Home

User manual / Technical Information

1. e Touch the Program button to return the programming screen Password Cancel Passwords A password can be created to protect the program from being edited and deleted by other users The password will be requested if a user attempts to edit or delete the program To create a password touch the None button next to Password e Enter the required password then touch OK The password is case sensitive e Touch Cancel to return to Program Options without entering a password e Touch the Program button to return to the Programming screen To change or remove the password from the Program Options screen touch the button next to Password e On the Password Editing screen touch the None button and enter the password e To remove the password touch Remove Password To change the password touch Change Password and type in the new password followed by OK Touch Cancel to return to the Program Options screen if no change is required Password Password Required Before changing or removing the password from this program please enter the current password Remove aa Change Password Password Required Before changing or removing the password from this program please enter the current password The password is correct Cancel SETTINGS Touch the Settings button to view the instrument defaults as set up in the instrument Settings module Any of these parameters can be edited by
2. Save a copy of the program on the currently inserted USB flash drive Save a copy of the program on this TC Plus Cancel Sort By Only a A Seltener Search By er Programs Fe Keyword User Select All Program Copy of GAPDH Keywords wheat gradient UserJayne Never used Ta DELETING FILES Unused or old files can be permanently deleted from the unit or a USB memory stick e Select one or more files for deleting by touching the appropriate file button Note Multiple file selection is optional and can be set up in the User Preferences section of the Settings Module or e Touch Select All to select all files e Touch Delete A message box will appear asking for confirmation of delete e Touch Yes to confirm the delete e Touch Cancel to abort the delete If the delete is confirmed a message box will confirm that the files have been deleted e Touch OK Confirm Delete Are you sure you would like to delete these files Once a file has been deleted it cannot be recovered Cancel Deleting Files 1 file deleted UPDATING THE PRIME SOFTWARE The Prime software can be updated by downloading the latest version from the Techne website www techne com You will need a USB memory stick on which to save the update Note that the update tool requires at least Windows XP SP2 and the Microsoft Net Framework 3 5 SP1 which if needed can be downloaded from http Awww microsoft com downloads
3. Temperature Gradient Enter the temperature gradient used 50 7 51 2 52 3 53 3 54 3 54 9 55 5 56 2 56 9 58 1 59 2 59 7 The oligo T_ calculator can be used to estimate the T_ of the PCR primers and help in selecting an appropriate annealing temperature for the thermal cycling program e Touch Enter The Oligo Sequence in order to input the sequence of the primer e Touch the A CGT buttons to enter the primer sequence Touch DEL to delete the last character Touch CLR to delete the whole sequence Use the arrow keys to scroll through the sequence e Touch OK to return to the calculator screen Enter The Oligo Sequence Primer Concentration Enter the concentration of the primer in pM Salt Concentration Enter the salt concentration in mM DNA Base Entry Bases ATTGTAATICG TAC OM 38 e Enter the primer concentration in the PCR mix e Enter the monovalent salt concentration of the PCR MIX e Touch Calculate to calculate the T_ of the primer e To check the T_ of another primer with the same primer and salt concentrations touch Back and enter the new primer sequence e Touch Reset to clear the entries Touch Back to return to the Settings menu Once all the settings and defaults have been set as required touch Save to save the changes and return to the Home Screen e l you do not wish to change any settings touch Cancel to return to the Home Screen ACGGCAATTGTAATTCGTAC Primer Conc
4. KEINE brennbaren Stoffe in der N he hei er Gegenst nde verwenden Das Ger t NICHT in der N he entz ndlicher Fl ssigkeiten oder Gase betreiben e O e Fl ssigkeiten NICHT direkt auf das Ger t auftragen SICHERHEIT DES BEDIENPERSONALS Alle Benutzer von Techne Ger ten m ssen Zugang zu der entsprechenden Literatur haben um ihre Sicherheit zu gew hren Es ist wichtig da diese Ger te nur von entsprechend geschultem Personal betrieben werden das die in dieser Gebrauchsanweisung enthaltenen Ma nahmen und allgemeine Sicherheitsbestimmungen und vorkehrungen beachtet Wenn das Ger t anders eingesetzt wird als vom Hersteller empfohlen kann dies die pers nliche Sicherheit des Anwenders beeintr chtigen Die Ger te von Techne entsprechen den internationalen Sicherheitsbestimmungen und sind mit einem automatischen bertemperaturabschalter ausgestattet Wenn ein Sicherheitsproblem auftreten sollte mu das Ger t ausgeschaltet und vom Stromnetz getrennt werden INBETRIEBNAHME Das Ger t mit beiden H nden tragen Das Ger t unter keinen Umst nden transportieren wenn es in Betrieb ist oder w hrend das Ger t noch am Netz angeschlossen ist 1 Alle Ger te von Techne werden mit einem Netzkabel geliefert das entweder eingesteckt wird oder fest mit dem Ger t verbunden ist 2 Vor dem Anschluss bitte kontrollieren ob die Stromversorgung den Angaben auf dem Typenschild auf der Ger ter ckseite entspricht Um die elekt
5. x 1000 A AS R In C 4 273 15 16 6 x log Na Where AH The sum of the Nearest Neighbour enthalpy changes Kcal mol A Helix initiation correction constant AS The sum of the Nearest Neighbour entropy changes cal K mol R The Gas Constant 1 99 cal K mol C Concentration of the oligo M Na Concentration of monovalent ions M Breslauer K J Frank R Blocker H and Marky L A 1986 Proc Natl Acad Sci USA 83 pp 3746 3750 The Oligonucleotide T_ calculator can be found in the Settings module where the user can input the oligonucleotide sequence its concentration in the reaction and the salt concentration of the reaction mix PROGRAMMING TEXT TEMPERATURE AND TIME This section gives instructions for the basic programming of text temperature and time which are required in later sections TEXT ENTRY When giving a name to a program or stage or when entering a keyword or a password a text entry screen will be opened Touch individual characters to create the name Test 1 CLR DEL e For words with all upper case letters touch CAPS aereo e Touch SHIFT if only the first letter is required in e For numbers touch 123 e For commonly used symbols touch SYM e Touch the space bar not labelled for spaces between characters e To clear the typed name touch CLR e To delete the last character touch DEL Once the name is complete touch OK TEMPERATURE ENTRY When touch
6. Keywords None selected User None selected User None selected Used Never used Used Never used Program Test 2 K ds None selected one selected Change Administrator Password To change the administrator password the new password must be entered twice below i i y i Confirm password n Restore Factory Settings Restore Factory Settings The administrator password is required again to restore factory settings to All changes to the instrument defaults and settings can ee be removed and the unit returned to its factory settings e From the Administrator menu touch Restore Factory Settings e Touch the None button and enter the administrator password e Touch Restore Settings and the unit will be reset to factory defaults Restore Settings Cancel Touch Cancel to return to the Settings menu without making any changes PROGRAM DEFAULTS The program default settings will apply to every new program created on the Prime However individual programs can be edited as required Heated Lid Use this to set the heated lid temperature to Heated Lid 105 0 C approximately 10 C higher than the hottest block temperature in the program Preheat Lid e Touch On Off to toggle between settings e Touch the temperature button to set the required lid temperature 35 C to 115 C Sample Cooling Preheat lid More Settings Set to On to pre heat the lid to the set temperature before the thermal cyclin
7. PELIGROSAS ya que pueden ocasionar quemaduras graves a los operarios y prender el material combustible Los usuarios deben conocer los posibles riesgos TENGA CUIDADO Y LLEVE GUANTES DE PROTECCION PARA PROTEGERSE LAS MANOS NO utilice sustancias combustibles cerca de objetos calientes e NO utilice el instrumento cerca de liquidos o gases inflamables NO coloque un liquido directamente en el instrumento SEGURIDAD DEL OPERARIO Todos los usuarios de equipos Techne deben disponer de la informaci n necesaria para asegurar su seguridad De acuerdo con las instrucciones contenidas en este manual y con las normas y procedimientos generales de seguridad es muy importante que s lo personal debidamente capacitado opere estos aparatos De no ser as la protecci n que el equipo le proporciona al usuario puede verse reducida Todos los equipos Techne han sido dise ados para cumplir con los requisitos internacionales de seguridad y traen incorporados un sistema de desconexi n en caso de sobre temperatura En caso de que surgiera un problema de seguridad desconecte el equipo de la red INSTALACI N El instrumento se debe transportar con las dos manos No mueva ni lleve el instrumento cuando se utilice o est conectado al suministro el ctrico principal 1 Todos los instrumentos Techne se suministran con un cable de alimentaci n que puede ser integrado o enchufable 2 Antes de conectar el instrumento al suministro
8. a prompt will indicate the acceptable range e Touch OK to return to the previous screen The decrease in temperature per cycle will now be 55 displayed AAA e Touch OK again to return to the programming screen Increase Per Cycle Decrease Per Cycle e Touch Cancel to return to the programming screen If no changes are required The temperature value will now appear orange in the programming screen indicating that it contains a modified function Note It is not possible to both increase and decrease rei 95 0 C 00 01 00 55 0 C 00 01 00 Insert a new step mont a nms ntanna monrt n nannan the temperature of the same step To enter a temperature gradient on a step AAAI PrimeG only On the PrimeG an additional Temperature Gradient button is available e Touch the button below Temperature Gradient to turn this function on Next touch the temperature entry button below this A new screen will open which is similar to the simple temperature entry screen The maximum temperature gradient based on the set hold temperature and the temperature limits of the unit will be shown Maximum gradient is 30 0 C Temperature Gradient e Enter the required value e Touch DEL to clear the entry e lf an entered gradient temperature is invalid a prompt will indicate the acceptable range e Touch OK to return to the previous screen The Temperature 55 0 MER temperature gradient for the step will now be 1234
