Home

Cell-to-Cell Communication as a Strategy to

1. Do not completely tighten one screw at atime Tighten all evenly by tightening them all small amounts alternately until all are tight DO NOT AUTOCLAVE THE TOP OF THE CHAMBER 10 Do not autoclave the pump 11 Do not disassemble the pump 157 DETAILED SPECIFICATIONS Flow range with 1 16 tubing 0 to 8 1 ml min Accuracy at settings 0 50 Flow 7 Power source AC adapter Chamber dimensions base with lid Outer 10 54 cm 1 x 6 54 cm w x 5 5 cm h length is cm with tubing connectors Inner 8 cm 1 x 4 cm w x 4 cm h Flow duration Up to 24 hours PharMed tubing life in pump 1000 hours Perfusion system storage temperature 100 F to 180 F PARTS Material Source PharMed Small Parts Tubing Inc Silicone Tube Small Parts Inc Part Quantity Name PHT 062A 10 1 10 ft roll Inlet tubing CT 063 25 1 10 ft roll Outlet tubing TP 2408 gt 100 1 4 Peristaltic Small Parts J Tubing Connector Instant Thumb Screws Screws Steel Small Parts Acrylic Sheet Ko Sides of Chamber Stainless Steel Polystyrene ORS 151 1 11 3 4 Sq In of 3 8 546K24 Tubing Connector Material for Cell Plates 330 158 159 CONTACT INFO For general questions about the FloCulture Perfusion System Email rossello umich edu To order additional cell plates or have the chamber repaired Kim Firestone Instrument Maker II The Uni
2. 11 cells or the increased stress experienced by the cells the predominant factor enhancing GJIC remains to be elucidated Differentiation of cells in a 3D constructs provide insights into the actual processes occurring within these scaffolds The data showed enhanced differentiation due to the initial alteration in cell seeding Specifically cells seeded in micromasses exhibited early signs of differentiation expressing high levels of ALP in the 2 day after culture Coupled with the early expression of the late differentiation marker osteocalcin fig 4B the results imply that micromass seeded cells prompts differentiation onset faster than the other methods It 1s also evident that differentiation in filtered seeded cells was greater than in static seeded scaffolds Fig 4A B although different than cells seeded in micromasses One explanation may be that cells in micromasses experience more nutrient and byproduct transport than the supersaturated cells in filtered scaffolds Although both have the benefits of high density transport and cell migration may play a role in differentiation Bone regeneration was also altered significantly as a function of seeding Ossicles regenerated from filtered and micromass seeded cells produced larger volumes of bone compared to static seeded cells fig 5 This result was particularly important when cells were seeded in PLGA scaffolds as bone regenerated from statically seeded cells was chara
3. 4086 Cotrina ML Lin JH Alves Rodrigues A et al Connexins regulate calcium signaling by controlling ATP release Proc Natl Acad Sci U S A 1998 95 26 15735 15740 9 40 41 42 43 44 Yang Y Bumgardner JD Cavin R Carnes DL Ong JL Osteoblast precursor cell attachment on heat treated calcium phosphate coatings J Dent Res 2003 82 6 449 453 Shu R McMullen R Baumann MJ McCabe LR Hydroxyapatite accelerates differentiation and suppresses growth of MC3T3 E1 osteoblasts J Biomed Mater Res A 2003 67 4 1196 1204 Suzuki T Yamamoto T Toriyama M et al Surface instability of calcium phosphate ceramics in tissue culture medium and the effect on adhesion and growth of anchorage dependent animal cells J Biomed Mater Res 1997 34 4 507 517 Lecanda F Warlow PM Sheikh S Furlan F Steinberg TH Civitelli R Connexin43 deficiency causes delayed ossification craniofacial abnormalities and osteoblast dysfunction J Cell Biol 2000 151 4 93 1 944 Stains JP Civitelli R Cell to cell interactions in bone Biochem Biophys Res Commun 2005 328 3 721 727 92 Chapter 4 Connexin 43 as a signaling platform for increasing the volume and spatial distribution of regenerated tissue 4 1 Introduction Cell to cell communication via intracellular chemical and mechanical signals 1s critical to maintain tissue homeostasis Gap junction intercellular communication GJIC is the most direct
4. Regeneration of bone has been more challenging since the thick nature of the tissue inhibits necessary transport of nutrients and cues for bone formation through out the 3D construct 36 Laurencin C 2006 Our group has shown that overexpressing the gap junction protein Cx43 in bone marrow stromal cells increases intercellular communication and differentiation in 3D cultures over cells expressing normal levels of Cx43 In addition we have shown that the effects of a known bone osteoinductive agent BMP7 are augmented when Cx43 is overexpressed We have also shown that Cx43 overexpression leads to greater distribution and more bone regeneration in an ectopic model Chapter 4 Our current study investigates the effects of GJIC in a more clinically relevant model by examinating the healing of a critical sized defect in the calvaria of nude mice Materials and Methods 196 Bone marrow stromal cell BMSCs isolation and culture Five week old C57BL 6 mice were used to isolate bone marrow cells from the femoral tibial and humeral cavities six bones per animal as previously described Briefly the bone marrow was mixed with minimum essential medium a MEM Gibco Laboratories Grand Island NY containing 10 fetal bovine serum FBS Gibco and antibiotics 100 ug ml penicillin G and 100 IU ml streptomycin at 37 C in 5 CO2 95 air Cells were pelleted by centrifugation at 1000 rpm for 5 min at 4 C resuspended in 10 ml
5. A14 Repair of craniotomy defects with genetically modified cells eee 191 A15 Transduction of BMSCs with LV Cx43 GFP 00 ccccccccceeeeeeeeeeeeeeeeeeeeeeeeeeeeees 193 Fatal cea Ad GC so Cd ol coe ua 0 ercmeerrererc or tem rere ever cn rarer eerie ttm ent enter raer an nt err e ye mn mrty 195 A17 Calvarial Defect Model Enhanced GJIC regenerates more bone in a critical STZ LS sacs tee essence eta EATE tesa AAEE E EAT 196 X1V Chapter 1 Introduction 1 1 Problem Statement and Thesis Aim Skeletal defects present a major clinical challenge with over 5 5 million fractures and 1 million bone grafting procedures done each year Present clinical skeletal defect therapies such as allogenic bone transplantation and non bioactive material implantation have limitations This reality points to the need of novel cell based strategies that can be tested in 3D in vitro models and validated in vivo Employing strategies that increase the rate of bone formation and enhance distribution of osteogenesis may help overcome these limitations Factors that may enhance bone formation include enhanced nutrient flux stress cell cell adhesion cell 10 22 cell communication growth factors and cell motility Designing initial seeding strategies that can exploit these factors may enable higher cell differentiation and bone Es 7 formation Alternatively cells can be altered endogenously to express higher levels of a
6. Minimize the amount of time transferring the perfusion system from the sterile hood to the incubator to reduce contamination D HOW TO SET UP SYSTEM l ae When the cultured cells are ready sterilize all components of the system except the cell plate Detailed How To s Experimentation Preparation C p 8 Place all components under the sterile hood immediately after being sterilized 146 Feed the PharMed tubing through the pump Detailed How To s Experimentation Procedure G p 13 Connect the PharMed tubing to the inlet of the chamber by sliding the tubing over the metal inlet port so that the direction of flow 1s from the pump into the inlet Note The inlet is the side of the chamber that is farthest from the notch Connect the silicone tubing to the outlet of the chamber by sliding the tubing over the metal outlet port Connect the free ends of the PharMed and silicone tubing to each other by sliding them each halfway over the metal tubing connector until they touch For all tubing connections plastic pull ties can be used to secure the tubing on the connectors for a tighter seal if desired or if leakage occurs Figure 3 ASSEMBLY DIAGRAM Step 3 Connect tubing to pump Step 6 Slide both types of tubing over tubing connector Step 4 Connect tubing Step 5 Connect tubing to to inlet port outlet port 147 E HOW TO INSERT CELL PLATE INTO CHAMBER l The assembled perfusion system
7. suspension solution into a sink approved for biological disposal Culture room Then the system can be taken apart and sterilized with appropriate sterilization protocols pending on what materials used autoclave or ethanol are cleansing 173 Preliminary filtration data Adhered Cell Count Ricardo Rossello Filtration seeding had a significantly higher percentage of cells adhered than the dynamic or static seeding figure 4 Filtration seems to have reached carrying capacity at the 6 hour period 92 32 6 12 while the other two methods show a steady increase in attached cells Mineralized scaffolds showed no significant difference to the PLGA only scaffolds However as time increased the p values decreased For the filtered seeded scaffolds the p values decreased from p 0 781 in the first hour to p 0 13 2 in the 24 hour Figure 4 The number of cells was accounted for after each time period and for each method The scaffolds where washed to remove the free cells trapped in the construct The remaining cells were trypzinied and accounted for There is a significant difference p lt 0 001 at all time points between seeding techniques There is also a significant difference between the Ihour and 6hour mark in the filtration process p 0 034 Another interesting result to note is that there is 174 a much smaller variation is observed at all points in the filtration process than in the highly variable static seeding Flo
8. 1 5 1 6 EEEE cet EEIE E EE T cet danseeeaae ties dnadwe cele aecetaaer OE 4 AP DUC ONS serrated toes sea E ecenacteene ee eons ees 5 Ouithime Gr Tiesi COnteit cits cient ard sae th bs snes treet eat atone ail aehea tes cata unds 7 RELCL CN CCS2 1 asssassuadeonissssianaaurssonssavaembundsonisassianieatitoadeaayavardovuaaiymenaoasdetes 10 Chapter 2 Establishing Micro CT Thresholds for Tissue Engineered Bone and Comparison of Bone Regenerated from Bone Marrow Stromal Cells and BMP 7 PAN duced Colls srys cis sunaaiosraseaecne sus erns in A 21 2A TINE OCU CHION a sessscerasitecatacGnn Geaiednatieauistasara a weaned 21 22 Manak and Method Srecni snip EE E edeese 24 2A Bone marrow stromal cell isolation and culture cceeeecceeeeeeeeeeeeeeees 24 DAG Generation of recombinant adenovirus and cell transduction 25 2 2 3 Gelatin sponge preparation a Eaa 26 2 2 4 Preparation of bioceramic Mineralized PLGA scaffold 26 D2 Transplantation MO DOST MICS iieri a A NT 26 2 2 6 Micro CT image acquisition and analysis cccccccccccssssssssssseeeeeeeeeeeeees 27 22d Minera ashing seori n EE aoe ed Sa 28 2 2 8 BTS COMO Yee a EE ATE EE EEEE TEA AE 28 229 ADNa yS iS OF DONE INS rW eara E E N 30 ZANO STAUSUCA ATA Y SOS esata aia tities et cct nas a aa 30 23 RESUS eene a A 31 2341 EE SIO E a E E E T E E EE S 31 232 Comparison of bone regenerated with different cell types 008 33 Die DISCUS SIO eese RNR 35
9. Amiel C Bailly C Friedlander G Multiple hormonal control of the thick ascending limb functions Adv Nephrol Necker Hosp 1987 16 125 136 Krebsbach PH Kuznetsov SA Bianco P Robey PG Bone marrow stromal cells Characterization and clinical application Crit Rev Oral Biol Med 1999 10 2 165 181 Pettway GJ Schneider A Koh AJ et al Anabolic actions of PTH 1 34 Use of a novel tissue engineering model to investigate temporal effects on bone Bone 2005 36 6 959 970 Jepsen KJ Goldstein SA Kuhn JL Schaffler MB Bonadio J Type I collagen mutation compromises the post yield behavior of Mov13 long bone J Orthop Res 1996 14 3 493 499 53 10 11 12 13 14 Wallace JM Rajachar RM Chen XD et al The mechanical phenotype of biglycan deficient mice is bone and gender specific Bone 2006 39 1 106 116 Barck KH Lee WP Diehl LJ et al Quantification of cortical bone loss and repair for therapeutic evaluation in collagen induced arthritis by micro computed tomography and automated image analysis Arthritis Rheum 2004 50 10 3377 3386 Ritman EL Molecular imaging in small animals roles for micro CT J Cell Biochem Suppl 2002 39 116 124 Fuerst G Tangl S Gruber R Gahleitner A Sanroman F Watzek G Bone formation following sinus grafting with autogenous bone derived cells and bovine bone mineral in minipigs Preliminary findings Clin Oral Implants Res 2004 15 6 733 Pey
10. Bars indicate groups that are not significantly different 82 Dye transfer as a function of cell seeding and material O Micromass 60 E Filtered Sj E Static amp m S Micromass AGA amp 5 Filtered AGA g a 30 m Static AGA a 20 am 0 M C SZ PLGA Mineralized Template Figure 3 3 Seeding alters gap junction intercellular communication Cells seeded in PLGA scaffolds by micromass transferred calcenin at a higher fraction 63 2 10 6 than both filtered 46 2 5 4 and static seeded cells 23 6 6 9 Although there was no significant differences in transfer between cells in mineralized and PLGA scaffolds for all seeding strategies micromass and filtered seeded cells exhibit no significant difference in transfer when seeded in a mineralized scaffold p 9 2 Cells treated with AGA show significantly less transfer than those that were not as well as showing no difference between seeding conditions exposed to the gap junction uncoupler This indicates a gap junction dependent transfer of calcenin Horizontal bars indicate groups that are not significantly different 83 ALP as a function of seeding and time PLGA OCN expression as a function of seeding and time PLGA A B OMicroMass oO MicroMass E Filtered g o Filtered pat E Static E Static 3 pe 18 e o Za 2s S 6 ou 12 z FE 22 10 fa 4 ES 8 S za r 5 6 BB 2 go 4 vT p agl g 2 a 0 z 0 i Day 2 Day 8 Day 16 z Day
11. Because of this there has been an extensive effort to rigorously compare bone morphometric measures from uCT aL 19 36 38 images with histological sections for trabecular bone measurements Three major thresholding approaches have been used to facilitate these comparisons Algorithm based auto thresholds have been extensively used to delineate bone from the other tissues These methods are statistical in nature do not segment based on 35 features within the image and rely on the assumption that the histogram of all grayscale values within the image has a bimodal distribution This assumption may not be valid when dealing with small newly formed bone ossicles Figure 1 making this approach variable and potentially inaccurate In fact when this approach was applied it resulted in threshold values which were at least 25 greater than the optimal thresholds those with high R values when compared with reference data leading to an underestimate in BVF if these autothresholds are used reiterating its inadequacy for tissue engineered ossicles Table 1 The second thresholding approach and perhaps the most extensively validated for trabecular bone have required the use of local and or adaptive thresholding techniques However these algorithms can be difficult to implement and as a result one of the most common thresholding techniques uses a simple global threshold For tissue engineered constructs standardized global
12. Filtration Device Centrifuge II Procedures 163 1 Trypsinize cells use 7ripsinizing Celsl protocol a Check flask after initial trypsinization and retrieval of cells to observe the quantity of non trypsinized cells b Ifsignificant repeat trip protocol c Trypsinize several times in order to retrieve an optimal amount of cells 2 Prepare A Pellet from Cell Suspension Note This is done several times to retrieve fats when culturing cells a Place the Cell suspension 15 ml falcon tubes and centrifuge 1 Centrifuge at about 1000 RPM fro about 3 mins b Retreive the supernatant and decant c Re suspend with media again d Centrifuge again mostly for when passaging otherwise centrifuging once is enough 3 Cover the Hemacytometer with Slide see fig 1 4 Prepare a Cell suspension of known volume a Re suspend the pellet in a known volume e g 1ml of solution Let sit for 3mins 1 Usually you want to count such that you have about 100 cells in each of the compartments fig 2 Thus determine the volume based on the expected number of cells you think you will have e g if you think you will have 7million cells then use about 7ml volume Note that for a number significantly more than 100 you should re suspend accordingly because the measurement is less accurate b Take 10uL of the suspension and pipette it gently into one of the sides fig 1 of the Hemacytometer and 10 more for the other slide 5 Count
13. Int 2002 26 4 313 317 Jorgensen NR Teilmann SC Henriksen Z Civitelli R Sorensen OH Steinberg TH Activation of L type calcium channels is required for gap junction mediated intercellular calcium signaling in osteoblastic cells J Biol Chem 2003 278 6 4082 4086 Cotrina ML Lin JH Alves Rodrigues A et al Connexins regulate calcium signaling by controlling ATP release Proc Natl Acad Sci U S A 1998 95 26 15735 15740 Jongsma HJ Wilders R Gap junctions in cardiovascular disease Circ Res 2000 86 12 1193 1197 Flenniken AM Osborne LR Anderson N et al A Gjal missense mutation in a mouse model of oculodentodigital dysplasia Development 2005 132 19 4375 4386 Kizana E Ginn SL Smyth CM et al Fibroblasts modulate cardiomyocyte excitability Implications for cardiac gene therapy Gene Ther 2006 13 22 1611 1615 Boengler K Heusch G Schulz R Connexin 43 and ischemic preconditioning Effects of age and disease Exp Gerontol 2006 41 5 485 488 119 10 l1 12 13 14 Paznekas WA Boyadjiev SA Shapiro RE et al Connexin 43 GJA1 mutations cause the pleiotropic phenotype of oculodentodigital dysplasia Am J Hum Genet 2003 72 2 408 418 King TJ Bertram JS Connexins as targets for cancer chemoprevention and chemotherapy Biochim Biophys Acta 2005 1719 1 2 146 160 Zhu D Caveney S Kidder GM Naus CC Transfection of C6 glioma cells with connexin 43 cDNA Analy
14. and mineralized B scaffolds at different time points following seeding via different techniques ccccccseeeeeeeeeeeeeees 8l Figure 3 2 Cell count and distribution varies in seeded scaffolds 6 hours after Bt EE E E E A 82 Figure 3 3 Seeding alters gap junction intercellular communication eeee 83 Figure 3 4 Expression of differentiation markers is increased with alternative seeding LEChniques and a Mineralized templile senese e 84 Figure 3 5 Volume fractions and patterns of osteogenesis vary as a function of scaffold S rfa eand secdine techniques eonia nien e O EE OET 85 Figure 3 6 Topographic analysis of mineral distribution within bone ossicles 86 CHAPTER 4 Figure 4 1 BMSCs are highly transduced with Cx43 GFP cc cecceececeeeeeeeeeeeeeees 113 Figure 4 2 GJIC in BMSCs as measured by Calcenin AM transfer is enhanced with Figure 4 3 Cx43 overexpression is associated with higher levels of OCN mRNA Expression AU aies resinae a a aa ade ae nea 115 Figure 4 4 Micro CT renderings and histological sections of ossicles regenerated following subcutaneous transplantation Of BMSCS cc ceesssssssseseeeeeeeceeeeeeeeeeeaaaaaas 116 Figure 4 5 Cortical like thickness and trabecular like bone volume fraction of tissue enome CLEC DOING ensar AA 118 Xi List of Tables Table 1 Comparison between optimal thresholds determined from regressions against ash fraction and auto thresholds determined us
15. dynamic figure 2B and micromass seeding figure 2D Micromass seeding exhibited significantly higher cell counts than static seeding after 6 hours in both mineralized and non mineralized templates p gt 0 001 Histology showed that micromass seeded scaffolds exhibited highly dense centralized localization of cells Quantitatively figure 2E 6 fold increase in the number of cells attached in filtration over static seeding and validated dynamic seeding and micro mass seeding as suitable seeding techniques that show significantly greater cell adhesion than static seeding p lt 0 001 for both over static seeding The standard deviation in cell cluster number is significantly less in filtered seeding than the other methods 138 7 10 2 cells counts Micro mass seeding had the highest deviation 68 0 23 4 cells counts 3 3 2 Micromass seeded cultures enhance gap junction dependent cell cell communication A significant increase in calcenin AM transfer between donor and recipient cells in the micromass seeded cells after 5 hours figure 3 over filtered and static seeded cells p 0 034 p lt 0 001 respectively The presence of a mineralized scaffold had no effect 72 in calcenin transfer However in mineralized scaffolds transfer in filtered seeded cells and micromass seeded cells is only moderately significant p 0 92 Furthermore cells containing the gap junction inhibitor AGA showed little transfer compared to both experimental
16. figs 4C F Cells seeded in 73 mineralized templates by all seeding conditions expressed significantly larger amounts of ALP than cells seeded in PLGA scaffolds fig 4 C D p 0 021 Increasing the concentration of soluble calcium to cells seeded in PLGA exhibited a significant increase when compared to cells seeded in PLGA Filtered and static seeded scaffolds exhibited significant increases in expression p 0 032 p 0 042 while only moderately significant in micromass seeded cells p 0 099 Mineralized scaffolds enhance bone formation H amp E slides showed normal bone containing marrow that included fat entrapped cells and hematopoietic cells for all groups seeded in mineralized scaffolds figure 5 A E Static seeded scaffolds exhibit small bone formation with but no marrow In general when a mineralized template is use cells regenerate more bone Figures 5A G Bone formation is observed in the periphery of ossicles produced by filtered seeded cells with increasing shell thickness in the mineralized scaffolds figure 5 B E Bone generated by micromass seeded scaffolds showed bone growth in the core of the ossicles Figure 5A D and entrapped cells morphology indicative of bone tissue Statically seeded produced marginal bone formation in PLGA scaffolds and was clearly aided by the presence of a mineral layer in the scaffold figure 5 C F E Micromass and filtration seeding led to a higher BVF than static seeding figure 5G There wa
