Lentiviral shRNA expression Cloning Kit User Manual for
Contents
1. Lentiviral shRNA expression Cloning Kit User Manual for making shRNA expression lentivectors Cat Product Name Amount Application LTSH GB pEco Lenti H1 kit Make shRNA expression shRNA GFP Bsd lentivector with cloning kit selection marker LTSH GP pEco Lenti H1 l kit Make shRNA expression shRNA GF P Puro lentivector with cloning kit selection marker LTSH RB pEco Lenti H1 1 kit Make shRNA expression shRNA REP Bsd lentivector with cloning kit selection marker LTSH RP pEco Lenti H1 1 kit Make shRNA expression shRNA RFP puro lentivector with cloning kit selection marker LTSH Puro pEco Lenti H1 l kit Make shRNA expression shRNA puro cloning lentivector with kit selection marker LTSH Bsd pEco Lenti H1 1 kit Make shRNA expression shRNA Bsd cloning lentivector with kit selection marker Each Kit Contents One of the following pre cut linear vector dependent upon the Catalog pEco Lenti H1 GFP Bsd linear vector 10ul or pEco Lenti H1 GFP Puro linear vector 10rxn or pEco Lenti H1 RFP Bsd linear vector or pEco Lenti H1 RFP Puro linear vector or pEco Lenti H1 Puromycin linear vector or pEco Lenti H1 Blasticidin linear vector 10x shRNA oligo annealing solution 5Oul UK amp Rest of World Switzerland Deutschland North America amsbio InN fAMArmn nCAIA A AA intfo amsbio com Centro Nord Sud 2E CH 6934 Bioggio Lugano Tel 41 0 91 604 552. 22 Fax 41 0 91 605 17 85 184 Milton Park Abingdon OX14 4SE Oxon UK Bockenheimer Landstr 17 19 60325 Frankfurt Main 23591 El Toro Rd Suite 180 Lake Forest CA 92630 Tel 44 0 1235 828 200 Fax 44 0 1235 820 482 Tel 49 0 69 779099 Fax 49 0 69 13376880 Tel 1 800 987 0985 ye eee Fax 1 949 265 7703 WWW a nsplio com AMS Biotechnology T4 ligase enzyme 10ul 10rxn Cloning control insert annealed Luc shRNA duplex 1x 10ul 10rxn 57 AGCGa CGAG t GCTC AAA Sequencing primer 1 tube 1Oul x 25ng ul 5S ggatccaatatttgcatgtcgctatg 10 rxn Note Chemical competent cells are required for the cloning but not included in this kit You can use any common chemical competent cells like DH5a NovaBlue or others Storage shRNA Cloning Kit is shipped on dry ice Each kit contains sufficient amounts for 10 shRNA cloning reactions The kit should be stored at 20 C Products stable for 6 months Quick protocol for experienced users 1 Design two DNA oligonucleotides encoding shRNA sequence 2 Anneal the two oligo to generate a duplex 3 Clone the duplex into provided linear pEco shRNA vector by T4 ligation reaction 4 transform into competent cells and grow in LB ampicillin plate 5 confirm positive clone by sequencing 6 knockdown analysis after transfection of shRNA plasmids into mammalian cells 7 Produce shRNA lentivirus and transduce into desired cells fo
3. RNA top strand 5 AGCGatgaaacgatatgggctgaatacCGA Ggtattcageccatatgtttca Knockdown of co transfected luciferase by Luc shRNA 107 54 100 100000 26 67 _ ECU ARNA 700ng Neg Ctr 140000 120000 rase activity amsbio Knockdown of co transfected luciferase expression in 293 HEK cells by pEco H1 luc shRNA GFP Bsd plasmid Luc shRNA duplex was cloned into pEco H1l shRNA GFP Bsd vector then co transfected with pcDNA3 1 luciferase firefly plasmid 100ng and Luc sh RNA plasmid 700ng into 293HEK cells in 24 well plate Cells were harvested at 3 days after transfection Luciferase activity was measured from cell lysate 10ul ea using luciferase reporter assay kit on LMax microplate luminometer Null shRNA plasmid serves as the negative control plasmid here Example B P53 shRNA Measurement of mRNA level by real time qPCR P53 shRNA top strand 5 AGCGecaetacaactacatgtgtaaCG A Gttacacatgtagttgtagtgs 1 000 1000 B1 ARn 1 000 B2 1900 amp 3 Cycle P53 shRNA Neg Ctr Detector hu p53 Pict sfarn vs Cycle Threshokte 019733958 Knockdown of endogenous human P53 in A549 cells by pEco H1 p53 shRNA GFP Bsd plasmid P53 shRNA duplex was cloned into pEco Hl shRNA GFP Bsd vector and transfected into A549 cells grown in medium containing 10ug ml blasticidin Cells were harvested at 3 days after transfection P53 levels were detected from extracted total RNA by r
