User Manual
Contents
1. User Manual K Safety Guidelines The HIV based lentivector system is designed to maximize its biosafety features which include e A deletion in the enhancer of the U3 region of 3 ALTR ensures self inactivation of the lentiviral construct after transduction and integration into genomic DNA of the target cells e The RSV promoter upstream of 5 LTR in the lentivector allows efficient Tat independent production of lentiviral RNA reducing the number of genes from HIV 1 that are used in this system e Number of lentiviral genes necessary for packaging replication and transduction is reduced to three gag pol rev The corresponding proteins are expressed from different plasmids lacking packaging signals and share no significant homology to any of the expression lentivectors pVSV G expression vector or any other vector to prevent generation of recombinant replication competent virus e None of the HIV 1 genes gag pol rev are present in the packaged lentiviral genome as they are expressed from packaging plasmids lacking packaging signal therefore the lentiviral particles generated are replication incompetent e Lentiviral particles will carry only a copy of your expression construct Despite the above safety features use of HIV based vectors falls within NIH Biosafety Level 2 criteria due to the potential biohazard risk of possible recombination with endogenous lentiviral sequences to form self replicating virus or the pos2. Cellecta DECIPHER shRNA Libraries www cellecta com User Manual IMPORTANT The barcode sequences in Human Modules 2 and 3 have significant overlap therefore these modules cannot be combined in any step of the procedure including HT Sequencing Library Vector Target Genes mRNA shRNA Catalog Human Module 1 pRSI12 Signaling Pathways 5 043 27 500 DHPAC Mi1 P Human Module 2 pRSI12 Disease Associated 5 412 27 500 DHDAC M2 P Human Module 3 pRSI12 Cell Surface Extracellular DNA Binding 4 922 27 500 DHCSC M3 P Mouse Module 1 pRSI12 Signaling Pathways 4 625 27 500 DMPAC M1V2 P Mouse Module 2 pRSI12 Disease Associated 4 520 27 500 DMDAC M2V2 P NOTE The module names in DECIPHER are used solely for convenience to describe the major groups of genes targeted in the module Many genes targeted in a module do not fall within the description all modules target a variety of genes throughout the genome and not all genes generally considered to fall under a specific description will be found in the module with the specific gene description Please refer to the gene lists and complete gene annotations available on the DECIPHER website at http www decipherproject net support gene lists associated with each module for detailed information regarding which genes are present in each specific module Also each module targets an orthogonal set of MRNA transcripts so there is no overlap in the targets betw
3. 7471 SspI NruI 612 7147 Scal EcoNI 945 MfeI 964 BbvCI 1199 6667 AhdI PpuMI SanDI 1709 BspDI ClaI 1798 BsaAI 1928 BbsI Bpil 2064 BbsI BpiI 2090 EcoRI 2117 PaeR7I PspXI TliI XhoI 2126 pRSI12 U6 sh HTSA4 UbiC TagRFP 2A Puro 8058 bp Cloning site CPPT 5774 PciI Agel 2322 BstBI 2331 AfeI 2391 5352 SfiI XbaI 2735 BsrGI 2797 Bsu36I 3013 PshAI 3387 BamHI 3459 PfIFI Tth111I 3567 BsiWI 3581 BspEI 3638 4732 KpnI 4728 Acc651 4651 NaeI 4649 NgoMIV RsrII 3641 4133 HincII 4133 GGD sali BstEII 3659 4092 SexAI EagI 3973 For sequences and cassette designs for other standard library vectors please visit the Cellecta website http www cellecta com resources vector information or contact Cellecta at tech cellecta com All Cellecta lentiviral vectors including the DECIPHER vectors are covered by a lentiviral expression system license owned by Life Technologies Corporation LTC See Terms and Conditions M 2 HT Sequencing Primers Please check the Product Analysis Certificate that came with your DECIPHER library module to determine which vector and cassette you have M 2 1 HTS4 Cassette DECIPHER pRSI12 U6 sh HTS4 UbiC TagRFP 2A Puro tech cellecta com 19 of 25 v9a 9 15 2015 Cellecta DECIPHER shRNA Libraries www cellecta com User Manual Amplicon Size 2 4 round
4. 20 ul 10X Titanium Taq Buffer Y ul Deionized water 4 ul 50X Titanium Taq 200 ul Total volume Split into 2 x 100 ul reactions Run PCR under the following cycling conditions 94 C 3 minutes 1 cycle o 2d Geen Seconds 12 or 14 cycles the number of 65 C 10 seconds cycles that worked the best in 72 C 10 seconds the previous step 68 C 2 min 4 Analyze the PCR products by gel electrophoresis on a 3 5 agarose 1XTAE gel in order to ensure equal yields of amplified barcodes for all samples Combine amplified barcodes from the 2 x 100 ul Second Round PCR reactions and purify the samples as follows 1 Purify the PCR product with the QlAquick PCR purification kit QIAGEN following the manufacturer s protocol In the last centrifugation step use a centrifuge spin filter at maximum speed for 5 minutes This is to dry the membrane completely to avoid ethanol contamination in the purified PCR product Separate by electrophoresis in a preparative 3 5 agarose 1XTAE gel Cut out band and extract DNA from the gel using the QIAquick gel purification kit QIAGEN 4 Quantitate using A260 nm measurement using NanoDrop spectrophotometer or equivalent and adjust concentration to 10nM e g 0 75 ng ul for 106 bp product HTS3 or 1 8 ng ul for 255 bp HTS4 tech cellecta com 14 of 25 v9a 9 15 2015 Cellecta DECIPHER shRNA Libraries www cellecta com User Manual G HT Sequencing of Pooled shRNA specific Barcodes on
5. Illumina s GAIIx or HiSeq See Required Materials for a list of recommended Illumina kits for HT Sequencing of samples transduced with a Cellecta library HT sequencing of pooled amplified barcodes can be performed on the Illumina GAIIx 20 30 million reads per sample or HiSeq 80 100 million reads per sample using the GexSeq sequencing primer and following the manufacturer s protocol The final concentration of GexSeq primer in the reaction should be 500 nM For the cluster generation step use 20 fmoles 2 ul of 10 nM PCR product of the gel purified band from the 2 round of PCR The number of cycles read length required depends on the length of the barcode and is generally 20 for the DECIPHER libraries 18 nucleotides of barcode sequence and 2 extra nucleotides at the 5 sequence The shRNA library and PCR primer designs include sequences complementary to the sequences of the immobilized primers necessary for generating amplification clusters in Illumina s GAIIx or HiSeq flow cells Our design is only compatible with Single Read Flow Cells in the Single Read Cluster Generation Kit because our primers are not complementary to the sequences immobilized on Paired End flow cells in the Paired End Cluster Generation Kit 1 Adjust purified PCR samples to 10nM 1 7 ng ul concentration 2 For cluster generation step use Illumina Single Read SR flow cell and for each lane add 2 ul of each sample and add PhiX174 control templat
