Home

MACHEREY-NAGEL NucleoSpin® Robot

image

Contents

1. TECAN Application Guide MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit Genesis Freedom Genesis RSP Genesis RWS Document Name Application Guide MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit Version V1 0 Date 20 03 2003 Application Guide TECAN Table of Contents REVISION HISTORY E 2 1 APPLICATION DESCRIPTION ssssssssssssssssssessssssnunnnnsssnnnnnsos 3 1 1 a igeeli oilo PHIL 3 1 1 1 Gemini Script for the MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit 3 1 1 2 Intended Use 3 CM E EE 3 EC We HUE EE A PRINCIPLE A ec eee 4 241 Principle of Appltcatton nnne nnne nnne nnns 4 2 2 Principle of Automation cece cece cece cee cceecceeeceeeeceeeeeeceeeeceeeeeeeeeeecaeeeeeeeaessaeesaeeeaeenaas 4 WT ug RE T ee 5 3 1 Installing the SICK Mes EE 5 3 2 Check and Adjust Hardware TTT eebe egene 5 4 PREPARATION unde AEI 5 4 1 Sample Preparation cccccccccccccccccececeeeceeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeeseeeeeeeeeeeeess 5 42 E E E hao e p TTT E T 5 2 EAR 5 5 RUNNING THE SCRIPT ciii oo e Er Ee o eno haeo ca antn ot Eon ub Eo 8 5 1 MN NucleoSpin Robot 96 Extract G8 Gent 8 5 2 Customizing the Gemini DONE a aisi selis sko dru On EATI A CHR ANTAN ho Ebr bda aka Se E dea aa RISO 8 5 3 Extended Customzaton sse ene nnne 9 Me ei Teen Le Endas o dab dan e bd sad 9
2. confirmed sequence data see Fig 7 3 Model 377 48Zinn P1500A pBS925 nal G 299 A 521 T 482 C 364 Page 1 of 2 ABI le ecaitoso Zen P1500A_pBS925 A 2 1997 EE Fab 2001 1835 Ure d inn P1 1 PRISM Lane 48 Points 63710 14780 Baso 1 637 2 50 ABISO Doran SES Teaect IGA CTCAA Mago qa TAATA C GGT TAT CCACAGAATCAGGGGATAACGCAGGA AAGAACA T GT GA GCAA AAGGOCA GCAA AAGGC CAGGAACCGTAA AA AGGC CACAT TGcTaacaTT wo 170 w 190 mo mo zo m 240 oroor aT Mach cocr acoacr ACCOGATACCTOT ccacor TTCTCOOTTCOGGAAGCGIGGCGCTTTCTCATAGCTCACGCTGTAGGTA T TCA GT TOGGTGTAGGTOJ 410 ax E 4 E 4n 400 Fig 7 3 Sequencing of purified PCR products A 1500 bp PCR product was purified using the NucleoSpin Robot 96 Extract Kit on Tecan Genesis RSP 150 Instrument Purified DNA was sequenced using the ABI PRISM BigDye Terminator cycle sequencing ready reaction kit according to the manufacturer s instructions No background resulting from not removed primers was detected Application Guide MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit V1 0 doc Copyright by Tecan Schweiz AG Page 12 of 14 Application Guide STECAN 8 Reordering Hardware Order from Tecan SPE plate adapter frame 6 2x SPE vacuum block type C Carrier for microplates Carrier for three reagent troughs 100ml Carrier for three reagent troughs 200ml Reagent troughs 100ml 100 pcs Reagent troughs 200ml 32 pcs Standard tips set of 8 384well standard tip adjus
3. 120555 39 l saj dta da o sess sep css ees tds 9 ZE Eeer 10 SA Primer Removal Efficiency c ccccecsccascccosssctereconndesasaneceetectsntanssecesbendenseeasczeeccneancneerets 10 7 2 PCR Fragment Recovery P NR m 11 7 3 Sequencing PCR Products eI 12 o MEORBDEBINO sas rulo a us cece 13 a Bing EN TEE 13 10 CUSTOMER SUPPORT vrcccsctesoecccccccestctescesenceccccanleccessadsnecceadapeececdeaseecedeseesazes 14 Revision History Application Guide MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit V1 0 doc Copyright by Tecan Schweiz AG Page 2 of 14 Application Guide TECAN 1 Application Description 1 1 Introduction 1 1 1 Gemini Script for the MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit The MN NucleoSpin Robot 96 Extract G8 Gemini script runs on the Genesis Freedom RSP or RWS It allows fully automated purification of PCR products in a multi well format with the MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit in approximately 60 minutes The script can be obtained from your local Tecan application specialist Fig 1 1 Automation of the MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit on Genesis Freedom RSP or RWS 1 1 2 Intended Use The MN NucleoSpin Robot 96 Extract_G8 script is intended for automated processing of the MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit on a Tecan Genesis Freedom RSP or RWS The script is intended for research purposes only 1 2 Materials Refer to the MACHEREY N