4. and proceed with transformation Set up a cloning positive control reaction by using 1 ul of annealed Luc shRNA duplex provided thaw on ice The positive clone generated from control Luc shRNA duplex is capable of silencing firefly luciferase gene see Example of knockdown below in this manual 4 Transformation 1 Transfer 2ul of the ligation reaction into a vial of DH5a chemical competent E Coli cells gently mix Note competent cells are not included in this kit 2 Place cells on ice for 5 minutes then transfer cells into 42 C water bath incubate for 30 seconds without shaking Immediately transfer cells to ice 3 Add 250ul of SOC medium incubate at 37 C for 1 hour with shaking 4 Spread all 250ul of trasnformed cells on a pre warmed LB plate containing 100u g ml ampicillin and incubate overnight at 37 C Note in general you will get 30 100 colonies from your reactions and O to 5 colonies from the no insert control reaction 3 Confirm the positive clones Pick few colonies grow in LB ampicillin medium miniprep plasmid DNAs send for sequencing using the provided sequencing primer Note Primer provided at ready to use concentration of 25ng ul simply use lul per reaction Sequencing of stem hairpin structure may need special solution for best result Purified positive plasmid DNAs are ready for transfection into cells for knockdown analysis or they can be used to produce lentiviral particles in pa
5. ckaging cell lines and then the generated lentiviral particles can be used to transduce the cell line of your interest 4 Produce shRNA lentiviral particles optional k rm He Note pEco Lenti shRNA vectors are fully compatible with most current lentiviral system on market So you can use other vendor s lentivirus production system for virus production such as ViraPower Block it Invitrogen MissionShRNA Sigma Lent X Clontech GIPZ Lentiviral ShRNAmir Open Biosystem etc But the following protocol is recommended for the highest virus titers using Amsbio lentiviral reagents Cells grow packaging cells 293T LV cat TLV C in 24 well plate 2 5 x 10 cell well incubated in 5 CO2 overnight Transfection at the time of transfection cells should be 90 confluent Add 100ul of serum free medium or Opti Mem Invitrogen into 1 5ml tube then add 600ng of packaging mix Cat HT pack and 300ng of shRNA lentivector Use your desired transfection protocols according to the transfection reagent manual For example add 2ul of LF2K incubated for 30min in room temperature Transfer all transfection mixture 100ul into a cell well in 24 well plate incubated in 5 CO overnight The next day remove the medium and replace with complete culture medium Harvest virus supernatants at 48 72 hours after transfection Centrifuge virus particles at 3000rpm for 15min at 4 C to pellet cell debris Filter through a ster
6. e 418 6894 p 244 51 2002 Bosher M et al RNA interference Nature Cell Biol 2 E31 E36 2000 4 Meister G and T Tuschl Mechanisms of gene silencing by double stranded RNA Nature 2004 431 7006 p 343 9 5 Paddison P J A A Caudy and G J Hannon Stable suppression of gene expression by RNAi in mammalian cells Proc Natl Acad Sci U S A 2002 99 3 p 1443 8 A UK amp Rest of World Switzerland Deutschland North America Centro Nord Sud 2E CH 6934 Bioggio Lugano Tel 41 0 91 604 55 22 Fax 41 0 91 605 17 85 184 Milton Park Abingdon OX14 4SE Oxon UK Tel 44 0 1235 828 200 Fax 44 0 1235 820 482 Bockenheimer Landstr 17 19 60325 Frankfurt Main Tel 49 0 69 779099 Fax 49 0 69 13376880 23591 El Toro Rd Suite 180 Sn Lake Forest CA 92630 1a Tel 1 800 987 0985 Fax 1 949 265 7703 msbio AMS Biotechnology