6. CO incubator for 24 hours C 3 Day 2 DNAse I Treatment 7 At 24 hours post transfection replace the medium containing complexes with fresh 30 ml D MEM medium supplemented with 10 FBS DNase I 1 U ml MgCl 5 mM 20mM HEPES pH7 4 Continue incubation in the CO incubator at 37 C overnight Overnight DNase I treatment before harvesting virus does not negatively affect lentiviral titer or infectivity and helps prevent undesirable carryover of plasmid library into the virus prep NOTE Failure to change the media the day after transfection results in large carryover of plasmid free and or Lipofectamine bound in your lentiviral prep This may cause problems with most downstream molecular biology applications especially whenever there is a PCR step involved tech Qcellecta com 8 of 25 v9a 9 15 2015 Cellecta DECIPHER shRNA Libraries www cellecta com User Manual C 4 Day 3 Collect Lentiviral Supernatant 8 At 48 hours post transfection collect all 30 ml of the virus containing medium from each plate and filter the supernatant 300 ml through a Nalgene 0 2 um PES filter a low protein binding filter to remove debris and floating packaging cells Failure to filter supernatant could result in carry over of cells into your lentiviral prep NOTE Usually the peak of virus production is achieved at 48 hours post transfection Supernatant can also be collected again at 72 hours post transfection replace the collected 48 h
7. Packaging the Library 1 What was the lentiviral titer and what was the total number of TU packaged 2 How was the virus concentrated if applicable Transducing Target Cells 1 What MOI did you use to transduce your target cells 2 What target cells did you use 3 How many replicates did you use i e duplicate triplicate etc 4 Did you use puromycin after transduction and at what concentration 5 For how long did you use puromycin on the cells RNAi Screen 1 Could you briefly explain your experiment 2 How many infected cells were used Sample Preparation amp HT Sequencing 1 Describe the protocol you used to amplify the barcodes 2 What HT sequencing system and which Illumina HT Sequencing Kits did you use 3 How much PCR product was used for HT Sequencing 4 How many sequences were read per sample 5 Would you be able to send us the raw data so that it may help us diagnose the issue Please refer to the questions above and contact us by phone or email Phone 1 650 938 3910 Toll Free 1 877 938 3910 Fax 1 650 938 3911 E mail Technical Support tech cellecta com General Information info cellecta com Sales sales cellecta com Orders orders cellecta com Blog http www cellecta com blog Postal Mail Cellecta Inc 320 Logue Ave Mountain View CA 94043 tech cellecta com 17 of 25 v9a 9 15 2015 Cellecta DECIPHER shRNA Libraries www cellecta com
8. Product for longer time periods in greater quantities or for other purposes or to practice more broadly under the shRNA IP Rights or to practice under other CSHL intellectual property rights please contact the CSHL Office of Technology Transfer at 516 367 8301 Definitions Affiliate means at the time of reference thereto any corporation company partnership joint venture or other entity which controls is controlled by or is under common control with the subject entity where control means direct or indirect ownership of more than 50 of i the outstanding stock or other voting rights entitled to elect directors or ii all ownership interests or in any country where the local law shall not permit foreign equity participation of 50 or more then the direct or indirect ownership or control of the maximum percentage of such outstanding stock voting rights or ownership interests permitted by local law Commercial Entity means any entity or organization other than a Non Profit Entity CSHL means Cold Spring Harbor Laboratory Customer means the company or other entity or organization that orders pays for and takes delivery of the Product Non Profit Entity means any college university or governmental entity including without limitation governmental and quasi governmental institutes and research laboratories or any non profit scientific research or educational organization that is of the type described in section 501 c 3 of the
9. concentration of approximately 2 mg ml Expected yield is about 10 ug per 1 million cells 12 Incubate 30 minutes at 80 C before spectrophotometer reading F Amplification of ShRNA specific Barcodes from Genomic DNA An adequate amount of DNA needs to be used in the first amplification to ensure full representation of the barcodes from all the cells isolated from each experimental sample For negative screens where DNA was isolated in the previous step from 25 million or more cells the pooled barcodes should be amplified from 200 ug of genomic DNA When amplifying barcodes from samples generated by positive selection screens use the entire amount of genomic DNA recovered up to 200ug with a proportionally fewer number of 100 pl reactions per sample This protocol was optimized using an ABI GeneAmp PCR System 9700 with Titanium Taq DNA polymerase mix Clontech Takara Use of other PCR enzymes and or thermal cyclers may require additional optimization The lentiviral shRNA library and PCR primer designs include sequences complementary to the sequences of the immobilized primers necessary for generating amplification clusters in Illumina s GAIIx or HiSeq Flow Cells Our library design is only compatible with Single Read Flow Cells in the SingleRead Cluster Generation Kit because our primers are not complementary to the sequences immobilized on Paired End flow cells in the Paired End Cluster Generation Kit See Required Materials for th
10. our experience the addition of glutamine increases titer approximately 2 fold If D MEM comes supplemented with stable L Alanyl L Glutamine dipeptide addition of fresh glutamine is not necessary e Glutamine L Alanyl L Glutamine Dipeptide L glutamine Mediatech Cat 25 015 CI e HEPES e MgCl e Fetal Bovine Serum recommended Mediatech Cat MT 35 010 CV e Puromycin e D PBS Mediatech Cat 21 031 CV e Trypsin EDTA Mediatech Cat 15 040 CV e Polybrene hexadimethrine bromide Sigma Aldrich Cat 107689 e 500 ml 0 2 um filter units Fisher Scientific Cat 09 741 05 or Thermo Scientific Cat 569 0020 e Tissue Culture Plates and Related Tissue Culture Supplies e Lipofectamine Reagent Life Technologies Cat 18324 020 tech Qcellecta com 5 of 25 v9a 9 15 2015 Cellecta DECIPHER shRNA Libraries www cellecta com User Manual e Plus Reagent Life Technologies Cat 11514 015 e 15 ml BD FALCON screw cap centrifuge tubes 12 000 RCF rated PP P CHCls resistant BD Biosciences Cat 352196 e Buffer P1 SOmM Tris HCI pH 8 0 10mM EDTA QIAGEN Cat 19051 e RNase A QIAGEN Cat 19101 e Sonicator for Genomic DNA Shearing e Phenol Chloroform pH 8 0 Sigma Aldrich Cat P3803 e DNase I RNase free Epicentre Cat D9905K e Titanium Taq DNA polymerase with PCR buffer Clontech Takara Cat 639242 e dNTP Mix 10 mM each GE Healthcare Cat 28 4065 52 e OlAquick PCR purif
