER B output and 1PPS on SER A Appendix B on page 35 describes the message strings programmable for output on SER B 3 4 3 AM IRIG B order code T2 Axxx Provides amplitude modulated IRIG B output B12x SAN SYN IND on INTERNATIONAL TTM 01 E Use either coaxial cable or shielded twisted pair to feed this signal to any connected IED The output is fully floating and is transformer isolated Output Type AM IRIG B Amplitude modulated IRIG B The output is user programmable for IRIG B120 B121 B122 or B123 The AM IRIG B output can drive many devices in parallel multi drop In all c
13. and position calculations A good starting value is 5 degrees but this may need to be increased in areas with land based obstacles to prevent time quality loss due to multipathing effects Increasing this value may reduce the number of satellites in view Page 20 of 41 TTM 01 E User Manual 1 Edition September 2009 6 1 3 Sync Sync Holdover Time The Sync Holdover Time parameter is used to control the period after loss of satellite sync that will be tolerated before TTM 01 E will show the loss of sync status indicating an alarm state Correct installation will make the loss of sync event rare although in areas with poor GPS coverage there may be occasions where tracking is momentarily lost The sync holdover feature is used to mask these effects The accuracy of all outputs when there is a complete satellite blackout is maintained to within a few micro seconds over short periods a few minutes and to within 200us for up to 40 minutes A single satellite signal sufficiently recovers accuracy to within 1us B E In typical SCADA operations time syncing to within 0 5ms is considered adequate Setting Sync Hold to the maximum 2550 seconds will prevent loss of sync alarms in the event that satellites are temporarily obstructed Outputs report the true sync state Under normal conditions this option should be selected The clock reports the true state of synchronization to the connected IEDs And are suppres
14. aracter lt SOH gt is exactly on the second that the message describes Comms 9600bd 8 bit ASCII no parity Definition lt SOH gt DDD hh mm ssQ lt CR gt lt LF gt Refer to String A table above for the definitions of the common digits Quality Character Q Meaning HEX ASCII 20 lt Space gt Clock in sync timing accuracy is better than 60nS 2E full stop Clock is accurate to 1us 2A Clock is accurate to 10us 23 H Clock is accurate to 100us 3F Clock accuracy may be worse than 100us Example Interpretation lt SOH gt 112 12 34 36 lt CR gt lt LF gt day 112 time 12 34 36 gt 100us sync error Page 36 of 41 TTM 01 E User Manual 1 Edition September 2009 B 5 String C Time Code O P on P4 About This code is effectively a combination of String A and String B It provides both year information and a sync indicator field Timing Transmitted once every second The leading edge of the start bit of the first character lt CR gt is exactly on the second to which the message data refers Comms 9600bd 8 bit ASCII no parity Definition lt CR gt lt LF gt Q YY DDD hh mm ss 000 x Placeholder Content lt CR gt lt LF gt HEX OD 0A Q Quality indicator in sync out of sync HEX 20 ASCII YY Year 00 99 representing the last two digits of the year DDD Day of year range 001 365 hh hour OO 23 mm minute 00 59 SS second
15. as a guideline The GPS receiver has excellent out of band rejection characteristics as does the antenna itself However sound engineering practice should not rely on these factors alone to guarantee performance Careful installation will enhance the long term reliability and on going stability of the Time Code Generator The absolute minimum bend radius for the antenna cable supplied is 40mm but it is preferable to use a larger radius if possible Caution should be taken at all times during the installation of the cable to avoid crushing or shorting the cable GPS Antenna Installation The antenna cable is passed up through the pipe from the bottom end through the mounting plinth and connects directly to the TNC connector on the base of the antenna It is advisable to wrap self amalgamating tape around the connector to seal the connection and provide protection against moisture ingress Fastened the antenna to the mounting plinth using the four stainless screws supplied with the kit and then the complete antenna assembly can be placed on the pipe and secured by tightening the grub screws on the side of the plinth with the supplied Hex key Page lo of 41 TTM 01 E User Manual 1 Edition September 2009 In Summary 1 Install the GPS antenna in a position where it has a clear view of the sky away from RF transmitters and in a lightning protected zone Establish a mounting method and procure a suitable mounting pipe Feed the