17. tomography J Bone Miner Res 1989 4 1 3 11 Muller R Van Campenhout H Van Damme B et al Morphometric analysis of human bone biopsies A quantitative structural comparison of histological sections and micro computed tomography Bone 1998 23 1 59 66 Cartmell S Huynh K Lin A Nagaraja S Guldberg R Quantitative microcomputed tomography analysis of mineralization within three dimensional scaffolds in vitro J Biomed Mater Res A 2004 69 1 97 104 Jones AC Milthorpe B Averdunk H et al Analysis of 3D bone ingrowth into polymer scaffolds via micro computed tomography imaging Biomaterials 2004 25 20 4947 4954 55 22 2 24 25 26 21 28 Gauthier O Muller R von Stechow D et al In vivo bone regeneration with injectable calcium phosphate biomaterial A three dimensional micro computed tomographic biomechanical and SEM study Biomaterials 2005 26 27 5444 5453 Schneider A Taboas JM McCauley LK Krebsbach PH Skeletal homeostasis in tissue engineered bone J Orthop Res 2003 21 5 859 864 Otsu N A threshold selection method from gray level histograms IEEE Trans Sys Man Cyber 1997 9 62 63 66 Kuhn JL Goldstein SA Feldkamp LA Goulet RW Jesion G Evaluation of a microcomputed tomography system to study trabecular bone structure J Orthop Res 1990 8 6 833 842 Waarsing JH Day JS Weinans H An improved segmentation method for in vivo microCT imaging J Bone Min
18. u 35 ES S o i Si 25 J z 2 4 1 Pe a 5 a en z a j l Pod F J a E i Ai l EET C Ta F A i Sey i 8 i A z 5 6 E _ ie p po mi tt i at Bitit wit BP T C4 BVPT Cx EMSC Cedi BMP Cwi3 BMPP Cet dy Figure 4 3 Cx43 overexpression is associated with higher levels of OCN mRNA expression at all times Overexpression of Cx43 had significant effects on OCN expression when comparing a 2D monolayer to a 3D cell culture b The normalized values of OCN mRNA where significantly higher in two dimensions for cells that did not overexpress Cx43 while cells that overexpressed Cx43 exhibited no significant difference between 2D and 3D cultures This result suggests that 2D cell culture models may not translate to 3D culture and that Cx43 overexpression may be a tool to mediate those differences Surface vs core studies c support this conclusion suggesting that cell to cell communication in the core regions can be enhanced Cx43 overexpression produces evenly distributed differentiation throughout the 3D culture providing a tool to regenerate larger and uniformly distributed tissue equivalents Significant increases are indicated by Cx43A7 BMSC Cx43 BMP7 Horizontal bars indicate pairs that are significantly different 115 BMSC BMP7 BMSC Cx43 BMP E BMSC LVGFP E BMSC ADCMVMT BMSC LVGFP ADCMVMT SYA p BMSC m m Cx43 isi O BNP n 5 50 S Cx43 BMP7 nae a
19. well as a more dense distribution of mineral 47 A 4 Week B amp Week 380 S 35 4 4 p ii R lt 0 9100 A E ag oi H 5 _ R 0 9534 7 gt T 2 eei kd 4 4 amp D amA re E E aa paj ot lt E acd et So E 4 a ai 34 H 0 ag T 5 J 7 j 0 H a 5 14 eee A E EE 1 4 f F r r 7 i y 4 gig om azr O24 gr O28 GE o3 0 di i oe OM j s 20 Mineral Content 20 Mineral Comtent C 12 Week D Pooled Data s J 4 Oo G ai r o a p 5 yo 4 H E G ad G f 2 4 D28 0 28 a0 0 H w om aag Daz 20 Mineral Comil 20 kinira Comont E Bone HU 4 weak E waak 12 wk Pooled T 600 14 50 0 63273 0 6932 0 7133 0 7102 T 700 17003 0 7283 0 7233 bos 0 7201 T 800 13 403 Ure 0 7354 07332 Ufa 1T 900 21 80 07i 0 8502 MELE ii Oo Titi 34 20 oat O 9218 o 91k4 i T 1100 26 70 0 8971 0 95 34 0 8313 0 3109 4 Tsim 29 10 0 9019 0 9254 06313 0 6334 E T 1300 31 50 0 3792 0 8517 0872 0e T 1400 33 90 0 8593 05933 08335 0 663 o T 1500 36 40 USS Lesa We DEAR T 1600 33 00 0 7559 O21 0 7662 0 7943 T 1700 41 20 0742 0 7713 0 7623 0 7593 T 1800 43 50 0 746 0782 07873 0 7293 T 1900 46 00 0 7219 0 693 a BE Far IFEF T 2000 45 50 0 7479 0 pad 7345 0 7343 Figure 2 5 Correlation between area fraction of regenerated bone determined by micro CT and area fraction of mineral determined by von Kossa stainin
20. 0 9188 0 9429 0 8992 0 9119 A T 1200 29 10 0 8793 0 9109 0 8821 0 8936 e T 1300 31 50 0 8343 0 8277 0 9242 0 8797 T 1400 33 90 0 8022 0 8442 0 8702 0 8321 o T 1500 36 40 0 8091 0 7811 0 8422 0 8102 T 1600 38 60 0 7829 0 7936 0 8104 0 7921 T 1700 41 20 0 8023 0 7382 0 7924 0 7812 T 1800 43 60 0 7392 0 7425 0 6992 0 7429 T 1900 46 00 0 7294 0 7032 0 7994 0 7693 T 2000 48 50 0 7499 0 6332 0 7921 0 7822 Figure 2 2 Correlation between volume fraction of regenerated bone determined by micro CT and ash fraction at different thresholds The optimal regression is depicted by the line on each plot A 4 weeks B 8 weeks C 12 weeks D pooled times The correlation coefficients and of bone HU for all thresholds are also shown E The 1000 1300 range of thresholds yielded a correlation coefficient R2 gt 0 87 for all time points and level of significance p lt 0 049 Significance p lt 0 05 is denoted by 45 A 4 Week B 8 Week 0 40 404 8 5 3 1 S 40 4 5 n 2 rs R 0 9028 29 4 20 5 x o O 104 10 4 m o o o 5 an ot ot re an at 0 18 0 19 an 0 18 020 022 024 025 028 0 30 0 32 2D Bone Fraction 20 Bone Fraction C 12 Week D Pooled Data 0 60 50 50 w o 2 4 v 40 o R 0 9781 z D4 30 4 E 4 20 a 2 U u oO 104 10 a hal o o4 e 9 0 15 0 20 025 0 30 0 35 0 40 0 40 2D Bone Fraction 20 Bone
21. 1238 1248 Nair LS Bhattacharyya S Laurencin CT Development of novel tissue engineering scaffolds via electrospinning Expert Opin Biol Ther 2004 4 5 659 668 Katz RW Hollinger JO Reddi AH The functional equivalence of demineralized bone and tooth matrices in ectopic bone induction J Biomed Mater Res 1993 27 2 239 245 15 45 46 47 48 49 50 Sli DZ Ducheyne P Qiu Q Bioactive ceramics The effect of surface reactivity on bone formation and bone cell function Biomaterials 1999 20 23 24 2287 2303 Jorgensen NR Henriksen Z Brot C et al Human osteoblastic cells propagate intercellular calcium signals by two different mechanisms J Bone Miner Res 2000 15 6 1024 1032 Triggle DJ L type calcium channels Curr Pharm Des 2006 12 4 443 457 Berridge MJ Lipp P Bootman MD The versatility and universality of calcium signalling Nat Rev Mol Cell Biol 2000 1 1 11 21 Rottingen J Iversen JG Ruled by waves intracellular and intercellular calcium signalling Acta Physiol Scand 2000 169 3 203 219 Willecke K Eiberger J Degen J et al Structural and functional diversity of connexin genes in the mouse and human genome Biol Chem 2002 383 5 725 737 Pettway GJ Schneider A Koh AJ et al Anabolic actions of PTH 1 34 Use of a novel tissue engineering model to investigate temporal effects on bone Bone 2005 36 6 959 970 Civitelli R Ziambaras K Warlow PM
22. 1476 Rottingen J Iversen JG Ruled by waves intracellular and intercellular calcium signalling Acta Physiol Scand 2000 169 3 203 219 Cartmell SH Porter BD Garcia AJ Guldberg RE Effects of medium perfusion rate on cell seeded three dimensional bone constructs in vitro Tissue Eng 2003 9 6 1197 1203 89 25 26 Dele 28 29 30 31 Zhao F Ma T Perfusion bioreactor system for human mesenchymal stem cell tissue engineering Dynamic cell seeding and construct development Biotechnol Bioeng 2005 91 4 482 493 Burg KJ Holder WD Jr Culberson CR et al Comparative study of seeding methods for three dimensional polymeric scaffolds J Biomed Mater Res 2000 51 4 642 649 Goldstein AS Effect of seeding osteoprogenitor cells as dense clusters on cell growth and differentiation Tissue Eng 2001 7 6 817 827 Leonova EV Pennington KE Krebsbach PH Kohn DH Substrate mineralization stimulates focal adhesion contact redistribution and cell motility of bone marrow stromal cells J Biomed Mater Res A 2006 79 2 263 270 Murphy WL Kohn DH Mooney DJ Growth of continuous bonelike mineral within porous poly lactide co glycolide scaffolds in vitro J Biomed Mater Res 2000 50 1 50 58 Liao CJ Chen CF Chen JH Chiang SF Lin YJ Chang KY Fabrication of porous biodegradable polymer scaffolds using a solvent merging particulate leaching method J Biomed Mater Res 2002 59 4 676 6
23. 2 Day 8 Day 16 ALP as a function of template conditions OCN as a function of template conditions C and seeding day 8 D and seeding Day 16 red b O nu ANONO rmalized to day 2 filtered ALP expression rmalized to day 2 filte ALP expression no OCN expression no OCN MicroMass Filtered Static Figure 3 4 Expression of differentiation markers is increased with alternative seeding techniques and a mineralized template Alkaline phosphatase A and Osteocalcin B expression increased significantly in cells seeded by micromass over filtration ALP p day2 lt 0 001 p day 8 lt 0 001 OCN p day 8 lt 0 001 p day 16 0 0211 and static seeding ALP p day2 day 8 lt 0 001 OCN p day 8 day 16 lt 0 001 Cells seeded in a mineralized template and calcium rich environment also expressed higher levels of ALP C and OCN D over cells seeded in PLGA Cells seeded in mineralized templates expressed significantly more ALP and OCN in all seeding techniques over cells seeded in PLGA only ALP p day2 0 031 p day 8 lt 0 001 p day 16 lt 0 001 p day2 lt 0 001 OCN p day 8 0 033 p day 16 lt 0 001 Although cells seeded with increased extracellular calcium did not exhibit a significant difference in ALP relative to those seeded in PLGA it did exhibit significant differences in expression in OCN expression for filtered and static seeded cells p 0 032 p 0 042 respectively 84 Bone Volume Fraction 8
24. 49358 52040 5 43 3 i I 150000 2 f i z 100000 J Threshold ns 50000 0 2000 4000 Grayscale Yalue B 150000 T S F 100000 a hon Lu gogl 0 2000 4000 Grayscale Yalue Figure 2 1 Autothresholding mechanisms use a bimodal to find a threshold value by finding the midpoint of the intermodal zone When mature bone a is analyzed using these autothresholding mechanisms the typical separation the intensity peaks is even and easy to discriminate and a threshold can then be easily selected However when the frequency of mineral is low and tissue is still forming b such as in immature ossicles the skewed unimodal distribution in the histogram violates an underlying assumption of the autothresholding algorithm making this approach difficult to employ Furthermore the lack of a bone peak makes it difficult to discriminate between new bone and marrow fibrous tissue fat and other soft tissue within the implant 44 A 4 Week B B Week Ash Fraction Ash Fraction C 12 Week D Pooled Data BWF BWF Ash Fraction Ash Fraction E Bone HU 4 week 8 week 12 week Pooled T 600 14 50 0 6193 0 592 0 5678 0 5692 T 700 17 00 0 7291 0 6932 0 6738 0 7192 T 800 19 40 7304 0 7829 0 7568 0 7582 e T 900 21 80 0 8001 0 7838 0 7824 0 6622 O T 1000 24 20 0 9825 0 8953 0 6842 0 9431 Y T 1100 26 70
25. 5 10 Dull T Zufferey R Kelly M et al A third generation lentivirus vector with a conditional packaging system J Virol 1998 72 11 8463 8471 Leonova EV Pennington KE Krebsbach PH Kohn DH Substrate mineralization stimulates focal adhesion contact redistribution and cell motility of bone marrow stromal cells J Biomed Mater Res A 2006 79 2 263 270 124 43 44 45 46 47 48 49 50 5l Feldkamp LA Goldstein SA Parfitt AM Jesion G Kleerekoper M The direct examination of three dimensional bone architecture in vitro by computed tomography J Bone Miner Res 1989 4 1 3 11 Wallace JM Rajachar RM Chen XD et al The mechanical phenotype of biglycan deficient mice is bone and gender specific Bone 2006 39 1 106 116 Lecanda F Warlow PM Sheikh S Furlan F Steinberg TH Civitelli R Connexin43 deficiency causes delayed ossification craniofacial abnormalities and osteoblast dysfunction J Cell Biol 2000 151 4 93 1 944 Lecanda F Towler DA Ziambaras K et al Gap junctional communication modulates gene expression in osteoblastic cells Mol Biol Cell 1998 9 8 2249 2258 Stains JP Civitelli R Gap junctions in skeletal development and function Biochim Biophys Acta 2005 1719 1 2 69 81 Stains JP Civitelli R Cell to cell interactions in bone Biochem Biophys Res Commun 2005 328 3 721 727 Amiel C Bailly C Friedlander G Multiple hormonal control of th
26. 80 kVp and 80uA respectively To reduce the potential for beam hardening artifact the x rays were passed through a 0 2mm Al filter immediately upon exiting the source and the specimens were immersed in dH2O during the scanning process Projection images were acquired over 198 degrees using 2x2 binning and an exposure time of 1100 ms and four frames were averaged for each projection to improve the signal to noise ratio The projection data was then corrected and reconstructed using the Feldkamp cone beam algorithm to create three dimensional images with an isotropic voxel size of 18um The scanner was calibrated once daily using a phantom that contained air water and hydroxyapatite Bone volume fractions were determined by using a MatLab program designed to integrate all grayscale voxels above a particular threshold To determine the overall volume of the ossicles the program determined the perimeter of each 2D uCT slice by tracing the outer edge The program then integrated all the perimeters to determine the 3D surface area and the number of voxels inside the surface defined the total volume High density voxels outside of the 3D surface and unattached to the ossicle were discarded while voxels inside were evaluated at the specified thresholds to determine the BVF which was calculated as the number of voxels above the threshold relative to the total number of voxels A threshold of 1100 was used to quantify the BVF Rendered images of the wh
27. David H Kohn Kyungsup Shin Sun I g Hong et al Self assembled mineral scaffolds as model systems for biomineralization and tissue engineering Proc Sth Int Conf Chem amp Biol Min Tissues 2005 Yaszemski MJ Payne RG Hayes WC Langer R Mikos AG Evolution of bone transplantation Molecular cellular and tissue strategies to engineer human bone Biomaterials 1996 17 2 175 185 Burchardt H Glowczewskie F Miller G Freeze dried segmental fibular allografts in azathioprine treated dogs Clin Orthop Relat Res 1987 218 218 259 267 87 10 l1 12 13 14 15 16 Beaman FD Bancroft LW Peterson JJ Kransdorf MJ Bone graft materials and synthetic substitutes Radiol Clin North Am 2006 44 3 451 461 Oklund SA Prolo DJ Gutierrez RV King SE Quantitative comparisons of healing in cranial fresh autografts frozen autografts and processed autografts and allografts in canine skull defects Clin Orthop Relat Res 1986 205 205 269 291 Shaffer JW Field GA Goldberg VM Davy DT Fate of vascularized and nonvascularized autografts Clin Orthop Relat Res 1985 197 197 32 43 Yoshikawa H Myoui A Bone tissue engineering with porous hydroxyapatite ceramics J Artif Organs 2005 8 3 131 136 Takagi K Urist MR The role of bone marrow in bone morphogenetic protein induced repair of femoral massive diaphyseal defects Clin Orthop Relat Res 1982 171 171 224 231 Hollinger JO
28. Fraction E Bone HU 4 week 8 week 12 week Pooled T 600 14 50 0 5853 0 6012 0 5922 0 5833 T 700 17 00 0 6012 0 6392 0 6438 0 6223 T 800 19 40 0 6593 0 6432 0 6529 0 6498 T 0 21 80 0 7302 0 7535 0 7322 0 7328 O T 1000 24 20 0 8818 0 8932 0 8821 0 8923 y 1 1100 26 70 0 9001 0 8992 0 9431 0 9085 T 1200 29 10 0 9034 0 9028 0 9781 0 9322 e T 1300 31 50 0 8709 0 8822 0 8928 0 8875 T 1400 33 90 0 8122 0 8247 0 8545 0 8232 o T 1500 36 40 0 7828 0 8114 0 8531 0 8343 T 1600 38 80 0 7539 0 7832 0 7642 0 7576 T 1700 41 20 0 7769 0 7693 0 7942 0 7882 T 1800 43 60 0 7829 0 7001 0 6924 0 7459 T 1900 46 00 0 6938 0 7032 0 6692 0 6912 T 200 48 50 0 6922 0 7389 0 7676 0 7298 Figure 2 3 Correlation between area fraction of regenerated bone determined by micro CT and area fraction determined on same section by H amp E staining Regressions were performed for the A 4 week B 8 week C 12 week and D pooled time groups The correlation coefficients and of bone HU for all thresholds are also shown E The optimal threshold at each time is 1200 with R gt 0 9 Significance p lt 0 05 is denoted by 46 Figure 2 4 Comparison of von Kossa images that have been stitched together left and the analogous uCT planes right at a 4 weeks b 8 weeks and c 12 weeks for sections of ossicles regenerated from BMSCs The slides demonstrated that there is increasing mineralization as a function of time as
29. GJIC Many of these messengers are a function of the local external environment in which the cells are present For tissue engineering purposes this is an important component as the local environments of cells in the periphery exposed to nutrients and those entrapped in the core of the constructs may be significantly different Enabling higher cell to cell communication may help transfer important secondary messengers in bone formation such as calcium ATP and insitol triphosphate Such communication may overcome the limitations exhibited by some cells in less than optimal environments to differentiate and regenerate tissue As a tissue engineering strategy enhanced GJIC can also be used in tandem with another agent such as BMP 7 to increase the overall effect of the agent and enhance tissue formation and uniformity of distribution When BMP 7 binds to type I receptors in the cell membrane it enables a cascade of secondary messengers to be released inside the cell These messengers trigger transcription of proteins that induce differentiation and can be transferred to neighboring cells through the conduits formed by the docking of Cx43 enabled gap junctions Augmenting the communication enables the secondary messengers to reach cells that may have not been exposed to the stimuli This dynamic allows transcription mechanisms to develop in cells that prompt differentiation which leads to tissue formation Therefore BMP 7 and gap junctions generat
30. J Cell Biochem 2003 88 3 446 454 Schwiebert EM Extracellular ATP mediated propagation of ca 2 waves focus on mechanical strain induced ca 2 waves are propagated via ATP release and purinergic receptor activation Am J Physiol Cell Physiol 2000 279 2 C281 3 Franceschi RT Wang D Krebsbach PH Rutherford RB Gene therapy for bone formation In vitro and in vivo osteogenic activity of an adenovirus expressing BMP7 J Cell Biochem 2000 78 3 476 486 Franceschi RT Yang S Rutherford RB Krebsbach PH Zhao M Wang D Gene therapy approaches for bone regeneration Cells Tissues Organs 2004 176 1 3 95 108 122 29 30 31 32 23 34 35 Krebsbach PH Gu K Franceschi RT Rutherford RB Gene therapy directed osteogenesis BMP 7 transduced human fibroblasts form bone in vivo Hum Gene Ther 2000 11 8 1201 1210 Rutherford RB Moalli M Franceschi RT Wang D Gu K Krebsbach PH Bone morphogenetic protein transduced human fibroblasts convert to osteoblasts and form bone in vivo Tissue Eng 2002 8 3 441 452 Chatterjee B Meyer RA Loredo GA Coleman CM Tuan R Lo CW BMP regulation of the mouse connexin43 promoter in osteoblastic cells and embryos Cell Commun Adhes 2003 10 1 37 50 Griffith LG Swartz MA Capturing complex 3D tissue physiology in vitro Nat Rev Mol Cell Biol 2006 7 3 211 224 Huang R Lin Y Wang CC et al Connexin 43 suppresses human glioblastoma cel
31. MEM Consumables Gloves 24 well vials Plastic Vials Flasks Nalge Nunc Int 136196 polysterene sterilized filter cap flask angled neck 50 ml 25 cm 2 culture area Kim wipes Paper towels Nalgene Filter Plastic bags Equipment Laminar flow hood suction system tube large liquid waste flask Tweezers forceps sterile keep in EtOH under hood Test tube rack for 1 5m tubes Microscope Incubator CO2 1 Culture cells as indicated in tissue culture protocol 2 Achieve 30 50 confluency before infection with virus 3 Unfreeze the LV titer in a water bath heat media to 37C in the same water bath 4 Calculate the Titer necessary for your infection based on Multiplicity of Infection MOI Check MOI protocol 5 Remove all the media from the flask or well plate and place 10 titer into flask or plate Immediately after pipette 8ug ml protamine into the flask 1ml for each 8ml of media virus suspension used 6 Incubate for 16 hours for infection to occur 7 After this time period remove Media and wash with HBBS two times 8 Pipette fresh cell media as described above to flasks for 6 8 hours 9 Repeat step 7 10 Repeat steps 8 only let media for 3 4 days Trouble shooting When cells are not thriving increasing the FBS to 15 20 is a helpful alternative 194 A16 LVCx43GFP Plot Provided by Inder Verma and Eddy Kizana Sp 8896 AATATT Ais B458 CCAnnnnmnn CTT C
32. MEM press with dry gauze to drive off the air bubbles Then dry Gelform with another dry gauze 2 Cells were harvested and counted then alliquote into ependorf tubes at 2 3 million ml tube Centrifuge and aspirate the supernatant reserve 30 50 ul medium and suspend cell pellet by pipetting 3 Place one sponge tube and incorporate cells suspension into it by gently dipping sponge to the bottom of the tube Co culture the cell sponge at 37 C in an incubator for 30 minutes 4 Take tubes and surgical instruments to Room 6203 SCID room Anesthesize mice figure 1 with intraperitoneal ketamine cocktail Ketamine cocktail 0 3 ml Ketamine 19 0 2 ml Xylacine 0 5 ml Saline Dosage 50 100 ul mouse 5 A linear scalp incision was made from the nasal bone to the occiput and full thickness flaps were elevated 6 The periosteum overlying the calvarial bone was completed resected A trephine was used to create a 5 mm craniotomy defect centered on the sagittal sinus and the wounds were copiously irrigated with Hanks balanced salt solution HBSS while drilling 7 The calvarial disk was removed carefully in order to avoid injury to the underlying dura or brain 8 After careful hemostasis gelatin sponges previous loaded with cells were placed into the defects The sponges filled the entire defect and attached the bone edges around the entire periphery 9 The incisions were closed with 4 0 Chromic Gut suture Ethicon Joh