7. eal time Q PCR assay Data were normalized to internal level of GAPDH Null shRNA plasmid serves as negative control Conclusion RNAi gene silencing can be effectively carried out via pEco H1 shRNA GFP Bsd vectors Trouble shooting Problems Solution Make freshly annealed duplex and dilute for ligation reaction Few or no colonies Extend ligation time or leave it at 4 C overnight Use more duplex add 5ul of diluted duplex in ligation reaction Use different competent cells amsbio Related Products Cat Product Name Amount Application HT Pack Lentiviral packaging 600ng ul x Packaging for lentivirus plasmids 100u1 production TLV C 293TLV lentiviral One vial lentivirus production cells packaging cells gt 2 x 10 cells Lentiviral shRNA cloning service Amsbio provides cost effective shRNA cloning services Simply tell us the target you want to knockdown we will design the shRNA for your target or you provide the RNAi target sequence and we clone shRNA sequences into our shRNA expression vectors with the selected marker Sequencing verified shRNA plasmids and packaged lentiviral shRNA particles will be delivered to you Our service has the fast turnaround time and lowest costs Please contact us for quote References 1 Lee R C et al The C elegans Heterochronic Gene lin 4 Encodes small RNAs with antisense complementarily to lin 14 Cell 75 843 854 1993 2 Hannon G J RNA interference Natur
8. iRNA Target Designer Clontech s RNAi Target Sequence Selector Gene Link shRNA designer Invitrogen s BLOCK 1T RNAi Designer katahdin RNAi Central WI siRNA selection program 2 Cloning of shRNA expression plasmids Anneal the designed two single stranded DNA oligonucleotides Set up the annealing reaction as follows 100 uM Top strand oligo 10 ul 100 uM Bottom strand oligo 10 ul 10x oligo annealing buffer 3 ul DNase free water 7 ul Total volume 30 ul Incubate reaction mixture at 95 C for 5 minutes can be done in PCR machine Leave the mixture on the PCR machine to gradually cool down for 30 minutes Then put tubes on ice Make 1 1000 dilution add lul of annealed mixture in 99 ul cold DNase free water and then take 2 ul add to 18 ul of 1x annealing solution on ice Final diluted annealed duplex is ready for ligation Save undiluted duplex at 20 C for long term storage Note always put diluted annealed duplex on ice to avoid double strand DNA melt Ligation reaction Set up the ligation reaction as follows pEco Lenti H1 shRNA linear vector l ul Annealed duplex 1 1000 dilution l ul 5x T4 ligase buffer 2 ul DNase free water 5 ul T4 ligase l ul Total volume 10 ul Mix reaction well and incubate for 30 minutes at room temperature Note incubation for longer time may generate more colonies Place reaction on ice
9. ile 0 45um filter Store virus at 80 C 5 Transduction of shRNA lentivirus and selection of the stable clones Cells plate the desired host cells at 10 20 confluency culture at 37 C overnight Note for inducible shRNA expression a Tet repressor stable cell line has to be used as host cells to repress the expression in advance and expression is induced later on by adding tetracycline Amsbio provides a Tet repressor expression cell line with Blasticidin selection Cat SC005 On 2 day thaw lentiviral stock change medium with complete medium containing 6ug ml polybrene and add appropriate amount of lentiviral particles into culture to get a range of MOI from 1 to 10 as desired incubate at 37 C overnight At 24 hours after transduction remove the medium containing virus and replace with complete medium 37 C overnight At 72 hours after transduction remove the medium and replace with complete medium containing the appropriate amount of antibiotics to select for stably transduced cells Note the amount of antibiotic added is dependent on the cell type A kill curve has to be tested to use the right amount of antibiotics In general use 0 5 10ug ml of blasticidin and 10 100 ug ml of puromycin Change medium containing puromycin every 3 4 days At the time when the mock treated well has no living cells trypsinize the antibiotic resistant colonies and make a series of dilution seed into each well in 24 well plate co