16. ases a terminating resistor must be fitted at the far end of the cable The terminating resistor value range is from 100 ohms few loads to 180 ohms many loads 1W resistors are recommended Page 12 of 41 SYN IND INTERNATIONAL TTM 01 E AM IRIG B TTM 01 E User Manual 1 Edition September 2009 4 INSTALLATION 4 1 Identification Each TTM 01 E unit is shipped with an identification label on the side of the case The label provides details of the particular options fitted to the unit the power supply requirement the serial number and firmware revision s Check the identification label on the side of the unit to ensure that the correct model has been supplied before proceeding to install 4 2 Product Registration Register your TIM 01 E at www tekroninternational com register to receive firmware upgrade notifications customer resources access and more 4 3 Packing list Each TTM 01 E kit is shipped with the following TTM 01 E Time Code Generator GPS Antenna optimized for stationary applications with mounting plinth Antenna lead in cable fitted with matching connectors CAT5e Ethernet cable Configuration Software User Manual this document 4 4 Mounting the TTM 01 E The clock is designed to be mounted to a standard din rail mount using the supplied clips on the base The clips can also be used to screw mount the unit Page 13 of 41 www tekroninternationa
17. canausenaneas 28 PPENDIX SPECIFIC ATIONS vc ccccecaccsceccccecaucucaucucueaucucaucesauausueaucueauausavausntanees 29 APPENDIX B SERIAL O UTPUT STRING S eccececceccececcuccecuceusaucueauseeeetaesausevaesenaesas 35 WARRANTY STATEMENT cccccececcccecsccececcucueaucuceecucueausucauausaeausueaeeueauausaeausevaesesanes 40 Page 5of 41 Page 60f 41 TTM 01 E User Manual 1 Edition September 2009 1T INTRODUCTION Congratulations on your purchase of TTM 01 E Tekron s powerful and cost effective synchronization solution for RTUs Protection Relays and other Intelligent Electronic Devices IEDs used in electrical sub stations and industrial control installations Utilizing state of the art technology and a timing optimized snow resistant antenna these compact units lock onto atomic clock references from the GPS satellite constellation and produce time codes and pulses with sub microsecond accuracy and precision TTM 01 E s rugged design is suitable for noisy electrical environments while built in electrical isolation combined with strong push pull drives on all outputs simplify wiring schemes and enhance reliability TTM 01 E clips onto a standard DIN rail Windows software and Ethernet connectivity make customization and setup a breeze TTM 01 E comes complete with all components required for installation including low loss antenna cable antenna pipe mounting components configuration software and cable and optional l
18. ded by the original manufacturer of the accessory Examples of such products and accessories are antennas cables etc There are no understandings agreements representations or warranties express or implied including warranties of merchantability or fitness for a particular purpose other than those specifically set out above or by any existing contract between the parties Any such contract states the entire obligation of Tekron The contents of this document shall not become part of or modify any prior or existing agreement commitment or relationship The information recommendation description and safety notations in this or other documents supplied by Tekron are based on general industry experience and judgment with respect to such hardware and software THIS INFORMATION SHOULD NOT BE CONSIDERED TO BE ALL INCLUSIVE OR COVERING ALL CONTINGENCIES NO OTHER WARRANTIES EXPRESS OR IMPLIED INCLUDING WARRANTIES OF FITNESS FOR A PARTICULAR PURPOSE OR MERCHANTABILITY OR WARRANTIES ARISING FROM COURSE OF DEALING OR USAGE OF TRADE ARE MADE REGARDING THE INFORMATION RECOMMENDATIONS DESCRIPTIONS AND SAFETY NOTATIONS CONTAINED HEREBYAND IN HARDWARE AND SOFTWARE SPECIFICATION DOCUMENTATION OR INSTRUCTIONS SUPPLIED BY Tekron In no event will Tekron be responsible to the user in contract in tort including negligence strict liability or otherwise for any special indirect incidental or consequential damage or loss of equipment plant or power system
19. ditional protection TN a ie through the use of an impulse suppressor i N In the event of a lightning derived high voltage surge occurring the impulse suppressor activates short circuiting the cable directly to earth antenna to the lightning arrestor Keep the distance from the as short a possible f For the lightning protector to be effective it G wa must be firmly mounted to a conductive SS metal surface that is itself bonded to the building protective earth Ensure that a good electrical connection is made between the surge protector and the earthing system All earthing connections should be as short as possible should Coaxial Cable ta GPS have no sharp bends or loops The ae preferred mounting position is on the inside of the buildings exterior wall G adjacent to the antenna lead entry point p l 5 Protection Earth Antenna Mounting Bracket The antenna pipe mounting plinth is designed to fit over the top of a user supplied pipe like a capping Source a pipe that has an external diameter of between 40 and 42mm 1 inch 32mm nominal ID galvanized pipe The top end of the pipe should be cut flat so that the rubber gasket inside the antenna mount sits flush against it forming an effective weather seal Page 15 of 41 www tekroninternational com Establish the mounting method for the pipe such as strapping or bolting to a frame on the edge of the building or strapping to an air conditioning ex