11. plasmid library DNA as a positive control If it produces the correct amplification product the problem lies with absent or low numbers of barcodes e g low MOI or problems with the transduction efficiency or impurities in genomic DNA which block barcode amplification If the positive control works dilute the genomic DNA 2 5 fold and repeat the amplification step using 180 wg of genomic DNA in several PCR test tubes If not confirm use of the correct primers and reagents Verify that primer sequences are correct Please see Appendix I 2 No barcodes present in HT Sequencing results Problem Incorrect primer used in Illumina Cluster Generation step Solution Ensure that you or the HT Sequencing core facility uses the proper GexSeq Sequencing primer see Appendix NOT the Sequencing primer that comes with the Illumina Cluster Generation Kit Problem Incorrect Cluster Generation kit used Solution Ensure that you or the HT Sequencing core facility uses the proper Single Read Cluster Generation Kit see Required Materials tech Qcellecta com 16 of 25 v9a 9 15 2015 Cellecta DECIPHER shRNA Libraries www cellecta com User Manual J Technical Support For help with using DECIPHER Pooled Lentiviral shRNA Libraries please email technical support at tech cellecta com with the answers to the questions below if applicable Library Used 1 Which library did you use and which Module s 2 What are the lot numbers
12. see Appendix for primer sequences for vectors with HTS4 and HTS3 shRNA cassettes NOTE During the PCR please take a 5 ul aliquot from the tube after 10 12 and 14 cycles and save it for the next step The goal is to find the optimal cycle number in order to avoid overcycling of PCR reactions which can result in the generation of a longer fragment that corresponds to a fusion double barcode product 2 The amplified barcodes are then analyzed on a 3 5 agarose 1XTAE gel load 5 ul lane The results should reveal a bright band of amplified barcode products HTS6 cassette 251 bp The goal of this analytical PCR step is to optimize the starting amount of First Round PCR product and the number of cycles if necessary in order to achieve equal intensities of a single band across all DNA samples from the genetic screen 3 Repeat second round amplification of barcodes from each sample using the optimized volume of First Round PCR product 2 x 100 ul of Second Round PCR product per sample and 12 18 cycles of PCR Set up 2 x 100 ul reactions for each sample containing an adjusted equal amount of First Round PCR product 2 ul or more Prepare a master mix for the second prepration PCR tech Qcellecta com 13 of 25 v9a 9 15 2015 Cellecta DECIPHER shRNA Libraries www cellecta com User Manual X wl First Round PCR Product 10 ul Forward 2 round PCR primer 10 uM 10 ul Reverse 2 d round PCR primer 10 uM 4 ul 50X dNTP 10 mM each
13. 2015 Cellecta DECIPHER shRNA Libraries www cellecta com User Manual e Linearized shRNA expression vector for cloning individual constructs used to validate hits from your screen e LentiFuge lentiviral concentration reagent The following custom services are available from Cellecta at additional cost For more information visit www cellecta com email us at sales cellecta com or call 1 650 938 3910 Additional Products and Services Catalog Ready to Use Packaging Plasmid Mix 250 ug CPCP K2A LentiFuge Viral Concentration Reagent 1000X for 1 L supernatant LFVC1 DECIPHER Module Packaging 2 x 10 8 TU or 1 x 10 9 TU per module CLVP 2E8 CLVP LGLIB HT Sequencing of DECIPHER Library experimental samples frozen cells CANA SQ CANA SQD DNA or xenograft CANA SQT Pre made or Custom Lentiviral shRNA Constructs Plasmid or Packaged Many Cloning DECIPHER Module into Custom shRNA library vector DCLN M P B 3 Materials Needed from Other Vendors e 293T 17 Cell Line ATCC Cat CRL 11268 e Dulbecco s Modified Eagle Medium D MEM 1X Mediatech CellGro Cat 15 013 CV NOTE ADD FRESH GLUTAMINE 1X at the time a sealed bottle of D MEM is opened even if the label indicates glutamine has already been added Glutamine in solution at 4 C has a half life of 1 2 months so glutamine D MEM purchased off the shelf from a supplier is to be regarded as glutamine In
14. BD Biosciences Cat 352196 2 Add 0 25 ml 10 SDS mix and incubate 5 minutes at RT Using an ultrasonic homogenizer sonicate to shear DNA into 10 100 kb sized fragments To prevent cross contamination thoroughly wash the ultrasound head with running water and dry with clean paper towel between samples 4 Add 10 ul of proteinase K mix and incubate 15 minutes at RT Add 5 ml Phenol Chloroform Isoamyl Alcohol solution vortex hard and spin down 60 min 20 C at 8 000 rpm in JA 14 or equivalent rotor Beckman 6 You should have about 5 ml of clear upper phase Transfer 4 ml of upper phase to new 15 ml DISPOSABLE screw cap tube same as in Step 1 7 Add 0 5 ml 3M Sodium Acetate 4 ml isopropanol mix well and spin down 30 min 20 C at 8 000 rpm in JA 14 or equivalent rotor 8 In order to have a more visible pellet compacted at the bottom of the tube it is recommended to incubate overnight at RT before centrifugation IMPORTANT If starting material is less than 5 million cells add carrier before centrifugation linear polyacrylamide 25 ug ml final and spin down for a longer time 60 min tech Qcellecta com 10 of 25 v9a 9 15 2015 Cellecta DECIPHER shRNA Libraries www cellecta com User Manual 9 Discard supernatant add 10 ml 70 ethanol spin down 5 min 20 C at 8 000 rpm in JA 14 or equivalent rotor 10 Discard supernatant and air dry pellet 11 Dissolve DNA pellet in appropriate volume of dH20 to a
15. HER pooled lentiviral 27K shRNA library 27K shRNA complexity using Invitrogen s Lipofectamine and Plus Reagent Other transfection reagents may be used but the protocol should be adjusted to fit the manufacturer s protocol The yield of recombinant lentiviral particles typically produced under these optimized conditions is 1 10 x 109 TU ml In this protocol using ten 10 15 cm plates at least 3 x 10 TU of total lentiviral particles can be made and then concentrated to up to 100 fold using several described methods We do not recommend scaling down the lentiviral packaging protocol due to risk of compromising the representation of the shRNA library 1 Start growing 293T cells in D MEM medium plus glutamine supplemented with 1096 FBS without antibiotics 2 to 3 days prior to transfection C 1 Day O Plate Cells 2 Twenty four 24 hours prior to transfection plate 12 5 x 109 293T cells in each of ten 10 15 cm plates or 150 cm flasks Use 30 ml of media per plate Disperse the cells and ensure even distribution At the moment of transfection the cells should have reached 80 confluency Increase or decrease the number of 293T cells seeded if optimal confluency is not achieved in 24 hours Incubate at 37 C in a CO incubator for 24 hours tech Qcellecta com 7 of 25 v9a 9 15 2015 Cellecta DECIPHER shRNA Libraries www cellecta com User Manual C 2 Day 1 Transfection Ten 15 cm plates 3 In sterile 50 ml
16. Internal Revenue Code or that is qualified under a state non profit organization statute Product means a product including without limitation expression vectors encoding an shRNA the design manufacture or use of which in whole or in part is the subject of the shRNA IP Rights and is deemed to include all components progeny reproductions modified versions and other derivatives thereof Seller means Cellecta Inc 2015 Cellecta Inc All Rights Reserved Trademarks CELLECTA is a registered trademark of Cellecta Inc DECIPHER is a trademark of Cellecta Inc CRL 11268 is a trademark of ATCC Invitrogen Lipofectamine and Plus Reagent are trademarks of Life Technologies Corporation tech Qcellecta com 25 of 25 v9a 9 15 2015