10. ntinue to grow cells Inspect the cells under fluorescent microscope select the wells that show GFP signal from all cells grow cells in larger amounts 4 Collect cells and freeze down cells in cryogenic vial as stable shRNA expression cell lines Validation of shRNA knockdown In general most RNAi designs can obtain greater than 50 success rate with greater than 75 knockdown levels However there is no holy grail for an ultimate RNAi design Effective RNAi sequence has to be empirically validated To validate effective shRNAs different approaches are used to measure the mRNA levels or its protein products such as using Q PCR or western blot Alternatively a reporter assay can be applied to screen shRNAs One main concern for RNAi knockdown is the so called off target effect We designed a negative shRNA sequence as the universal negative control It was designed against entire human and mouse transcripts with the minimal sequence humology to any human or mouse ORF sequence to minimize the non specific knockdown The Negative control shRNA lentiviral particles are provided as catalog products Or you can design and clone your own negative control shRNA using this kit For you reference please review the following expression knockdown results using Amsbio s shRNA vector Examples for knockdown using pEco H1 shRNA GFP Bsd vectors Example A Luc shRNA measure the luciferase activity by luciferase assay kit Luc sh
11. r knockdown analysis or generate shRNA stable cell lines Cloning Scheme Overhang Sense 19 21 loop Antisense 19 21 AGCG NNNN NNNNCGAGNNNN NNNN NNNN NNNNGCTC NNNN NNNNAAAA H1 Promoter TCGC H1 promoter GGATCCAATA TTTGCATGTC GCTATGTGTT CTGGGAAATC ACCATAAACG CCTAGGTTAT AAACGTACAG CGATACACAA GACCCTTTAG TGGTATTTGC TGAAATCCCT ATCAGTGATA GAGACTTATA AGTTCCCTAT CAGTGATAGA ACTTTAGGGA TAGTCACTAT CTCTGAATAT TCAAGGGATA GTCACTATCT Transcription start anne GA TTTTTTGGCCGGCC ACCGGTTAGT AATGATCGAC AATCAACCTC CTHCGC AACCGGCCGG TGGCCAATCA TTACTAGCTG TTAGTTGGAG TRBS Tetracycline Repressor Binding Site Vector Schematic maps Schematic representation of shRNA lentivectors RFP Bsd RFP Puro L Rsv GFP Bsd WPRE GFP Puro Puro Bsd Introduction RNA interference RNAI1 technology is a tool for loss of function knockdown silencing studies in mammalian cells without making knock out germline cells Originally double strand short RNAs were found in vivo inhibiting gene expression The mechanism is a series of enzymatic reactions mediated by short RNAs that are complementary in sequence to the silenced targets leading to mRNA degradation or translational repression RNAi knockdown can be introduced by synthetic short double strand RNA siRNA or vector expressed stem hairpin RNA shRNA which is further processed by Dicer enzyme to produce double strand short RNAs Another category of RNAi fo
12. r virus transduction efficiency 5 Long term stable silencing effect the vector encodes an antibiotic marker or a a fluorescent antibiotic fusion marker allowing generation of stable cell lines for long term knockdown 6 Generated lentiviral shRNA particles can be transduced into your cells of interest Note lentivector can be transfected into cells for gene expression knockdown It can produce lentivirus to transduce the hard transfected cells for long term knockdown study 7 Optional inducible knockdown This lentivector or its lentivirus can be used for constitutive high expression of shRNA without needs for any induction However the vector s human H1 promoter is integrated with two Tet repressor binding sites TRBS allowing inducible expression of shRNA when the tetracycline repressor protein TetR exists in advance 8 Insert compatible the same annealed shRNA duplex can be readily cloned into all other linear shRNA lentivectors with different selection markers Cat LTSH GB LTSH GP LTSH RB LTSH RP LTSH Puro LTSH Bsd Protocols 1 Design single stranded DNA oligonucleotide Design two DNA oligonucleotides a top strand and a bottom strand according to the following structure The top strand has AGCG overhung at its 5 end followed by the selected target sequence sense sequence of 19 21 nucleotides a CGAG loop or use your own loop and the reverse complementary to the target sequence antisense The bottom st