33. Mineralized PLGA PLGA Figure 3 5 Volume fractions and patterns of osteogenesis vary as a function of scaffold surface and seeding techniques Macromass seeded scaffolds produce smaller ossicles with a more abundant mineralization in the core of the scaffold A D Filtered scaffolds B E show a larger shell of bone formation with little or no mineralization in the core of the scaffold in both CT renderings and H amp E histological sections Static seeded scaffolds produce scant mineralization and bone formation C F Mineralization enhances mineral coverage and BVF in all groups These significant differences as a function of surface material and initial seeding were quantified G Both the micromass and filtration seeding yielded significantly larger BVF than static seeding p lt 0 001 Although there was no significant difference between the filtration and macromass seeding the variability is 2 fold greater in the macromass implants Mineralized scaffolds showed a significantly higher BVF with all seeding techniques than did their PLGA counterpart p micromass 0 037 p filtration 0 013 p static 0 009 Bars indicate groups that are not significantly different 85 A O Micromass B Filtration 0 25 25 50 50 75 5 100 Fraction of Total Bone as rm rn w ai an an Figure 3 6 Topographic analysis of mineral distribution within bone ossicles In order to quantify the observed differences
34. PnPP 10ul sample set the timer from this moment to measure exactly 15 min for example put the sample into the tube every 30 seconds 7 Put 500ul 0 1N NaOH stop solution for example put this stop solution every 161 30 seconds so that every tube are on reaction for exact 15 min 8 Read them at A405nm in the spectrophotometer Dr Taichiman s lab DNA quantitation refer to the picogreen DNA quantitation protocol Calculation E405 18500 Units ml A405 18 5 Gminutes ml 162 A3 Cell Counting with Hemocytometer Ricardo Rossello and David H Kohn I Equipment and Supplies Chemicals Media Consumables Equipment 70 Ethanol bottle for instruments amp spray bottle Ice PBS 1X Hanks Balanced Salt Solution HBBS Gibco BRL 14170 120 Fetal bovine serum Gibco BRL 16000 044 Alfa MEM Gibco BRL Cat 12571 063 alfa MEM 1X Note All media preparation and other cell culture work must be performed in a laminar flow hood Use a Steril 500ml Nalgene filter to prepare the media For 500 ml 50ml Fetal calf serum Sml Penicillin Streptomycin Balance alfa MEM Gloves Plastic Vials Flasks Nalge Nunc Int 136196 polysterene sterilized filter cap flask angled neck 50 ml 25 cm 2 culture area Kim wipes Paper towels Nalgene Filter Plastic bags Laminar flow hood suction system tube large liquid waste flask Test tube rack for 1 5m tubes Microscope
35. This distance begins at the point where the radius of the cross sectional area of flow is no longer changing See Appendix 2 for equations Contamination Physiological conditions are not the only factors that affect cell growth Contamination from bacteria can easily occur in cell culture systems if special care is not taken to keep the system sterile Providing an environment that cells find ideal to live and reproduce in means that other organisms such as bacteria find this environment favorable too Just one component being contaminated can lead to bacterium infecting the system and ruining an entire experiment by killing other cells or creating byproducts that can alter experimental results Bacteria multiply and grow very quickly which is why it is extremely important to make sure that every component in the system is completely sterile before and during the experiment Tubing PharMed tubing and silicone tubing were used in our perfusion system Silicone tubing was used to connect the outlet of the chamber to the inlet of the reservoir and was selected because it is an industry standard for cell culture tubing Silicone tubing is 170 permeable to gas which allows CO exchange in the incubator This allows the pH of the media to be controlled PharMed tubing was used to connect the reservoir outlet to the entrance of the chamber The reason for using two different types of tubing in our system design is durability When using Sili
36. after 8 weeks of implantation Fig 4 When the data were pooled among timepoints the global threshold value of 1000 had the highest coefficient of variation Fig 5d To further ensure that the global threshold range of 1000 1300 on a uCT image accurately represents the amount of bone the data were pooled across timepoints and uCT data was statistically compared with the ash fraction and histology data There were no significant differences between the uCT data and the corresponding ash fraction or histology data When taken in conjunction with the regression analyses this suggests that this threshold range can accurately be used to quantify the amount of bone on a uwCT image Therefore an optimal threshold range was defined as 1000 1300 32 Autothreshold values show a marked difference 25 48 from the threshold with highest R value at 4 and 12 weeks and this difference was even larger at 8 weeks Table 1 The autothresholds for the 8 week groups were significantly greater p 0 0213 than those for the 4 and 12 week periods and had greater variability within each group even though the regressions indicate that the optimal threshold range for the 8 week timepoint is similar to the optimal threshold range for the 4 week and 12 week timepoints Auto thresholds were greater than the optimal threshold range determined by the regressions which would lead to an underprediction of BVF if autothresholds were utilized 2 3 2 Comparison o
37. after trypsinization repeat the procedure again Pipette media into the flask to stop tripsinizing effects Use this media a few times to wash of some cells by tilting the flask to the side fig 2 and repidetely washing Device Setup fig 1 Connect tubes to the pump Place wetted scaffold see Wetting of Scaffolds on to the sterilized crystal tube Utilize the sterilized tweezers to place it Insert cell suspension into to the tubes Make sure it is saturated with the desired cell suspension density see Cell Count Protocol Close filtration loop 3 Place Filtration Device into CO2 Tank Connect the Device to the adaptor at the far end of the incubator Turn on the pump NOTE For Maximum Cell Count Switch off direction of flow periodically to maximize seeding and adhesion Retrieve scaffolds from the apparatus Take the tubes out of the apparatus Carefully detach the tubes in the hood over a Petri dish Utilize tweezers to take scaffold out Place scaffold in Petri dish or 24 well plates To ensure hydration of the scaffold wet the scaffold by pipetting a small amount of media to the scaffold Make sure the scaffold stays hydrated For example for a 4mm diameter and 1 mm thick scaffold pipette about 12uL of media Place plate in CO2 Incubator until ready for use in vitro or in vivo 179 Fig 1 Filtration apparatus a the arrows signify the tubes 3 that where the flow occurs b This is the crystal tube whe
38. all the screws evenly see Figure 8 Screws should be tightened in the following order 1 A corner screw 2 screw in opposite corner from first screw 3 another corner screw 4 the final corner screw 5 one side screw and 6 the final screw The screws should be tightened by going through the sequence of screws 3 times The first time through tighten each screw until there is an increase in resistance The second time through tighten each screw until there is significant resistance When there is significant resistance the lid should be held tightly on to the chamber The third time through simply check that each screw 1s tight and tighten any that are loose t2 m Make sure that the o ring 1s positioned in its groove correctly to form a tight seal with the top of the chamber Ay Do not tighten one screw completely before tightening the others at all This can lead to more rapid deterioration of the interior threading 44 DO NOT OVERTIGHTEN SCREWS Figure 7 BOTTOM VIEW OF CHAMBER LID Groove for o ring 151 Figure 8 LID ATTACHMENT Align parts in correct position e N Y Lid with o ring in place H i A i Tighten Screws K HOW TO CHECK FOR LEAKS l Dry the outside of the system with a paper towel Look for visible signs of leaking especially at connections of tubing with other components and around the lid Wipe all connections with a dry paper towel to see if any liquid is present on the
39. an osteogenic phenotype 94 in vitro and bone formation in vivo were examined Toward this end we chose to induce bone formation by both transducing BMSCs with Cx43 and co transducing Cx43 gene modified BMSCs with an adenovirus encoding the gene for BMP7 BMP7 is a 36 3 and does not modulate the powerful osteoinductive agent that enables differentiation expression of Cx43 Cell to cell communication and osteogenic differentiation were assessed in both a 2D monolayer and 3D cultures In 3D cultures differentiation and GJIC were further assessed the surface and the inner core of 3D scaffolds Because of the differences in cell numbers between 2D and 3D cultures intracellular communication and mRNA obtained from the cells was normalized In vivo regeneration of tissue by cells overexpressing Cx43 was quantified and compared to tissue regenerated by BMSCs The differences were assed as a function of total bone volume fraction of bone regenerated after 4 8 12 weeks of transplantation as well as quantitatively assessing for differences in the spatial uniformity of the tissue The same in vivo studies were performed in BMSCs overexpressing BMP7 and co transduced with Cx43 and BMP7 Our experiments aim to answer two critical questions in applied biology First can overexpression of Cx43 enhance cell communication throughout three dimensional structures Secondly can such enhanced communication lead to higher and more spatially di
40. and reservoir 1f applicable except the cell plate a Autoclave the bottom part of the chamber Teflon part all tubing PharMed and Silicone the o ring and the 6 thumb screws b Use a 70 ethanol solution for the pump and top of chamber 1 Pump Spray with ethanol before assembling system ii Top of chamber Submerge in 70 ethanol for 1 minute remove and let dry under chemical hood Assemble perfusion system under chemical hood a PharMed tubing runs through the pump and connects to the chamber inlet and silicone tubing b Silicone tubing connects to the outlet of the chamber and the PharMed tubing Insert the plate and sponge if desired securely into the chamber This may be done by hand with sterile gloves on or using sterile forceps spray both gloves and forceps with 70 ethanol before use Prime the perfusion system with media a Fill chamber with media pour from media bottle or use a 25 ml pipette b Turn pump on until bubbles stop coming out of tubing c Turn pump off Secure the lid onto the chamber with thumb screws and check for leaks Move the perfusion system into the incubator Make sure the incubator is set to proper temperature and carbon dioxide levels Plug the pump into a socket in the incubator Set the peristaltic pump to desired flow rate level 1 4 ml min and turn it on 11 Check again that there are no leaks Close the incubator and allow the system to run for the desired
41. and quantitative comparisons Quantification of bone on H amp E stained sections can be subject to variation because measurements are dependent on subtle changes in the matrix architecture so von Kossa staining which has high contrast in areas of mineralization was also employed The third regression comparison compared the 2D area fraction of bone determined from uCT with 2D mineral fraction determined by thresholding von Kossa stained histological sections In order to make this analysis applicable to images obtained using different uCT scanners the thresholds were normalized to the Bone HU value from the hydroxyapatite phantom This hydroxyapatite has a similar radiodensity to mature bone and does not change Normalizing to this value reported as Bone HU reflects the ratio of the threshold radiodensity in comparison to the radiodensity of mature bone After an appropriate threshold was determined a comparative study between the amount and distribution of bone regenerated in vivo from transplanted murine BMSCs and BMP 7 transduced cells was conducted 2 2 Materials and Methods 2 2 1 Bone marrow stromal cell isolation and culture Five to eight week old male C57BL 6 mice were used to isolate bone marrow cells from the femoral tibial and humeral cavities six bones per animal as previously described Briefly bone marrow cells were isolated by extracting the marrow from the bone cavities The bone marrow was mixed with complete medi
42. be performed in a laminar flow hood Use a Steril 500ml Nalgene filter to prepare the media For 500 ml 50ml Fetal calf serum Sml Penicillin Streptomycin Balance alfa MEM Consumables Gloves Plastic Vials Flasks Nalge Nunc Int 136196 polysterene sterilized filter cap flask angled neck 50 ml 25 cm 2 culture area Kim wipes Paper towels Nalgene Filter Plastic bags Equipment Laminar flow hood suction system tube large liquid waste flask Test tube rack for 1 5m tubes Tweezers forceps sterile keep in EtOH under hood Microscope Filtration Device Centrifuge II Procedures Trypsinize cells use 7ripsinizing Celsl protocol Check flask after initial trypsinization and retrieval of cells to observe the quantity of non trypsinized cells 183 If significant repeat trip protocol Trypsinize several times in order to retrieve an optimal amount of cells Prepare A Pellet from Cell Suspension Note This is done several times to retrieve fats when culturing cells Place the Cell suspension 15 ml falcon tubes and centrifuge Centrifuge at about 1000 RPM fro about 3 mins Retrieve the supernatant and decant Count the cells using the Hemocytometer see Cell Counting with Hemocytometer Protocol Re suspend the cell pellet and aliquot an on 1 5ml tubes the amount desired for the making of the macro mass of cells you are going to seed For example If you have a cell count of 1 Million Cells and you want
43. between all the gray scale values below the mature bone calibration This relationship is as follows Threhsold HU Calibration HU 1073 mg cc Bone Mineral Density Threshold mg cc This transformation was applied to the thresholds HU used in these experiments and are reported in table 2 2 55 CONCLUSIONS This study showed that the uCT is an accurate tool to analyze the bone content of ossicles Using an autothresholding algorithm might lead to an underestimate of BVF because a fundamental underlying assumption of this algorithm is not satisfied Based on 2 and 3 dimensional validations a threshold range of 1000 1300 24 2 31 5 of Bone HU is optimal for the early stages of bone formation This threshold should provide some standardization and consistency for characterization of tissue engineered bone 4 Table 1 Comparison between optimal thresholds determined from regressions against ash fraction and auto thresholds determined using histograms and threshold Time 4A weeks Oo weeks 12 weeks calculating algorithm Optimal Threshold Auto Threshold BMSCs Auto Threshold BMP 1000 1432 i 124 1481 120 1100 2184 225 2072 202 1200 1566 149 1498 132 42 Table 2 Linear transformations of threshold in Hounsfield units HU to physical mineral density threshold mg cc 15558 5 18241 20816 2 23391 4 25966 6 28649 1 31224 3 33799 5 3637 4 7 39057 2 41632 4 44207 6 46782 8
44. bone cells in rat calvaria Anat Embryol Berl 1993 187 4 343 352 17 62 63 64 65 66 67 68 69 Schiller PC D Ippolito G Balkan W Roos BA Howard GA Gap junctional communication 1s required for the maturation process of osteoblastic cells in culture Bone 2001 28 4 362 369 Thi MM Kojima T Cowin SC Weinbaum S Spray DC Fluid shear stress remodels expression and function of junctional proteins in cultured bone cells Am J Physiol Cell Physiol 2003 284 2 C389 403 Dorshkind K Green L Godwin A Fletcher WH Connexin 43 type gap junctions mediate communication between bone marrow stromal cells Blood 1993 82 1 38 45 Montecino Rodriguez E Leathers H Dorshkind K Expression of connexin 43 Cx43 is critical for normal hematopoiesis Blood 2000 96 3 917 924 Kizana E Ginn SL Allen DG Ross DL Alexander IE Fibroblasts can be genetically modified to produce excitable cells capable of electrical coupling Circulation 2005 111 4 394 398 Dull T Zufferey R Kelly M et al A third generation lentivirus vector with a conditional packaging system J Virol 1998 72 11 8463 8471 Zufferey R Nagy D Mandel RJ Naldini L Trono D Multiply attenuated lentiviral vector achieves efficient gene delivery in vivo Nat Biotechnol 1997 15 9 871 875 Stains JP Lecanda F Screen J Towler DA Civitelli R Gap junctional communication modulates gene transcription by altering
45. cell communication enables cells to act in a synchronized manner thereby allowing full development of tissue throughout the scaffold The significant increases in total bone volume fraction and distribution of tissue in bone formed from cells overexpressing Cx43 relative to that formed from BMSCs suggest that Cx43 can be a powerful tool to regenerate 3D tissue in vivo GJIC also enables the distribution of signals ignited by a secondary stimulus whether electrical mechanical or biological in nature between neighboring cells To test the effect of higher GJIC in tandem with another stimulus cells were induced to overexpress bone morphogenetic protein 7 BMP7 This growth factor was chosen because it has potent osteoinductive effects but does not modulate the expression of Connexin 43 Our results showed that enhanced GJIC increased the effect of BMP7 suggesting that the overexpression of Connexin 43 synergistically enhances the effects of other stimuli by enhancing the distributed differentiation potential of cells throughout a 3D culture Fig 3 and volume fraction of regenerated bone Figs 4 5 over cells 111 overexpressing BMP7 alone The experiments with BMP7 are an example of a platform that could potentially be extended to other tissues by using connexin 43 with other growth factors or stimuli that enhance the regeneration of a particular tissue of interest Combined our findings suggest that increasing gap junction intercellula
46. chamber to remove all the media into the same container as before To dispose of the media see Disassemble System below B DISASSEMBLE SYSTEM l bJ ia A Disconnect silicone tubing from tubing connector Hold tubing vertically above used media container and allow fluid to drain from tubing for 2 minutes Perturb the tubing gently to ensure tubing drains fully O Be careful that the end of the tubing remains above the media container Disconnect the PharMed tubing from the tubing connector and inlet port Place paper towel under each end of the tubing to absorb fluid flowing out of the tubing Unscrew four screws and remove plastic cap from front of pump Figure 5 Turn pump on to slowest setting in counterclockwise direction Gently pull tubing out of pump in a counterclockwise fashion Turn pump off Remove PharMed tubing from tubing sleeve by pulling it out Hold PharMed tubing vertically above used media container and allow fluid to drain trom tubing for 2 minutes Perturb the tubing gently to ensure tubing drains fully Be careful that the end of the tubing remains above the media container Seal used media container Place in autoclave and remove top leave top in autoclave Run autoclave for 30 minutes at 30 PSI 270 F Once cooled pour media down drain Spray all surfaces of pump chamber chamber lid screws tubing connector o ring and PharMed and silicone tubing with 70 ethanol Leave components
47. delivery to communication incompetent cells and as a main component to induce homeostasis Therefore mechanistic studies to understand the roles of GJIC in various aspects of biology are necessary In bone studies have shown that the lack of GJIC in cells inhibits the phosphorylation of Spl transcription factor which promotes the transcription of osteocalcin The effects of such phosphorylation on cells with higher GJIC need to be elucidated Also based on the results presented in this thesis Chapter 4 5 higher GJIC enhances ALP Thus the mechanistic role of GJIC in the transcription of ALP and other bone differentiation indicators need to be studied Also mechanistic studies need to be performed to understand the potential feedback control mechanism of Cx43 to control the regeneration of tissue One proposal to ignite this process may be to label the cells seeded in the constructs with green fluorescent protein GFP to observe what their fate is This way the interference of outside cells may be quantified by determining what cells are embedded in mineral The studies with connexin 43 can be extended to targeted delivery therapy with important implications The loss of gap junction mediated cell to cell communication not only leads to compromised development in many tissues and organs but also facilitates tumorigenesis and autonomous cell behavior in cancerous cells Enabling delivery of connexin 43 to cancerous cells may help eliminate th
48. directly into the interior of the container Be careful not to talk sing or whistle when you are performing these sterile procedures to minimize contamination To avoid cross contamination use a single pipette per container especially when pipetting media Techniques should be performed as rapidly as possible to minimize contamination DO ALL WORK IN STERILE HOOD B HOW TO SEED CELLS l t2 i m Suspend the cells to be seeded in desired growth media Filter the solution using a Steriflip to ensure solution is sterile Place the cell plate side with the x marked on it should be face down in a Petri Dish large enough to hold the plate The side without the x is coated to promote cell adhesion Add solution containing media and cells The media should cover the plate Place the Petri Dish containing the cell plate into the incubator for 48 hours in order to let the cells adhere to the plate and begin proliteration Cells are seeded on cell plate and now ready for testing in the perfusion system C STERILIZATION PROCEDURES FOR ASSEMBLY OF PERFUSION SYSTEM l t2 Follow standard aseptic technique for cell culture while assembling the perfusion system Clean every component of the perfusion system according to perfusion system sterilization protocol below Before placing in sterile hood spray all objects including hands thoroughly with 70 ethanol Assemble entire perfusion system under the sterile hood