17. PCR 255 bp Primer Name Used for Sequence IDT preferred FWdHTS was FwdHTS2 15t Round 5 TTCTCTGGCAAGCAAAAGACGGCATA 3 RevHTS1 1st Round 5 TAGCCAACGCATCGCACAAGCCA 3 FwdGex was GexiMS 2 4 Round 5 CAAGCAGAAGACGGCATACGAGA 3 RevGex was Gex2M 2 4 Round 5 AATGATACGGCGACCACCGAGA 3 5 AGAGGTTCAGAGTTCTACAGTCCGAA 3 GexSeqS HT Sequencing iro ud ied FwdU6 1 Standard 5 CAAGGCTGTTAGAGAGATAATTGGAA 3 sequencing FwdU6 2 Standard 5 CCTAGTACAAAATACGTGACGTAGAA 3 sequencing M 2 2 HTS3 Cassette DECIPHER pRSI9 U6 sh HTS3 UbiC TagRFP 2A Puro dW Amplicon Size 2 4 round PCR 106 bp Primer Name Used for Sequence IDT preferred FwdHTS was FwdHTS2 1st Round 5 TTCTCTGGCAAGCAAAAGACGGCATA 3 RevHTS was RevcPPT 5 1st Round 5 TGCCATTTGTCTCGAGGTCGAGAA 3 FwdGex was GexiMS 2 d Round 5 CAAGCAGAAGACGGCATACGAGA 3 RevGex was Gex2M 2 d Round 5 AATGATACGGCGACCACCGAGA 3 GexSeqN HT Sequencing 5 ACAGTCCGAAACCCCAAACGCACGAA 3 HPLC Purified FwdU6 was Fwd U6 1 Standard 5 CAAGGCTGTTAGAGAGATAATTGGAA 3 sequencing FwdU6 2 Standard 5 CCTAGTACAAAATACGTGACGTAGAA 3 sequencing tech Qcellecta com 20 of 25 v9a 9 15 2015 Cellecta DECIPHER shRNA Libraries User Manual M 3 Common Library Vector Features www cellecta com Feature Function Source R
18. Yo Rea x b 2 JY iw f 4 43 54 M w ay 4 1 RS f Discovery is yours CELLECTA Cellecta DECIPHER Pooled Lentiviral shRNA Libraries HT RNAi Genetic Screens User Manual V9a 9 15 2015 www cellecta com Cellecta DECIPHER shRNA Libraries www cellecta com User Manual Contents A Background siete eee ee eee ee 3 B DECIPHER Project Required Materials cccccssssccccecessesesneseeeeecesseseaeseceeecessesesaeseceescesseseaasaeeeesens 4 Bids Included Materials oet ce eoe taxe er tiae teo ht uix torpe Tobia dada REENE 4 B 2 Materials Available Separately from Cellecta esee enne nnne 4 B 3 Materials Needed from Other Vendors sess nnnn ennt entere 5 B 4 Related Services from Cellecta sessi nennen nennen ennt entere snnt entere 7 C Packaging Protocol for Pooled Lentiviral shRNA Libraries nnn 7 MP P PROEEUJELCZOJIpREM c 7 C 2 Day 1 Transfection Ten 15 cm plates ccccccsscccessseceseessecececsseeeseeseeeececsseeeceesseeeseesaeeeeeesaeeeeeees 8 C3 Day 2 DNAse Treatment c tec eet iis ter esi deseo i Fees ee RE Reet 8 C 4 Day 3 Collect Lentiviral SUPernatant ccccccccccecessssssseceeeeeceeseseeaeseeececesseeeaeeeeeeeseesesaaaeeeeeeseeesaes 9 C 5 Concentrating Virus Optional srcour a SE 9 D Transduction Protocols Lentiviral Titer Estimation and Screening Prot
19. cessed edited normalized and transformed using your data analysis tool of choice such as SAS SPSS or for simpler analyses Microsoft Excel The program requires the appropriate DECIPHER Module Library BLIB files which are available for download at http www decipherproject net software blib files To install just move them to the same directory where the Barcode Deconvoluter software resides View the Frequently Asked Questions FAQ page here http www decipherproject net support frequently asked questions M 6 2 List of Functionally Validated shRNA http www decipherproject net software validated shrna sequences As a result of NIH SBIR grants HG003355 and RRO24323 Cellecta has compiled a database of 120 000 functionally validated shRNA for human and mouse genes Under the NIH Data and Resource Sharing Plan the shRNA sequences are freely available to all academic and commercial researchers M 6 3 RNAi Generator Tool http www decipherproject net software third party Generate a list of optimal shRNA target sequences for given input sequences The software is extremely customizable Authored by Gus Frangou Ph D of the Roswell Park Cancer Institute tech cellecta com 23 of 25 v9a 9 15 2015 Cellecta DECIPHER shRNA Libraries www cellecta com User Manual N Terms and Conditions Cellecta Inc Limited License Cellecta grants the end user the Recipient of the Pooled Lentiviral s
20. cing Identification of shRNA barcodes in the experimental samples requires amplification of the barcode portion of the integrated lentiviral constructs from sample genomic DNA Subsequent high throughput sequencing of barcodes by the Illumina GAIIx or HiSeq is done to quantify each barcode and generate digital expression data using Deconvolution software We currently do not support HT sequencing of samples on the Illumina MiSeq Due to the large amount of cells and resulting genomic DNA the following protocol is recommended for isolating genomic DNA rather than using a commercial column based kit Use of a commercial column based kit may result in loss of genomic DNA and loss of representation of barcodes that survived the screening protocol Cellecta now offers sample prep HT sequencing and analysis services Please contact us at sales cellecta com or visit http www cellecta com products services cellecta pooled lentiviral libraries next gen sequencing and analysis for more information If you are starting with fewer than 1 million cells we recommend using the Qiagen QIAamp DNA Micro Kit according to the manufacturer s instructions instead of using the protocol here NOTE Use of disposable tubes is highly recommended in order to avoid contamination 1 Suspend cell pellet in 5 ml QIAGEN buffer P1 with RNaseA in 15 ml POLYPROPYLENE phenol chloroform resistant BD FALCON screw cap centrifuge tube 12 000 RCF rated
21. e appropriate Illumina catalog numbers HT sequencing of samples on the Illumina MiSeq is not supported The goal of the first PCR is to amplify barcodes from genomic DNA The goal of second PCR which uses only 596 of volume from the 1st PCR with nested PCR primers is to separate the amplified barcodes from non specific PCR products and excess genomic DNA These extraneous contaminants can interfere with gel purification of the amplified barcodes Moreover the nested PCR primers introduce sequences complementary to the oligos immobilized in the Illumina flow cell which are required for sequencing Use 10 ng of plasmid shRNA library as an amplification control in the first round of PCR and the PCR product from this amplification for the remaining steps tech Qcellecta com 11 of 25 v9a 9 15 2015 Cellecta DECIPHER shRNA Libraries www cellecta com User Manual F 1 First Round of PCR The first round of PCR serves to amplify the barcodes remaining in the genomic DNA pool after the phenotypic screen is complete We recommend not exceeding 100 wg in 100 ul total volume per reaction Prepare a master mix according to the table below For each sample prepare 4 x 100 yl reactions containing a total of 200 ug of genomic DNA _ ul Genomic DNA 200 ug 12 ul Forward 1 round PCR primer 10 uM 12 ul Reverse 1 round PCR primer 10 uM 8 ul 50X dNTP Mix 10 mM each 40 ul 10X Titanium Taq Buffer _ Hl Deionized water 8 ul 50X Titani