20. dresses can then receive the status messages from the NTS unit Even if there is no formal SNMP system running on the network the messages can be received and displayed on the destination machines running Windows NT or higher using the freeware utility SNMPTRAP EXE which is on the CD supplied with the TTM 01 E kit Syslog local file Normally you would set to zero unless further categorizations of the syslog messages are required Syslog destination One or two IP addresses may be entered to define destination machines running system logs 6 4 NTP PTP Tab This tab is inactive unless the NTP SNTP or NTP SNTP and PTP are ordered at the time of ai purchase E Licensing A license may be purchased at a later time and entered into the licensing section of the configuration software to activate these options NTP Compatibility Do not respond when unsynched Selecting this option causes the time server not to respond to time synch request unless synchronized to satellites Broadcasts Send Broadcasts If this option is selected the unit prompts for a poll interval The unit will then broadcast time packets at the interval specified Send Multicasts If this option is selected the unit prompts for a poll interval and Multicast Group IP The unit will then broadcast time packets at the interval specified to the multicast group specified Page 24 of 41 TTM 01 E User Manual 1 Edition September 2009 Secur
21. e always And finishing on the And sync relay is always on test mode ist vi Sunday v of April vi at 3 00 a m Current reported sync state 4 Syne 5 2 Direct connection method Run the supplied CD and locate the configuration software which is in Drive TTMO1E TTMO0O1E exe This software may be run directly from the CD or be copied to a local folder Drive is typically D Apply power to TTM 01 E and connect the unit via an Ethernet crossover cable to a PC and run the configuration software program TTMO1E exe As in the the case of connection via a LAN a window will appear showing the serial number of the TTM 01 E unit connected Select the serial no of the unit and click open s Ifthe TTM 01 E unit s serial number does not appear check the Windows firewall settings on your PC to ensure that the programme is not being blocked Page 19 of 41 www tekroninternational com 6 CONFIGURING THE TTM 01 E 6 1 Time Tab 6 1 1 Localization Section Local Standard Time LST The time offsets define the number of hours and in rare cases minutes that the local time differs from UTC time A positive offset means that the local time is ahead of UTC Lookup The Lookup button provides a convenient way of automatically filling in time offset and daylight savings parameters simply by selecting a geographical location Note this information is derived from Windows so shou
22. eptember 2009 6 2 3 Output time selection This option allows the user to output local time or UTC time over the IRIG B outputs Output time selection 6 2 4 IRIG B Options In the Output Config page Checking the Binary seconds in IRIG B code field adds binary encoded seconds of day information to the IRIG B code Checking the IEEE1344 or AFNOR extensions adds AFNOR 587 500 or IEEE1344 extensions to the IRIG B code 6 2 5 IEEE 1344 and AFNOR Extensions The IRIG B time code provides time of day and day of year data The latest version of the standard IRIG 200 04 also includes year information The IEEE1344 extensions add data relating to local time and the quality of the time signal Extension name Extra information contained IEEE 1344 Year impending leap second info local time offset US specification impending daylight savings change time quality AFNOR NFS 87 500 Year day of year day of week month day of month Only one of IEEE1344 or AFNOR NFS 87 500 may be on at any time most equipment that comes from the US will use the IEEE 1344 extensions 6 3 Network Tab 6 3 1 Network configuration If your network supports DHCP the TTM 01 E can obtain IP Address settings automatically Otherwise you need to ask your network administrator for the appropriate IP setting IP Configuration Networks that include a DHCP server offer automatic address allocation via Dynamic Host Confi