4. 000 bp PCR fragment unpurified lane 6 1000 bp PCR fragment purified Separation was stopped after 5 min A to check primer removal Primers are completely removed after purification see arrow Electrophoresis was continued for 60 min B for complete separation of PCR products Application Guide MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit V1 0 doc Copyright by Tecan Schweiz AG Page 10 of 14 Application Guide TECAN 7 2 PCR Fragment Recovery Excellent homogeneity in PCR product recovery was achieved when using the MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit on TECAN Genesis Results for a set of different fragment length is visualized in Figure 7 2 bp 1484 982 787 645 490 359 252 164 Fig 7 2 Homogeneity of purification 96 PCR samples 25 ul each sizes as indicated were purified using the NucleoSpin Robot 96 Extract kit on Tecan Genesis Samples were eluted with 125 ul elution buffer NE dried and separated on 1 agarose gel ethidium bromide stain Application Guide MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit V1 0 doc Copyright by Tecan Schweiz AG Page 11 of 14 Application Guide TECAN 7 3 Sequencing PCR Products PCR samples purified with the MN NucleoSpin Robot 96 Extract Kit G8 script can be used for automated fluorescent DNA sequencing micro arrays and restriction digestion Sequencing a 1500 bp PCR on ABI PRISM 377 DNA sequencer results in more than 600bp
5. AGEL NucleoSpin Robot 96 Extract Kit user manual Rev 01 August 2002 or later for a complete list of materials delivered with the kit Application Guide MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit V1 0 doc Copyright by Tecan Schweiz AG Page 3 of 14 Application Guide SGTECAN 1 3 Requirements Software Instrument Gemini V3 5 or later Genesis Freedom 100 150 or 200 with LiHa 8 tips and RoMa or Genesis RSP 100 8 or 150 8 or 200 8 or Genesis RWS 100 8 or 150 8 or 200 8 Instrument Configuration e 2 5ml syringes or larger e fixed tips standard tip or 384well adjustable standard tip Module e Te VacS B with vacuum block C e Adapter frame 6 2x Carriers e one trough rack for three 100ml troughs e one trough rack for three 200ml troughs e one microplate carrier Other e PCR Plate for cooling positioning of unskirted PCR plate types Order Information e Refer to chapter 8 Reordering Information 2 Principle 2 1 Principle of Application The NucleoSpin Robot 96 Extract purification kit is designed for the post PCR clean up in 96well microplate format on a Genesis RSP robotic platform using vacuum filtration technology The principle is based on reversible disruption of the hydrate shell surrounding nucleic acids in the presence of chaotropic salts PCR products are adsorbed to the silica membrane while residual primers primer dimers nucleotides Taq polymerase do not bind and are removed
6. Miyamachi mailto helpdesk jp tecan com Fuchu City Tokyo Netherlands Tecan Benelux B V B A Phone 31 1834 4817 4 Industrieweg 30 Fax 31 1834 4806 7 NL 4283 Giessen Scandinavia Tecan Nordic AB Phone 46 31 75 44000 Box 208 Fax 46 31 75 44 010 SE 431 23 M lndal Spain Tecan Spain Phone 34 93 490 0174 Sabino de Arana 32 Fax 34 94 411 2407 E 08028 Barcelona USA Tecan US Phone 1 919 361 5200 P O Box 13953 Research Triangle Parc NC 27709 Fax 1 919 361 5201 Helpdesk 800 TECAN US 800 832 2687 mailto helpdesk us tecan com Application Guide MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit V1 0 doc Copyright by Tecan Schweiz AG Page 14 of 14