22. e based on standard Illumina protocol 3 For HT sequencing step Add GexSeq primer 10 uM i e 20x to the PhiX174 primer to a final concentration of 0 5 uM 4 Run HT sequencing reaction for the appropriate number of cycles with GexSeq PhiX174 primer mix Please see Appendix for HT sequencing primer sequences for vectors with HTS3 and HTS4 shRNA cassettes For other vectors refer to the Product Analysis Certificate that came with the product or contact Cellecta Cellecta now offers sample prep HT sequencing and analysis services Please contact us at sales cellecta com or visit http www cellecta com products services cellecta pooled lentiviral libraries next gen sequencing and analysis for more information H Barcode Enumeration Conversion of raw sequencing data to number of reads for each barcode For DECIPHER shRNA Libraries step by step protocols for barcode deconvolution and enumeration are included with the downloadable software available on the DECIPHER Project website at http www decipherproject net software tech cellecta com 15 of 25 v9a 9 15 2015 Cellecta DECIPHER shRNA Libraries www cellecta com User Manual I Troubleshooting Difficulties with Probe Preparation and HT Sequencing I 1 No PCR Product Problem Incorrect primers or bad reagents used or missing reagents or low transduction of target cells or poor DNA prep with PCR inhibitors Solutions Include 10 ng of
23. eec ea tea Ren Qus ende De ERR 19 M 2 1 HTSA Cassette ies ere bte teh tortus buses expe dra eran eua cree ta Rex esed edes 19 M2223 SEA GCLCIDI EDD e 20 tech Qcellecta com 2 of 25 v9a 9 15 2015 Cellecta DECIPHER shRNA Libraries www cellecta com User Manual M 3 Common Library Vector Features ccccccsssssccecececsesenneaecececsseesesaeaeceeeessseeeaeaeeeeeeeeseseneaeeeesens 21 M 4 DECIPHER Library HT Sequencing Q C Data cccccccccccsssssssecececsssesecssseeeescessesaaeseeeeseesseseaaees 22 M 5 DECIPHER Library Individual Clone Sequencing Q C Data cccccsssscccceceesesssseceeeeseessessaeens 22 M 6 DECIPHER Project ResolUtces ier m ae mer aie De ET chases sctusddveucbaseds cone 23 M 6 1 Barcode Analyzer and Deconvoluter cccccccessssssssceeeeececeeseaeaeeeeecesseseeaeeeeeesseeseseaeeeseesseesees 23 M 6 2 List of Functionally Validated ShRNA sesenta nnns nnne aa 23 Mi6 3 RNAI Generator TOOL iei e neu Erat ee rris tee sa entes E eee eR e Ru Haken 23 N Terris and Conditions rtr ttes nre eet e Rete Yn ae enge peau ue X ERR e eee E enu d ne CR 24 A Background DECIPHER libraries are barcoded lentiviral shRNA libraries optimized for RNAi Genetic Screens in a pooled format They are made to cover most of the human and mouse gene set but are not completely genome wide DECIPHER libraries have e A high percentage of functionally validated sequences e 5 to 6 shRNAs per gene resul
24. een modules B DECIPHER Project Required Materials B 1 Included Materials e 120 ug of each plasmid library ordered in the pRSI12 U6 sh HTS4 UbiC TagRFP 2A Puro vector enough to generate lentivirus for approximately 50 100 screens depending on cell type e 10 ug empty library vector as a packaging and transduction control or after linearization by BbsI Bpil restriction digest for cloning individual constructs used to validate hits from your screen e User Manual and Product Analysis Certificates http www cellecta com resources product manuals and certificates e List of shRNA and barcode sequences http www decipherproject net support e HT Sequencing QC data of plasmid libraries http www decipherproject net support The vector map sequence feature map and restriction map can be downloaded from the DECIPHER Project website at http www decipherproject net support B 2 Materials Available Separately from Cellecta e Lentiviral packaging mix Cat CPCP K2A Libraries can be packaged into lentiviral particles with nearly any 2 or 3 d generation HIV based lentiviral packaging mix Cellecta s lentiviral packaging mix contains two plasmids psPAX2 and pMD2 G pre mixed in an appropriate ratio e Positive control targeting lentiviral shRNA constructs Custom or premade e Negative control non targeting lentiviral shRNA constructs Custom or premade tech cellecta com 4 of 25 v9a 9 15
25. hRNA Libraries and Vector the Product a non transferable non exclusive license to use the reagents for internal research use only as described in the enclosed protocols in particular research use only excludes and without limitation resale repackaging or use for the making or selling of any commercial product or service without the written approval of Cellecta Inc separate licenses are available for non research use or applications The Product is not to be used for human diagnostics or included used in any drug intended for human use Care and attention should be exercised in handling the Product by following appropriate research laboratory practices Cellecta s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price Cellecta s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty Cellecta does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned Cellecta disclaims any and all responsibility for injury or damage that may be caused by the failure of the Recipient or any other person to use t
26. he Product in accordance with the terms and conditions outlined herein The Recipient may refuse these licenses by returning the enclosed Product unused By keeping or using the enclosed Product you agree to be bound by the terms of these licenses The laws of the State of California shall govern the interpretation and enforcement of the terms of these Licenses Limited Use Label Licenses The Recipient acknowledges that the Product has been developed by Cellecta based on licenses from Third Parties and agrees with the Terms of Limited Use for the Recipient provided by the Third Parties Agilent Technologies Inc End User Label License for the use of shRNA libraries comprising Oligo Pools This Internal Use only license grants End Users the sole right to use and fully consume or destroy this product the Product Use of the Product is limited to Research Use ONLY not for diagnostic procedures solely to determine genetic loss of function with short hairpin RNA shRNA interference libraries In all cases sale or other transfer or distribution to third parties of i the Product or any portion of the Product ii DNA RNA and protein constructs or libraries created from the Product or any portion of the Product or of iii transformed phage viruses cells or tissues created directly or indirectly from the Product or any portion of the Product is strictly prohibited without prior written approval by Agilent Technologies Inc Life Techn
27. hen currently in effect then the following additional restrictions shall apply This License and Customer s rights hereunder automatically terminate 1 year after delivery of Product to Customer After 1 year of Product use customer must enter into a separate written agreement with CSHL that covers the shRNA IP rights or Customer shall immediately stop using and destroy all Product in its possession The Product may not be used to make any mouse that is of a strain of mice for germ line transmission by embryonic transfer of a gene encoding an ShRNA that induces suppression of a gene or genes by RNAi No Transfers Customer may not distribute or transfer the Product by license sale loan lease rental or any other means to any commercial partner or any other third party for any commercial purpose except only in the following case Customer may transfer the unmodified Product to a commercial third party contractor who pursuant to a written agreement with Customer and only for non royalty based payment s undertakes on behalf of Customer to use the Product solely for Customer s benefit and internal research purposes which third party shall not after termination of such work retain or receive subsequent rights to possess access or use any Product or any results of such work and from whom Customer receives no payments pursuant to such agreement Compliance Customer may only use the Product in compliance with all local state federal and other appl