23. guration Protocol DHCP The time server will automatically operate within a DHCP environment to fetch a dynamic address if it does not already have a fixed address configured Host IP Address Set to your desired IP address Netmask Set to 255 255 255 0 for a standard class c network Gateway Refer to the network administrator Page 23 of 41 www tekroninternational com 6 3 2 Simple Network Management Protocol SNMP and Syslog reporting Report low satellites This setting defines the minimum number of satellites which must be visible If the number of GPS Satellites drops below this threshold a SNMP message low satellites is generated As TTM 01 Es true clock accuracy when tracking just a single satellite is at least two orders of magnitude better than what can be practically handled on the network the default value of 1 is sufficient for detection of this condition The default setting of units shipped is 1 SNMP community name The default value is public This may be changed to suit the specific SNMP architecture on the network if required If SNMP is not implemented for other purposes on the network then the public setting allows the use of a simple SNMP trap display utility running on a remote monitoring PC to display the status messages sent from the NTS SNMP trap destination This parameter allows for up to five destination IP addresses to be entered Machines on any or all of these IP ad
24. haust or similar The base of the pipe needs to be accessible for the cable entry if this is not practical then a hole or slot can be made in the side of the pipe to allow the cable to enter and be passed up to the top of the pipe An adjustable antenna mounting bracket can be procured from Tekron at the time of ordering Refer to appendix A 2 for specifications Cable Installation Tekron GPS Clocks can be ordered with 15 30 or 60 meters of high performance RF cable factory fitted with a TNC type male connector at one end and a SMA male connector at the other The TNC type connector mates with the connector on the antenna and provides a robust and weather resistant connection The smaller SMA connector mates with the connector on the GPS clock rear panel and is only fractionally larger in diameter than the cable itself this facilitates installation in conduit and through small apertures Custom lengths can be ordered upon request however additional costs may apply Where antenna cable distances exceed 60 meters lower loss e g LMR400UF cables can be used or alternately an in line amplifier can be installed Refer to Tekron for further advice While the cable shielding is excellent the cable should not be routed in close proximity to power cables or other RF cables carrying transmitter signals in particular parallel runs are to be avoided if possible If such runs are absolutely unavoidable a minimum separation of 30cm may be used
25. ightning protection kit Page 7of 41 www tekroninternational com 2 LED INDICATORS The top of the TTM 01 E features two LED indicators The GPS LED shows the status of the internal GPS receiver while the SYN LED shows sync status of the unit Outputs are synchronized to UTC time only when the SYN LED is illuminated on Table 1 below provides information regarding the interpretation of the LEDs Antenna fault The antenna or antenna cable is either disconnected or faulty or there is a short circuit somewhere 4 flashes sec The antenna is good TTM 01 E is searching the sky for satellites but is not in sync to UTC time 2 flashes sec TTM 01 E outputs are accurate to within 200ns of UTC time and therefore useable for sync purposes 1 flash sec long on Table 1 Refer to section 3 2 for information regarding the interpretation of the LNK LED Page 8 of 41 TTM 01 E User Manual 1 Edition September 2009 3 INPUTS AND OUTPUTS 3 1 Antenna connector SMA connector The ant antenna input provides an interface for an external active antenna via low loss coaxial cable 50 Q impedance 5 V DC 50 mA max is supplied to power an active antenna The total combined gain of the antenna system antenna plus cable and connectors should fall in the range of 10 to 35 dB the optimum being 22 dB TTM 01 E is normally supplied complete with a timing optimized narrow band antenna and 30 m of lead in cable
26. its of each character between but not including the and HEX OD OA Page 39 of 41 www tekroninternational com WARRANTY STATEMENT Tekron International Ltd Tekron warrants for a period of TEN years from the P DOD MN date of shipment that each Product supplied shall be free of defects in material LON and workmanship During this period if the customer experiences difficulty with Le YS a product and is unable to resolve the problem by phone with Tekron Technical 39 Support a Return Material Authorization RMA will be issued Following receipt of an RMA number the customer is responsible for returning the product to V er Tekron freight prepaid Tekron upon verification of warranty will at its option repair or replace the product in question and return it to the customer freight prepaid No services are handled at the customer s site under this warranty Tekron shall have no obligation to make repairs or to cause replacement required through normal wear and tear or necessitated in whole or in part by catastrophe fault or negligence of the user improper or unauthorized use of the Product or use of the Product in such a manner for which it was not designed or by causes external to the Product such as but not limited to power or failure of building services A product will not be warranted if it is an accessory not carrying the Tekron brand name In this case warranties are limited to the warranty provi