7. ble Carriers on the worktable Carriers are placed on the worktable as shown in Fig 4 1 Grid 1 Grid 3 Grid 6 Grid 7 Grid 13 Grid 20 Carrier for three 100ml troughs Carrier for three 200ml troughs Wash Station Microplate Carrier RoMa Version Te VacS Vacuum Block Hotel MN Type 2 Racks and Containers on Carriers Racks and containers with buffers are placed on the carriers as shown in Fig 4 1 and 4 2 Plates are prepared in hotel as shown in Fig 4 3 Grid 1 Grid 2 Grid 7 two 100ml troughs rear position middle position two 100ml troughs rear position middle position Paper holder with 5 pieces of paper PCR sample plate Round well Block 96wells rear position middle position front position Application Guide MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit V1 0 doc Copyright by Tecan Schweiz AG Page 6 of 14 Application Guide TECAN Grid 13 adapter frame type 6 and vacuum block C rear position adapter frame type 6 front position Grid 20 Elution plate U Bottom position 1 NucleoSpin Extract Binding Plate yellow position 2 MN Wash Plate position 4 Liquids in Troughs Fig 4 2 Placement of Liquids in Containers Buffer NTB 60ml Buffer NE N Buffer NT3 Buffer NT3 120ml 40ml 120ml Grid 1 Grid 2 Fig 4 3 Plates in Hotel Application Guide MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit V1 0 doc Copyright by Tecan Schweiz AG Pag
8. cision of liquid handling arm in Genesis Instrument Software Adjust reference positions scale factor absolute z positioning and z offset if necessary e Adjust predefined RoMa vectors e Preferably perform test runs with water before running the script with real samples Note The RoMa vectors are defined for the Genesis RSP 150 When using a different Genesis Instrument the RoMa vectors must be adapted to the respective instrument type Script adaptation also may be required when working with a different syringe size 4 Preparation 4 1 Sample Preparation e Place the PCR plate with PCR samples on Genesis Microplate Carrier un sealed 4 2 Working Solutions Refer to MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit user manual for complete instructions on preparing working solutions Refer to Liquids in Containers for amount of liquid to be provided on the worktable 4 3 Worktable Note If changing the worktable layout it may be necessary to adapt the script to the new worktable Before starting the script make sure that the worktable is arranged properly Application Guide MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit V1 0 doc Copyright by Tecan Schweiz AG Page 5 of 14 Application Guide TECAN ESA a 9 9 9 9 4 LA Ito Mla L i lal L lal i N N E 9 4 25 30 Fig 4 1 Gemini Worktable Layout for MN NucleoSpin Robot 96 Extract_G8 script on Genesis Instrument Hotel not visi
9. e 103 Fax 41 1 922 8112 CH 8708 Mannedorf Helpdesk 41 1 922 8282 mailto helpdesk ch gttecan com Asia Tecan Asia Pte Ltd Phone 65 4 441 886 80 Marine Parade Fax 65 4 441 836 3113 04 mailto tecan tecan com sg Singapore 449269 Austria Tecan Austria GmbH Phone 43 6 246 8933 Untersbergstrasse 1a Fax 43 6 246 7277 0 A 5082 Grodig Salzburg Helpdesk 43 6 246 8933 444 mailto helpdesk at tecan com Belgium Tecan Benelux B V B A Phone 32 1 542 1319 Vaartdijk 55 Fax 32 1 542 1612 B 2800 Mechelen mailto tecan be tecan com France Tecan France S A Phone 33 1 3068 8150 Parc d Activites de Pissaloup Fax 33 1 3068 9813 Batiment Hermes II Helpdesk 33 1 3068 8150 Rue Edouard Branly mailto helpdesk fr tecan com F 78190 Trappes Germany Tecan Deutschland GmbH Phone 497 9519 4170 Theodor Strom Strake 17 D 74564 Crailsheim Fax 49 7 9515 038 Helpdesk 01805 832 2633 mailto helpdesk de tecan com United Kingdom Tecan UK Phone 44 11 89 300 300 Theale Court Fax 44 11 89 305 671 11 13 High Street Helpdesk 44 11 89 300 300 Theale mailto helpdesk uk tecan com UK Reading RG7 5AH Italy Tecan Italia S r l Phone 39 02 215 2128 Via F lli Cerci Fax 39 02 215 97441 Palazzo Bernini Helpdesk 39 02 215 2128 Centro Direzionale Milano2 mailto helpdesk it tecan com I 20090 Segrate Mi Japan Tecan Japan Co Ltd Phone 81 4 2334 8855 Meiji Seimei Fuchu Building Fax 81 4 2334 0401 10F Helpdesk 81 6 6305 8511 1 40