28. icable laws regulations and rules including without limitation for uses in the United States EPA FDA USDA and NIH guidelines Customer may not directly or indirectly use the Product or allow the transfer transmission export or re export of all or any part of the Product or any product thereof in violation of any export control law or regulation of the United Sates or any other relevant jurisdiction Disclaimers THE PRODUCT IS PROVIDED AS IS WITHOUT WARRANTY OF ANY KIND NO WARRANTY IS MADE THAT THE PRODUCT WILL MEET CUSTOMER S REQUIREMENTS OR THAT ANY RESULT CAN BE ACHIEVED OR THAT USE OF THE PRODUCT WILL NOT INFRINGE ANY PATENT OR OTHER PROPRIETARY RIGHT ALL WARRANTIES EXPRESS OR IMPLIED ORAL OR WRITTEN ARE HEREBY EXPRESSLY DISCLAIMED INCLUDING WITHOUT LIMITATION ALL IMPLIED WARRANTIES OF NON INFRINGEMENT QUIET ENJOYMENT MERCHANTABILITY OR FITNESS FOR ANY PARTICULAR PURPOSE AND ALL WARRANTIES ARISING FROM ANY COURSE OF DEALING COURSE OF PERFORMANCE OR USAGE OF TRADE Other Uses Except for the limited use expressly specified above no other license is granted no other use is permitted and CSHL retains all rights title and interests in and to the shRNA IP Rights Nothing herein confers to Customer by implication estoppel or otherwise any right or license under any patent patent application or other proprietary intellectual property right of CSHL other than the shRNA IP Rights For information on purchasing a license to use the
29. ication kit QIAGEN Cat 28106 e QlAquick Gel Extraction Kit QIAGEN Cat 28706 e Primer for sequencing shRNA inserts in shRNA constructs IDT See Appendix M e PCR primers for barcode amplification from genomic DNA IDT See Appendix M e HT sequencing primers IDT See Appendix M tech cellecta com 6 of 25 v9a 9 15 2015 Cellecta DECIPHER shRNA Libraries www cellecta com User Manual e HT Sequencing Kits Illumina Platform Kit Type Illumina Cat Description Sequencing FC 104 5001 TruSeq SBS Kit v5 GA 36 cycle GAIIx Cluster Generation GD 203 5001 TruSeq SR Cluster Kit v5 CS GA Sequencing FC 401 3002 TruSeq SBS Kit v3 HS 50 cycle HiSeq Cluster Generation GD 401 3001 TruSeq SR Cluster Kit v3 cbot HS NextSeq 500 Sequencing FC 404 2005 NextSeq 500 v2 Kit See Illumina website for information on HiSeq 2500 rapid run kits NOTE We currently do not support HT sequencing of samples on the Illumina MiSeq B 4 Related Services from Cellecta e Custom Pooled shRNA Library Construction e RNAi Functional Genetic Screens with Pooled shRNA Libraries Cat CRGS X e HT Barcode Sequencing of Cell Pellets DNA or Xenografts from RNAi Screen with Cellecta Library e Pre made and Custom shRNA and CRISPR Constructs e Linearized shRNA Expression Vectors C Packaging Protocol for Pooled Lentiviral shRNA Libraries The following protocol describes the generation of a packaged DECIP
30. ion histograms for individual DECIPHER libraries are available on the PAC forms available on the Cellecta website at http www cellecta com resources protocols M 5 DECIPHER Library Individual Clone Sequencing Q C Data DECIPHER Libraries in pRSI12 Vector DECIPHER Library Human M1 Human M2 Human M3 Mouse M1 Mouse M2 Lot 11070805 12052001 12052002 13011802 13011803 Library Complexity number of clones gt 50 x 10 90 x 10 180 x 10 n a n a Number of random clones picked 40 24 24 24 19 Single Insert Rate gt 95 gt 95 gt 95 gt 95 gt 95 Number of clones with at least one mutation n 2 3 5 2 1 deletion or insertion Mutation Deletion Insertion Rate 0 1 0 2 0 2596 0 32 0 15 0 1 Estimated of Inserts without any mutations deletions or insertions in antisense portion and gt 95 95 93 95 95 considered to be functional tech cellecta com 22 of 25 v9a 9 15 2015 Cellecta DECIPHER shRNA Libraries www cellecta com User Manual M 6 DECIPHER Project Resources DECIPHER Library users have access to additional valuable resources M 6 1 Barcode Analyzer and Deconvoluter http www decipherproject net software barcode deconvoluter This software is required to convert raw HT sequencing data from DECIPHER library screens into a summary file for subsequent processing and it includes annotation for every identified gene Next data can be pro
31. n resistance marker in the DECIPHER vectors Puromycin resistant marker for selection of the Streptomyces PuroR transduced cells alboniger Woodchuck hepatitis virus posttranscriptional Woodchuck WPRE regulatory element enhances the stability of viral eee hepatitis virus transcripts 3 Self inactivating long terminal repeat Allows viral packaging but self inactivates the 5 LTR for biosafety AU3 HIV 1 purposes Dull et al 1998 The element also contains HIV 1 tech cellecta com 21 of 25 v9a 9 15 2015 Cellecta DECIPHER shRNA Libraries www cellecta com User Manual inactivating 3 LTR with deletion in U3 region prevents formation of replication competent viral particles after integration into genomic DNA SV40 T i polyadenylation Allows transcription termination and polyadenylation of SV40 signal MRNA SV40 Ori Al for episomal replication of plasmid in eukaryotic SV40 ere bacterium Amph ee UR el cat P paratyphi pUC ori pUC bacterial origin of replication pUC c element on complementary strand M 4 DECIPHER Library HT Sequencing Q C Data Complete Plasmid shRNA Library HT sequencing data for all modules is available on the DECIPHER Project website at http www decipherproject net support Plasmid HT Sequencing data may be used as negative control untreated untransduced day 0 data for many types of genetic screens The shRNA barcode representat
32. ocols 10 E Genomic DNA Extraction for Barcode Amplification and HT Sequencing sees 10 F Amplification of shRNA specific Barcodes from Genomic DNA esee 11 er S Tesi de tol fefe Of PER p 12 F 2 Second Round of PCR retener cetur eer EP DERE ERE e Re a DER LEER VE See Ea LER o Ede HR Rue NEUE dEi 13 G HT Sequencing of Pooled shRNA specific Barcodes on IIlumina s GAlIx or HiSeq 15 H Barcode Enumeration Conversion of raw sequencing data to number of reads for each barcode 15 l Troubleshooting Difficulties with Probe Preparation and HT Sequencing cccccccesesssssseeeeeees 16 1 1 NO PCR Product esc ccvscecsccesast avetecseneesssteaved sue seeevacs avedeseusieseatavelessvec EE E EERE ANENE KEREN 16 1 2 No barcodes present in HT Sequencing results cccceessssecececesseseseseceeecesseseaaseeeeeeeessesnaaeens 16 J Technical SUPP OME uttter tocar ot ea EUR HRREK Ree E RTE RUN HERR ned ee EUR e gea A sins ura euo R d 17 K Safety Gulidelifies 2 Etre tees UNE LIMINE Ud EI DUM 18 L ire 18 M Appendix rdi mE SHIRE resi unti eu E 19 M 1 Lentiviral shRNA Expression Vector Maps ccccccccssssceceesececeeaececeesaececeesaececeesaeeeeeesaeeeeeeaaes 19 M 2 HT Sequericing PFIIrs s meet De eee exei le ex ded