13. rand has AAAA overhung at its 5 end and the rest is complementary to the top strand Overhang Sense 19 21nt loop Antisense 19 21nt 5 AGCG NNNN NNNNCGAGNNNN NNNN NNNN NNNNGCTCNNNN NNNNAAAA 5 Overhang Loop length has little or no effect on knockdown Four nucleotides CGAG here have been tested as good minimal length for effective RNAi knockdown You may design your own loop sequence such as a restriction enzyme RE recognition sequence However most RE sequences are palindrome structures which form a continuous hairpin structure with your RNAi sequence which may not be processed correctly into RNAi by Dicer in vivo Two overhangs ensure the directional cloning of the annealed double stranded oligo into provided linear vector 4 The transcription start site is at the first nucleotide of the target sequence sense on the top strand Native H1 RNA initiates at an A so A is recommended to be the first base in sense target sequence shRNA target sequence sense selection There are some general guidelines for selecting the effective shRNA sequence Many online tools or designers can help you select your shRNA sequence But effective RNAI target sequence has to be empirically verified To avoid the off target effect design a scrambled sequence from selected shRNA sequence or a universal Null sequence as a negative control for knockdown analysis shRNA design tools ie An RwWN Promega s s
14. und in vivo is micro RNA miRNA which has similar knockdown mechanism Native or artificial miRNA can be processed from pre micro RNA that is expressed via vector Chemically synthesized double stranded RNA siRNA is only for transient silencing effect In contrast vector expressed RNAi can provide a long term effect by stable selection Vector expressed RNAi for gene silencing provides an alternative convenient method to functional studies in both animal and cell line models Variety of RNAi vectors are now commercially available in the market Lentivectors are HIV 1 Human Immunodeficiency Virus 1 derived plasmids used to generate lentiviral particles lentivirus that can be transduced into virtually all kinds of mammalian cell types or organs including stem cells primary cells and non dividing cells both in vivo and in cell culture system Particles stably integrate into the transduced cells genome for long term expression shRNA expression vectors with different markers Amsbio provides cloning kits for making shRNA lentiviral expression vectors with different selection markers Cat LTSH GB LTSH GP LTSH RB LTSH RP LTSH Puro LTSH Bsd Each kit contains a pre cut ready to use linear vector for ligation of shRNA duplex sequence The linear vector was designed for cloning of double strand DNA encoding a short hairpin RNA Once transcribed the shRNA is processed into short RNA in vivo for RNAI analysis To make shRNA e
15. xpression vector two synthetic oligonucleotides are first annealed to form the DNA duplex which is then cloned into the ready to use linear vector via T4 enzyme ligation The transcription of shRNA is driven by tetracycline inducible human H1 promoter a RNA polymerase III promoter For inducible expression the shRNA expression is repressed in the presence of TetR and induced by tetracycline The expression of TetR can be achieved by using the Tet repressor stable cell line Cat SC005 or pre made Tet repressor lentiviral particles or co transfection with the TetR expression vectors This lentiviral version of shNA vector allows generation of shRNA lentiviral particles that can be transduced into your desired cell lines The shRNA stable expressing cells can then be selected by antibiotic or sorted via a fluorescent signal when applicable Each Kit provides enough materials for 10 cloning reactions for generation of your own lentiviral shRNA expressing clones with the following advanced features Key Features 1 Linearized vector is ready for use no need for the tedious bench work preparation of vector backbone 2 Precise directional cloning of your DNA duplex encoded shRNA structure 3 Rapid high efficient cloning with low background Room temperature for 30min gt 90 positive rate 4 Internal fluorescent reference the vector encode a fluorescent protein GFP or RFP allowing real time monitoring of the transfection o
Download Pdf Manuals
Related Search