9. can be cycled repeated a defined number of times Insert a new stage e To insert a stage in a program touch Insert a new stage A stage with one step will be inserted Stage 1 Touch this to give the stage a name optional Enter the name using the text entry screen 1 cycle Touch this to edit the number of cycles repeats for the stage Enter the required number of cycles then touch OK Temperature e Touch the temperature button to edit the temperature of the step and add any increment decrement or gradient features Time Touch the time button to edit the hold time of the step and to add any increment decrement time features Ramp rate e Touch the ramp rate setting to adjust the ramp rate The range is 0 1 C s minimum to 3 4 C s maximum for heating and 1 0 C s for cooling The value can be entered to 1 decimal place Ramp rate will affect the heating or cooling rate from the previous step to the current step Once set touch OK to return to the Programming Screen Delete a stage To delete a stage touch the stage area to highlight it and then touch Delete Test 1 Program Options 95 0 C 00 01 00 Insert a new step Cancel A Insert a new stage Maximum 1234567890 a Pe Cancel Test 1 Program Options 95 0 C 00 01 00 Insert a new step Cancel A Insert a new stage INSERT DELETE A STEP Insert a new step Touch Insert a new step to insert the
10. file Search program files or temperature logs from the Run a program 2 Step Template complete list of saved files Used Yesterday 1 48 PM A 1 e Search by keyword 3 Step Template a2 Used Yesterday 1 48 PM RT PCR Template Create a new Ice Bucket Version 1 117 v2 1 1 a Sort By Programs And Search By Search By Logs Program Keyword a Select All Name ABC e Search by user Settings Search by keyword and user e To search for a file saved on the unit touch View Files to open the File Manager screen Search from a list Touch Programs And Logs to display either programs only temperature logs only or both Use the up and down arrow buttons to scroll through the list of saved files e Touch Sort By Program Name to list the programs in order The options are e Program Name ABC ZYX e Recently Used ABC ZYX e Most Used ABC ZYX e User ABC ZYX Search the files by keyword Touch Search By Keyword and this will open the list of keywords stored on the unit e Select one or more keywords by touching the buttons to highlight them Touch again to de select e When all keywords have been selected touch Done to return to the File Manager screen Only the files with the selected keyword s saved with them will be listed To clear the keyword search touch Clear Keyword Search Temperature Log from 123456 2 Step Template Keywords None selected User None selected C
11. it is possible to just feel the pressure being applied Finally rotate the knob a further quarter of a turn the lid is now at the correct pressure for use with the consumable Ensure that all consumables used in the block are of the same height and are spread evenly across the block Insert empty dummy tubes if necessary to spread the pressure of the heated lid evenly Q2 What is the Pause function at the start of the program used for A2 Some users prefer to preheat the heated lid before placing the samples into the unit The pause feature is used to pause the unit after the 2 minute heated lid preheat step Q3 What is Sample Cooling A3 Sample cooling can be applied during the lid pre heat phase This maintains the block at 4 C while the lid is heating to temperature and avoids any increase in sample temperature due to the heated lid before the thermal cycling program begins Q4 What is Hot start A4 The Hot Start step is used to pause the machine at a specific temperature typically around 70 C after the initial template denaturation The reason is to allow the manual addition of unmoditied Taq DNA polymerase which may loose activity if added during the initial denaturation step Heat activated Taq or Hot Start enzymes do not require this step Q5 What is the incremented time and temperature function for A5 Incremented decremented time and temperature are used to increase or decrease either the time or te
12. next step in the current stage e Edit the new step temperature hold time and ramp rate as required Delete a step e To delete a step touch the step area to highlight it and then touch Delete INSERT DELETE A PAUSE Insert a pause To insert a pause between stages touch Insert a pause The hold temperature will be that of the previous step The unit will not continue with the remainder of the program until it is manually un paused by the user Delete a pause To delete a pause touch the pause button to highlight it and then touch Delete Note To insert a pause between two previously programmed stages it is necessary to first delete the later stages to where the pause is required PROGRAM OPTIONS Touch this to view the program defaults as set up in the Settings module 60 0 C 00 00 40 Ineard a nau ctaan Sten 2 Settings Temperature Ramp Rate Insert a new stage Insert a pause Cancel Program Any of these parameters can be edited by touching the appropriate button and will be saved for the current program only Touch Program to return to the programming screen Cancel User User names can be entered and linked to the program to help in searching and identifying programs Create a new user e To enter a user name touch the None selected button next to User e User names that have already been created will then be listed e TO create a new user name touch the Create
13. than 1 Final Extension Time Final Extension Time Minutes To increase the step hold time per cycle Minutes e For an increase in hold time per cycle touch the button below Increase Per Cycle to turn this function on Next touch the time entry button below this Increase Per Cycle Decrease Per Cycle e 00 00 00 00 00 00 A new screen will open which is similar to the simple time entry screen The maximum increase in hold time per cycle based on the number of cycles and the time Increase Per Cycle limits of the unit will be shown Maximum increase per cycle is 02 56 27 Minutes Enter the required value using the and buttons e If an entered incremented time is invalid a prompt will indicate the acceptable range Touch OK to return to the previous screen The increase in hold time per cycle will now be displayed Touch OK again to return to the programming screen Increase Per Cycle Decrease Per Cycle e Touch Cancel to return to the programming screen if no changes are required e 00 00 10 00 00 00 The time value will now appear orange in the programming screen indicating that it contains a modified function 95 0 C Maximum 506 Maximum Inead a nr ntanna Inna a nanan To decrease the step hold time per cycle Minutes e For a decrease in hold time per cycle touch the button below Decrease Per Cycle to turn this se m function on Next touch the time entry button bel
14. 2 0 C 00m30s Stage 2 Number of cycles 40 Step 1 94 0 C 01m00s Step 2 55 0 C 00m50s Step 3 72 0 C 01m00s The Ice Bucket and Ligation programs are simple temperature holds with the former having an infinite hold at 10 C and the latter at 15 C In both of these programs the heated lid is switched off and the initial denaturation hot start and final extension functions disabled INCREMENTED DECREMENTED TIME AND TEMPERATURE The software allows the user to either increment or decrement the time and or temperature of a step within a cycling stage These features are used with applications such as touchdown PCR where the annealing temperature is gradually decreased during the cycling process and long PCR where due to the size of the product long annealing extension times are required and the extension time is increased by 15 to 20s per cycle during the final stages of the reaction GRADIENT Pr meG ONLY The gradient feature of the PrimeG can be useful in optimising the annealing conditions for primers A gradient can be set around a temperature in any step of a program The set temperature is the temperature in the middle columns of the block and the gradient is the variation at the two extremes of the block the left hand columns being the coolest and the right hand columns the hottest 123456 7 8 9101112 A 000000000CO C D E F e G H 00000000C0O Lowest Set Highest temperature temperature temperature G
15. 567890 displayed e Touch OK again to return to the programming screen e Touch Cancel to return to the programming screen If no changes are required The temperature value will now appear orange in the programming screen indicating that it contains a modified function TIME ENTRY Temperature 00 01 00 Insert a new step When touching a time parameter a time entry screen will open There are two forms of time entry screen e A simple form for adjusting the time of the program parameters such as initial denaturation and final extension e An advanced form when programming step hold times within a cycling stage that includes the options for introducing incremented decremented time for example in long PCR Simple time entry e Enter the time using the or buttons to increase or decrease the number of hours minutes or seconds e Using the button with the value set at 0 will scroll to the maximum permitted value e Touching Hide Hours will remove the hour time selector and just display selectors for minutes and seconds e Once the time is correct touch OK to return to the previous screen e Touch Cancel to return to the previous screen if no changes are required Advanced time entry e First ensure the number of cycles for the stage has been set then enter the required hold time as described above Note Increase Decrease Per Cycle will be inactive unless the number of cycles set is greater
16. 60 C 00 00 40 35 cycles n Temperature Log Edit as Programs Instruments Library Settings About New Program Open Program Keywords 2 Step Open in Workbench xl Search Delete Final Extension 72 C 00 05 00 Back Library 2 x femplate ct Er le 3 steps cyclerprogram 4 Temperature Log 129163305559374364 temperaturelog ni 4 Temperature Log 129163305559374364 temperaturelogdata Sk Temperature Log 129163305577186522 temperaturelog My Computer m db My Network Places 4 Temperature Log 129163305577186522 temperaturelogdata le Temperature Log 129163305588123812 temperaturelog 47 Temperature Log 129163305588123812 temperaturelogdata 7 Temperature Log 129163305601717301 temperaturelog af Temperature Log 129163305601717301 temperaturelogdata 8 af cyclerprogram 12 Step Template cyclerprogram 47 3 Step Template cyclerprogram 13 step cyclerprogram 4 ALU 2 cyclerprogram Af ALU 2 steps cyclerprogram lt File name File ever used None None When opening a temperature log file the Temperature Log Monitor screen will be displayed To view the complete temperature log drag the mouse across the screen to scroll through the data points The view will show a graphical representation of the actual temperature changes second by second throughout thermal cycling program Clicking on the Program View button of this scre