33. ologies Corporation End User Label License for the use of Lentiviral Expression System This product or service based upon the Lentiviral Expression System is sublicensed from Life Technologies Corporation under U S Patent Nos 5 686 279 5 834 256 5 858 740 5 994 136 6 013 516 6 051 427 6 165 782 6 218 187 6 428 953 6 924 144 7 083 981 and 7 250 299 and corresponding patents and applications in other countries for internal research purposes only Use of this technology for gene therapy applications or bioprocessing other than for nonhuman research use requires a license from GBP IP LLC Please contact GBP IP LLC 537 Steamboat Road Suite 200 Greenwich CT 06830 Use of this technology to make or sell products or offer services for consideration in the research market requires a license from Life Technologies Corporation 5791 Van Allen Way Carlsbad CA 92008 Evrogen IP JSC End User Label License for the use of lentiviral shRNA constructs comprising TagRFP encoded gene This product is for internal non commercial research use only No rights are conveyed to modify or clone the gene encoding fluorescent protein contained in this product The right to use this product specifically excludes the right to validate or screen compounds For information on commercial licensing contact Evrogen Licensing Department email license evrogen com Cold Spring Harbor Laboratory CSHL End User Label License for use of expression vec
34. on and filtered as in step 8 above 1 Aliquot lentiviral supernatant in clear sterile centrifuge tubes 2 Add LentiFuge to a final concentration of 5 ug ml and incubate for 1 hour at 4 C 3 Centrifuge at 10 000 rpm for at least 1 hour at 4 C in a Beckman JA 14 or JA 10 or equivalent rotor Mark the tubes to identify the location where the pellet will be At the end of centrifugation you may or may not be able to see a pellet assume it is at the location of the mark 4 Immediately discard the supernatant by aspirating Place the tubes on ice resuspend the in visible pellet in PBS 10 FBS or PBS 1 BSA make aliquots and freeze at 80 C Alternatively you may concentrate virus by the any of the methods below However the yield of virus is superior 80 recovery using Cellecta s protocol above e Ultracentrifugation at 50 000 g for 90 minutes at 4 C e Sucrose cushion ultracentrifugation e PEG precipitation followed by centrifugation tech Qcellecta com 9 of 25 v9a 9 15 2015 Cellecta DECIPHER shRNA Libraries www cellecta com User Manual D Transduction Protocols Lentiviral Titer Estimation and Screening Protocols For complete protocols on transduction of target cells with pooled lentiviral shRNA libraries titer estimation and examples of screening protocols please see the Pooled Lentiviral shRNA Library Screening Reference Manual E Genomic DNA Extraction for Barcode Amplification and HT Sequen
35. our supernatant with 30 ml of fresh D MEM medium supplemented with 10 FBS 20mM HEPES pH7 4 and continue incubation in the CO incubator at 37 C for 24 hours CAUTION You are working with infectious lentiviral particles at this stage Please follow the recommended guidelines for working with BSL 2 safety class materials see Safety Guidelines 9 Proceed to concentration step or aliquot and store the non concentrated supernatant at 80 C Freezing and thawing usually results in 20 loss of lentiviral titer with each cycle Cellecta offers lentiviral packaging services Please contact us at sales cellecta com or visit http www cellecta com products and services lentiviral packaging for more information C 5 Concentrating Virus Optional Although concentrating virus is optional it is recommended if 1 very high titer virus stock is needed to achieve desired MOI in hard to transduce target cells 2 virus should be suspended in another media besides DMEM 10 FBS which is optimal for sensitive target cells or 3 18 hour post transduction baseline control is used in your screen to minimize problems with possible plasmid library carry over However because of the additional manipulation of samples there is the added risk of contamination and loss of virus The following protocol was optimized to concentrate virus with high recovery The protocol assumes that lentiviral supernatant was harvested 48 hours after transfecti
36. ous Sarcoma Allows Tat independent production of viral MRNA Dull Rous sarcoma PuroR VHS et al 1998 virus enhancer promoter HIV 1 truncated 5 Permits viral packaging and reverse transcription of the HIV 1 LTR viral mRNA Luciw 1996 duis psi y Allows viral packaging Luciw 1996 HIV 1 packaging signal se EE Permits Rev dependent nuclear export of unspliced HIV 1 RRE viral mRNA Kjems et al 1991 Malim et al 1989 U6 Human U6 promoter drives RNA Polymerase III H man transcription for generation of shRNA transcripts Central polypurine tract cPPT improves transduction cPPT efficiency by facilitating nuclear import of the vector s HIV 1 preintegration complex in the transduced cells UbiC promoter Ubiquitin C promoter drives expression of TagRFP and Human TagRFP fluorescent protein Evrogen serves as an sea anemone truncated 3 LTR a polyadenylation signal for transcription termination and polyadenylation of mRNA in transduced cells Required for viral reverse transcription self TagRFP indicator of successful transduction Entacmaea quadricolor Thosea asigna virus 2A translational cleavage site containing 18 amino acid residues Cleavage occurs via a co translational ribosome skipping mechanism 2A T2A between the C terminal glycine and proline residues us asigna leaving 17 residues attached to the end of TagRFP and 1 residue to the start of the puromyci
37. polypropylene tube mix the Ready to use Packaging plasmid mix with the plasmid DECIPHER library and add the plasmid mixture to D MEM medium without serum or antibiotics Add the Plus Reagent mix and incubate at room temperature for 15 min See the table below for the volumes to use 10X 15 cm plates Component 600 ul Ready to use Packaging Plasmid Mix 0 5 ug pl 60 ul Plasmid shRNA Library 1 ug l 12 000 ul D MEM no FBS no antibiotics 600 ul Plus Reagent 13 260 ul Total volume IMPORTANT DO NOT use less than ten 15 cm plates to package a batch of DECIPHER or 27K library A smaller amount may cause shRNA insert representation to be adversely affected 4 Add Lipofectamine Reagent to the D MEM medium without serum or antibiotics in order to make a convenient master mix according to the table below Mix gently 10X plates Component 12 000 ul D MEM no FBS no antibiotics 900 ul Lipofectamine 12 900 ul Total volume 5 Add the diluted Lipofectamine Reagent from step 4 to the DNA Plus Reagent complex from step 3 mix gently by flicking the tube or vortexing and incubate at room temperature for 15 min 6 Add 2 5 ml of the DNA Plus Reagent Lipofectamine Reagent complex from step 5 to each 15 cm plate from step 2 and mix complexes with medium by gentle rotation Take care not to dislodge cells from the plate Incubate at 37 C in the