27. ity Use MD5 Authentication The TTM 01 E supports fully encrypted requests If this option is selected the unit then prompts for five ASCII or Hex keys 6 5 GPS Tab The information in the GPS tab helps with troubleshooting and optimizing an antenna installation 6 5 1 Satellite Visibility Visible satellites are shown on a polar display The rings mark the elevation and the sectors mark azimuth The centre of the display represents directly overhead and the elevation is 90 at this point The edge of the display elevation 0 represents the horizon The azimuth is a compass direction where 0 represents true north 90 is east and 180 is south Satellites being used are marked by a colored cross on the display and a blue bar on the Satellite Signal Strength Indicator otherwise it is gray on both TTMO1 E Configuration Tool Connected to SN 30329 Fw 00 00 Beta 9 Refresh sn 0060 Settime Licensing About Help Satellite Visibility Signal Strength Indicator sat ld 2616 14 22 31 12 30 9 11 32 1 Location Time Latitude Longitude Status Antenna Almanac 6 5 2 Signal Strength Indicator 41 39 14 south 174 40 9 east connected good The signal strength indicator gives real time information regarding the signal reception from GPS satellites Green bars indicate good satellite reception Orange bars indicate poor reception 6 5 3 Location This shows the la
28. l com 4 5 GPS Antenna and Cable Installation 4 5 1 GPS Antenna NAIS GPS Antenna The TTM 01 E unit s standard shipping configuration includes an active GPS antenna radome specifically designed for industrial static timing environments together with a pipe mounting plinth The mechanical diagram below shows the radome and pipe mounting plinth attached Refer to Appendix A 1 for the complete antenna specifications The antenna pipe mounting plinth is designed to fit over the top of a pipe like a capping The mount has an internal diameter of 43mm to fit a pipe with external diameter of between 40 and 42mm 1 inch 32mm nominal ID galvanized pipe The top end of the pipe should be cut flat so that the rubber gasket inside the antenna mount sits flush against it forming an effective weather seal The mount is fixed to the pipe with two stainless steel M8 hexagon socket setscrews supplied Available Accessories Antenna Cable Adjustable Antenna Mounting Bracket Lightning Protection Kit In line Amplifier Page 14o0f 41 TTM 01 E User Manual 1 Edition September 2009 Pre installation GPS Antenna placement The GPS antenna should always be installed in a position where it has a clear view of the satellites in the sky When surveying a site prior to installation consider any fixed or moving obstructions which may affect GPS reception E g Terrain Pylons mobile obstructions Avoid close proximity to antennas from other ser
29. ld be verified as correct before use Region observes daylight savings Selecting this option allows the TTM 01 E to be configured to make daylight savings changes automatically Further options are then made available including e DST Daylight Savings Time offset in reference to LST Local Standard Time e Fixed date or fixed rule for calculating a date method TTMO01 E Configuration Tool Connected to SN 30329 FW 00 00 Beta Coe wv 0060 Refresh Store Set time Licensing About Help Time Outputs Network NTP PTP GPS UTC Time Loca Standar Time Antenna Antenna cable delay 30 ns Antenna mask angle 5 A deg 2 54 11 a m 2 54 11 p m g v weg 25 Aug 2009 25 Aug 2009 Localisation Sync Local standard time LST is UTC 12 00 v Sync holdover time 10 seconds Sync Roldoveris the penod that the unit will ay n sync after GPS satellites are lost Outputs report the true sync state Outputs report in syne always And sync relay is always on test mode Current reported sync state 4h Syne 6 1 2 Antenna Antenna Cable Delay All antenna systems introduce signal delay depending on the cable length Optimize the timing accuracy of the output signals by entering the appropriate value in this field 4ns per meter of antenna cable E g for a 30 meter antenna cable enter 120 Antenna Mask Angle This is the elevation above the horizon below which satellites will not be used in time
30. ment may be transmitted or reproduced in any form or by any means without the written permission of Tekron International Ltd Published in New Zealand WARNING This product has been designed to comply with the limits for a Class A digital device pursuant to Part 15 of FCC rules These limits are designed to provide reasonable protection against such interference when operating in a commercial environment Page 41 of 41