17. A PROGRAM NOT ON THE SHORTCUT LIST e Once the required program has been identified touch it to highlight it The Program Selector Screen will show a summary of the program the instrument settings and a graphical representation of the thermal cycling program e Touch Edit to edit the program if required e Touch Back to return to the Home Screen e Touch Start to proceed to the Pre run Screen e From the Pre run Screen touch Start to run the program See THE RUN SCREEN on page 46 for further information on instrument status and progress during a run ra Choose a program Le il 7 Preheat Lid 2 Step Template A 1 i Cene on Ein Hold Used Today 3 43 PM s 0 y Int 1 enaturation 3 Step Template Hot Start an usec Off Ice Bucket Used Today 4 19 PM RT PCR Template Used Last Friday 1 27 PM Initial Denaturation 94 C 94 C 60 C 72 C 10 C 00 05 00 00 00 30 00 01 00 00 05 00 Final Extension Final Hold ss 30 Cycles Program 2 Step Template i Back End time Edit Today 10 45 AM Temperature Log EDITING A PROGRAM EDITING SAVED PROGRAMS First select the required program by searching the Run a program module e To edit a selected program touch the Edit button Any of the Program Options Settings or thermal cycling parameters can be edited Once all the required changes have been made touch Save Note this will overwrite the existing program To copy a program fo
18. Connect to the mains electricity supply with the plug provided or one wired correctly for the supply Switch the power ON using the switch located on the rear of the unit The front display will then light up eee 6 Release the heated lid by lifting the latch forward and use it to lift the lid To close the lid lower the lid onto the block and press the latch to secure in place 7 Place the samples in the block If individual tubes or strip tubes are being used space these out evenly across the block to equalise the pressure from the heated lid 8 The heated lid has a rotating knob to adjust the lid pressure on the samples allowing for a variety of consumables to be used To adjust the pressure a Place the samples in the block and place the lid in the down position b Adjust the orange rotating knob anticlockwise to give the least pressure then close the lid Tully c Gently rotate the knob clockwise until you can feel pressure beginning to be applied d Rotate the knob a further quarter of a turn and this will give the correct pressure Do not over tighten 9 Once the pressure has been set it does not need to be adjusted unless a different block or consumable Is used Cirio GENERAL SOFTWARE FEATURES INTRODUCTION The Prime software allows the user to quickly and easily create thermal cycling programs using a simple and clear touch screen format The software is structured into five modu
19. Distributor Carl Roth GmbH Co KG Schoemperlenstra e 3 5 76185 Karlsruhe www carlroth com Prime and PrimeG OPERATOR S MANUAL Bibby Scientific ace CONTENTS PAGE INTRODUCTION 3 BEFORE USE 4 Unpacking 4 SAFETY INFORMATION 5 English 5 Fran ais 7 Deutsch 9 Italiano 11 Espanol 13 CONTACT INFORMATION 15 gt PRIME SPECIFICATION 16 INSTALLATION 18 GENERAL SOFTWARE FEATURES 20 Introduction 20 Template programs 20 Incremented decremented time and temperature 21 Gradient PrimeG only 21 Oligonucleotide T_ calculator 22 PROGRAMMING TEXT TEMPERATURE AND TIME 23 Text entry 23 Temperature entry 23 Time entry 21 INSTRUMENT SETTINGS AND DEFAULTS 30 User preferences 30 Instrument settings 31 Program defaults 33 Service settings 34 Gradient calculator 35 Oligonucleotide T_ calculator 35 CREATE A NEW PROGRAM 37 Name the program 37 Insert delete a stage 38 Insert delete a step 39 Insert delete a pause 39 Program options 39 gt PAGE Settings 43 View 43 Delete 44 Up and down arrows 44 Save 44 Cancel 44 RUN A PROGRAM 45 Running a program from the shortcut list 45 The pre run screen 45 The run screen 46 Searching for a program not in the shortcut list 47 Running a program not on the shortcut list 49 EDITING A PROGRAM 50 Editing saved programs 50 Editing templates 50 Editing password protected programs 50 CURRENT STATUS 51 VIEW FILES 92 File searching 52 Viewing a program file 54 Viewing a temperature log
20. ESTARE ATTENZIONE ED INDOSSARE GUANTI PROTETTIVI PER LE MANI NON usare sostanze combustibili vicino ad oggetti caldi NON mettere in funzione lo strumento nei pressi di liquidi o gas infiammabili e e NON collocare alcun tipo di liquido direttamente nello strumento SICUREZZA DELL OPERATORE Il personale che utilizza l apparecchiatura Techne deve avere a disposizione la documentazione necessaria al fine di assicurare la loro incolumit importante che solo personale adeguatamente addestrato utilizzi questo apparecchio in conformit alle istruzioni contenute in questo manuale e nel rispetto delle normative e procedure generali di sicurezza Se l apparecchio utilizzato in modo non specificato da Bibby Scientific Ltd la protezione fornita dall apparecchiatura all utilizzatore potrebbe essere a rischio Tutte le unit Techne sono state progettate in conformit ai requisiti internazionali di sicurezza e sono equipaggiate con un interruttore anti surriscaldamento Se si dovesse verificare qualche problema di sicurezza disconnettere l apparecchio dalla rete INSTALLAZIONE Occorre trasportare lo strumento usando entrambe le mani Non spostare n trasportare lo strumento quando in funzione o collegato all alimentazione elettrica di rete Tutti gli strumenti Techne sono forniti con un cavo di alimentazione pu essere integrale o plugin 1 2 Prima di collegare lo strumento all alimentazione elettrica di rete controll
21. G FOR A PROGRAM NOT IN THE SHORTCUT LIST There are four ways to search for a program if it is not in the shortcut list Search from the complete list of saved programs Choose a program Sort By c n RA e Search by keyword Program nn Name ABC Keyword User e Search by user 2 Step Template Search by both keyword and user ae 3 Step Template Select an item from the list to see detail Search from a list program details To search for a program saved on the unit touch Run a Program to open the Program Selection RT PCR Template Scree n Used Last Friday 1 27 PM Use the and buttons to scroll up and down the list of stored programs e Touch Sort By Program Name to list the programs in order The options are e Program Name ABC ZYX e Recently Used 123 321 e Most Used 123 321 User ABC ZYX Search the programs by keyword Keywords 2009 Wheat Lab e Touch Search by Keyword and this will open the list of keywords stored on the unit Create a new keyword e Select one or more keywords by touching the with gradient buttons to highlight them Touch again to de select 2010 When all keywords have been selected touch Done to return to the Program selection screen Wheat Lab Only the programs with the selected keyword s saved with them will be listed e To clear the keyword search touch Clear Keyword Search Search the programs by user e Touch Search by User and this wi
22. ONLY The fused plug supplied with the mains cable is fitted with a 5 amp fuse to protect the instrument and the operator 4 The units are rated to operate at 100 240V 50 60Hz 5 Place the unit on a suitable flat bench or in a fume cupboard if required ensuring that the air inlet vents on the underside are free from obstruction 6 Plug the mains cable into the socket on the back of the instrument 7 Switch on the instrument using the switch located on the front of the unit Replacement cable Should the mains lead need replacement a cable of 1mm of harmonized code HO5VV F connected to an IEC320 plug should be used IF IN DOUBT CONSULT A QUALIFIED ELECTRICIAN ENVIRONMENTAL CONDITIONS The Prime is designed operate under the following conditions Indoor use Ambient temperature range 5 C to 40 C Altitude to 2000m Relative humidity not exceeding 80 Mains supply fluctuations not exceeding 10 Over voltage category Il IEC 60364 4 443 Pollution degree 2 Note The control specifications are quoted at an ambient temperature of 20 C The specification may deteriorate outside an ambient temperature of between 10 C and 30 C The instrument has been tested for radio frequency interference and is certified under EN61326 GUARANTEE The instrument is guaranteed against any defect in material or workmanship for the period specified on the enclosed guarantee card This period is effective from the date of purchase wit
23. T_ calculator Software updates 5 7 colour VGA LCD touch screen 1000 10 10 99 Yes 0 1 C s steps 4h 59m 59s 1s Yes Yes Yes Yes Alpha numeric plus symbols Yes Yes Yes Yes Yes always or never Yes based on the Nearest Neighbour method Free of charge trom www techne com Breslauer K J Frank R Blocker H and Marky L A 1986 Proc Natl Acad Sci USA 83 pp 3746 3750 COMMUNICATION PORTS USB port on front of unit Connection for USB memory stick USB port on rear of unit Connection for servicing and calibration only DIMENSIONS Height mm 240 Width mm 240 Length mm 420 Weight kg 9 4 POWER Voltage 100 240V 50 60Hz Power 425W heute INSTALLATION See also the Safety Information sections on pages 5 to 14 FRONT VIEW 1 Lid adjustment knob Lid release latch 5 7 colour VGA LCD touch screen display DS W N USB port for memory stick REAR VIEW 1 Mains cable inlet 2 On Off rocker switch 3 USB port for service and calibration only INSTALLATION 1 Place the unit on a suitable flat bench ensuring that the air inlet vents on the sides are free from obstruction 2 Insert the block into the unit ensuring the connectors on the block and unit are aligned 3 Slide the quick release bars on the block towards the closed padlock symbols to lock the block in place 4 Plug the mains cable into the socket on the back of the instrument 5
24. V 50 60 Hz 3 ROYAUME UNI SEULEMENT La prise avec fusible int gr fournie avec le c ble secteur est munie d un fusible 5A destin prot ger l appareil et l utilisateur 4 Les unit s sont valu es pour fonctionner 100 240V 50 60Hz 5 Placer l appareil sur une surface plane ou si n cessaire sous une hotte d aspiration veiller ce que les trous d a ration situ s sous l appareil ne soient pas obstru s i O 6 Raccorder le cable d alimentation la prise situ e l arri re de l appareil 7 Allumer l appareil utilisant le commutateur situ sur l avant de l unit C ble de rechange S il s av re n cessaire de remplacer le cordon d alimentation utiliser un c ble de 1 mm conforme la norme HO5VV F reli a une prise IEC320 EN CAS DE DOUTE CONSULTER UN ELECTRICIEN QUALIFIE CONDITIONS ENVIRONNEMENTALES Le Prime est con u pour fonctionner dans les conditions suivantes Pour un usage int rieur seulement Temp rature ambiante 5 C 40 C Altitude inf rieure 2000m Humidit relative ne d passant pas 80 Fluctuations de l alimentation n exc dant pas 10 de la valeur nominale Cat gorie Il IEC 60364 4 443 de surtension Degr de pollution 2 Remarque Les param tres sont indiqu s pour une temp rature ambiante de 20 C Ces caract ristiques peuvent se d t riorer en dehors d une temp rature ambiante de 10 30 C l appareil a t test en mati re de radiofr quences et e
25. a new user button e Type in the user name and touch OK aelelr e riulijo i OBQUEUNEN The new user name will be added to the list To select a user name touch the button to highlight it Touch it again to de select it Create a new User e To delete a user name from the list select the user name and touch Delete Touch Done to return to Program Options The user name will now appear in the Program Options screen Program Touch the Program button to return the programming screen Password Keywords keywords None selected Keywords can be entered and linked to the program to Create a new keyword help in searching for related programs With gradient e To enter a keyword touch the None selected button next to Keywords e Other keywords that have already been created will then be listed e To create a new keyword touch the Create a new keyword button Cancel Type in the keyword and touch OK Wheat Lab RAE BARRE DA SHIFT FRESE O e Keywords 2009 Wheat Lab The new key word will be added to the list e To select a keyword touch the button to highlight it Touch it again to de select it More than one keyword can be selected Create a new keyword With gradient e To delete a keyword from the list select the keyword s and touch Delete e Touch Done to return to Program Options Wheat Lab The keyword s will now appear on the Program Options screen