38. sibility of insertional mutagenesis For a description of laboratory biosafety level criteria consult the Centers for Disease Control Office of Health and Safety Web site at http www cdc gov biosafety publications bmbl5 bmbl5 sect iv pdf It is also important to check with the health and safety guidelines at your institution regarding the use of lentiviruses and follow standard microbiological practices which include e Wear gloves and lab coat at all times when conducting the procedure e Always work with lentiviral particles in a Class II laminar flow hood e All procedures are performed carefully to minimize the creation of splashes or aerosols e Work surfaces are decontaminated at least once a day and after any spill of viable material e All cultures stocks and other regulated wastes are decontaminated before disposal by an approved decontamination method such as autoclaving Materials to be decontaminated outside of the immediate laboratory area are to be placed in a durable leakproof properly marked biohazard infectious waste container and sealed for transportation from the laboratory L References For a complete list of References and Product Citations please see http www cellecta com resources publications tech Qcellecta com 18 of 25 v9a 9 15 2015 Cellecta DECIPHER shRNA Libraries www cellecta com User Manual M Appendix M 1 Lentiviral shRNA Expression Vector Maps 1 MluI SphI 96
39. tors encoding an shRNA Acceptance This Limited Use License License contains the exclusive terms and conditions between CSHL and Customer for use of the Product By opening the Product container or in any other way accessing or using the Product Acceptance you will create a binding legal contract upon the terms and conditions herein without modification Customer s purchase order or similar terms shall not apply to this License If you are not authorized by Customer to enter into this License or do not agree to all terms and conditions in this License then you are prohibited from opening the Product container or otherwise accessing or using the Product Permitted Use Portions of the Product are covered by US and foreign patent applications or patents and other proprietary intellectual property rights owned by CSHL shRNA IP Rights Subject to Acceptance and all terms and conditions of this License sale of the Product to Customer by Seller acting under its license from CSHL an Authorized Sale conveys to Customer only the nonexclusive nontransferable right under the shRNA IP Rights to use the Product solely for Customer s internal research purposes and only at its facility where the Products are delivered by Seller Unlicensed Products Any Product that is acquired other than pursuant to an Authorized Sale including without limitation any Product not acquired from Seller shall be deemed to be an Unlicensed Prod
40. ts in at least 70 knockdown efficiency for approximately 65 of the target genes represented depending on the cell type e Equally represented shRNA constructs with differences in concentrations not exceeding one order of magnitude e Typically about 80 90 of the population of shRNA constructs present within a 10 fold range The barcodes in the DECIPHER libraries are composed of an 18 nt sequence and facilitate HT sequencing data analysis and identification of functional shRNAs using the Illumina HT Sequencing platform Barcodes are identified and converted to lists of genes shRNA with enumerated barcode data and amplification of the specific shRNA hairpins for detection is not required The protocols below provide the instructions on how to package the DECIPHER pooled lentiviral shRNA libraries and how to isolate and amplify the barcodes after your RNAi screen Please read the entire user manual before proceeding with your experiment For a description of the theories behind using pooled shRNA lentiviral libraries information on viral transduction titering or for examples of positive and negative screens using pooled lentiviral libraries please read the Pooled Lentiviral shRNA Library Screening Reference Manual The protocols and methods apply specifically to DECIPHER Modules 1 3 To ensure you have the latest version of this user manual please visit http www cellecta com resources protocols tech Qcellecta com 3 of 25 v9a 9 15 2015
41. uct This License shall be void and of no effect for Unlicensed Products and shall not convey any express or implied right to make use or sell Unlicensed Products for any purpose Restrictions Customer obtains no right to sublicense it rights or to use the Product for the benefit of any third party for any commercial purpose including without limitation using the Product in connection with providing services to any third party or tech cellecta com 24 of 25 v9a 9 15 2015 Cellecta DECIPHER shRNA Libraries www cellecta com User Manual generating commercial databases The Product may not be used in vitro or in vivo for any diagnostic preventative therapeutic or vaccine application or used directly or indirectly in humans for any purpose Customer may not isolate extract reverse engineer derive copy or separately use any component of the Product such as for example any shRNA component for any commercial purpose including without limitation for the purpose of making Products other than solely for Customer s internal research purposes Non Profit Customers If Customer is a Non Profit Entity then the following additional restrictions shall apply Customer obtains no right to use the Product for any commercial purpose Commercial Customers If Customer is a Commercial Entity unless Customer has already entered into a separate written agreement that has been executed by CSHL that covers the shRNA IP rights and that is t
42. um Taq 400 ul Total volume Split into 4 x 100 ul test tubes 94 C 3 minutes 1 cycle 94 C 30 seconds 65 C 10 seconds 16 cycles 72 C 20 seconds 68 C 2 min Please see Appendix for primer sequences for vectors with HTS3 and HTS4 cassettes tech cellecta com 12 of 25 v9a 9 15 2015 Cellecta DECIPHER shRNA Libraries www cellecta com User Manual F 2 Second Round of PCR The second round of PCR nested PCR is required in order to significantly reduce genomic DNA carryover into the samples used for HT sequencing Additionally the second round PCR primers have complimentary sequence to the immobilized primers in the HT sequencing Illumina flow cells Amplify each DNA sample with the Forward and Reverse 2 round primer set and perform HT sequencing on one sample per lane in the flow cell with the GexSeq primer 1 Combine together the 4 x 100 ul First Round PCR reactions and use a 5 ul aliquot in the second round of analytical PCR with nested primers in each 100 ul reaction 5 ul First Round PCR Product 5 ul Forward 24 round PCR primer 10 uM 5 ul Reverse 2 round PCR primer 10 uM 2 pl 50X dNTP Mix 10 mM each 10 ul 10X Titanium Taq Buffer 71 ul Deionized water 2 ul 50X Titanium Taq 100 ul Total volume 94 C 3 minutes 1 cycle 94 C 30 seconds 10 12 or 14 cycles take a 5 ul aliquot after 65 C 10 seconds each cycle for analysis 72 C 20 seconds 68 C 2 min Please
Download Pdf Manuals
Related Search