49. et al Regulation of connexin43 expression and function by prostaglandin E2 PGE2 and parathyroid hormone PTH in osteoblastic cells J Cell Biochem 1998 68 1 8 21 16 Ser 54 55 56 F 58 59 60 6l Wyatt LE Chung CY Carlsen B et al Bone morphogenetic protein 2 BMP 2 and transforming growth factor betal TGF beta1 alter connexin 43 phosphorylation in MC3T3 E1 cells BMC Cell Biol 2001 2 14 Stains JP Civitelli R Gap junctions in skeletal development and function Biochim Biophys Acta 2005 1719 1 2 69 81 Steinberg TH Civitelli R Geist ST et al Connexin43 and connexin45 form gap junctions with different molecular permeabilities in osteoblastic cells EMBO J 1994 13 4 744 750 Stains JP Civitelli R Cell cell interactions in regulating osteogenesis and osteoblast function Birth Defects Res C Embryo Today 2005 75 1 72 80 Civitelli R Cell cell communication in bone Calcif Tissue Int 1995 56 Suppl 1 S29 31 Stanka P Occurrence of cell junctions and microfilaments in osteoblasts Cell Tissue Res 1975 159 3 413 422 Doty SB Morphological evidence of gap junctions between bone cells Calcif Tissue Int 1981 33 5 509 512 Palumbo C Palazzini S Marotti G Morphological study of intercellular junctions during osteocyte differentiation Bone 1990 11 6 401 406 Jones SJ Gray C Sakamaki H et al The incidence and size of gap junctions between the
50. even cell profile Other important parameters are the flow rate inner diameter and length of the tubes These have to be determined based on the flow profile laminar vs turbulent RE see next section and desired stress component Fluid dynamic equations that should be used to determine these parameters are in Appendix 2 Fluid Dynamics Tests have been conducted to determine which type of flow causes the best cell proliferation and of turbulent flow laminar flow and no flow laminar flow causes the greatest amount of cellular growth 1 Turbulent flow causes stagnant points and dramatic shear stress variations which may kill cells or tear them from the plate s surface Laminar flow is a steady flow in which a velocity gradient is present that extends from the fastest velocity at the center of the flow to zero flow at the wall or stationary object Laminar flow occurs when viscous forces dominate in the flow This is determined by the Reynolds number which is a non dimensional number takes into account the parameters of the flow If the Reynolds number is less than 2300 the flow is laminar If the Reynolds number is greater than 2300 the flow is not laminar When fluid flow undergoes a change in diameter there is a region in which turbulent flow can occur for a limited distance This turbulent region 1s called the entrance region This entrance region can be calculated from the Reynolds number and the diameter of the new region of flow
51. groups without AGA p lt 0 001 in both mineralized and PLGA scaffolds indicating GJIC dependent transfer 3 3 3 Seeding and template conditions alter bone marker expression Expression of bone differentiation markers ALP and OCN was significantly altered when different scaffolds and seeding techniques were implemented figure 6 At day 2 ALP expression was significantly higher in micromass seeded than both filtration and static seeded scaffolds p lt 0 001 for both which exhibited no difference in the differentiation marker fig 6a At day 8 micromass seeded scaffolds still exhibited significantly higher expression when compared to filtration and static seeded scaffolds p lt 0 001 for both however filtration also significantly expressed more ALP than static p lt 0 001 At day 16 there was no significant difference in ALP expression between seeding methods Expression of osteocalcin fig 6 b was different starting at day 8 where micromass seeding exhibited significantly higher expression p lt 0 001 for both compared to filtration and static seeded scaffods At day 16 OCN expression in micromass seeded scaffolds was significantly greater than filtration and static seeded scaffolds p 0 0211 Cells seeded through filtration expressed significantly higher OCN than statically seeded cells p lt 0 001 Template mineralization and the presence of soluble calctum increased ALP and OCN expression over cells seeded in PLGA scaffolds
52. in sterile hood for 20 minutes or until dry Sterilize all components Detailed How To s Experimentation Preparation C p 8 154 ADDITIONAL FEATURES The perfusion system can be modified to increase the scope of experiments that it is useful for 1 HIGHER FLOW RATES The chamber has been designed and validated to have laminar flow at pump speeds of 1 4 ml min Faster pump speeds and or larger tubing can also be used to get higher flow rates In order to employ larger tubing new tubing connectors of desired diameter must be substituted for the current 1 16 diameter tubing connectors The connectors can be screwed in and Teflon tape can be used to secure the connectors if necessary Note It is not guaranteed that at flow rates faster than 1 4 ml min the flow profile will be laminar Also the tubing connectors should not be changed often because this can lead to deterioration of the Teflon threading 2 RESERVOIR The perfusion system has been designed for easy incorporation of a reservoir The reservoir should have two openings that the inlet and outlet tubing can pass through The openings must be sealed to the outer diameter of the tubing to ensure that the system 1s closed and there are no leaks The addition of a reservoir will allow the user to take pH measurements of the media provided that another opening in the reservoir accommodates a pH meter 3 LID SCREWS The threads of the screw holes used to secure the lid on
53. in future studies it may be prudent to select a single global threshold within the 1000 1300 range and apply it to constructs across the timepoints of interest This study also compared the osteogenic potential of two cell sources in vivo Both BMSCs and BMP 7 transduced cells formed mineralized ossicles but showed different patterns of tissue formation in vivo The overall volumes of the regenerated ossicles were significantly different between the different cells and time Fig 7 At 8 weeks the ossicles were not significantly bigger than their 4 week counterparts Fig 7 but had a significantly greater amount of bone within the implant Fig 6a Fig 7b This suggests that bone apposition may occur by further mineralization of the bone that is present as well as new bone formation in areas that were previously unmineralized The 12 week period shows that the ossicles became larger and although it was not significantly different tended to have a higher bone volume fraction These effects may be contributing to the disparity in auto threshold values Table 1 observed in the three time periods The threshold value increases between 4 and 8 weeks before decreasing The overall size and mineral content of ossicles formed by BMP 7 transduced cells were significantly greater compared to the ossicles formed from BMSCs BMP 7 not only stimulates osteoblastic differentiation of osteoprogenitors but may also differentiate the transduced non osteogenic m
54. in mineral distribution through out the ossicles cross sectional slides where analyzed with a program designed to calculate the topographical distribution of the mineral The program was set to analyze sections in 25 increments from centroid a Even distribution of bone in ossicles produced by micromass seeding showed no significant differences in bone between regions b Ossicles generated by scaffolds seeded through filtration showed a significant difference in mineral from the periphery 75 100 to the core 0 25 p lt 0 001 The amount of mineral content in 0 25th of the micromass ossicles was significantly greater than the filtered ossicles p 0 0213 while the opposite is true for the periphery p 0 0311 Horizontal bars indicate groups that are significantly different 86 3 5 References Cheung C The future of bone healing Clin Podiatr Med Surg 2005 22 4 631 41 Vill Friedlaender GE Immune responses to osteochondral allografts current knowledge and future directions Clin Orthop Relat Res 1983 174 174 58 68 Friedlaender GE Bone grafts the basic science rationale for clinical applications J Bone Joint Surg Am 1987 69 5 786 790 Goldberg VM Stevenson S Natural history of autografts and allografts Clin Orthop Relat Res 1987 225 225 7 16 Damien CJ Parsons JR Bone graft and bone graft substitutes A review of current technology and applications J App Biomater 1991 2 3 187 208
55. is 4 ft Note If the media becomes too acidic during the experiment there is not enough gas exchange and the length of the silicone tubing should be extended Acidic conditions are indicated by the media turning orange and then yellow or by a pH reading below 7 1 B HOW TO CALIBRATE PUMP bJ gt d 10 11 Calibration does not need be repeated for each experiment once it has been performed for a given tubing diameter The calibration only needs to be done when the diameter of the tubing is changed As a regulatory measure it 1s recommended that calibration be performed every 6 months to confirm the precision of the flow rates from the pump even if the tubing diameter has not been changed Set up the pump Detailed How To s Experimentation Procedure G p 13 Make sure the power switch is in the off position Take a beaker or other container with at least 100 mL of volume and fill it up with water Put both the inlet and the outlet tubing into the beaker and turn the pump on Prime the system such that the tubing volume is fully occupied by water When the system is not primed water bubbles will be seen leaving from the outlet tubing The cessation of bubbles from the outlet tubing therefore is a good indication that the system is adequately primed Turn the pump off temporarily Take the outlet tubing out of the water beaker and place it over a graduated cylinder Do not allow water to dri
56. l s Fap A Place the pump in the work area Plug pump into a 120V AC GFI outlet 50 60 cycles The peristaltic pump requires electricity Without a working power source the pump is not functional Use extreme caution while dealing with electricity Avoid contact with the plug while it is inside the electric socket and make sure the area near the power source is dry Unscrew the four screws that hold the plastic cap on the face of the pump See Figure 5 Select sterilized 1 16 diameter PharMed tubing and slide the sterilized tubing sleeve provided with the pump over the 1 16 diameter tubing The 1 16 diameter tubing is too slender for the peristaltic pump to effectively push fluid through it without the tubing sleeve Only tubing that is covered by the sleeve should be in the pump for the 1 16 tubing size Adjust the dial on the pump to the lowest possible setting 0 Turn the pump on by using switch on the face of the pump Note There are two settings on the pump clockwise and counterclockwise The clockwise setting will push media fluid out of the bottom right portion of the pump tubing interface The situation is reversed for the counterclockwise setting Choose one of the two settings to run the experiment in See Figure 1 To get the tubing into the pump follow the rotary device on the face of the peristaltic pump gently easing the thick tubing into the empty spaces as the rotor keeps moving Con
57. leaks and ensuring there are none you can then carefully move the perfusion system into the incubator The incubator has a rubber stopper in the back end which will be necessary to remove in order to connect the AC outlet Running Experiment Once in the incubator you need to prepare the system for the experiment Secure the chamber in the incubator to ensure that it will not move during experiment and connect the AC outlet After the chamber is secured once again check for leaks and make sure everything is connected properly Check that the incubator is set to proper temperature and carbon dioxide levels Then set the peristaltic pump to desired flow rate level 1 4ml min After making sure everything is set up properly the user is ready to run the experiment First turn on the peristaltic pump and look to make sure media is flowing through the system Next check once again that there are no leaks Finally close the incubator and allow the system to run for the desired period of time Once the desired experimental run time is complete the user can open the incubator and turn off the peristaltic pump Next move the perfusion system from the incubator to the chemical hood The user can then take out the plate and media from the reservoir and save them for further testing Finally the last step is to disassemble and sterilize the system again Empty the remaining media suspension from the system into a jar with bleach Decant the bleach
58. outside of the chamber or at tubing connections If the towel gets wet that component is leaking and the leak should be fixed immediately see Troubleshooting section for how to fix leaks L HOW TO RUN SYSTEM allt ele ieee nw Place the perfusion system in the incubator Set incubator to 37 C and 5 CO Plug pump into GFI electrical outlet inside incubator Ensure pump is set to desired flow rate and turn it on using power switch on the front of the pump Check for leaks as above Close incubator and allow to run for desired period of time up to 24 hours After experiment is completed turn pump off unplug pump and remove perfusion system to sterile hood 152 DETAILED HOW TO S POST EXPERIMENT PROCEDURES A HOW TO REMOVE THE MEDIA AND CELL PLATE Aw All perfusion system internal surfaces and tubing may have been in contact with media Treat all surfaces as potential biohazards Any spillage should be sprayed thoroughly with 70 ethanol and wiped with a paper towel All used paper towel should be disposed of in a red biohazard container 1 Remove lid from chamber Unscrew each screw slightly and then unscrew each one completely Place lid on paper towel under sterile hood and spray down with 70 ethanol 2 To take a sample of the media from the chamber for testing use a large pipette to transfer the used media into a clean sterile glass container 3 Aspirate the rest of the media from the chamber into a
59. particular protein or transcription factor that enable higher differentiation and bone formation The aims of this thesis and underlying studies are therefore 1 to employ exogenous strategies that can alter bone regeneration and differentiation by virtue of the biomimetic nature of the scaffold and initial seeding conditions that enhance nutrient flux stress cell adhesion cell cell communication with an emphasis on gap junction intercellular communication GJIC and 2 To endogenously overexpress the gap junction forming protein Cx43 in bone marrow stromal cells and measure the impact in GJIC cell differentiation and bone regeneration in 3D along with the impact of higher GJIC when cells are stimulated with the bone osteogenic factor BMP7 The following sections present the background relevant to this thesis finalizing with the outline of the content presented in the same 1 2 Cell based Constructs A cell based approach in which a porous 3 dimensional synthetic construct provides a substrate for cells can enhance cellular growth proliferation and provide a temporary template for the formation of extracellular matrix and new tissue Poly a hydroxy acids such as poly lactic acid and poly glycolic acid are considered biocompatible and degrade over controllable time scales into natural metabolites which makes them attractive materials for scaffolds PLGA polylactic glycolic acid supports osteoblast atta
60. sealable disposable autoclavable container 4 To remove the cell plate position a sterile thin tipped rigid tool such as forceps in the notch at an angle away from the cell plate Use this as a lever to gently pry the end of the cell plate out of the indentation in the bottom of the chamber See Figure 9 below Ay Be gentle so that the plate does not pop completely out of the indentation because this could adversely affect the cells if the plate flips over Figure 9 PLATE REMOVAL Cell Plate Removal Tool Chamber Gently apply downward force on tool to remove plate Notch Cell Plate 153 fe Once the end of the cell plate 1s elevated from the bottom of the chamber use sterile forceps or your gloved fingers on the edge of the plate to carefully lift it out of the chamber and into a Petri dish or other sterile surface under the sterile hood 4 amp AVOID contact with the surface of the cell plates as this could impact results of any cell plate tests done Remove the silicone tubing from the outlet port of the chamber and place it in a small container of 30 ml PBS A small amount of media may escape when moving tubing Treat with caution and follow the above protocols to clean it up Turn pump on and set dial to maximum setting 100 Run pump for 2 minutes Turn off pump A Make sure that the open end of the silicone tubing is completely submerged in the PBS solution throughout the 2 minutes Re aspirate the
61. that dissolution of mineral in scaffolds occurs at later times Future experiments should examine GJIC at different times including those in which the mineralized scaffolds show higher dissolution rates As an endogenous strategy we enhanced osteogenic differentiation and in vivo bone formation to by genetically altering BMSCs to overexpress the gap junction forming protein Cx43 Such overexpression enhanced cell to cell communication as measured by calcenin AM transfer in a 2 dimensional monolayer and 3D cell cultures Therefore transduction via a lentivirus containing the Cx43 gene is an effective way to enhance communication in GJIC in areas of limited cell to cell communication Coupled with the inability to communicate when BMSCs overexpressed a mutant Cx43 gene that inhibits GJIC our results indicate that GJIC is an important and essential component to tissue regeneration and can be augmented artificially to enhance such communication Because GJIC mediated by Cx43 allows the transfer of molecules as large as IKD in size these conduits are the main modes for transfer of 1ons metabolites and secondary messengers that affect signaling and prompt signaling cascades As an example osteocalcin transcription is prompted by the passage of secondary messengers through 130 gap junctions that enable phosphorylation of the Spl transcription factor When GJIC is high phosphorylation of Sp1 is significantly greater than when cells exhibit low
62. the regenerated bone ossicles were harvested 3 2 10 Micro CT 3D image acquisition and analysis Ossicles clear of soft tissue were scanned on a high resolution cone beam micro CT system Enhanced Vision Systems now GE Healthcare Preclinical Imaging London 69 Ontario Canada while immersed in distilled H20 The x ray source voltage and current were 80 kVp and 80uA respectively To reduce the potential for beam hardening artifact the x rays were passed through a 0 2mm AI filter immediately upon exiting the source and the specimens were immersed in dH2O during the scanning process Projection images were acquired over 198 degrees using 2x2 binning and an exposure time of 1100 ms and four frames were averaged for each projection to improve the signal to noise ratio The projection data was then corrected and reconstructed using the Feldkamp cone beam algorithm to create three dimensional images with an isotropic voxel size of 18um The scanner was calibrated once daily using a phantom that contained air water and hydroxyapatite Bone volume fractions were determined by using a MatLab program designed to integrate all grayscale voxels above a particular threshold To determine the overall volume of the ossicles the program determined the perimeter of each 2D uCT slice by tracing the outer edge The program then integrated all the perimeters to determine the 3D surface area and the number of voxels inside the surface defined the tota
63. the concentration of oxygen and the distribution of such concentration throughout a 3D structure the alternative seeding techniques filtration and micromass can be compared Although high flux in vitro systems have been studied extensively Chapter 4 studying the effects of increased nutrient flux in vivo has been elusive particularly because of the difficulties present with interfacing a flux generating system that creates such flux in vivo Using advances in micro fluidics a system can be designed and built to create a nutrient flux that is exogenous to the animal model The proposed system would incorporate small degradable channels that pass through the 3D scaffolds Once transplanted a small outlet would be set outside the body to allow continuous or non continuous flow to enter via a pump or injection The micro fluidic tubes would be permeable to the nutrients as to allow for delivery throughout the construct in vivo To test the validity of this system in vitro studies would be necessary to assess nutrient delivery to all regions and in vitro osteogenic differentiation As nutrient flux is a generally favorable condition for all tissues such an approach can yield positive results through out the tissue engineering realm 134 GJIC is a highly studied phenomenon that plays a role in most tissues and may have far reaching implications in fields other than tissue engineering such as cancer prevention cancer treatment targeted
64. the construct enhancing cell nutrition and decreasing the possibility of an undesirable micro environment due to toxic byproducts BMP release from the transduced cells seems to enhance the rate of differentiation This is evident by the significantly higher mineral content in the 4 week group This rapid differentiation leads to tissue formation throughout the construct Based on our study we hypothesize that co seeding of BMP 7 transduced cells and BMSCs would have therapeutically advantageous results BMP 7 transduced cells would be used on the epiphysis area to enhance regional bone density while BMSC would be placed to construct the shaft of long bones due to the matured bone marrow forming property most mimicking the structural functional characteristics of native bone Such approach may be useful in future clinical trial to bone regeneration 39 Other types of scaffolds that are non degradable degrade at slower rates or have densities closer to that of bone such as Ca P ceramics may show their presence in CT images Such materials may also have intensities that overlap with or interfere with the detection of new bone and the intensity will vary based on the amount and density of ceramic To overcome these potential complications in analyzing tissue engineered bone scans of empty constructs should be taken at the selected threshold before implantation Empty constructs should also be used as an in vivo control for degradation Usi