26. are la tensione confrontandola con la targhetta riportante valori nominali si trova sul retro dell unit Notare che al fine di garantire la corretta sicurezza elettrica occorre che l unit sia messa a terra Collegare il cavo di rete ad una presa idonea secondo la tabella riportata alla pagina successiva 220 240V 50 60Hz 110V 120V 50 60Hz 3 SOLO REGNO UNITO la spina con fusibile fornita con il cavo di rete dotata di un fusibile da 5 Amp per proteggere lo strumento e l utente 4 Le unit sono stimate funzionare a 100 240V 50 60Hz 5 Collocare l unit su un banco piano idoneo o in una cappa aspirante se necessario assicurandosi che gli sfiati delle prese d aria nella parte inferiore non siano ostruiti 6 Inserire il cavo di rete nella presa che si trova sul retro dello strumento 7 Accendere lo strumento per mezzo dell interruttore situato sulla parte anteriore dell unit o Cavo di ricambio Qualora occorra sostituire il cavo di rete si dovr utilizzare un cavo di 1mm codice armonizzato HO5VV F collegato ad una spina IEC 320 IN CASO DI DUBBIO RIVOLGERSI A UN ELETTRICISTA QUALIFICATO CONDIZIONI AMBIENTALI Prime stato progettato per funzionare nelle seguenti condizioni uso interno e range di temperatura ambiente da 5 C a 40 C e altitudine massima 2000 m e umidit relativa non superiore all 80 e oscillazione dell alimentazione di rete non superiore al 10 categoria di sovr
27. atensione Il IEC 60364 4 443 grado di inquinamento 2 Nota le specifiche di controllo sono indicate ad una temperatura ambiente di 20 C Le specifiche potrebbero peggiorare fuori da una temperatura ambiente compresa tra 10 C e 30 C Lo strumento stato collaudato per interferenze da radiofrequenze ed certificato secondo la norma EN61326 GARANZIA Lo strumento garantito da qualsiasi difetto nei materiali o nella lavorazione per il periodo specificato nella scheda di garanzia allegata Questo periodo valido dalla data di acquisto entro tale periodo tutte le parti difettose saranno sostituite gratuitamente a condizione che il difetto non sia la conseguenza di un incidente un uso improprio o negligenza L assistenza secondo quanto stabilito dalla presente garanzia deve essere ottenuta dal fornitore dello strumento Il presente manuale stato preparato ad uso dei clienti di Techne e niente di quanto in esso contenuto costituisce garanzia condizione o rappresentanza riguardo la descrizione la commerciabilit l idoneit allo scopo o altrimenti dell unit o dei componenti Nonostante la descrizione e le specifiche dello strumento contenuti nel manuale dell operatore Techne si riserva il diritto di apportare le modifiche ritenute opportune agli strumenti o a qualsiasi loro componente Sais INFORMACION DE SEGURIDAD Lea atentamente este manual antes de utilizar el Prime ADVERTENCIA LAS ALTAS TEMPERATURAS SON
28. change any settings touch Program Defaults Cancel to return to the Home Screen More Settings Cancel USER PREFERENCES Language Language e Touch the language button to set the required English French Spanish Italian German language The options are English French Spanish Italian and German English Temperature Display Celsius C Celsius C Fahrenheit F Temperature Display e Touch the temperature button to set the required Home Screen File List Sort Recently temperature units The options are C and F i Recent Used First ie Home Screen File List Sort More Settings This sets the user preference for listing the program shortcuts on the Home Screen e Touch the button to set the required sorting preference The options are recently used first or most used first e Touch More Settings for further user preferences Select Multiple Items in File Manager Select Multiple Items in File Manager This allows either multiple files or only single files to be On Off selected for copying and deleting when using the File Manager in the View files module e Touch to select On or Off e Touch Back to return to the Settings menu More Settings eee INSTRUMENT SETTINGS Temperature Log Recording Temperature Log Recording Always Never To record the temperature logs block temperature profile of each run touch the button to set this to Always If AS temperature logs are not re
29. d cleaning 1 Before removing the block disconnect from the power supply and allow it to cool to below 50 C 2 Slide the quick release handles in the direction of the arrows indicated and lift the block assembly out of the unit 3 Never lift or carry the block by one quick release handle always use both handles or support the block from underneath 4 When re fitting the block or fitting a new one slide the quick release handles in the opposite direction to lock the assembly into the unit 5 Open or closed padlock symbols are printed on the quick release handles for easy reference UPGRADING FROM Prime TO PRIMEG The standard Prime thermal cycler can be easily and quickly upgraded to the gradient PrimeG version by purchasing the 5PRIMEX USB upgrade The upgrade consists of a custom USB stick which will only work in a specified unit based on the unit serial number 1 Turn on the Prime then insert the upgrade USB stick into the port on the front of the unit 2 A screen will appear indicating the upgrade to the unit The upgrade will be performed automatically 3 Remove the USB stick once the upgrade is complete FAQS Q1 Howdoladjust the pressure of the heated lid for my tubes or plates A1 For thermal cyclers with lid adjustment knobs rotate the knob anticlockwise until there is no pressure on the consumable then close the lid and latch it To obtain the correct pressure gently rotate the knob clockwise until
30. d or save the new program details as a new program with a different name Save As New Program Cancel nni CURRENT STATUS The Current Status area of the Home Screen provides status information on the Prime and is used to access the Run Screen On the Home Screen the Current status area shows the versions of software and firmware loaded on the unit Run a program e Touch the Current status button to view the status 2 Step Template ai of the Prime Used Yesterday 1 48 PM 3 Step Template Used Yesterday 1 48 PM RT PCR Template Create a new Used Yesterday 1 45 PM program Settings Version 1 117 v2 1 1 Ice Bucket Used 19 04 2010 A 4 Current status View files ra The Prime status will be shown Current status If a unit is running a program as shown by the status This Instrument the Run Screen can be viewed Runs can then be paused LAS I tatus Runnin or stopped as required Togni 2 cae rare End time Today 9 17 AM Accessed Today 8 15 AM e Touch the area to select the unit e Touch View e Touch Cancel to return to the Home Screen Cancel VIEW FILES The View files module opens the File Manager and allows access to all the program and temperature log files From here it is possible to copy program files to the unit for editing Files can also be deleted or copied to a USB memory stick for transfer to a PC or storage FILE SEARCHING There are four ways to search for a
31. details aspx familyid AB99342F 5D1A 413D 8319 81DA479AB0D7 amp displaylang en e From the website click on Support followed by Software Downloads i Techne 5 Prime Update Tool 1 129 l Gl X Choose a USB memory stick to use for the update To update a 5 Prime you ll need a USB memory stick with at least 5MB of free space e Complete the short registration form and click on Use the following steps S b it 1 Choose a USB memory stick you would like to use for the update A folder called UDMIT Update will be copied to the memory stick 2 Turn the 5 Prime off and put the stick into one of the front USB ports Yo U WI NOW have access to a softwa re an d Manua 3 Turn the 5 Prime on and follow the instructions on screen downloads e Select the Prime Update and choose the option to run the file Please insert a USB memory stick Insert a USB memory stick into the PC and click to select Click on Prepare the USB memory stick This will copy the update to the USB memory stick e Turn the Prime off and insert the USB stick into the front USB port Turn the Prime on and follow the instructions on the screen The update will take several minutes When finished the home screen will be displayed e Remove the USB memory stick from the Prime n REMOVING AND EXCHANGING BLOCKS The thermal cycling block can be removed and exchanged for one of a different format or for detaile
32. e DELETE This is used to delete an entry First touch the required segment followed by Delete UP AND DOWN ARROWS Use these buttons to scroll through a program SAVE Touch this button to save the program CANCEL Touch this button to cancel changes to the program and return to the Home Screen RUN A PROGRAM From the Home Screen touch one of the shortcuts to run one of the listed programs or touch Run a program to search and select from other programs and templates saved on the unit Selected programs can be run directly or edited before running RUNNING A PROGRAM FROM THE SHORTCUT LIST On the Home Screen the Run a program area displays shortcuts to four programs User Preferences in the Settings module can be used to select whether this displays the four most recently used programs or the four most frequently used programs e To run one of the programs in the shortcut list touch Run a program the button to open the Pre run Screen 2 Step Template n 1 Used Yesterday 1 48 PM 3 Step Template A 2 Used Yesterday 1 48 PM Settings RT PCR Template n 3 Create a new Used Yesterday 1 45 PM program ice Bucket as Used 19 04 2010 Current status Version 1 117 v2 1 1 View files THE PRE RUN SCREEN The Pre run Screen shows a graphical representation of the program allowing for a rapid check of the temperature parameters The centre of the screen shows each temperature step and hold time not
33. e ambient room temperature therefore run times will also depend on ambient temperature The status of the block is indicated by the step bars which display the activity of the block i e ramping to temperature paused or the count down time of the step Progress through the program is indicated by the stage bar s which show at which cycle of the program the unit is currently at e Touch Stop to stop the program A prompt will ask you to confirm the stop e Touch Temperature log to view the block temperatures The previous two minutes of temperature readings can be viewed by scrolling across the screen using a finger Note The complete log is written and saved on the unit only if Temperature Log Recording is selected as Always in the Instrument Settings Note Touch Program View to return to the program Dur Program status 2 Step Template End time Touch Pause to pause the program Today 12 16 PM e If paused touch Continue to un pause the program e Touch Back to return to the Home Screen Note It is possible to access all modules of the software while the unit is running a program Once the run has finished Program Finished will be displayed instead of End time From the Home Screen This Instrument ID TCPrime65535 e Touch Current status Status Running Program 2 Step Template End time Today 9 17 AM e Touch the area for the instrument Accessed Today 8 15 AM e Touch View SEARCHIN