10. e 7 of 14 Application Guide TECAN 5 Running the Script 5 1 MN NucleoSpin Robot 96 Extract G8 Script Before Running the Script Start Gemini exe Set data path to folder NucleoSpin Robot 96 Extract V1 0 Open script Prepare Genesis Instrument worktable with appropriate carriers racks troughs plates and reagents Flush liquid system until it is free of air bubbles Start the script After Running the Script Purified PCR samples ready for use in further applications Flush liquid system 30ml Remove buffers from worktable Clean Genesis worktable and carriers 5 2 Customizing the Gemini Script To facilitate modifying the Tecan Gemini script the following table gives an overview of the structure of the script Please refer to the Gemini Software Manual for more information of script writing in Gemini Table 5 2 Structure of the Gemini Script Comment in Script Explanation Dilute PCR reaction to 100 ul with buffer NE Buffer NE is used to dilute to final volume 100ul Dispense binding buffer NTB Buffer NTB is pre dispensed into the reaction block Round well Block Transfer PCR Mix mix and transfer to Samples are mixed with Buffer NTB and Silica plate applied onto NucleoSpin Extract Binding Plate yellow DNA adsorption step Vacuum is applied to drain liquid from NucleoSpin Extract Binding Plate DNA binds to silica membrane Wash of silica membrane with buffer NT3 Co
11. in subsequent wash steps After removal of ethanol by drying in vacuum purified DNA is eluted in water or low salt elution buffer Purified PCR products are ready to use for down stream applications like sequencing restriction analysis or spotting on arrays 2 2 Principle of Automation The Genesis Instrument equipped with a Te VacS allows fully automated purification of PCR products All pipetting is performed by the Genesis Liquid Handling Arm LiHa The Robotic Application Guide MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit V1 0 doc Copyright by Tecan Schweiz AG Page 4 of 14 Application Guide SGTECAN Manipulator Arm RoMa moves microplates between Hotel and Te VacS Due to proprietary equipment usage the automated process may not be completely congruent with the manual process described in the MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit user manual 3 Installation 3 1 Installing the Script e Make sure the required software Gemini V3 5 or later is properly installed e Unzip the NucleoSpin Robot 96 Extract Kit V1 0 data folder and create a backup copy Note In addition to the Gemini script file also carriers racks and liquid classes used by the script are needed Carrier cfg Lclasses dat Gemini cfg Gemini opt for proper functioning 3 2 Check and Adjust Hardware e Check instrument configuration required for MN NucleoSpin Robot 96 Extract Kit _G8 script see chapter 1 3 e Check pre
12. ination process steps e g bleach Drop of residual liquid from cartridge outlets in neighboring plate wells Increase vacuum pressure and duration for drying step Spraying aerosol formation during elution step Check cartridge outlet position in relation to liquid level in the Elution plate Weak yield or purity Refer to the MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit user manual Application Guide MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit V1 0 doc Copyright by Tecan Schweiz AG Page 9 of 14 Application Guide TECAN 7 Results 7 1 Primer Removal Efficiency PCR products purified with the MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit on TECAN