65. the recruitment of Sp1 and 18 70 TI V2 T3 74 T3 76 Sp3 to connexin response elements in osteoblast promoters J Biol Chem 2003 278 27 24377 24387 Hagen G Muller S Beato M Suske G Sp1 mediated transcriptional activation is repressed by Sp3 EMBO J 1994 13 16 3843 3851 Majello B De Luca P Lania L Sp3 is a bifunctional transcription regulator with modular independent activation and repression domains J Biol Chem 1997 272 7 4021 4026 Lania L Majello B De Luca P Transcriptional regulation by the sp family proteins Int J Biochem Cell Biol 1997 29 12 1313 1323 Flenniken AM Osborne LR Anderson N et al A Gjal missense mutation in a mouse model of oculodentodigital dysplasia Development 2005 132 19 4375 4386 Lecanda F Warlow PM Sheikh S Furlan F Steinberg TH Civitelli R Connexin43 deficiency causes delayed ossification craniofacial abnormalities and osteoblast dysfunction J Cell Biol 2000 151 4 93 1 944 Reaume AG de Sousa PA Kulkarni S et al Cardiac malformation in neonatal mice lacking connexin43 Science 1995 267 5205 1831 1834 Furlan F Lecanda F Screen J Civitelli R Proliferation differentiation and apoptosis in connexin43 null osteoblasts Cell Commun Adhes 2001 8 4 6 367 371 19 The 78 T9 80 Jorgensen NR Geist ST Civitelli R Steinberg TH ATP and gap junction dependent intercellular calcium signaling in ost
66. thrive and differentiate while those in the core of the scaffold are less viable and exhibit 30 31 compromised differentiation This limitation produces incomplete regeneration of 49 52 tissue making it less clinically relevant Therefore there is a need to generate 3D 109 in vitro models for bone engineering in order to create strategies and study mechanisms that will help regenerate clinically viable tissue equivalents To gain insight into the ability of increased GJIC to enhance spatial distribution of differentiation we cultured cells in monolayer 2D and scaffolds 3D and assessed differences in GJIC and osteogenic differentiation between 2D and 3D cultures and between the surface and inner regions of 3D cell cultures Cells overexpressing Cx43 exhibited higher GJIC in 3D culture relative to the 2D monolayer whereas control cells and cells overexpressing only BMP experienced similar levels of GJIC Cells overexpressing Cx43 exhibited similar levels of OCN expression relative to BMSCs in 2D and 3D cultures These results contrast the decreased levels of OCN mRNA in BMSCs and BMSCs overexpressing BMP in 3D cultures when compared to a monolayer Our data points out to the greater importance of GJIC in 3D constructs compared to a 2D monolayer Fig 3b Overexpression of Cx43 enables greater GJIC in 3D and has a high impact on the differentiation of cells suggesting that more gap junction channels are formed when cells are in a
67. way of achieving such signaling and is particularly important to maintain synchronized and cooperative behavior of cells in three dimensional tissue As consequence the absence of gap junctions has been linked with several debilitating diseases and tissue malformations such as oculodentaldigital dysplasia impaired heart 5 10 function and certain types of cancerous tumors Of the 19 known gap junction subunits connexins connexin43 Cx43 is the most prevalent The ubiquitous nature of this protein throughout most vertebrate cell types makes it a potent signaling platform that enables cells to communicate directly and also distribute secondary messengers 12 21 initiated by other biological cues and stimuli that play a role in cell differentiation 13096 and tissue formation such as Bone Morphogenetic Protiens BMPs and PHT However characterization of these stimuli has been limited to in vitro assessment of cells in a two dimensional monolayer and may misconstrue the real impact of these factors in 93 three dimensional settings Limitations in cell to cell communication in 3D may hinder the coordinated behavior of cells and inhibit proper passage of secondary messengers and eventual tissue formation Overexpressing Cx43 as a conduit to improve GJIC can be a platform to enhance the distribution of signals among cells in a 3D setting and therefore be a powerful strategy in both cell based strategies and target
68. 001 in both 8 and 12 week periods Finally co transduced groups produced significantly higher BVF than any other group in the 8 and 12 week period suggesting a synergistic relation between Cx43 and BMP7 Significant increases are indicated by BMSC EE Cx43 BMP7 Horizontal bars represent groups that are not significantly different control groups and BMSCs 117 SBMSC OBMP E C43 imm 1 al Thickness i amp o E EJ a Pa lt Figure 4 5 Cortical like thickness and trabecular like bone volume fraction of tissue engineered bone CT data files were analyzed using a custom topological MatLab program that quantifies both the average cortical thickness and trabecular like BVF a Cx43 transduced cells produced an average cortical thickness that was significantly greater p lt 0 001 for all time points than the cortical thickness of bone produced by BMSCs b The trabecular like bone volume fraction c was significantly greater in bone regenerated from cells containing Cx43 as well when compared to BMSCs p 4 weeks lt 0 001 p 12 weeks lt 0 001 Co transduced cells had significantly larger fraction of trabecular like bone at the 8 p lt 0 001 and 12 p lt 0 001 week than all groups Significant increases are indicated by BMSC Cx43 BMP7 Cx43 BMP7 118 4 55 References Goldmann WH Mechanical aspects of cell shape regulation and signaling Cell Biol
69. 2 5 CONCEUSION S sri E ER 4 20 REL CC at csaeaaaas sea ste esseaa tessa E E E A 53 Chapter 3 Effects of Cell Seeding and Self Mineralizing Template on Differentiation and Volume OF REGener ated BONG acs hia ce seaet Getenytn e tea ea Gee ees 59 3 1 DYE OGIO Hois 59 3 22 Materials and Metin OS ies os cece ante ceneunte onctectvantvonte ananin aiaa a aana ena iaa rA 62 3 21 Bone marrow stromal cell BMSCs isolation and culture 62 3 2 2 SCaNold Preparato Mirane nana E E TE NTA 63 3 2 3 Mine ralizaOn OL SCan Olds a aisha ee readouts ea ee 63 3 2 4 PEE W CHING SCATIOIGS emisa e 64 3 2 5 NS CC AS irinin A E eeaer tea canes 64 3 2 6 Cell COuntin Gan Gv Histol Gy castes veces tnardede e ETAN 65 JA Dyetrinsio r Studi ES usA tapes tciasun tears 66 3 2 8 RTPCR Analysis of differentiation markefs cccccccccceeeeeeeeeeeeeeeeeeeees 67 3 2 9 Transplantation of cell scaffold constructs ccccccccccceeeeeeeseseeeeeeeeeeeaes 69 3 2 10 Micro CT 3D image acquisition and analysis ccccccccceeeeeeeeeeeeeeeees 69 2AL HISLOIO PICA AMA V SeS einn a a et aeadtdeece 70 3 2 12 Anialysis OF DONE INGTOWID xc cccucciccsecsasevscesns ane dediacdecsssenad sbesavsvesns ans enaa 71 3 3 IRS SUH ES rset seat otedasansaseacansaesacestecoscese ces eae ar eoatcoe ae sack ore ees sesaeeresa neo eeae toretatecaet 71 3 3 1 Filtration seeding achieves a higher number of attached cells 00 71 a2 Micromass seeded cultures enhance
70. 24 for 8 weeks vs 12 weeks BMP 7 p 0 049 for 4 weeks vs 12 weeks and p 0 044 8 weeks vs 12 weeks Similar transient differences occurred in the ossicle ash content The ash content was significantly greater in the ossicles formed from BMP 7 transduced cells in comparison to ossicles formed from BMSCs at all timepoints p 0 002 0 001 0 021 at 4 8 and 12 weeks respectively The ash content increased significantly after 4 weeks in bone formed from both cell types Fig 7b BMSCs p 0 20 for 4 weeks vs 8 weeks and p 0 029 for 8 weeks vs 12 weeks BMP 7 p 0 001 for 4 weeks vs 8 weeks There was also a significant difference in the distribution of bone regenerated by the two cell types Fig 8 As observed in the uCT renderings the ossicles show distinct patterns of osteogenesis Fig 6b The bone regenerated by BMSCs showed significantly more bone formation in the periphery 76 100 percentile region for the BMSCs vs BMP 7 transduced cells p 0 0198 with light mineral expression in the central part of the ossicle There was significantly more internal bone regeneration in the BMP 7 constructs than for the BMSC constructs p 0 0308 in the 023 percentile region and p 0 0242 in the 26 5 0 percentile region To demonstrate that the thresholds were not specific to the resorbable gelatin scaffolds bioceramic scaffolds synthesized by the self assembly of carbonated apatite were also tested The volume fraction of bone regene
71. 3 5 2 the correlations and levels of significance quickly diverge as the threshold is set below 900 or above 1400 and 3 there is no significant difference in the BVF of ossicles measured between 1000 and 1300 A slight increase in the threshold value with the highest R with respect to implantation time was observed when the 3D measures were compared Fig 2 This time dependence suggests that mineral packs over time and is therefore detected at a higher intensity at later times At earlier times where the mineral is more dispersed the amount of mineral present in a voxel might not be enough to be recognized at a higher threshold However this time dependence was not present when 2D histological data was compared with analogous wCT sections Fig 3 Fig 5 This may be due to the inherent 2D limitations of the histology but this seems unlikely because overestimating or underestimating effects of a particular wCT section are corrected because they are being compared to their analogous closely aligned histological slide Another possible explanation for the difference in temporal sensitivity of the ash fraction and histological data is that the three dimensional structure of the bone within the ossicle affects the thresholding process There may be more partial volume artifact in 3D and this may have an impact when making comparative measurements since the 37 ashing process will not be affected by partial volume problems Because of this
72. 3D setting as the cell cell surface contacts increase enabling higher cell cell communication when sufficient channels are formed Secondly the results suggest cell to cell communication is an essential component in the observed differences between 2D and 3D settings Figs 2b 3b Inhibited cell to cell communication may enable cells to act independently and un synchronized which may affect tissue development and homeostasis Further insights into the impact that GJIC has in 3D cultures is derived when the core sections of 3D cell scaffold constructs are compared to surface sections Figs 2c and 3c Cells that do not overexpress Cx43 exhibit significantly less GJIC and differentiation in the core of the 3D cultures 110 contrasting cells overexpressing Cx43 in which there is no significant difference in GJIC and differentiation between the core and surface suggesting that enhanced GJIC enables a more even distribution of cues and differentiation in 3D The in vitro results clearly demonstrate the effects in osteogenic differentiation as a function of enhanced Cx43 expression In vivo tissue regenerated by cells overexpressing Cx43 had a larger quantity of bone in growth relative to control groups Fig 4 a l The larger production of trabecular like bone ingrowth characterized by regeneration of bone in the core of the ossicle and a thicker cortex suggest that when differentiation and bone formation are occurring the higher level of cell to
73. 69 Tween 20 Fisher Biotech BP337 500 Triton X 100 Sigma X 100 Propidium Iodide PI Sigma P 4170 Ca Mg free Delbecco s PBS HPLC grade H O Fetal calf Serum FCS Internal standard IS trout erythrocyte nuclei BioSure 1008 Antibodies Purified Mouse anti BrdU Pharmingen 33281A Goat anti Mouse IgG Whole molecule FITC conjugate Sigma F0257 Solutions 0 5 mg ml RNAse A in PBS PTS PBS with 0 5 Tween 20 and 5 FCS HC l Triton 0 1 N HCI containing 0 7 Triton X 100 1 At desired time point s incubate cells with 30 uM BrdU for 15 min 2 Remove BrdU media Rinse 1x with PBS 3 Detach cells as appropriate trypsin EDTA etc and resuspend in 10 ml media 4 Permeabilize cells 167 Determine cell count Aliquot desired number of cells per test sample to 15 ml conical tubes Pellet at 1200 rpm for 5 min at 4 C Decant supernatant wash with 3 ml PBS and re pellet Resuspend pellet in 0 3 ml PBS agitate gently then add 0 7ml ice cold 100 EtOH slowly Mix gently with a 1 ml glass transfer pipette 6 The cell concentration following permeabilization should be approximately 10 cells sample Samples can be stored in EtOH for up to 2 weeks at 4 C 5 Add IS if desired at a concentration of 10 IS per 10 cells Mix gently with a 1 ml glass transfer pipette Pellet at 1100 rpm for 8 min at 4 C Decant supernatant wash with 5 ml PBS re pellet and decant supernatant 6 Add 1 ml P
74. 799 5 mg cc respectively This threshold should provide some standardization and consistency for characterization of 127 tissue engineered bone These threshold values were used as a guideline to compare tissue engineered bone throughout the experiments performed in this thesis First we addressed the question of altered initial conditions in the form of cell seeding and surface chemistry to increase the amount of tissue engineered bone Chapter 3 The alternative seeding strategies developed here filtration and micromass seeding aimed to overcome the limitations observed with the commonly used static seeding techniques in tissue engineering Cell density cell substrate adhesion and cell cell communication were assessed although other factors such as nutrient and byproduct flux cell cell adhesion mechanical loading and migration were considered in the design of these strategies Micromass and filtration seeding led to significant increases in GJIC osteogenic differentiation and amount and spatial distribution of regenerated bone in vivo The outcomes attained by altering initial cell seeding conditions are powerful in the clinical context namely by altering cells initial positioning cell to cell communication and density in 3D scaffolds higher amounts of tissue can be regenerated Clinically the micromass principle may have a more powerful impact in larger defects using larger scaffolds as different arrays of micromasses can
75. 81 Mikos AG Thorsen AJ Czerwonka LA Bao Y Langer R Winslow DN Vacanti JP Preparation and characterization of poly L lactic acid foams Polymer 1994 35 1068 1077 90 32 33 34 35 36 37 38 39 Luong LN Hong SI Patel RJ Outslay ME Kohn DH Spatial control of protein within biomimetically nucleated mineral Biomaterials 2006 27 7 1175 1186 Rossello RA Wang Z Krebsbach PH and Kohn DH Establishing micro CT thresholds for tissue engineered bone and comparison of bone regenerated from BMSC and transduced C 4 cells Trans 31st Annual Meeting Soc for Biomat 2005 Wallace JM Rajachar RM Chen XD et al The mechanical phenotype of biglycan deficient mice is bone and gender specific Bone 2006 39 1 106 116 Holy CE Shoichet MS Davies JE Engineering three dimensional bone tissue in vitro using biodegradable scaffolds Investigating initial cell seeding density and culture period J Biomed Mater Res 2000 51 3 376 382 Zhang S Wu XY Li YH Xie LQ Mechanotransduction in bone Space Med Med Eng Beying 2001 14 6 465 468 Goldmann WH Mechanical aspects of cell shape regulation and signaling Cell Biol Int 2002 26 4 313 317 Jorgensen NR Teilmann SC Henriksen Z Civitelli R Sorensen OH Steinberg TH Activation of L type calcium channels is required for gap junction mediated intercellular calcium signaling in osteoblastic cells J Biol Chem 2003 278 6 4082
76. BS containing 0 5 mg ml RNAse A Agitate tube gently Incubate at 37 C for 30 min Add 5 ml PBS pellet at 1100 rpm 8 min at 4 C Decant supernatant 7 Agitate pellet then resuspend with 1 ml of HCl Triton solution Vortex gently Incubate on ice for 10 min Add 5 ml PBS pellet at 1100 rpm for 8 min at 4 C Decant supernatant and blot gently to dry 8 Add 1 ml sterile HPLC water vortex gently Incubate at 97 C for 15 min Note be sure to cap tubes loosely to allow for expansion and keep lid on water bath to control heat range 9 Immediately chill in ice water bath for 15 min Add 5 ml PBS containing 0 5 Tween 20 Pellet at 1100 rpm 8 min at 4 C Decant supernatant 10 Add 100 ul PBT Agitate gently with transfer pipette Transfer sample to a 1 5 ml microcentrifuge tube 11 Add 100 ul of a 1 100 dilution of anti BrdU Ab Incubate at RT for 30 min Add 1 2 ml PBT Pellet at 3200 rpm for 2 min in a microcentrifuge Eppendorf Centrifuge 5415 C Decant supernatant Note Speed and time are IMPORTANT at this point the pellet is very loose and it may be necessary to re pellet 12 Add 150 ul of a 1 20 dilution of FITC conjugate Ab Incubate at RT for 30 min Add 1 2 ml PBT Pellet at 3200 rpm for 2 min in a microcentrifuge 13 Resuspend pellet in 0 5 ml PI stock solution Transfer sample to a 0 5 ml snap top microcentrifuge tube Cover samples with foil 14 Leave samples at RT for 1 hr before taking them to the Flow Lab A5
77. Cell to Cell Communication as a Strategy to Regenerate Three dimensional Tissue by Ricardo Antonio Rossello A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy Biomedical Engineering in The University of Michigan 2007 Doctoral Committee Professor David H Kohn Chair Professor Paul H Krebsbach Professor Martin A Philbert Assistant Professor Michael Mayer 3D Rendering of Pluripotent Adult Stem Cells Bone Marrow Stromal Cells Ricardo Antonio Rossello All Rights Reserved 2007 Dedication To my beloved mother and father for never telling me how to live but living and letting me watch and to Prof Jorge W De Jesus il Acknowledgements As I conclude my current academic pursuits I would like to acknowledge all the people who have helped me along the way and in more ways than one to complete this work I am grateful for all of the friends I have made while in Michigan you know who you are All of you played a vital role in the successful completion of my work and will always hold a special place in my heart In particular I would like to thank my surrogate family in Michigan the Cervi s Without their care love and attention I would have never been able to weather the storm To my lab mates Kyungsup Shim Sharon Segvich Lihn Luoung Nadder Sahar Joseph Wallace Erin Gatenby Shan Lee Lisa Winkle I deeply appreciate your help advice and most o
78. Designing a Filtration Device for Scaffolds Ricardo Rossello A filtration device has proven to increase the cell retention in porous PLGA and Mineralized PLGA scaffolds significantly Appendix 1 The basic principle is to have cell suspension filter through tightly packed scaffolds in order to 1 create a gradient so that cells can pack the scaffold and 2 those cells that filter through will have other 168 opportunities to attach as the suspension cycles The basic components of the apparatus figure 1 are 1 Peristaltic Pump 2 Tubes 3 Chamber There are other components that may become essential based on the experiment such as a reservoir of media Although these three components are simple in essence they need to be tailored to the particular experiment I will discuss the design criterion needed to adjust the apparatus for any particular experiment Peristaltic Pump Non Stick Tubes Basic Schematic Figure 1 Basic Schematic of a filtration device to seed cells into Scaffolds Factors of Importance Design Parameters When designing the filtration experiments the first order of business is determining the dimensions of the scaffold Diameter Thickness mm3 This is very important because based on these all other parameters have to be determined Scaffold Diameter will drive 169 the diameter of both the chamber and tubes Scaffold thickness will determine how many scaffolds you can use to get an
79. Lk p T J L B J 7 l r Lr he A F z yy Perfu SYS FloCulture Perfusion System User Manual By Ricardo Rossello and 450 Group 138 INTRODUCTION The PerfuSys FloCulture Perfusion System is a perfusion system specially designed for bone cell cultures The perfusion system consists of a chamber pump and tubing and is designed to provide a laminar flow of media across a cell plate at different user controlled flow rates To ensure laminar flow low flow rates must be used Media circulates through perfusion system continuously to facilitate transport of nutrients and waste without the need to constantly change the media Once the perfusion system is set up and turned on it can run continuously for up to 24 hours The PerfuSys FloCulture Perfusion System is an excellent tool for users who want to test cell growth and survival under different test conditions while being confident that all other variables remain constant The perfusion system is easy to operate and it provides reliable results 139 NOTES ON SAFETY The warning signs and icons shown and explained on this page are intended to assist you in using the product correctly and safely to prevent harm to you others and the system The icon indicates something that is mandatory The 4 amp caution icon indicates matters in which bodily harm or material damage to the product or local environment could occur as a result of incorrect handling The icon indi
80. M NaCl 4 0 mM KCl 0 5 mM MgSO4 1 0 mM MegCl2 4 2 mM NaHCO3 2 5 mM CaCl2 and 1 0 mM KH2PO4 SBF was buffered to maintain a pH 7 4 with Tris HCl and washeld at 37 C for the duration of the incubation period 2 2 5 Transplantation into host mice All procedures involving animals were performed in accordance with protocols approved by the University Committee on Use and Care of Animals UCUCA at the University of Michigan A total of 60 implants 30 BMSC loaded implants and 30 transduced cell loaded implants were transplanted subcutaneously into 15 nude mice as previously described Briefly nude mice nu nu were anesthetized by an intraperitoeal 26 injection of 100 mg kg ketamine and 10 mg kg xylazine An incision was made on the back of each mouse and implants were inserted into the subcutaneous cavities Four gelatin cell constructs 2 BMSC 2 BMP 7 were placed per mouse and wounds were closed with surgical clips The location of the constructs within each mouse was randomized 2 2 6 Micro CT image acquisition and analysis Ossicles were scanned on a high resolution cone beam micro CT system Enhanced Vision Systems now GE Healthcare Preclinical Imaging London Ontario Canada while immersed in distilled H20 The x ray source voltage and current were 80 kVp and 80uA respectively To reduce the potential for beam hardening artifact the x rays were passed through a 0 2mm Al filter immediately upon exiting the source and th