34. el ctrico compruebe que el voltaje coincida con el indicado en la placa de r gimen situada en la parte trasera de la unidad El instrumento debe disponer de una toma de tierra para garantizar la seguridad el ctrica adecuada Conecte el cable de alimentaci n a un enchufe adecuado seg n la siguiente tabla 220 240V 50 60Hz 110V 120V 50 60Hz 3 SOLO PARA EL REINO UNIDO El enchufe suministrado con el cable de alimentaci n incluye un fusible de 5 amperios para ofrecer protecci n al instrumento y al usuario 4 Las unidades se clasifican para funcionar en 100 240V 50 60Hz 5 Situe la unidad sobre una mesa plana o en una campana de laboratorio si es necesario y asegurese de que los orificios de ventilaci n situados en la parte inferior no tienen ninguna obstrucci n 6 Conecte el cable de alimentaci n en el enchufe situado en la parte trasera del instrumento 7 Encienda el instrumento usando el interruptor situado en el frente de la unidad Cable de repuesto Si es necesario sustituir el cable de alimentaci n se debe utilizar un cable de 1mm de c digo armonizado HO5VV conectado a un enchufe IEC320 EN CASO DE DUDA PONGASE EN CONTACTO CON UN ELECTRICISTA CONDICIONES AMBIENTALES El Prime est disefiado para utilizarse en las condiciones siguientes Uso en interior Intervalo de temperatura ambiente 5 C a 40 C Altitud hasta 2000 m Humedad relativa no superior al 80 Fluctuaciones del suministro el c
35. emove passwords from password protected programs change the Administrator password and restore the unit to its factory settings e Touch None and enter the administrator password The default password is 1234 Touch OK to enter the Administrator Settings menu e Touch Cancel to return to the menu without making any changes Remove Passwords e From the Administrator menu touch Remove Passwords Touch the file with the password to be removed e Touch Remove Password The password will now be removed and the program can be deleted if required e Touch Close to return to the menu Change Administrator Password This allows the administrator to change the default password 1234 e From the Administrator menu touch Change Administrator Password e Touch None entered and enter the new password e Touch the second None entered to confirm the new password Note It is recommended that the administrator keeps a record of the new password e Touch OK to return to the menu or Cancel to return without making any changes Administrator Password Required The administrator password is required to access administrator settings The password is correct Search By Sort By K 2 re A J bias Remove Password Program 2 Step Template Keywords None selected User None selected Used Today 10 02 PM Program Ice Bucket Keywords None selected User None selected Used Never used Program RT PCR Template
36. en will display the program that generated the temperature log For further information on using the Techne Workbench software see the separate user manual which can be downloaded from www techne com COPYING FILES Files can either be copied onto the unit for editing or to and from a USB memory stick To copy files to the unit e Select one or more files for copying by touching the appropriate file button Note Multiple file selection is optional and can be set up in the User Preferences section of the Settings Module or e Touch Select All to select all files e Touch Copy A message box will confirm that the files have been copied The copied file s will now be highlighted and listed as Copy of and can be edited as required Program PCN End time Today 15 38 Program Name ABC Program 2 Step Template Keywords Defra 2008 s Program 3 Step Template Keywords Defra 2009 ser Bates Copying Files 1 file copied 00 11 40 00 11 40 C holding Progress 00 11 41 01 07 12 Pause Instrument Program View Search By Search By Keyword User Program 3 Stage Template K ds Defra 2008 Program Copy of 2 Step Template K ds None ds IPCA 3 one selected st Thursday 6 59 PM Close en To copy files to a USB memory stick Insert a USB memory stick into the port on the front of the unit A message screen will appear confirming that the USB memory stick has be
37. en inserted Touch Cancel to return to the File Manager Screen e Select one or more files for copying by touching the appropriate file button or e Touch Select All to select all files e Touch Copy A message screen will appear giving the option of saving the files to the unit or to the USB memory stick e Touch the upper button to save the file s to the USB memory stick Touch Cancel to return to the File Manager screen The file s will be saved on the USB memory stick in a folder called FileSystem as a cyclerprogram file To copy files from a USB memory stick Insert a USB memory stick into the port on the front of the unit A message screen will appear confirming that the USB memory stick has been inserted Touch Yes to view the programs on the USB memory stick in the File Manager A USB button will be visible in the top right corner indicating that the files are being read from the USB memory stick e Select one or more files for copying by touching the appropriate file button Or e Touch Select All to select all files e Touch Copy A message screen will appear giving the option of saving the files to the unit or to the USB memory stick e Touch the upper button to save the file s to the Prime unit e Touch Cancel to return to the File Manager screen USB flash drive inserted Would you like view any programs or temperature logs on the USB flash drive using the file manager Cancel
38. entration Enter the concentration of the primer in pM Salt Concentration Enter the salt concentration in mM Calculate Tm Calculation 50mM salt and 0 5pM primer ACGGCAATTGTAATTCGTAC 58 94 C Calculate CREATE A NEW PROGRAM From the Home Screen touch the Create A New Program button This will open a screen where you can build a program by adding stages and steps and define the temperatures and hold times The function of each of the buttons on this screen is fame te program l Name the program Program Options Settings described below Bi Save Delete A Cancel NAME THE PROGRAM Touch this button to give the program a name Type in the required name using the text entry screen e Once the name is complete touch OK to return to the programming screen e Touch Cancel to return to the programming screen if no changes are required When saving the program if the chosen name has already been used for another program the message nn ee ee e program name is already in use by another program Please choose a box shown opposite will appear different program name Touch OK to return to the Programming screen e Touch the program name and enter a different name e Once the name is complete touch OK to return to the programming screen Touch Save to save the program INSERT DELETE A STAGE A stage is a section of a program that consists of a number of individual steps that
39. file 54 Copying files 55 Deleting files DI UPDATING THE PRIME SOFTWARE 58 REMOVING AND EXCHANGING BLOCKS 59 UPGRADING FROM PRIME TO PRIMEG 39 FAQs 60 TECHNICAL SUPPORT AND SERVICING 61 ADDITIONAL INFORMATION 62 User Maintenance 62 Fault Finding 62 Fuses 62 Insulation Testing 62 ACCESSORIES 63 REPLACEMENT PARTS 63 INTRODUCTION The Prime is a stand alone flexible and versatile thermal cycler designed to accurately control the temperatures of samples between 4 C and 100 C It has many scientific applications including PCR reverse transcription ligation and sequencing It has user interchangeable blocks to allow for most commonly used consumables including 0 2ml x 96 well plates 0 2ml tubes 0 5ml tubes and 384 well plates The heated lid is fully adjustable to accommodate a wide range of different consumables The Prime is programmed via a 5 7 colour VGA LCD touch screen using simple and intuitive software Programs and run progress can be viewed as a temperature step graphical display allowing the user to readily check the status or position within a run Files can be saved with user names and or keywords which allows for rapid searching and retrieval A USB port on the front of the unit allows transfer of Tiles to and from a USB memory stick for viewing in the Techne Workbench PC software and for the easy update of instrument software The Prime can easily be upgraded to the PrimeG which incorporates a block gradient funct
40. g program begins e Touch On Off to toggle between settings Sample Cooling Set to On to cool the block to 4 C while the lid preheats e Touch On Off to toggle between settings e Touch More Settings for further program defaults or Back to return to the Settings menu Pause This will cause the unit to pause before the program starts at the ambient temperature of the block unless Sample Cooling has been set to On In this case the unit will pause with the block held at 4 C and the program will not commence until the unit is manually un paused e Touch On Off to toggle between settings 8 Ta Initial Denaturation Use this to denature the sample and or activate the enzyme before the thermal cycling program begins e Touch On Off to toggle between settings Initial Denaturation e Touch the time button to set the required hold time e Touch the temperature button to set the required Hot Start temperature Hot Start This will cause the unit to pause at the set temperature The program will not continue until the unit is manually un paused More Settings e Touch On Off to toggle between settings e Touch the temperature button to set the required temperature e Touch More Settings for further program defaults or Back to return to the Settings menu Final Extension Final Use this to add a final extension step to the program to EE 00 05 00 ensure complete amplification of the products e Touc
41. h On Off to toggle between settings Final Hold e Touch the time button to set the required hold time e Touch the temperature button to set the required temperature Final Hold This will hold the block at the set temperature at the end of a program until the user manually stops the unit More Settings e Touch On Off to toggle between settings e Touch the temperature button to set the required temperature e Touch More Settings to return to the top of the Program Defaults menu or Back to return to the Settings menu SERVICE SETTINGS The service settings are for the use of authorised service engineers only A service engineer s password is required to access these settings n GRADIENT CALCULATOR PrimeG ONLY The Gradient Calculator can be used to calculate the temperature for each column of the block for a user specified temperature and gradient range e Touch the Target Temperature button and enter the required temperature e Touch OK e Touch the Temperature Gradient button and enter the required gradient range followed by OK e Touch OK The calculated temperatures for each of the columns of the block will now be displayed Note With the 384 well block the columns are paired as it is not possible to individually control 24 columns Therefore only 12 column temperatures are available across this block OLIGO T CALCULATOR Target Temperature Enter the temperature used for the gradient