31. ng is transmitted once every second with the leading edge of the start bit of the first carriage return lt CR gt exactly on the second 9600bd 8 bit ASCII no parity lt CR gt lt LF gt 1100 lt CR gt lt LF gt 44hhmmss lt CR gt lt LF gt 54ddd lt CR gt lt LF gt lt CR gt lt LF gt 45HHMMss lt CR gt lt LF gt 55DDD lt CR gt lt LF gt lt BEL gt Content HEX OD OA ASCII 1100 ASCII 44 means local time follows ASCII 54 means local day of year follows ASCII 45 means UTC time follows ASCII 55 means UTC day of year follows Local day of year 001 365 Local hour of day 00 23 Local minute of day 00 60 seconds 00 59 UTC Day of year 001 365 UTC hour 00 23 UTC minute 00 59 HEX 07 37 B 9 NMEA ZDA Time Code O P on P4 About Timing Comms Definition Placeholder GPZDA hh lt CR gt lt LF gt This string is compatible with and defined by the NMEA 0183 standard Transmission is once every second The leading edge of the start bit of the is exactly on the second 9600bd 8 bit ASCII no parity GPZDA hhmmss 00 DD MM YYYY xx yy CC lt CR gt lt LF gt Content ASCII GPZDA ASCII comma UTC hour of day 00 23 UTC minute of day 00 60 UTC Seconds 00 59 ASCII 00 UTC day of month 01 31 depending on which month UTC month
32. onnector set to match antenna cable 1 Crimp Tool to match the above connectors RG59 1 Roll Self amalgamating Insulation tape Page 27 of 41 www tekroninternational com 8 FIRMWARE UPGRADE INSTRUCTIONS Download the file ttmO1e_firmware_vxxxx exe from the customer resources section on the Tekron International website You will need a username and password which will have been issued when the TTM 01 E was registered If the product has not been registered it can be registered at www tekroninternational com register If you would like to be notified when new firmware is available or if you would like to obtain access for further personnel contact Tekron at support tekroninternational com Once the firmware is downloaded connect your PC to a network switch in the same subnet as the TTM 01 E unit which requires upgrade and follow the directions below B E To confirm that the TTM 01 E and PC have a good connection run the configuration software and verify that the TTM 01 E can be seen on the network Once this is confirmed close the configuration software Never upgrade the firmware with the configuration software running 1 Run the ttm01e_firmware_vxxxx exe programme and click begin Firmware Update TTM O1 E code 16448 Please connect powered on unit to the network then click Begin 2 Recycle i e turn off and then on the power to the TTM 01 unit being upgraded Firmware Update EIER TTM O1 E code 16
33. pproximately Diameter 163 mm Weight 420g Connector type N Type Female Both ends Electrical Specifications Power Consumption 8 mA Input Voltage 3 to 8 Vdc Operating Current lt 10 mA typical Noise Figure lt 4 dB typical Environmental Operating Temperature 55 to 45 C Page 33 of 41 www tekroninternational com A 6 Lightning Protection Kit The Polyphaser GX Series has separate circuits for RF path protection and DC pass protection This extra filtering allows us to provide the lowest let through voltage in the industry The GX Series is the protector to which all others are compared and is the standard protector for GPS and tower mounted equipment Physical Specifications Property Dimensions Width Depth Height Weight Connector type Electrical Specifications Operating Voltage Maximum RF Power 20 C Frequency Insertion Loss Return Loss Surge Max Multi strike Surge Throughput Energy User current Environmental Relative Humidity Vibration DC Resistance Temperature Fully weatherized housing meets IEC 60529 IP67 Meets Bellcore TA NWT 00487 Procedure 4 11 wind driven 120 MPH rain intrusion 3 65 92 7 M8 X 1 25 6H NUT NG 2X 31 8 0 82 20 9 Page 34 of 41 Metric 93 mm 72 mm 36 mm 200 g N Type Female Both ends 800 2500 MHz lt 0 1 db Typical gt 26 db 20 kA 8x20 us IEC 61000 4 5 lt 15 uJ 6 Vdc
34. s 00 59 000 ASCII 000 Example Interpretation lt CR gt lt LF gt 02 112 12 34 36 000 day 112 of year 20 02 time 12 34 36 out of sync N B in the above example the three trailing spaces as described in the definition are invisible B 6 String D Time Code O P on P4 String D is IDENTICAL in content to String B but the second mark is at the leading edge of the start bit of the lt CR gt Example Interpretation lt SOH gt 112 12 34 36 lt CR gt lt LF gt day 112 time 12 34 36 gt 100us sync error B 7 String E Time Code O P on P4 About This provides time year information and a sync indicator field 37 Timing The string is transmitted once every second with the leading edge of the start bit of the lt CR gt exactly on the second Comms 9600bd 8 bit ASCII no parity Definition lt SOH gt YYY DDD hh mm ssQ lt CR gt lt LF gt Placeholder Content lt SOH gt HEX 01 YYY 3 digit year e g 012 2012 HEX 3A DDD Day of year range 001 3605 hh hour 00 23 mm minute 00 59 Ss seconds 00 59 Q Quality character as defined in String B above Example Interpretation lt SOH gt 004 112 12 34 36 lt CR gt lt LF gt 2 004 day 112 12 34 36pm gt 100us sync error Page 37 of 41 www tekroninternational com B 8 String F Time Code O P on P4 Timing Comms Definition Placeholder lt CR gt lt LF gt 1100 The stri