81. The program then integrated all the perimeters to determine the 3D surface area and the number of voxels inside the surface defined the total volume High density voxels outside of the 3D surface and unattached to the ossicle were discarded while voxels inside were evaluated at the specified thresholds to determine the BVF which was calculated as the number of voxels above the threshold relative to the total number of voxels Using this method a threshold of 1100 was used to re construct a rendered image of the ossicles and determine their distribution A custom program was developed to determine the distribution of regenerated bone as a function of the distance to the geometric center of each ossicle Using the 2D Micro CT sections the centroid was calculated with a MatLab script and used as a frame of reference to divide the ossicles into regions Defining the centroid as the o percentile and the edge as the 100 percentile boundaries were calculated by lines that radially pointed into the center from the edges Cortical bone was determined to be the 102 continuous bone formation in the periphery of the ossicle The program calculated this thickness by averaging the thickness at 10 degree increments from the geometric center of the ossicle total 36 data points per ossicle Trabecular bone volume fraction was determined to be the remaining bone fraction normalized to the potential trabecular space total bone volume cortical bone v
82. Winn SR Tissue engineering of bone in the craniofacial complex Ann N Y Acad Sci 1999 875 379 385 Ishaug SL Crane GM Miller MJ Yasko AW Yaszemski MJ Mikos AG Bone formation by three dimensional stromal osteoblast culture in biodegradable polymer scaffolds J Biomed Mater Res 1997 36 1 17 28 Katz RW Hollinger JO Reddi AH The functional equivalence of demineralized bone and tooth matrices in ectopic bone induction J Biomed Mater Res 1993 27 2 239 245 88 17 18 19 20 21 22 Ls 24 Ducheyne P Qiu Q Bioactive ceramics The effect of surface reactivity on bone formation and bone cell function Biomaterials 1999 20 23 24 2287 2303 Jorgensen NR Henriksen Z Brot C et al Human osteoblastic cells propagate intercellular calcium signals by two different mechanisms J Bone Miner Res 2000 15 6 1024 1032 Triggle DJ L type calcium channels Curr Pharm Des 2006 12 4 443 457 Romanello M Veronesi V D Andrea P Mechanosensitivity and intercellular communication in HOBIT osteoblastic cells A possible role for gap junction hemichannels Biorheology 2003 40 1 3 119 121 Berridge MJ Lipp P Bootman MD The versatility and universality of calcium signalling Nat Rev Mol Cell Biol 2000 1 1 11 21 Romanello M D Andrea P Dual mechanism of intercellular communication in HOBIT osteoblastic cells A role for gap junctional hemichannels J Bone Miner Res 2001 16 8 1465
83. a MEM and plated at a density of 30 000 nucleated cells cm and cultured under the same conditions The culture medium was replaced three times per week and at near confluence 90 the adherent cells were washed with phosphate buffered saline solution and enzymatically detached by means of a 0 25 trypsin EDTA solution Sigma St Louis MO Cells were re plated at a density of 30 000 cells cm and a subsequent passage performed 7 10 days after when cells achieved near confluence Viral Vector Production Vectors encoding Cx43 and BMP 7 were produced by the University of Michigan Vector Core employing standard transient transfection methods to produce replication incompetent viral vectors The development and production of adenovector encoding BMP7 under the transcriptional control the human CMV promoter has been previously described Similarly the development and production of the lentiviral vector encoding Cx43GFP has also been previously described The latter vector system was based on the human immunodeficiency virus Type 1 HIV 1 and the four plasmids Rossello et al 197 required for vector production were kindly supplied by Professor Inder Verma from the Salk Institute San Diego USA Empty vectors or vectors encoding GFP were also produced for lentivirus LVGFP LVMT and adenovirus ADCMVMT as a control group for the experiments Rossello et al Transduction of BMSCs BMSCs were plated at a density of 2 25 mill
84. a fraction determined via H amp E and von Kossa Regressions were performed for each cell type and time independently and by pooling cell types and time SigmaStat 3 1 Comparisons between mean BVF or area fraction and ashing or histology at each threshold were also carried out via t tests paired two 30 tailed Because this range of thresholds can vary on different scanners the ratio of these thresholds to the bone HU value was calculated and will be reported in addition to the actual grayscale values used Two way analyses of variance ANOVA were used to evaluate effects of time and cell type on overall volume BVF and mineral content One way ANOVA on bone fraction as a function of cell type and region were also performed All analysese were performed using SigmaSTAT version 3 1 using Turkey s HSD post hoc test Statistical significance for all tests was assumed if the p lt 0 05 2 3 Results 2 3 1 Threshold analysis There was no difference in the optimal threshold range defined as having an R gt 0 85 between ossicles formed from BMSC and BMP7 transduced cells Therefore thresholding results are reported on data pooled from both cell types Based on the comparison of wCT BVF calculations with ash fraction data there was a slight difference in the optimal threshold with time of implantation Fig 2 At 4 weeks a threshold of 1000 yielded the highest coefficient of variation Fig 2a whereas the threshold with the hig
85. aced into a new one with fresh a MEM The process was done 5 6 times until the pH of the a MEM in the tube matched that of the sterile a MEM pH 7 1 The scaffolds were then left to soak in the media overnight before seeding 3 2 5 Cell Seeding The experimental design assessed three methods of seeding static dynamic and filtration at three time points 1hr 6hrs and 24hrs using both mineralized and non mineralized PLGA scaffolds 6 scaffolds were used for each procedure for a given time point and material Static seeding was performed in 24 well plates by pipetting a cell suspension into the scaffold Each well contained 1 scaffold A cell suspension of 1ml a MEM containing 10 fetal bovine serum FBS and antibiotics 100 ug ml penicillin G and 100 IU ml streptomycin at 37 C in 5 CO2 95 air and cell density of 0 8EE6 cells ml was used in static dynamic and filtration seeding experiments The scaffolds were placed into the incubator at 37 C in 5 CQO2 95 for all seeding methods immediately after Dynamic seeding was performed by trapping two scaffolds in a 15 ml falcon tube between meshes with a stir bar outside the meshes in the bottom of the tube Because the number of cells was desired to be kept constant about SmL of media were added to the cell suspension so that both scaffold and stir bar would be completely submerged The cell suspension was poured into the tubes and these were placed in a stir plate inside an incu
86. affinity and may promote important signaling cascades In order to form tissue equivalents cells must be properly seeded into porous scaffolds These seeding conditions may dictate the ultimate properties and direction of the new tissue Static or gravitational seeding is the most commonly employed means of 2799 daa entrapping the cells in the scaffol However this method has inherent limitations in cell retention and localization In rigid scaffolds cells usually attach at very low percentages and show dispersed localization producing large variability in the resulting 24 40 Furthermore the ability for cells to adhere into the substrate is of engineered tissue pivotal importance When cells attach to the substrate in high numbers higher cellular coverage inside the scaffold is possible Also as cells attach expeditiously they can start the biological processes and signaling that will lead to proliferation migration and differentiation 7 13 Seeding Strategies and Template Chemistry for 3D tissue engineered constructs To address the seeding density and localization problem an alternative method of seeding can be done by filtering the cells into the scaffold in a cyclic manner This method circulates the cell suspension through the scaffolds with a small pressure gradient applied by a peristaltic pump The homogeneous cell suspension that filters through the scaffold is cycled through and may produce higher cell density an
87. aining both membrane tracker and calcenin AM The transfer fraction of cells was determined normalizing the value of the transfer region to the total number of recipient cell counts This experiment was performed with n 6 groups Statistical differences in percent of dye recipient cells were measured using a 2 way ANOVA on template and seeding strategy p lt 0 05 3 2 8 RTPCR Analysis of differentiation markers BMSCs were seeded in Mineralized and non mineralized scaffolds by static filtration and micromass strategies The seeded constructs were placed in 24 well plates supplemented with osteogenic media a MEM media 10 Fetal Bovine Serum 1 Pen Strep 1 100x B Glycerophosphate 1 L ascorbic acid phosphate 0 05 0 05 Dexamethasone An additional group in which 1 5mM of Ca was added to osteogenic media was tested to assess the effects of soluble calcium Media was replenished every 24 hours to ensure optimal nutrient contents in the surface of the scaffolds At 2 8 and 16 days for analysis real time PCR was used to detect the expression of two bone differentiation markers Alkaline Phosphatase ALP and Osteocalcin OCN Primers and TaqMan probes were purchased ABI The primer 67 sequences utilized were as follows OCN 5 CCAGCGACTCTGAGTCTGACAA 3 and 5 CCGGAGTCTATTCACCACCTTACT 3 ALP 5 GCCCTCTCCAAGACATATA 3 and 5 CCATGATCACGTCGATATCC 3 Cells seeded scaffolds or in 12 well plates were trypzinized after 2 8 an
88. and allows for flow rates from 0 3 to 90 ml min based on the inner diameter of the tubing used 171 Chamber Design The design of the chamber is the primary concern in designing the system The chamber must be designed such that there is laminar flow trough the scaffolds Sheer stress and uniformity of flow are variables to take into account which can affect a biological outcome The chamber must also be biocompatible and sterilizable There is no specific upper constraint on size except that it fit in the incubator but the larger the chamber the more media will be required and the larger the scaffold may have to be this should not be a concern for our scaffolds are small For scaffolds the chamber will be a cylindrical non stick glass tube that will be sterelizable these glass vials are sold on fisher pending the size Typically this tube is the same one used for casting the scaffolds A chamber can also be made from Teflon if a particular size is desired The tradeoff is the observational capabilities of glass versus the ability to have a machined chamber with the specific size that is desired Other options are acceptable so long as they follow the basic criterion that the chamber needed be biocompatible sterilizable and non adhesive for cells Inlets and outlets to the chamber can be machined if such a difference in cross sectional areas 1s desired However for most cases matching the inner diameter of the tubes to the outer d
89. and incorporate cells suspension into it by gently dipping sponge to the bottom of the tube Co culture the cell sponge at 37 C in an incubator for 30 minutes 4 Take tubes and surgical instruments to Room 6203 SCID room Anesthesize mice figure 1 with intraperitoneal ketamine cocktail Ketamine cocktail 0 3 ml Ketamine 0 2 ml Xylacine 0 5 ml Saline Dosage 50 100 ul mouse 181 Make two small vertical incisions 1 cm long on the back along the spine One incision at hindlimbs level and the second one at forelimbs level Make bilateral subcutaneous pouches by dissecting the skin with blunt scissors Place one sponge in each quadrant of the animal s back Total 4 sponges animal Suture the incision to close wounds figure 2 Monitor mice recovery until the next day Removal the suture 2 weeks post operation if not absorbable Figure 1 Inject mice by grabbing the skin over the cervix and Holding the tail and leg if necessary with one of our loose fingers a Figure a Suture the Incision 182 A9 Cell Seeding by Micromass Ricardo Rossello and David H Kohn I Equipment and Supplies Chemicals 70 Ethanol bottle for instruments amp spray bottle Ice PBS 1X Hanks Balanced Salt Solution HBBS Gibco BRL 14170 120 Fetal bovine serum Gibco BRL 16000 044 Alfa MEM Gibco BRL Cat 12571 063 alfa MEM 1X Media Note All media preparation and other cell culture work must
90. and intensity to determine whether the levels of Cx43 expression were significantly different p 0 05 between cell groups The average of the total Cx43 or Cx43 GFP fusion gene was normalized against GAPDH for BMSCs BMSCs transduced to overexpress Cx43 GFP and BMSCs transduced to overexpress GFP All values were later normalized to the expression of BMSC Cx43 content 4 2 4 2D and 3D Cell Culturing For 2D cultures 1 million cells were cultured in 6 well plates Sarstead and grown to 90 confluence 3D culture experiments were performed by seeding cells in gelatin sponges Gelform Pharmacia amp Upjohn Kalamazoo MI Two experiments were done 1 overall assessment of cell to cell communication and differentiation in 3D construct relative to 2D cultures 2 assessing the differences in these parameters between the surface and core regions of cell seeded 3D scaffolds In the 3D studies the gelatin sponges were designed to have 3x3x3mm dimensions Studies that examined peripheral vs core communication and differentiation were performed by entrapping two sponges in 96 well plates corning one on top of the other The thickness of the top 98 sponge was set at 0 5mm compared to 2 5mm for the bottom sponge Cell gelatin constructs completely covered the side of the plates The bottom sponge is taken to be the core section of the scaffolds as the walls of the well plate serve to block any flux or communication from the bottom or side
91. ansduction efficiency although this is proportional to increasing cell death as VSVG and the localization molecules can be toxic We usually let the 911 cells go overnight Multiple infections may be preformed on the same cells to increase the transduction efficiency To do this allow the primary infection to stay on the cells overnight replace the supernatant with media and allow the cells to recover for 24h and then infect again overnight This cycle may be repeated 3 4 times 190 A14 Repair of craniotomy defects with genetically modified cells Ricardo Rossello Zhuo Wang and David Kohn All experiments were performed in accordance with the University Committee on Use and Care of Animals UCUCA Animals were housed in a light and temperature controlled environment and given food and water ad libitum Animals 4 to 5 week old female SCID mice N NIH bg nu xid Charles River Laboratories Raleigh NC USA Chemicals Ketamine Xylacine Saline Consumables Sterile Gelfoam sponge 12 sq cmx 7 mm Sterile gauze Serum free alpha MEM serum 6 well culture plate Equipment Laminar Flow Hood Surgical scissors blade 15 and scalpel 4 0 Chromic Gut suture Procedure 1 Under sterile environment place the Gelform sponge onto a 100mm Petri Dish Slice the sponge horizontally in half with the scalpel 3 5 mm height each Use scissors to cut the Gelform into 3 5 mm cubes place the Gelform cubes onto a pre wet gauze by alpha
92. at 4 and 12 weeks The trabecular like BVF was significantly higher in ossicles formed with cells co transduced with Cx43 and BMP7 after 8 and 12 weeks of implantation Fig 5c In the 4 week period the BMSC Cx43 group had significantly more trabecular like bone formation than the BMSC group p lt 0 001 These differences were not observed at the 8 week period p lt 0 56 but were again evident in the 12 week time point p lt 0 001 In cells transduced with BMP7 cells overexpressing Cx43 exhibited significantly more trabecular BVF p lt 0 001 at all time points Furthermore the effect of the co transduction in bone in growth was significantly greater when cells were co transduced p lt 0 001 against all other groups suggesting a synergistic effect in the development and growth of bone 4 4 Discussion Our data demonstrates that Cx43 overexpression can be a platform to enhance cell to cell communication throughout 3 dimensional tissue and as a tool to regenerate tissue in vivo Specifically we demonstrated that cells expressing higher levels of Cx43 exhibit higher GJIC more osteogenic differentiation in vitro and when transplanted form tissue of larger volume and more uniform spatial distribution Using Cx43 as a signaling platform can have profound effects in both cell based tissue engineering and 108 targeted gene therapy Tissue engineering will benefit from the production of higher volumes of more highly distributed tissue
93. at a sample size equal to six n 6 wells or 99 gelfoam constructs A 2 way ANOVA was used to determine significant differences between 3D and 2D realms and cell type Two tailed student t test was applied to determine significant differences between cells in surface of the 3D scaffold outer 0 5mm and core inner 2 5mm of the 3D constructs p 0 05 4 2 6 Real time PCR Analysis Real Time PCR was used to detect the expression of two bone differentiation markers alkaline phosphatase ALP and osteocalcin OCN on BMSC control groups and cells modified with Cx43 and or BMP7 PCR was performed using ABI Prism 7700 sequence detection system Primers and TaqMan probes were designed using Primer Express design software ABI The primer sequences utilized was as follows OCN forward 5 CCAGCGACTCTGAGTCTGACAA 3 and reverse 5 CCGGAGTCTATTCACCACCTTACT 3 Cells seeded scaffolds or in 12 well plates were trypzinized after 2 8 and 16 days to remove cells and the total RNA was extracted Trizol invitrogen Corp The RNA was purifed RNeasy Quigen and treated with DNAse I Cycling conditions were as follows 50C for 2 minutes and 95C for ten minutes followed by 50 cycles of 95C for 15 seconds and 60C for 1 minute No template control analyses were run for each primer set and 18s rRNA ABI endogenous control was run for each sample Analysis was performed by first setting an appropriate standard threshold level in the linear part of the reac
94. at overexpression of Cx43 enhances GJIC in 3D 104 BMSCs BMSCs transduced with BMP7 and BMSC Cx43A7 exhibited significantly less calcenin transfer in the core of the scaffold relative to the periphery Fig 2b p BMSCs lt 0 002 p BMP7 lt 0 001 p Cx43A7 lt 0 013 However cells overexpressing Cx43 exhibited similar GJIC transfer in the surface and core sections of the scaffold Our results imply that cell cell communication is compromised in cells entrapped in the core of 3D tissue engineered equivalent and that overexpressing Cx43 1s one potential solution to overcome this problem Our data therefore suggests that overexpressing Cx43 provides a platform that enables a more amplified level of cell to cell communication 4 3 3 Cx43 overexpression enhances overall and spatial distribution of differentiation markers Increased Cx43 expression in BMSCs was associated with significantly higher levels of osteocalcin OCN mRNA relative to control groups Fig 3a Two days after differentiation was induced cells overexpressing Cx43 and Cx43 BMP7 exhibited significantly higher levels of OCN mRNA p lt 0 001 against all groups and no significant difference between them p 0 692 Cells overexpressing BMP7 only expressed higher levels of OCN than BMSCs p lt 0 023 although significantly less than cells overexpressing Cx43 p lt 0 001 Similar trends were observed on the gin day after differentiation was induced although OCN expres
95. ation between area fraction of regenerated bone determined by micro CT and area fraction determined on same section by H amp E staining 000000000 46 Figure 2 4 Comparison of von Kossa images that have been stitched together left and the analogous uCT planes right at a 4 weeks b 8 weeks and c 12 weeks for sections of ossicles regenerated from BMSCS ccccccccccssssssssesssseeeeeeeceeeeeeeeeeeeeaaaaas 47 Figure 2 5 Correlation between area fraction of regenerated bone determined by micro CT and area fractiohn of mineral determined by von Kossa staining on the same Secole SREE decent asau ees E tee needa eee 48 Figure 2 6 Bone regeneration as a function of cell type and time ee eeeeeeeeees 49 Figure 2 7 Overall volume and total mineral ash content of ossicles regenerated from transplanted BMSCs and BMP 7 transduced cells cccccccccccssssseseeceeceeeeeaeeeeees 50 Figure 2 8 Quantification of mineral distribution on von Kossa stained slides for the 4 WEEK SAMDICS i ossionaneseomuseiuanasousmesueeaacowenusubimnasousnusironnat dase saurenmne teaieauronnee lensed 51 Figure 2 9 Correlation between volume fraction of regenerated bone determined by uCT at different thresholds and mineral fraction determined by ashing when BMSCs are in a ceramic scaffold for 6 weeks cccccccsceccsccscecceccsccscsccnccscaccscescuscscescscesencescacess 52 CHAPTER 3 Figure 3 1 Percent of cells adhering to PLGA A