42. hin this period all defective parts will be replaced free of charge provided that the defect is not the result of an accident misuse or negligence Servicing under this guarantee should be obtained from the supplier of the instrument This manual has been prepared for the convenience of Techne s customers and nothing in this manual shall be taken as a warranty condition or representation concerning the description merchantability fitness for purpose or otherwise of the unit or components Notwithstanding the description and specification s of the instruments contained in the operator s manual Techne reserves the right to make such changes as it sees fit to the instruments or to any of the components ee L INFORMATION DE SURETE Veuillez lire attentivement toutes les instructions de ce document avant d utiliser le Prime AVERTISSEMENT Les TEMPERATURES ELEVEES SONT DANGEREUSES car elles peuvent provoquer de graves br lures chez l op rateur et enflammer les mat riaux combustibles Les utilisateurs doivent porter une attention toute particuli re aux points suivants PROCEDER AVEC PRUDENCE ET PORTER DES GANTS POUR SE PROTEGER LES MAINS NE PAS utiliser de mat riaux combustibles aupr s d objets chauds NE PAS utiliser l appareil a proximit de liquides ou de gaz inflammables NE PAS verser de liquides directement dans l appareil S CURIT DE L OP RATEUR Tous les utilisateurs de produits Techne doivent avoir pri
43. ilar to the simple temperature entry screen The maximum increase in temperature per cycle based on the number of cycles Increase Per Cycle Maximum increase per cycle is 1 6 C and the temperature limits of the unit will be shown e Enter the required value Up to 1 decimal place 0 5 DEL Touch DEL to clear the entry e lf an entered incremented temperature is invalid a prompt will indicate the acceptable range e Touch OK to accept and return to the previous screen The increase in temperature per cycle will now be Temperature C 99 displayed e Touch OK again to return to the programming e Touch Cancel to return to the programming screen if geo Off no changes are required Test 1 Program Options 95 0 C 00 01 00 The temperature value will now appear orange in the programming screen indicating that it contains a modified function To decrease the step temperature per cycle e For a decrease in temperature per cycle touch the button below Decrease Per Cycle to turn this function on Next touch the temperature entry button below this A new screen will open which is similar to the simple temperature entry screen The maximum decrease in temperature per cycle based on the number of cycles ee Per Cicle and the temperature limits of the unit will be shown Per cycle is 1 9 C e Enter the required value e Touch DEL to clear the entry e If an entered decremented temperature is invalid
44. ing a temperature parameter a temperature entry screen will open There are two forms of temperature entry screen e A simple form for adjusting the temperature of the instrument parameters such as the heated lid and program parameters such as initial denaturation and final extension e An advanced form when programming step temperatures within a cycling stage that includes the options for introducing an incremented decremented step temperature for example in touchdown PCR or a temperature gradient Simple temperature entry e Enter the temperature type in the required value The decimal point can be used for 0 1 C resolution Heated Lid e To clear the entry press DEL e f an entered temperature is invalid a prompt will indicate the acceptable range e Once the temperature is correct touch OK to return to the previous screen e Touch Cancel to return to the previous screen if no changes are required Advanced temperature entry First ensure the number of cycles for the stage has been set then enter the required hold temperature as described above Note Increase Decrease Per Cycle will be inactive unless the number of cycles set is greater than 1 To increase the step temperature per cycle e For an increase in temperature per cycle touch the 2 414034567809 456178 button below Increase Per Cycle to turn this function on Next touch the temperature entry button below this A new screen will open which is sim
45. ion and gradient calculator allowing for simple and rapid optimisation of reaction conditions Purchase of this instrument conveys a limited non transferable immunity from suit for the purchaser s own internal research and development and applied fields other than human in vitro diagnostics under non real time thermal cycler patents of Applied Biosystems LLC BEFORE USE Before using the Prime please ensure you have read this manual carefully If there is any doubt relating to the proper use of this equipment the staff at Bibby Scientific Ltd or your supplier will be happy to assist you UNPACKING When unpacking the unit please ensure that the following have been removed from the packaging e Prime with block e Mains cables UK EU and US e Operator s manual e Warranty card The user is advised to keep the original packaging in case the instrument ever needs to be returned for service or repair Bibby Scientific Ltd accepts no responsibility for damage incurred unless the unit is correctly packed and transported in its original packaging ae SAFETY INFORMATION Please read all the information in this manual before using the Prime WARNING HIGH TEMPERATURES ARE DANGEROUS they can cause serious burns to operators and ignite combustible material Users should be aware of the following potential hazards USE CARE AND WEAR PROTECTIVE GLOVES TO PROTECT HANDS DO NOT use combustible substances near hot objects DO NOT opera
46. les which are accessed from the Home Screen These allow the user to Run an existing program selecting from templates or Run a program programs saved on the unit 2 Step Template e Create a new program Used Yesterday 1 48 PM a 3 Step Template Set instrument and program defaults and Used Yesterday 1 48 PM n2 preferences Includes calculator tools RT PCR Template A 3 Create a new Used Yesterday 1 45 PM program e View the current status of the unit Ice Bucket as Used 19 04 2010 Current status Version 1 117 v2 1 1 e View and search for files stored on the unit A TEMPLATE PROGRAMS To help with programming a number of program templates are installed on the unit which are available to copy and edit or can be run directly without changes Details of the installed program templates are given below Instrument and program defaults Parameter 2 Step Template 3 Step Template RT PCR Template Heated Lid 105 C 105 C 105 C Heated lid before program On On On Sample cooling On On On Pause before program Off Off Off Initial denaturation 94 C 05m00s 94 C 05m00s 94 C 05m00s Hot start Off Off Off Final extension 72 C Usm00s 72 C O5m00s 72 C 0 mM00s Final hold 10 C 10 C 10 C Thermal cycling conditions 2 Step Template 3 Step Template RT PCR Template Stage 1 Number of cycles 30 30 1 Step 1 94 0 C 00m30s 94 0 C 00m30s 45 0 C 40m00s Step 2 60 0 C 01m00s 55 0 C 00m30s 94 0 C 05m00s Step 3 7
47. ll open the list of user names stored on the unit e Select the required user name by touching the appropriate button to highlight it Touch again to de select e When the user name has been selected touch Done to return to the Program selection screen Only the programs with the selected user name saved with them will be listed e To clear the user name search touch Clear User Search Search the programs by keyword and user e Touch Search by Keyword and this will open the list ot keywords stored on the unit Select one or more keywords by touching the buttons to highlight them Touch again to de select e When all keywords have been selected touch Done to return to the Program selection screen Only the programs with the selected keyword s saved with them will be listed e Touch Search by User and this will open the list of user names saved with previously keyword searched programs e Select the required user name by touching the appropriate button to highlight it Touch again to de select e When the user name has been selected touch Done to return to the Program selection screen Only the programs with both the selected user name and key word s saved with them will be listed Choose a program Sort By Clear TEN NS Program Keyword Clear user Name ABC Search Heated Lid Preheat Lid On Test 1 Used Today 3 42 PM e Trial Or 00 05 00 94 C Used Today 10 35 AM Ta RUNNING
48. mperature incrementally over the number of cycles in a stage Incrementation of extension time is used with Long PCR which is when large template fragments are to be amplified e g 27kb lambda DNA 40kb genomic DNA Decremented temperature is used for protocols such as Touchdown PCR where the first cycle starts with a high annealing temperature and over the number of cycles in the stage there is a gradual decrease in the temperature This ensures that only the specific product is amplified Q6 What is a gradient thermal cycler A6 Gradient blocks enable a particular temperature step in a protocol to be programmed so that the temperature varies across the block By specitying a temperature and the gradient to be applied each column will achieve a different temperature The set temperature is in the middle of the block the lowest on the left and the highest on the right The gradient is the total difference across the block for example if the set temperature was 60 C and the gradient 10 C then the temperatures would range from approximately 55 C to 65 C from left to right Q7 Whyisa temperature gradient required A7 The annealing temperature of the specific primers used in DNA amplification often requires optimisation Instead of running multiple experiments with different annealing temperatures the gradient thermal cycler PrimeG allows the testing of up to 12 different annealing temperatures simultaneously
49. n beziehen sich auf eine Umgebungstemperatur von 20 C und k nnen sich au erhalb des Bereichs 10 C bis 30 C verschlechtern Das Ger t wurde auf HF St reinfl sse gepr ft und entspricht den EMV Bedingungen nach EN61326 GARANTIE Techne gew hrleistet dass dieses Ger t f r den auf der Garantiekarte angegebenen Zeitraum keine Herstellungs und Materialm ngel aufweist Dieser Zeitraum tritt ab dem Verkaufsdatum in Kraft Innerhalb dieses Zeitraums werden alle defekten Teile kostenlos ausgetauscht soweit der Defekt nicht auf einen Unfall Missbrauch oder Nachl ssigkeit zur ckzuf hren ist Wartungsarbeiten die unter diese Garantie fallen m ssen von der Verkaufsstelle f r dieses Ger t gehandhabt werden Diese Anleitung wurde zur Information der Kunden von Techne erstellt und stellt in keinster Weise eine Gew hrleistung Bedingung oder Darstellung bez glich der Beschreibung Marktg ngigkeit oder Zweckdienlichkeit dieser Ger te oder Bauteile dar Unabh ngig von Beschreibung und Spezifikation en des hier beschriebenen Ger ts beh lt sich Techne das Recht vor nderungen an diesem Ger t oder dessen Bauteilen vorzunehmen n INFORMAZIONI DI SICUREZZA Leggere attentamente il presente manuale prima di usare il Prime AVVERTENZA Le ALTE TEMPERATURE SONO PERICOLOSE in quanto possono provocare serie ustioni agli operatori e dare fuoco al materiale combustibile Gli utenti devono conoscere seguenti pericoli potenziali PR