35. sed when out of Sync When this option is selected the clock will not output any time sync signals unless it is synced to one or more satellites Outputs report in sync always The clock will output time sync signals as if it were synced to GPS even if this is not true e g there is no antenna attached In this mode the sync indication outputs will be active at all times B E Outputs report in sync always is typically used for testing in laboratory environments and should NEVER be used in time critical environments And sync relay is always on The sync indication outputs are always active indicating the clock is in sync even if this is not true 6 2 Outputs Tab 6 2 1 Programmable Outputs TTM 01 E GPS Clocks with order codes beginning with T2 User defined pulse Sxxx or T2 Txxx can be configured to output one of four different output waveforms Selection between the four lmrIe BO00 standard DCLS options is done via a drop down menu The options IRIG B200 modified manchester DCLS available for each output are User defined pulse DCF 77 simulation IRIG B000 standard DCLS IRIG B200 Modified Manchester DCLS User defined pulse DCF 77 simulation Each of the programmable outputs can also be inverted in its operation g TIM 01 E GPS Clocks beginning with T2 Axxx only output modulated IRIG B B120 time codes Page 21 of 41 www tekroninternational com In the case of the User
36. titude and longitude of the installation 6 5 4 Status This shows the Antenna and Almanac status Page 25 of 41 www tekroninternational com 6 6 Test Mode When the antenna is disconnected the time can be arbitrarily set using the Set Time button This function allows the TTM 01 E to be used as a signal source for testing the ability of externally attached equipment to correctly process received time codes through set time unusual time transitions such as the 28 29 Feb rollover during leap years or daylight savings transitions The TTM 01 E would normally be configured with Outputs report in sync always and And sync relay is always on settings activated when arbitrarily setting the time Page 26 of 41 TTM 01 E User Manual 1 Edition September 2009 7 FACTORY HARDWARE OPTIONS 7 1 Power Supply Options This table shows the three different power supply configurations that may be ordered with TTM 01 E Designator DC Input Range L Low 12 to 36 Vdc M Medium 20 to 72 Vdc H High 90 to 300 Vdc 7 2 Lightning Protection Option A lightning Protection kit may be fitted into the antenna lead in cable The kit contains a protection device two coaxial cable connectors a connector crimp tool and mounting hardware Refer to Appendix A 6 for specifications 7 2 1 LPKO1 Kit Contents Quantity Description 1 Polyphasor DGXZ 06NFNF A Impulse Suppressor 2 N type Male Crimp Style Coaxial cable c
37. to 610 uJ 60 Vdc 4 kV 2 kA 8 x 20 us waveform lt 4A 0 to 95 1G 5 Hz to 500 Hz lt 0 1 Q Typical 50 C to 85 C 2 19 55 7 2 82 71 6 pm TTM 01 E User Manual 1 Edition September 2009 APPENDIX B SERIAL OUTPUT STRINGS B 1 NGTS Time Code O P on P4 Timing Transmitted once per minute Sent during the last second before the minute rollover to which the data in the string refers About Normally used in conjunction with 10mS pulse on P4 pin 1 that finishes precisely on the minute Comms 9600bd 8 bit ASCII no parity Definition TYYMMWhhmmx lt CR gt lt LF gt Placeholder Content T T YY Last two digits of the year e g 12 the year 2012 MM Month 00 January 12 December W Day of week 01 Monday 07 Sunday hh Two digit hour mm Two digit minute xX Time mode 0 Local time 1 UTC time lt CR gt Carriage Return HEX 0D lt LF gt Line Feed HEX 0A Example Interpretation T020422112340 lt CR gt lt LF gt Monday 22 April 2002 12 34 local time B 2 IRIG J 17 Time Code O P on P4 About Timing Comms Definition Example This code is compatible with IRIG Standard 212 00 Transmitted once every second The leading edge of the start bit of the first character lt SOH gt is exactly on the second that the message describes 9600bd 7 bit ASCII odd parity lt SOH gt DDD hh mm ss lt CR gt lt LF gt Placeholder Content