Genesis were analyzed by agarose gel electrophoresis Figure 7 1 shows PCR products of various lengths before and after purification This figure also illustrates the size dependency of the recovery rate bp 1000 500 404 331 242 CH 190 Fig 7 1 Primer removal A set of PCR products sizes as indicated 20 ul were purified using the NucleoSpin Robot 96 Extract kit on Tecan Genesis RSP 150 instrument After elution purified samples and unpurified controls were dried and separated on 1 agarose gel ethidium bromide stain Lane 1 PCR mix unpurified lane 2 PCR mix purified 2 purified samples were combined before drying to demonstrate primer removal lane 3 250 bp PCR fragment unpurified lane 4 250 bp PCR fragment purified lane 5 1
13. ntaminants removal Air drying Residual ethanol is evaporated from membranes by extensive vacuum driven airflow Dry cartridge outlets on absorbent paper Removes droplets from cartridge Elution Purified PCR fragments are eluted from NucleoSpin Extract Binding Plate with Buffer NE Application Guide MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit V1 0 doc Copyright by Tecan Schweiz AG Page 8 of 14 Application Guide TECAN 5 3 Extended Customization With Te Shake e Faster mixing without tip washing throughput will increase e Gemini script and worktable must be adapted Multiple Batches e Gemini script and worktable must be adapted Additional Hotels required e Recommended to use a Te Shake with shaker plate for two microplates Disposable Tips e Gemini script and worktable must be adapted 6 Troubleshooting Table 6 1 Troubleshooting Problem Possible Cause and Suggestions Insufficient vacuum Plate not positioned correctly Check RoMa Vector Block sealing dirty or broken Check and clean or replace sealing upper lower Te VacS failure Check Te VacS functionality RoMa drops plates RoMa vectors are not correctly configured Adjust RoMa vectors especially grip distance and gripper force Plates stick to carrier or Te VacS block Clean carrier or Vacuum block Cross contamination Tips not clean enough observed in downstream Increase wash volume and or implement decontam
14. table Paper holder PCR Plate Adaptor for Cooling Filter Paper Te VacS B Te Shake optional 760666 760626 612604 613020 760645 613021 760646 612501 612532 760653 623037 760656 Note Optional hardware for extended customization can be ordered from your local Tecan representative If you want to order a complete Te VacS module please refer to the respective order configuration sheet Kit Order from MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit 2x96 NucleoSpin Robot 96 Extract Kit 4x96 NucleoSpin Robot 96 Extract Kit 24x96 Available separately from MACHEREY NAGEL 9 Literature Tecan Manuals Square well Block pack of 20 pcs MN Wash Plate pack of 20 pcs Self adhering PE foil pack of 50 pcs Genesis Freedom Operating Manual Genesis RSP Operating Manual Genesis RWS Operating Manual Gemini Software Manual Te Shake Operating Manual optional MACHEREY NAGEL Technical Note MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit user manual Rev 01 August 2002 or later Application Guide MACHEREY NAGEL NucleoSpin Robot 96 Extract Kit V1 0 doc Copyright by Tecan Schweiz AG 740707 2 740707 4 740707 24 740670 740674 740676 391588 390783 391197 391201 391496 Page 13 of 14 Application Guide STECAN 10 Customer Support Country Region Address Telephone Fax E mail Switzerland Tecan Schweiz AG Phone 41 1 922 8111 Seestrass

Download Pdf Manuals

image

Related Search

Related Contents

408-78003 - TE Connectivity  ロケ一ティングワイヤ一 FRT  クイックドロープローブ 取扱説明書  MODE D`EMPLOI - Support  FZ-1A  Freisprechanlage Audio 2000 Halter-Set für Sony  Pliego de Especificaciones Técnicas  HS-1000 User's Manual    Sterling SDAA 25-100 Dehumidifier User Manual  

Copyright © All rights reserved.
Failed to retrieve file