50. n cualquiera de sus componentes cuando lo estime oportuno CONTACT INFORMATION UK Bibby Scientific Ltd Beacon Road Stone Staffordshire ST15 OSA UK Tel 44 0 1785 812121 Fax 44 0 1785 810405 E mail sales bibby scientific com www techne com France Bibby Scientific Limited Batiment Le Deltaparc Parc Silic PN2 7 rue du Canal BP 55437 VILLEPINTE 95944 ROISSY Charles de Gaulle France Tel 33 0 148 63 78 03 Fax 33 0 148 63 78 01 E mail ventes bibby scientific com www bibby scientific com Middle East Bibby Scientitic Middle East Ltd PO Box 27887 Engomi 2433 Nicosia Cyprus Tel 357 22 660 423 Fax 357 22 660 424 e mail sales bibby scientificme com For technical sales or servicing information contact your local Techne dealer or North and South America Bibby Scientific US Inc t a Techne Inc 3 Terri Lane Suite 10 Burlington N J 08016 USA Toll Free in NA 800 225 9243 Tel 1 609 589 2560 Fax 1 609 589 2571 E mail labproducts techneusa com www techneusa com Italy Bibby Scientific Italia Srl Via Alcide de Gasperi 56 20070 Riozzo di Cerro al Lambro MI Italia Tel 39 0 2 98230679 Fax 39 0 2 98230211 E mail marketing bibby scientific it www bibby scientific it Asia Bibby Scientific Singapore Prudential Tower Level 26 30 Cecil Street Singapore 049712 Tel 65 6631 2976 Fax 44 0 1785 810405 e mail infoObibby scientific com www bibby scie
51. ntific com PRIME SPECIFICATION TEMPERATURE Block temperature range Block uniformity at 55 C Temperature accuracy at 55 C Gradient availability PPrimeG only Maximum gradient PrimeG only Minimum gradient PrimeG only Column uniformity with a 10 C gradient PrimeG only Pre run sample cooling Temperature set point adjustment HEATING COOLING RATE Maximum heating rate Minimum heating rate Maximum cooling rate Minimum cooling rate HEATED LID Selectable heated lid temperature Lid uniformity Pre heat lid Warm up time from ambient Over temperature cut out Regulated heated lid pressure 4 C to 100 C lt 0 3 C lt 0 25 C Between 30 C and 80 C 29 C 19 C with the 384 well block IPC lt 0 3 C Yes 4 C 0 1 C 3 4 C s 0 1 C s 1 0 C S 0 1 C s 35 to 115 C or off ES E Yes lt 2 min Yes Manually adjustable The heated lid is only operational if the block temperature is set above 35 C PROGRAMMING Program interface Maximum number of programs stored Maximum number of stages per program Maximum number of steps Maximum number of cycles per stage Programmable ramp rate Maximum hold time Minimum hold time Gradient calculator PrimeG only Incremented decremented temperature Incremented decremented time Pause facility Program naming Password protection Keyword selection Run completion time End of program alarm Auto resume on power failure Oligonucleotide
52. ore keywords by touching the buttons to highlight them Touch again to de select e When all keywords have been selected touch Done to return to the Program selection screen Only the programs with the selected keyword s saved with them will be listed e Touch Search By User and this will open the list of user names saved with previously keyword searched files e Select the required user name by touching the appropriate button to highlight it Touch again to de select e When the user name has been selected touch Done to return to the File Manager screen Only the files with both the selected user name and key words saved with them will be listed Programs And postal LE Name ABC Program GAPDH Keywords gradient User Jayne Used Today 3 56 PM Temperature Log from 123456 GAPDH Keywords gradient User Jayne Created Today 3 56 PM Create a new user Clear Keyword Search VIEWING A PROGRAM FILE Touch Programs And Logs to display Only Programs Search for the required program file and touch it to highlight it e Touch View to open the temperature profile Pre run Screen of the program Touch Start to start the program Touch Edit to edit the program e Touch Back to return to the previous screen Note The temperature log will remain blank until the program has been started VIEWING A TEMPERATURE LOG FILE It is not possible to view a temperature log file on the Prime It must fi
53. ow this Increase Per Cycle Decrease Per Cycle Ber 00 00 00 00 00 00 A new screen will open which is similar to the simple time entry screen The maximum decrease in hold time per cycle based on the number of cycles and the time ME Per Cycle limits of the unit will be shown Maximum decrease per cycle is 00 00 08 Hours Minutes e Enter the required value e If an entered decremented time is invalid a prompt will indicate the acceptable range e Touch OK to return to the previous screen The decrease in hold time per cycle will now be displayed Minutes Seconds e Touch OK again to return to the programming 4 A screen l I Per Cycl D Per Cycl e Touch Cancel to return to the programming screen if no changes are required e The time value will now appear orange in the programming screen indicating that it contains a modified function i i i Temperature Ramp Rate Note It is not possible to both increase and decrease ET the time of the same step 95 0 C Maximum Insart a nau ntanna Insaft a nannan INSTRUMENT SETTINGS AND DEFAULTS Touch the Settings button to access the instrument Settings menu e Touch any of the buttons to view and edit the settings User Preferences e Touch More Settings to access further options e Once all the settings and defaults have been set as Instrument Settings required touch Save to save the changes and return to the Home Screen e f you do not wish to
54. quired set to Never Always Never Auto Resume On Power Loss oo Date and Time Settings This determines whether the unit will restart after a power failure Setting Auto Resume to Always will always allow the unit to re start irrespective of the length of the power failure More Settings Date and Time Settings Date Use these settings to set the current date time and date Current date is 15 12 2011 format on the unit When set touch Back to return to the Settings menu Time Set Time Current time is 13 59 Date Format dd mm yy dd mm yy 15 12 11 mm dd yy 12 15 11 More Settings Date e Touch Set Date in order to enter the current date Use the and keys to set the date values e When the correct date has been set touch OK to return to the previous screen e Touch Cancel to return to the previous screen if no changes are required Time Touch Time in order to enter the current time using the 24 hour clock Use the and keys to set the time values e When the correct time has been set touch OK to return to the previous screen e Touch Cancel to return to the previous screen if no changes are required a ie Date Format Touch the date button to set the required date format The options are dd mm yy or mm dd yy e Touch More Settings for further date and time settings or Back to return to the Settings menu Administrator Settings This allows an administrator to r
55. r editing please see section VIEW FILES EDITING TEMPLATES Editing templates can be a quick method of creating a program by just changing a few key parameters However it is not possible to save changes to the templates installed on the thermal cycler If the edited program is a template touching Save will open the message box shown opposite e Touch the None button next to New Program Name and enter a name for the edited program Touch Save As New Program to save the changes The re named program will now be listed in the program list EDITING PASSWORD PROTECTED PROGRAMS If the edited program is password protected touching Save will open the message box shown opposite To save the changes either e Touch the None button next to Password and enter the correct password followed by Save Note this will overwrite the existing program Or e Touch the None button next to New Program Name and enter a new name for the edited program followed by Save as a New Program The re named program will now be listed as a separate program in the program list Test 1 Program Options Amplification 95 0 C 00 00 30 60 0 C 00 00 40 Cancel Pi This Program Is A Template A template is a program which comes installed on the thermal cycler and cannot be changed You can save the changes made to the template Save As New Program This Program Is Locked You can saye any changes made by entering the passwor
56. radient The maximum temperature gradient range which can be set is 29 C and the minimum is 1 C the lowest temperature is 30 C and the hottest temperature is 80 C Examples are given in the table below Lowest temperature Set temperature Highest temperature Gradient C C C C 50 55 60 10 40 5 69 5 29 50 5 65 19 5 29 A gradient calculator is included in the Settings module so the user can obtain an accurate estimation of the temperature of each column during the gradient stage The temperatures for any particular gradient are calculated from an algorithm stored in the block firmware OLIGONUCLEOTIDE T CALCULATOR One of the most important parameters in a PCR is the annealing temperature of the reaction This can be determined theoretically using various software programmes to calculate the melting temperature T_ of the primers The T_ is defined as the temperature at which half the DNA strands are single stranded and half are double stranded when base paired to a complimentary strand Using annealing temperatures that are well below the T_ of the primers can result in mismatching false priming and may lead to primer dimer artefacts Annealing temperatures that are significantly higher than the primer T_ may result in reduced priming or prevent priming altogether The Prime uses the Nearest Neighbour method for calculating the T_ of an oligonucleotide The T_ is calculated using the following equation T AH
57. reated Yesterday 1 44 PM Temperature Log from 123456 2 Step Template Keywords None selected UserNone selected Created Today 9 30 AM Temperature Log from 123461 2 Step Template Keywords None selected UserNone selected Created Today 9 30 AM Temperature Log from 3 Step Template Keywords None selected UserNone selected Created 29 03 2010 ywords 2009 Wheat Lab Create a new keyword With gradient Wheat Lab Program 2 Step Template Keywords None selected User None selected Used Today 9 30 AM Temperature Log from 123456 2 Step Template Keywords None selected User None selected Created Yesterday 1 48 PM Temperature Log from 3 Step Template Keywords None selected User None selected Created 29 03 2010 Program 3 Step Template Keywords None selected User None selected Used Today 9 31 AM Cancel Search the files by user Touch Search By User and this will open the list of user names stored on the unit e Select the required user name by touching the appropriate button to highlight it Touch again to de select e When the user name has been selected touch Done to return to the File Manager screen Only the programs with the selected user name saved with them will be listed e To clear the user name search touch Clear User Search Search the files by keyword and user e Touch Search By Keyword and this will open the list of keywords stored on the unit Select one or m