38. ueaucaucueaucueeacaucaeeaceeueeecseseeeecseeeesesaeees 13 4 2 Product Registration cccsecessseceeeceeccesseneesseeeeeceeeceusassueeseeeeeeaesanaasseeeeeseeseanaseeeess 13 TD PN 13 44 MOUNUNG ME TM O1 E iiniicsccniinisetivaininedaewsiaiacstnianiindacismeinienicunendncuasemanetaienis 13 4 5 GPS Antenna and Cable Installation rrnrrarnnrnrrnrnnrnrrnrnsrnrrnerarnsrnersrnsrnernrnnrnenn 14 16 JAN 17 5 CONFIGURATION SOFTWARE cccceccccececcuceccucucaucucucucauaucucaucueauausueausutanaueaeans 18 5 1 Connection via LAN icc cccccccccecsccsccecsccuceecuccuceecuecuceucueaucuecueaucueceeaecauceeausaeaeeaesaens 18 5 2 Directconnection Method 2 0 cece ceccccaccecccccececcucaucueaueaucauausucueaucaueueausaueutaueansnnanss 19 6 CONFIGURING THE TIM O1 E rernrvarnevnrvarnnvnrnevnnnsrnsvnnnnrnsvurnernsnurnnnnennnnnnne 20 JE EE TIa aE EO 20 EL TN 21 6 3 Network Tab i rarnnrnrrnrnnrnevnrnnrnerneravnnvnerernnrnernnnnnnnrunnnrnerurnnrnernrnnnnernrannuerurnnnner urnen nenne 23 6 4 NTP PIP Tab cccccccccccccccsccscecccccacccceccuccueaueeeceuceueaueaueaeceecsueaueaesuessessusauseaeeeeusanaaas 24 65 PT 25 6 6 Tet VL 01 0 LT 26 7 FACTORY HARDWARE OPTIONS ccsceccececcececcececucaucucaucueauaucueausueauausaeausevaneas 2 POW SE UDOV NNN 27 7 2 Lightning Protection Option essessssrererrnnseesrsrrnrrrsrrsnssnrnrnnnrnnssrrnnrrnresrerrererenne 27 8 FIRMWARE UPGRADE INSTRUCTIONS ccececcsceccecececucaecucucaucucatcueatau
39. vices where possible The antenna has excellent rejection characteristics to out of band signals as does the GPS receiver but high powered RF signals in close proximity to the antenna may swamp the very low level signals from the GPS satellites Reducing the risk of Lightning Strike The first line of protection against the effects of lightning induced surge events involves positioning the antenna in a lightning protected zone In practice this means ensuring that there is at least one other earth vs bonded structure located in the same rooftop area e g another 458 antenna or a lightning rod that reaches significantly higher than the top of the GPS antenna The GPS Antenna should then be mounted so that it lies within a 45 degree angle from the top of the other earth bonded structure The GPS antenna mount itself should also be securely bonded directly to the building protection earth and not connected via any of the other earthed structures By following the directions above you will reduce the risk of lightning strike However there is no fail safe way of preventing lightning strike A lightning arrestor should be installed to reduce the risk of damage caused in this instance p Lightning Protection p nr At installations where lightning frequently occurs a lightning arrestor should be installed between the antenna and clock amet Tekron s antenna lightning protection kit E ER AN E LPK 01 provides ad
40. ww tekroninternational com A 4 TTM01 E Unit Physical Specifications Dimensions Weight GPS Receiver Width Depth Height 55 mm 60 mm 90 mm 150 g L1 1575 42 MHz Frequency C A Code 12 Channel parallel tracking receiver Position Accuracy Timing Accuracy Acquisition Sensitivity Voltage Oscillator Specifications Horizontal Altitude Reacquisition Hot Start Warm Start Cold Start Acquisition Tracking Stability Freewheeling stability following tuning from at least 4 or more GPS satellites for at least 30 minutes Input and Output Specifications Type AM IRIG B Version AM IRIG B modulated 9V TTL Version TTL 5V Serial Version RS232 NTP SNTP Environmental Specifications Operating Temperature Range Electrical Specifications Power Supply Power drain Page 32 of 41 Electrical Physical RJ45 Low Voltage Medium Voltage High Voltage lt 9 m 90 lt 18 m 90 lt 60 ns to UTC lt 2s 90 lt 3s 90 lt 35s 90 lt 38s 90 146dBm 160dBm 2 7 3 6 Vdc 5 parts in 10 Accuracy at the port lt 2 us of UTC lt 200 ns of UTC lt 1 5 us of UTC lt 200 ns of UTC 10 to 65 C 12 36 Vdc 20 72 Vdc 90 300 Vdc 6 W max TTM 01 E User Manual 1 Edition September 2009 A 5 In line Amplifier The Raven LA Series inline amplifier filters and amplifies GPS signals to extend cable runs hundreds of feet Physical Length 95 mm a
41. y within a minute Reactivating a unit that previously has been zi synchronized 1000 s of km away from the present position will take longer but not E more than 45 minutes I Care should be taken to ensure that the connector is not cross threaded when attaching the antenna lead in cable The connector should be tightened firmly by hand only Do NOT over tighten Page 17 of 41 www tekroninternational com 9 CONFIGURATION SOFTWARE Configuration software is provided on a CD with all TTM 01 E units This software is compatible with Windows 2000 XP NT and Vista PC s The TTM 01 E can be configured over a Local Area Network LAN or by direct connection via crossover cable Sections 5 1 and 5 2 describe the two connection methods to enable configuration 5 1 Connection via LAN Run the supplied CD and locate the configuration software which is in Drive TTMO1E TTMO0O1E exe This software may be run directly from the CD or be copied to a local folder Drive is typically D Apply power to TTM 01 E and connect the unit to a network switch located on the LAN using the supplied 2m CAT5e Ethernet cable Using a PC connected to the LAN run the configuration software program TTMO1E exe The configuration software will use DHCP addressing to find any TTM 01 E units connected to the LAN I IP addresses do not need to be preset The window below will appear showing the serial numbers of all TTM 01 E units found on the L
Download Pdf Manuals
Related Search