96. bator The stir intensity was set at 150rpm In filtration seeding 4 64 scaffolds were placed in 4 glass cylinders of the same radius The cell suspension was circulated through the scaffolds with a small gradient applied by a peristaltic pump 1 37ml min through small non stick tubes silicon tubes Small Parts Inc D 3 5mm A homogeneous cell suspension is kept by adding a stir bar to the suspension reservoir Scaffolds D 4mm t lmm were placed in a cylindrical scaffold chamber ID 4mm 20mm The chamber is made of non stick glass so that the cells won t attach to its surface and only attach to the scaffolds In order to generate a laminar profile and keep the pH at 7 4 the length of the tubes was set at 0 3m Appendix Al A5 The complete system was placed in a CO2 incubator to promote gas exchange through the tubes Cells that are not seeded in the first filtrate are passed through several times until maximum retention is reached The mean residence time of cells was approximately 30 mins Therefore every 30 mins the direction of the flux was changed to avoid directional bias on the scaffolds In Micromass seeding the cell suspension was more concentrated and pipetted into the middle of the scaffold 4 0EE6 cells ml 3 2 6 Cell Counting and Histology After seeding the scaffolds were washed five times with MEM to retrieve all the free unattached cells The five wash benchmark was chosen after test studies confirmed that the
97. be created with the aim to regenerate full tissue equivalents Because the micromass 1s a localized strategy of highly dense clusters of cells these can be strategically placed within the scaffold to maximize cell viability nutrient flux and tissue regeneration With the aid of both mathematical modeling and experimental data the location and size of the micromasses can be arranged to optimize outcomes in vitro and in vivo Furthermore it is likely that the optimal array of micromasses would vary as a function of scaffold geometry 128 environment cell type and tissue The resulting models would provide an element of flexibility that optimizes tissue regeneration under different circumstances Both filtration and micromass strategies are simple and inexpensive alternatives to other strategies aimed to enhance tissue formation such as addition of inductive agents and genetic engineering Based on the simplicity of these techniques they should be implemented over the traditionally employed static seeding modality Template chemistry was also assessed as an initial and time dependant exogenous strategy to regenerate tissue Specifically for bone we demonstrated that a biomimetic scaffold rich in calctum phosphate serves as a better template than an organic template to enhance osteogenic differentiation in vitro and regenerate higher volumes of tissue engineered bone However our data shows that mineralization of the substrate does not enha
98. cally different and the results in one culture system do not necessarily translate to the other Furthermore our results suggest that cell to cell communication may be a main reason for such as difference observed in the two culture systems and that overexpressing Cx43 can mediate apparent differences in GJIC between the two systems Both BMSCs and BMSC BMP7 express significantly higher levels of OCN in the surface relative to the core of the scaffold Fig 3c p lt 0 001 for both Furthermore the effect of BMP7 is significantly neutralized in 3D showing a 4 fold decrease in OCN expression relative to 2D monolayer and only a moderate increase over the BMSC group in 3D p lt 0 092 When Cx43 is overexpressed along with BMP7 the differences 106 between 2D and 3D are not present Combining this observation with the results showing that cells overexpressing Cx43 produce similar levels of OCN in surface and core sections of the scaffold strengthen the hypothesis that Cx43 1s a potent signaling platform for 3D cultures that can create a spatially uniform distribution of differentiated cells 4 3 4 Cx43 Gene Modified Cells Regenerated More Bone In Vivo A qualitative comparison between bone formed from transplanted BMSCs Fig 4 a b c and BMSCs overexpressing Cx43 Fig 4 d e f shows that overexpressing Cx43 led to more bone formation and an increased cortical thickness Bone regenerated by BMSCs BMSCs overexpressing BMP7 and BMSCs overexpressi
99. cates extra information A CAUTION AVOID DIRECT CONTACT WITH THE CELLS AND MEDIA Cells can carry diseases that are harmful to humans Dispose of materials correctly and sterilize equipment thoroughly between each experiment to prevent the spread of disease Use materials that are biocompatible and non toxic when replacing parts that come in contact with the cells or media Follow sterilization protocols in this user manual Avoid electrocution when dealing with pump plug and electrical socket 140 Figure 1 LAYOUT DIAGRAM _ PFPenstalic pump provides Fl source for constant media fow Power Cord _ Dial for changing flow ry rates LL Ono clockwise and Roller Bracket Screws i counterclockwise Tubing Sleeve ai Tubing connector connects PharMed Tubing two types of tubing ID 1 16 OD 1 8 z Silicone Tubing 7 li Chamber lid j Hg Screws 6 to 7N secure lid to chamber Inlet pot n l Outlet port Chamber holds cell series Motch for plate plate and media Cell plate removal surface for cells to grow 141 ae 12 QUICK REFERENCE GUIDE Prepare the cells by seeding the cells on a sterile cell plate submerging the cell plate in a container of media and placing the container in the incubator for 48 hours to allow the cells to adhere to the plate and begin growing Sterilize all the components of the perfusion system chamber tubing pump
100. cending limb functions Adv Nephrol Necker Hosp 1987 16 125 136 Logeart Avramoglou D Anagnostou F Bizios R Petite H Engineering bone Challenges and obstacles J Cell Mol Med 2005 9 1 72 84 Janouskova O Fales I Kobylka P Vonka V Gene therapy of the graft versus host reaction Cas Lek Cesk 2003 142 9 530 533 Valimaki VV Aro HT Molecular basis for action of bioactive glasses as bone graft substitute Scand J Surg 2006 95 2 95 102 Langer R Vacanti JP Tissue engineering Science 1993 260 5110 920 926 Laurencin C Khan Y El Amin SF Bone graft substitutes Expert Rev Med Devices 2006 3 1 49 57 Lecanda F Towler DA Ziambaras K et al Gap junctional communication modulates gene expression in osteoblastic cells Mol Biol Cell 1998 9 8 2249 2258 Goldstein AS Effect of seeding osteoprogenitor cells as dense clusters on cell growth and differentiation Tissue Eng 2001 7 6 817 827 10 10 11 12 13 14 15 16 Altman GH Horan RL Martin I et al Cell differentiation by mechanical stress FASEB J 2002 16 2 270 272 Cherian PP Siller Jackson AJ Gu S et al Mechanical strain opens connexin 43 hemichannels in osteocytes A novel mechanism for the release of prostaglandin Mol Biol Cell 2005 16 7 3 100 3106 Romanello M Veronesi V D Andrea P Mechanosensitivity and intercellular communication in HOBIT osteoblastic cells A possible role for gap junc
101. chment and growth in vivo and in vitro a A suitable cell type can be found in the bone marrow stroma which consists of a heterogeneous population of cells that provide the structural and physiological support for hematopoetic cells The stroma contains cells with stem cell like characteristics called Bone Marrow Stromal Cells BMSC These cells have the potential to differentiate into osteoblasts chondrocytes adipocytes fibroblasts and hematopoetic cells BMSCs are a heterogeneous mixture of cells isolated from bone marrow aspirate which adhere to tissue culture plastic They contain a subpopulation of mesenchymal stem cells capable of differentiating into specific tissue given the proper biological cues However in vivo transplants of BMSCs and other cells used to regenerate tissue engineered bone exhibit deficiencies in formation as the inner core of the ossicles lacks the nutrient transport necessary to thrive Several important considerations must be taken into account to improve the initial conditions of the cell scaffold construct Cell seeding and cell substrate adhesion properties are of paramount concern Cell seeding conditions control the initial number of cells seeded and the localization of these cells Cyclic seeding conditions such as filtration may enhance adhesion because cells have the opportunity to adhere several times Cell substrate interactions are important because they determine the adhesion
102. cone tubing for peristaltic pumps it has a 75 hour operating life before failure which means it would have to be changed often based on the 6hour optimal time period every 12 runs or so Appendix 1 On the other hand Pharmed tubing s operating life before failure is over 1000 hours so it lasts a long time in the pump However PharMed does not meet an acceptable gas permeability requirement so the Silicone tubing is needed for part of the system to allow for the necessary gas exchange Figure 9 shows the gas permeability coefficient of the two types of tubing for various gases Tube specs and info in appendix 3 Permeability Coefficient Comparison PharMed Tubing Silicone Tubing ja 16 1 Oooo JOGO Permeability Coefficient W10 DO Carbon Dioxide Nitrogen DI gen Figure 9 The permeability of carbon dioxide is over 25 times larger in Silicone tubing than in PharMed tubing Pump The peristaltic pump is the research standard for cell culture perfusion systems The main reason for this is that there is no contact between the media and the pump This eliminates the pump from being a possible contaminant to the cells being cultured The peristaltic pump also provides a constant flow at variable flow rates Our lab purchased the PTP 2408 drawer labeled peristaltic pump in 2228 trom Small Parts Inc please note that based on your requirements you may need a different peristaltic pump It has a pump speed of 1 5 26 RPM
103. cterized by sporadic bone formation without marrow cavity or entrapped cells fig SF Not only did ossicles form from filtered and micromass seeded scaffolds with higher volumes of bone but the distribution of tissue was significantly different in these two strategies When seeded by filtration cells produced a peripheral shell of bone with diminished bone formation in the core of the ossicle This may be due to cells 78 thriving and differentiating in the periphery of the construct while transport is increasingly impaired thereby compromising tissue regeneration in the core of the scaffold This contrasts the spatially distributed formation of bone that characterizes ossicles regenerated by micromass seeded cells This increased presence of bone formation in micromass seeded ossicles may be due to both cell migration nutrient transport and a gradient of differentiation Because cells are seeded in the core of the scaffold at high densities and differentiation starts promptly it enables formation of bone in the center Cells may also migrate outward or inward from the body and start differentiating at a later time causing a differentiation gradient The end result is a more spatially distributed and uniform tissue equivalent Future studies may look at the potential effects of migration in micromass seeded scaffolds The distribution studies in tandem with the overall analysis of the ossicles strengthens the claim that altering the initia
104. d 16 days to remove cells and the total RNA was extracted Trizol invitrogen Corp The RNA was purifed RNeasy Quigen and treated with DNAse I Cycling conditions were as follows 50C for 2 minutes and 95C for ten minutes followed by 50 cycles of 95C for 15 seconds and 60C for 1 minute No template control analyses were run for each primer set and 18s rRNA ABI endogenous control was run for each sample Analysis was performed by first setting an appropriate standard threshold level in the linear part of the reaction for each primer The crossing value of this threshold was determined C for each sample Using the manufacturer s protocols ABI Prism 7700 Sequence Detection System User Bulletin 2 mRNA expression levels for each sample primer were normalized to endogenous rRNA 18S levels and the results were reported as a fold change relative to the OCN expression of BMSCs filtration seeding day 2 Filtration seeding was chosen as the normalizing seeding condition because the variation between samples was relatively low compared to static and micromass seeding techniques All reactions were performed in quintuplets Three 1 way ANOVAs were used to determine significant differences as a function of seeding condition scaffold and time Cell seeded constructs were trypzinized after 2 8 and 16 days to remove cells and the total RNA was extracted Trizol Invitrogen Corp The RNA was purifed RNeasy Quigen and treated with DNAse I Cycl
105. d even cellular distribution The increased cell density nutrient flux and sheer stress point to the potential of producing higher cellular adhesion and lower variability among samples 21 23 As an added benefit the oscillatory flow gradient increase proliferation and differentiation in BMSCs A higher density of cells is desired to increase the cell cell contacts that enable cellular communication and signaling However such high densities may produce an adverse microenvironment due to a supersaturation of cells inhibiting transport Passive nutrient diffusion is one of the biggest obstacles in 3D cell scaffold composite systems Particularly for bone the outer layer of cells and tissue prohibits proper exchange of nutrients and byproducts inside the ossicle s core One way to bypass this is by seeding cells in dense micromasses These micromasses are placed in a particular location in the scaffold center leaving less crowded areas were nutrients can flow through Micro masses could provide the benefits of higher density cell cell communication while allowing for transport of nutrients and cellular byproducts as well as migration of cells that would enable a differentiation gradient from the core to the periphery To create a favorable biomimetic environment a mineralized layer on a PLGA scaffold can be a dominant factor for the enhancement of cell adhesion and The increased adhesion will lead to a higher density of ce
106. d to disconnect the inlet outlet ports from the Teflon b Acrylic lid 1 Under sterile hood soak in 70 ethanol for 1 minute and remove 11 Let lid dry under the sterile hood for 20 minutes 11i If further sterilization is desired treat with UV for 5 minutes Silicone and PharMed tubing and tubing sleeve for pump Autoclave Steam for 30 minutes at 30 PSI 270 F Peristaltic Pump Thoroughly spray all pump surfaces with 70 ethanol before assembling system under sterile hood Cell plates a Under sterile hood soak in 70 ethanol for 1 minute and remove b Let the plates dry under the sterile hood c If further sterilization is desired treat with UV for 5 minutes 145 DETAILED HOW TO S EXPERIMENTATION PROCEDURE A GENERAL ASCEPTIC TECHNIQUE FOR CELL CULTURE l ae First wipe work area and hands with 70 ethanol To prevent contamination never uncover containers such as sterile flasks bottles and Petri dishes until they are to be used Replace cover immediately Never leave containers open to the environment Unwrap sterile pipettes ONLY at the time of use Sterile pipettes do not have to be flamed Pipetting your cells with a hot pipette will kill them When removing the cap from any container do not place the cap on any surface Keep cap interior facing downward This will prevent contamination by precipitate If possible tilt the container so that any falling microorganisms fall onto the lip rather than
107. e specimens were immersed in dH2O during the scanning process Projection images were acquired over 198 degrees using 2x2 binning and an exposure time of 1100 ms and four frames were averaged for each projection to improve the signal to noise ratio The projection data was then corrected and reconstructed using the Feldkamp cone beam algorithm to create three dimensional images with an isotropic voxel size of 18um The scanner was calibrated once daily using a phantom that contained air water and hydroxyapatite Bone volume fractions were determined by using a MatLab program designed to integrate all grayscale voxels above a particular threshold To determine the overall volume of the ossicles the program determined the perimeter of each 2D uCT slice by tracing the outer edge The program then integrated all the perimeters to determine the 3D surface area and the number of voxels inside the surface defined the total volume Zi High density voxels outside of the 3D surface and unattached to the ossicle were discarded while voxels inside were evaluated at the specified thresholds to determine the BVF which was calculated as the number of voxels above the threshold relative to the total number of voxels Bone volume fractions were calculated for all samples at a range of thresholds 600 2000 in increments of 100 in order to create a library of BVF values for regression against ash fraction and histologically determined bone and mineral frac
108. e 2 7 Overall volume and total mineral ash content of ossicles regenerated 8 eek 12Weck e a HILL from transplanted BMSCs and BMP 7 transduced cells The volume of the ossicles was significantly greater in the 12 week group compared to the 4 and 8 week groups in both cell types a There was also a significant difference in overall volume between the two cell types p lt 0 001 at all time points with BMP 7 constructs being approximately 2 fold larger The BMP 7 constructs were also larger than the original size of the gelatin sponge after 12 weeks b the total mineral content was significantly greater in ossicles formed from BMP 7 transduced cells The total mineral content increased significantly after 4 weeks for both cell types There was a significant difference between all times in the BMSC group and between 4 weeks and 8 weeks in the BMP 7 treated constructs Pairs that are not significantly different are indicated by 50 Mineral fraction Ss 8s S 8 ak 0 25 2550 50 75 75100 Figure 2 8 Quantification of mineral distribution on von Kossa stained slides for the 4 week samples Percent mineral was calculated in 4 regions 0 25 25 50 50 75 75 100 of the area from the centroid to the periphery There is a significant difference as denoted by in the percent of bone formed at the periphery and central parts of the gelatin foams between the two cell types Comparing the cell types at di
109. e autonomous behavior that characterizes them which is caused by a lack of intercellular communication Furthermore low GJIC is an early sign of potentially cancerous cells Based on this data 135 a novel assay based on Cx43 expression could be generated to provide patients with high cancer susceptibility an opportunity to detect a problematic site and treat it at the early Stages Although transduction with a lentivirus provided to be an effective means of enhancing GJIC identification examination and production of a pharmacological agent that enhances the expression of Cx43 in cells may yield a powerful tool to tackle health related problems that are caused by compromised cell to cell communication Of the potential health hazards that are may be caused by low GJIC two are at the top of the list of illnesses that claim lives in the United States namely heart disease and cancer As with any drug the specificity safety and efficacy would have to be assessed in animal models and human trails before it is employed Combined with the work performed in this thesis experiments elucidating the mechanistic role pharmacological intervention and eventual application of connexin 43 to human stem cells will strengthen the understanding and application of GJIC in tissue engineering and may serve as a future strategy for targeted cancer therapy 136 Appendices 137 Al FlowCulture Perfusion System Design and Specifications L
110. e regenerated tissue is also characterized by regeneration of tissue in the periphery of the 3D ossicle while only small amounts of bone are generated in the core Alternatively modifying the initial seeding conditions via novel seeding techniques may provide a means to enhance nutrient transport cell adhesion and cell cell communication in 3D scaffold Such initial seeding conditions may alter the eventual fate of the resulting tissue indicating the potential impact seeding may have on tissue engineered equivalents Two novel techniques seeding by filtration and micromass seeding may enable higher cell adhesion rates cell density and cell to cell communication Seeding by filtration occurs by circulating a dense cell suspension 61 through the scaffolds with the aid of a small pressure gradient applied by a peristaltic pump The homogeneous cell suspension that filters through the scaffold is cycled through and may produce higher cell density and even cellular distribution Micromass studies have been performed in vitro in a 2D monolayer This seeding strategy is achieved by placing a super dense cluster of cells at a particular location in a 3D scaffold leaving less crowded areas were nutrients can flow through Micromasses could provide the benefits of higher density cell cell communication and nutrient and byproduct flux thought to be vital to the proper development of tissue Our study aims to investigate a critical quest
111. e thick ascending limb functions Adv Nephrol Necker Hosp 1987 16 125 136 Beaman FD Bancroft LW Peterson JJ Kransdorf MJ Bone graft materials and synthetic substitutes Radiol Clin North Am 2006 44 3 451 461 Langer R Vacanti JP Tissue engineering Science 1993 260 5110 920 926 125 52 Valimaki VV Aro HT Molecular basis for action of bioactive glasses as bone graft substitute Scand J Surg 2006 95 2 95 102 126 Chapter 5 Conclusions 5 1 General Conclusions Our experiments examined strategies to enhance the regeneration of bone both exogenously cell seeding and biomimetic scaffolds and by endogenously overexpressing factors in BMSCs that would enhance bone formation Cx43 Specifically addressed in this thesis 1s the role of enhanced cell cell communication in the form of gap junction intercellular communication GIJC as a tool for bone regeneration Our results demonstrated significant increases in tissue regeneration using both endogenous and exogenous strategies which may have a powerful impact in the clinical setting As part of the experiments performed we first validated a threshold range to utilize for analysis of tissue engineered bone ossicles Chapter 2 Our threshold range was rigorously determined using imaging and ashing techniques to quantify tissue engineered bone in a Hounsfield Units HU b of bone HU and c Bone Mineral Density mg cc 1000 1300 24 2 31 5 25966 6 33