58. rische Sicherheit zu gew hrleisten muss dieses Ger t geerdet werden Schlie en Sie das Netzkabel entsprechend der folgenden Tabelle an einen geeigneten Stecker an Anschluss 220 240V 50 60Hz 110V 120V 50 60Hz 3 NUR F R GROSSBRITANNIEN der mit dem Netzkabel gelieferte Sicherungsstecker enth lt eine 5 Amp Sicherung zum Schutz des Ger ts und des Anwenders 4 Die Ma einheiten werden veranschlagen um an 100 240V 50 60Hz zu funktionieren 5 Stellen Sie das Ger t auf einen geeigneten ebenen Tisch oder in einem Abzugsschrank auf und sorgen Sie daf r dass die Lufteinlassschlitze auf der Ger teunterseite nicht blockiert sind I 1 1 gt gt _X0W gt lt 5x lild 6 Stecken Sie das Netzkabel in die Buchse auf der Ger ter ckseite ein 7 Schalten Sie das Instrument unter Verwendung des Schalters an der auf der Frontseite der Ma einheit gelegen ist Ersatzkabel Bei einem eventuellen Austausch des Netzkabels wird ein Kabel vom Typ HO5VV F mit 1 mm Adernquerschnitt und Europastecker IEC 320 ben tigt IM ZWEIFELSFALL EINEN ELEKTRO FACHMANN HINZUZIEHEN UMWELTBEDINGUNGEN Der Prime ist f r den Einsatz unter folgenden Bedingungen ausgelegt Gebrauch in Innenr umen Umgebungstemperatur zwischen 5 C to 40 C H he bis zu 2000 m Relative Feuchte nicht ber 80 Netzspannungsschwankungen nicht ber 10 berspannungsklasse 2 IEC 60364 4 443 Verschmutzungsgrad 2 Hinweis Die Ger tespezifikatione
59. rst be copied to a USB memory stick then viewed on a PC using the Techne Workbench software which can be downloaded free of charge from www techne com See the directions given in the next section for copying Tiles to a USB memory stick e Copy the files to a PC and open the Workbench software e Use Settings to select the path for the saved files or click on Open to browse for the saved files e Select the required temperature log and click Open Note Since the temperaturelogdata file is a text file it can also be opened in applications such as Excel for further analysis r Only Program NEN Name Program Alu opt 2 step Keywords Alu opt User Jayne Used 30 03 2010 Program Ice Bucket Keywords None selected UserNone selected Used 19 04 2010 Program pBR Keywords None selected User Jayne Used 13 04 2010 Program RT PCR Template Keywords None selected User None selected Used Yesterday 1 45 PM Initial Preheat Lid Sort By Program ABC Denaturation 105 C 94 C 00 05 00 Program GAPDH End time Today 2 59 PM Search By Search By Program Alu opt 3 step Keywords Alu opt User Jayne Used 30 03 2010 Program Ligation 15 C Keywords None selected User None selected Never used Program pBR fast Keywords None selected User Jayne Used 13 04 2010 Program GAPDH Keywords None selected User Jayne Never used 72 C 00 01 00 95 C 00 00 30
60. s connaissance des consignes et instructions n cessaires la garantie de leur s curit Important cet appareil doit imp rativement tre manipul par un personnel qualifi et tre utilis selon les instructions donn es dans ce document en accord avec les normes et proc dures de s curit g n rales Dans le cas o cet appareil ne serait pas utilis selon les consignes pr cis es par Bibby Scientific Ltd la protection pour l utilisateur ne serait alors plus garantie Tous les appareils Techne sont con us pour r pondre aux normes de s curit internationales et sont dot s d un coupe circuit en cas de surchauffe En cas de probl me de s curit couper l alimentation lectrique au niveau de la prise murale et enlevez la prise connect e l appareil INSTALLATION Porter l appareil deux mains Ne jamais d placer ou transporter l appareil lorsqu il est en fonctionnement o branch l alimentation lectrique 1 Tous les appareils Techne sont livr s avec un c ble d alimentation qui peut tre int gr l appareil ou a raccorder 2 Avant de raccorder l appareil l alimentation lectrique sur secteur v rifier la tension requise indiqu e sur la plaque d identification situ e au dos de l appareil Il est important que l appareil soit reli la terre pour assurer la protection lectrique requise Brancher le c ble secteur sur une prise appropri e voir tableau ci apr s 220 240 V 50 60 Hz 110 120
61. st certifi selon la norme EN61326 GARANTIE L appareil est garanti contre tout d faut de mat riaux ou vice de fabrication pendant la p riode pr cis e sur la carte de garantie jointe Cette p riode s applique a compter de la date d achat Au cours de cette p riode toutes les pi ces d fectueuses seront remplac es gratuitement dans la mesure o la d faillance n est pas due a un accident une mauvaise utilisation ou une n gligence Toute r paration sous garantie sera effectu e par le fournisseur Le pr sent manuel a t exclusivement r dig l attention des clients de la marque Techne et rien dans son contenu ne doit tre pris comme une garantie une condition ou une affirmation concernant la description la commercialisation l ad quation a un usage particulier de l appareil ou de ses composants Malgr la description et les caract ristiques techniques des appareils donn es dans le manuel de l utilisateur la soci t Techne se r serve le droit d apporter les changements n cessaires a l appareil ou a tout l ment qui entre dans sa composition eee SICHERHEITS INFORMATIONEN Lesen Sie diese Anleitung vor Verwendung des Prime bitte sorgf ltig durch ACHTUNG HOHE TEMPERATUREN STELLEN EINE GEFAHRENQUELLE DAR Sie k nnen schwere Brandverletzung verursachen und brennbare Stoffe entz nden Der Benutzer sollt sich mit den m glichen Gefahren vertraut machen UMSICHTIG VORGEHEN UND SCHUTZHANDSCHUHE TRAGEN
62. te the instrument in the vicinity of inflammable liquids or gases e DO NOT place any liquid directly into the instrument OPERATOR SAFETY All operators of Techne equipment must have available the relevant literature needed to ensure their safety It is important that only suitably trained personnel operate this equipment in accordance with the instructions contained in this manual and with general safety standards and procedures If the equipment is used in a manner not specified by Bibby Scientific Ltd the protection provided by the equipment to the operator may be impaired All Techne instruments are designed to conform to international safety requirements and are fitted with an over temperature cut out If a safety problem should be encountered switch off the unit at the mains socket and remove the plug from the electricity supply INSTALLATION The instrument should be carried using both hands Never move or carry the instrument when in use or connected to the mains electricity supply 1 All Techne instruments are supplied with a power cable this may be integral or plug in 2 Before connecting the instrument to the mains electricity supply check the voltage against the rating plate located on the back of the unit Please note that the unit must be earthed to ensure proper electrical safety Connect the mains cable to a suitable plug according to the table below 220 240V 50 60Hz 110V 120V 50 60Hz 3 UK
63. to scale Stages are indicated by a white bar spanning the steps within the stage The bottom of the screen shows the program name the date and the expected end time if it was started immediately ns 94 C 94 C 60 C 72 C 10 C 00 05 00 00 00 30 00 01 00 00 05 00 Final Extension Final Hold e Touch Start to start the program 30 cycles Touch Edit to edit the program Program 2 Step Template e Touch Back to return to the previous screen La Back Today 10 45 AM Note The temperature log will remain blank until the program has been started THE RUN SCREEN The Run Screen will be displayed after a program has been started It shows the instrument status and the progress of a run Once the program has been started the timers in the top right hand corner of the screen will indicate how long the program has been running and the total run time The progress bar at the top of the screen also indicates how far the run has progressed Final Extension Adaptive ramp rate 94 C 94 C 72 C The first time a program is run the unit estimates the iii n rn total run time based on the ramp rates set in the program After the first cycle has completed the actual pisiepaemplate time taken to complete the cycle is then used to Today DM re calculate the total run time Subsequent runs of the same program will therefore have a more accurate estimate of total run time The estimate also takes into account th
64. touching the appropriate button and will be saved for the current program only e Touch Program to return to the programming screen VIEW e Touch View to see a graphical representation of the program e If the program has more stages and steps than are displayed on the screen scroll through the program by dragging a finger across the touch screen The centre of the screen shows each temperature step and hold time not to scale Stages are indicated by a white bar spanning the steps within the stage The bottom of the screen shows the name of the program and the expected end time if it was started immediately Note The program is not saved at this point Touch Start to start the program Touch Edit to edit the program Touch Back to return to the Programming Screen Note The temperature log will remain blank until the program has been started If a step has a gradient programmed into it the bar will be shown thicker and indicate the upper and lower temperatures of the gradient range If a step has an incremented or decremented temperature this will be indicated by a white spot next to the temperature If a step has an incremented or decremented time this will be indicated by a white spot next to the time Preheat Lid Sample Cooling Program Test 1 End time 02 12 2011 14 40 A C o ug nanna 62 5 C 57 5 C 72 C 60 C e 72 C 00 00 40 00 01 00 00 00 40 00 01 00 00 00 40 00 01 00
65. trico no superiores al 10 Categoria de sobrevoltaje Il IEC 60364 4 443 Nivel de contaminaci n 2 Nota Las especificaciones de control corresponden a una temperatura ambiental de 20 C Las especificaciones pueden empeorar si se utiliza el instrumento fuera del intervalo de temperatura comprendido entre 10 C y 30 C Se han realizado pruebas para comprobar la interferencia de radiofrecuencia del instrumento el cual cumple la normativa EN61326 GARANTIA El instrumento est garantizado contra cualquier defecto en el material o la fabricaci n durante el periodo especificado en la tarjeta de garantia que se adjunta Este periodo entra en vigor a partir de la fecha de compra Durante este periodo se reemplazar n sin cargo alguno todas las piezas defectuosas a condici n que el defecto sea resultado de un accidente uso incorrecto o negligencia El distribuidor del instrumento proporcionar informaci n sobre las reparaciones realizadas bajo esta garantia Este manual se ha preparado con una finalidad informativa para los clientes de Techne y ninguna parte del manual se deber considerar como una garant a condici n o reflejo con respecto a la descripci n comerciabilidad idoneidad para un fin determinado o de otro tipo de la unidad o sus componentes Con independencia de la descripci n y las especificaciones del instrumento que se indican en el manual del operario Techne se reserva el derecho de realizar cambios en el instrumento o e

User manual / Technical Information

Contents

Download Pdf Manuals

Related Search

Related Contents