112. ecirculated heated water pad Recovery from anesthesia was monitored closely Four 8 and 12 weeks after transplantation mice were euthanized by cervical dislocation Ossicles were extracted and stored in 70 ethanol until analysis 4 2 8 Micro CT 3D image acquisition and analysis Ossicles were scanned on a high resolution cone beam micro CT system Enhanced Vision Systems now GE Healthcare Preclinical Imaging London Ontario Canada The x ray source voltage and current were 80 kVp and 80uA respectively To reduce the potential for beam hardening artifact the x rays were passed through a 0 2mm 101 Al filter immediately upon exiting the source and the specimens were immersed in dH20 during the scanning process Projection images were acquired over 198 degrees using 2x2 binning and an exposure time of 1100 ms and four frames were averaged for each projection to improve the signal to noise ratio The projection data was then corrected and reconstructed using the Feldkamp cone beam algorithm to create three dimensional images with an isotropic voxel size of 18um The scanner was calibrated once daily using a phantom that contained air water and hydroxyapatite Bone volume fractions BVF were determined by using a MatLab program designed to integrate all grayscale voxels above a particular threshold To determine the overall volume of the ossicles the program determined the perimeter of each 2D uCT slice by tracing the outer edge
113. ed by Cx43 work synergistically when BMP 7 prompts secondary messengers such as calcium and other transcription factors that can be distributed through gap junctions 131 The overexpression of Cx43 with or without BMP 7 also enhanced the distribution of regenerated tissue suggesting that cell to cell communication is important for effective tissue regeneration in the core of 3D bone ossicles Our in vitro data comparing the osteogenic differentiation of cells in the surface and core regions of a 3D construct supports this conclusion when Cx43 was overexpressed cell communication and osteogenic differentiation were enhanced in the core regions relative to BMSC control groups Furthermore we showed that GJIC plays a greater role in 3D compared to a 2D monolayer Communication between BMSCs is limited to a greater extent in 3D cultures However when BMSCs overexpress Cx43 both 3D and 2D cultures have similar transfer efficiencies Because homeostasis is such an important component of tissue formation we speculate that enhancing GJIC enables the population of cells seeded in the 3D construct to have a higher level of coordination enabling more spatially distributed tissue regeneration Because of the ubiquitous nature of Cx43 our strategy could be applied to different tissues with the aim of solidifying such overexpression as a powerful mechanism to enable higher cell to cell communication during differentiation and tissue formation Also t
114. ed delivery as treatments to boost cell to cell communication Our research therefore may have a significant impact in the regeneration of tissue de novo and in vivo as well as therapies for diseases in 3D tissues characterized by compromised cell to cell communication such as some forms of cancer and heart disease In this study we focus on the specific effects of Cx43 as a platform to enhance gap junction intercellular communication in 3D Because of its inherent limitation in producing spatially uniform 3D mineralized tissue equivalents bone is used as a model tissue Such limitation is in large part prompted by the early formation of hard tissue in the periphery of tissue engineered bone ossicles which prevents tissue regeneration in the core gt In order to examine the role of enhanced GJIC in tissue engineering we investigated the effects of stable Cx43 overexpression in bone marrow stromal cells BMSCs a pluripotent somatic stem cell by transducing them with a lentiviral vector encoding the Cx43 gene LVCx43GFP and seeding them in 2D and 3D cultures Enhancing gap junction function in BMSCs 1s attractive because these cells express a low level of Cx43 gt relative to osteoblasts and have the ability to differentiate into bone given the proper biological cues gt gt Both the effects of increased GJIC alone and in combination with an osteogenic stimulus on BMSC differentiation in 2D and 3D cultures into
115. ent on the surfaces of adjacent cells Gap Junctions form a transcellular channel that permits the rapid and efficient propagation of ions metabolites and second messengers between adjoining cells These hemichannels are called connexins Each Connexin monomer is a polypeptide consisting of 4 transmembrane domains two extracellular loops one intracellular loop and intracellular carboxylic and amino ends Throughout different types of tissue gap junctions play a mayor and extensive role in response to mechanical electrical and chemical stimuli Out of the 20 known connexins only Cx43 Cx45 and to a lesser extent Cx46 54 55 have been shown to exist in bone cells The primary gap junction in bone is Cx43 56 57 8 58 62 Cx43 produced Gap junctions have been demonstrated between osteoblasts as 1311 63 gt The extensive network well as communication between osteocytes and osteoblasts formed by osteocytes is also dictated by their gap junctions Gap junctions have been found to exist between bone marrow stromal cells The have considerable consequences in defining the structural organization of the hematopoietic environment This opens the possibility that bone marrow stroma can receive developmental cues via gap junctions gt Genetic modifications have been made to elucidate the role of Connexin 43 mediated gap junctions in different bone forming cell types and mouse models Cx43 knockout mice have sh
116. eoblastic cells J Cell Biol 1997 139 2 497 506 Schiller PC Roos BA Howard GA Parathyroid hormone up regulation of connexin 43 gene expression in osteoblasts depends on cell phenotype J Bone Miner Res 1997 12 12 2005 2013 Zhang W Green C Stott NS Bone morphogenetic protein 2 modulation of chondrogenic differentiation in vitro involves gap junction mediated intercellular communication J Cell Physiol 2002 193 2 233 243 Wyatt LE Chung CY Carlsen B et al Bone morphogenetic protein 2 BMP 2 and transforming growth factor betal TGF beta1 alter connexin 43 phosphorylation in MC3T3 E1 cells BMC Cell Biol 2001 2 14 20 Chapter 2 Establishing Micro CT Thresholds for Tissue Engineered Bone and Comparison of Bone Regenerated from Bone Marrow Stromal Cells and BMP 7 Transduced Cells 2 1 Introduction To regenerate complex tissues such as bone a variety of cell types including differentiated cells progenitor cells and genetically modified cells have been delivered 1 3 from designed scaffolds Bone regeneration from transplanted cells has been accomplished in open and closed systems in large and small animals and human clinical 4 5 trials are underway Comparison of the quantity and quality of bone regenerated via different strategies is lacking however in part because standardized means of analyzing bone regeneration are lacking Standard radiographic and histological techniques provide a s
117. equivalents while targeted delivery therapy can use Cx43 delivery to enhance GJIC in communication incompetent cells within living 3D tissue Our studies have significant impact in applied biology and will likely promote further investigation in the regeneration of other 3D tissues To achieve higher cell to cell communication we genetically engineered cells to over express the gap junction protein Cx43 Fig 1 Disruption of gap junctions formed by Cx43 in bone forming cells results in compromised osteogenic differentiation and 13 45 48 i However the role of deficiencies in matrix mineralization and bone formation overexpressing Cx43 in progenitor cells as a strategy to enhance 3 dimensional tissue regeneration has not been examined In this investigation we have shown that overexpression of Cx43 and increased gap junction function Fig 2 leads to higher cell differentiation in vitro Fig 3 and more in vivo bone formation Fig 4 Also bone regeneration in the core of the scaffolds was achieved Fig 5 which suggests a role for enhanced GJIC in the homeostatic environment necessary for full tissue regeneration These finding suggest that enhanced GJIC enables cues to distribute more effectively and cells when induced by the environment can differentiate and produce higher quantities of tissue Regeneration of large and uniform volumes of 3D tissue equivalents has been elusive When seeded into a 3D ECM analogue cells in the periphery
118. er Res 2004 19 10 1640 1650 Leonova EV Pennington KE Krebsbach PH Kohn DH Substrate mineralization stimulates focal adhesion contact redistribution and cell motility of bone marrow stromal cells J Biomed Mater Res A 2006 79 2 263 270 Krebsbach PH Gu K Franceschi RT Rutherford RB Gene therapy directed osteogenesis BMP 7 transduced human fibroblasts form bone in vivo Hum Gene Ther 2000 11 8 1201 1210 56 29 30 31 32 a3 34 35 Murphy WL Kohn DH Mooney DJ Growth of continuous bonelike mineral within porous poly lactide co glycolide scaffolds in vitro J Biomed Mater Res 2000 50 1 50 58 David H Kohn Kyungsup Shin Sun Ig Hong et al Self assembled mineral scaffolds as model systems for biomineralization and tissue engineering Proc 8th Int Conf Chem amp Biol Min Tissues 2005 Ding M Odgaard A Linde F Hvid I Age related variations in the microstructure of human tibial cancellous bone J Orthop Res 2002 20 3 615 621 Blake GM F Principles of Bone Densitometry In Rodan G ed Principles of Bone Biology Ist ed San Diego Academic Press 1996 1313 1332 Ho ST Hutmacher DW A comparison of micro CT with other techniques used in the characterization of scaffolds Biomaterials 2006 27 8 1362 1376 Moore MJ Jabbari E Ritman EL et al Quantitative analysis of interconnectivity of porous biodegradable scaffolds with micro computed tomography J Biomed Mate
119. esenchymal cells to osteoblast lineage cells 2 332 Cell mediated recombinant protein delivery may be superior to direct growth factor implantation because the continuous secretion of BMP 7 may act as a paracrine agent diffusing into the surrounding host tissue and stimulating responsive host cells in a manner similar to that proposed for exogenous recombinant BMP 7 Cell mediated BMP 38 delivery may also act as an autocrine agent to induce the osteoblastic differentiation of implanted cells Another possible mechanism is that one of the paracrine effects of secreted BMP 7 is to stimulate responsive cells to synthesize and secrete BMP and hence propagate the signal throughout the implant The distribution results verify the qualitative observation that most of the mineral formation is on the periphery for the BMSC transplants Fig 8 The development of a shell of bone on the periphery suggests that the cells on the outside differentiate more quickly possibly because they are exposed to more signals and nutrients If it occurs before internal mineralization this tissue formation at the periphery of a scaffold creates a border that increases the resistance to nutrients flowing in and byproducts flowing out potentially leaving the inside cells trapped and undifferentiated Bone ossicles formed from BMP 7 transduced cells have more dispersed mineral and are larger This decrease in mineral reduces the resistance of nutrients into the core of
120. exity and because many bone regenerative approaches do not have a bimodal histogram Figure 1 the vast majority of tissue engineering studies do not employ these methodologies Instead they use a simple global threshold where a single grayscale value is selected and voxels with intensities over that number are defined as bone Using this global thresholding approach is a source of concern because the source of such standardization is unclear and may lead to an inaccurate quantification of the amount of bone and therefore an inappropriate comparison of bone regenerated under different conditions Because of these limitations the goal of these experiments was to determine a global threshold for quantification of volume fraction of tissue engineered bone using uCT To determine the appropriate threshold the amount of regenerated bone determined via uCT was compared to the amount of regenerated bone determined by the more conventional techniques of ashing and quantitative histology Regressions were performed on three types of data over a range of thresholds to determine the threshold that yielded the best fit between uCT data and conventional data First the BVF determined from wCT was compared with the ash fraction to compare the amount of new bone three dimensionally Second the 2D area fraction of bone determined from wCT 23 and the 2D area fraction determined via H amp E staining in a closely aligned histological plane were used for visual
121. f all your friendship To my committee members all of whom are highly dedicated and extremely busy thank you for taking the time to converse and discuss my research and other aspects of life I shall always cherish those conversations To my advisor David H Kohn my gratitude for allowing me to learn under his tutelage I know I have become a better critical thinker for it I also appreciate the help of Dr Eddy Kizana and Jeff Maganck both of whom contributed to my research My very special thanks go to Joe Zhuo Wang who spent countless hours teaching me the intricacies of surgeries and who contributed greatly to the advancement of this thesis Finally I d like to thank my family for their support and encouragement and last but not least I d like to thank my better half Natasha Cervi for her unconditional love il Table of Contents 1B Jere Ukers 18 Weer repre tier arent E ett cree eran ter tits ereereater E ll PLCKMOW IEC CSIC IMIS 555 achsscssenssittn cuits nedutiancteathan diets dubite E EE EO AE il ASHORE FI CURCS a scsci ersten oehcase cartes cc a cates EA E A E E ates oie eo acai 1X TEAST Or Tables aise et oles ss cereale ct adiacns sts E A a xil TASUsO lA PPCM CCS ana a a a a at a a a xili aoe LINTOdUC HON arsin a T E T TS l 1 1 Problem Statement and Thesis A ties ios Gait reer ae eee eee l L2 WSN ASE CC OMSURUIC BS icia A a 2 1 3 Seeding Strategies and Template Chemistry for 3D tissue engineered constructs 1 4
122. f bone regenerated with different cell types Both transplanted BMSCs and BMP 7 transduced cells formed self contained mineralized bone and bone marrow organs Fig 6c An intact cortical shell of bone defined the external boundaries of the ossicles and the internal portion of the implants contained amorphous mineralized tissue Fig 6b 6c While both cell types supported active hematopoesis bone formed from BMP transduced cells often had small amounts of fibrous tissue localized to the central regions of the implant Quantifying the amount of bone indicated that there was a statistically significant increase in the volume fraction of bone regenerated throughout the duration of the study Fig 6a However there was no significant difference in the volume fraction of bone formed between the two cell types Variations in the ossicle volume also occurred throughout the study The ossicles derived from BMP 7 transduced cells were consistently larger than ossicles formed from BMSCs p lt 0 001 for all time points and significantly larger than the original scaffold after 2 weeks p 0 032 BMSC derived ossicles were small and maintained the size of 33 the original implanted scaffold Fig 7A Transient differences in the ossicle volume also occurred throughout the study The volume of the ossicles was significantly greater in the 12 week group compared to the 4 and 8 week groups in both cell types BMSC p 0 021 for 4 weeks vs 12 weeks and p 0 0
123. f cells to be labeled 185 A11 Immunohistochemistry stain on Connexin43 treated cranial defect sections Ricardo Rossello Zhuo Wang and David H Kohn Day 1 3 4 5 Deparafinized slides Xylene 10 minx2 Rehydration 100 EtOH 2x1 min 95 EtOH 1 min 75 EtOH 1 min PBS 10 min wash H20 5 ml Stock 30 20 ml 180 ml dd H20 3 final concentration PBS 10 min wash Use a decloaker chamber set up 2 mins first switch over 20 min then turn back merge the slides in Antigen retrieval reagent 1 lt Biocare Medical diluted with PBS 6 Ta 8 9 Day 2 10 11 12 13 14 15 16 17 18 PBS 10 min wash Block the slide with sniper for 5 min room temperature Primary Ab incubation diluted 1 1000 in Da Vinci Green antibody diluent Biocare Medical load 100 ul on each slide Place the slides on a wet chamber overnight at 4 C Drain with PBS 10 min 2 Ab incubation Biotinylated Coat anti Rabbit IgG BioCare Medical 10 15 min room temperature PBS 10 min wash Incubate for 15 minutes with streptavadin HRP Biocare Medical PBS 5 min wash DAB reaction Zymed South San Francisco CA 12 5ul 1 ml buffer all 75 ul on each slide for 30 seconds PBS wash 5 min Stain with hemotoxylin for 30 seconds then rinse with tapping water immediately Dehydrate reverse the first 3 steps mount and coverslip 186 A12 Westernblot Protocol and Preocedures Ricardo Rossello and Dav
124. fferent time periods showed no significant difference 51 70 60 a nr Threshold Bone HU R2 14 50 50 17 00 i 19 40 X 21 80 AQ 24 20 4 26 70 29 10 BVF z R2 0976 x lt its 31 50 ev ss 33 90 se 7 36 40 38 60 41 20 43 60 46 00 45 50 23 25 27 29 31 33 Mineral Ash Fraction Figure 2 9 Correlation between volume fraction of regenerated bone determined by uCT at different thresholds and mineral fraction determined by ashing when BMSCs are in a ceramic scaffold for 6 weeks The optimal regression is depicted by the line on each plot The correlation coefficients and levels of significance for all thresholds are shown in the table The 1000 1300 range of thresholds yielded a correlation coefficient R2 gt 0 95 supporting the general use of this threshold for different scaffolds oy 2 6 References Krebsbach PH Kuznetsov SA Satomura K Emmons RV Rowe DW Robey PG Bone formation in vivo Comparison of osteogenesis by transplanted mouse and human marrow stromal fibroblasts Transplantation 1997 63 8 1059 1069 Musgrave DS Bosch P Lee JY et al Ex vivo gene therapy to produce bone using different cell types Clin Orthop Relat Res 2000 378 378 290 305 Franceschi RT Wang D Krebsbach PH Rutherford RB Gene therapy for bone formation In vitro and in vivo osteogenic activity of an adenovirus expressing BMP7 J Cell Biochem 2000 78 3 476 486
125. filtration approach produces significantly more adhesion and cell retention than both dynamic and static seeding p lt 0 001 Filtration reaches a plateau after 6 hours Both static and dynamic techniques increase the number of adhered cells as a function of time There were no differences in adhesion between mineralized and PLGA scaffolds with the exception of static seeding at 1 and 24 hours Bars indicate pairs that were not significantly different Boxes denote groups that showed significant difference in adhesion due to scaffold 8 1 E Static Seeding Dynamic Seeding cell counts O Micromass Seeding E Filtration Seeding Figure 3 2 Cell count and distribution varies in seeded scaffolds 6 hours after seeding Histological slides demonstrate the even distribution and high cell adhesion produced in scaffolds that were seeded through filtration A Static seeding B is characterized by a lower yield of cells that are un evenly allocated throughout the sections Dynamic seeding showed sections with densely packed cells but also a large variation in cell location C Micromass seeding technique was validated showing a densely packed group of cells in the core of the scaffold Quantification of the mean cell count E in histological demonstrates that filtration dynamic and micromass seeding techniques enable more cell adhesion p lt 0 001 There was no significant difference between micromass and dynamic seeding p 0 672
126. g on the same section Regressions were performed for the A 4 week B 8 week C 12 week and D pooled time groups The optimal regression at each time is depicted on the plots Correlation coefficients and of bone HU for all thresholds are also shown E The optimal thresholds are 1000 1100 for all times The range of thresholds with the highest correlation coefficients and significance is consistent with the thresholds determined by regressions of the BVF with ash fraction and percent H amp E stain Significance p lt 0 05 is denoted by 48 A BVF as a Function of Time and Cell Type 60 BMP 7 BMSC fj 50 20 10 8 weeks 12 weeks Bone Volume Fraction Ww O BMSC BMP 7 Z BMSC BMP 7 Figure 2 6 Bone regeneration as a function of cell type and time A volume fraction of regenerated bone determined by micro CT the volume fraction of bone regenerated with each cell type at each time was calculated at the respective optimal threshold There was a significant difference denoted by in BVF between the 4 week samples and the 8 and 12 week samples for both cell types There however was no significant difference between the cell types B uCT renderings of the regenerated ossicles show increased mineralization as a function of time c H amp E slides from both cell types showing normal bone containing fully mature bone marrow 49 04 eek x A B I a i onst ruct BMP 7 eMer Figur
127. gap junction dependent cell cell COMMUNICA ON asson e a aan 72 3 3 3 Seeding and template conditions alter bone marker expression 73 3 3 4 Different seeding techniques led to distinct patterns of osteogenesis 75 i gt DISCUSSION oscar sce aie tre tetas ah ihe tes eect hanes ai eaten tre eee 75 vi 3 5 IRE LOT CIC OS shecd sxc hanes ar aniateccin ues eracduh oesdussae ar easaa tise ja gus uae aT aA 87 Chapter 4 Connexin 43 as a signaling platform for increasing the volume and spatial distribution OL regenerated TISSUE sissien nino en E E A E 93 4 1 DA Gt UTC iO ennas esses E E andes teh seacua teenies O 93 AZ Materials and NieiROdS s seseieeisneetelslanvat nine daanenvavtan eine 96 4 2 1 Waal V CClOP PLOCUC HON bs cicuausieuate ci ciate e a de ave eteabauded 96 4 2 2 Culture and Transduction of BMSCS cccceeeessssssssssssessssssssssssssseeeeeens 96 4 2 3 Wester mB IOL fs ccstenaunccnseatenaaueneceaneeedam auch T 97 4 2 4 2D amd S D CEC Gl gui ME a T Merman Renee meres OP er enee on 98 4 2 5 IDE Tramsier studies OLC KA orina tages teuesuntenins 99 4 2 6 Real time PCR Analy si a ticdstesivseiiecisdetcstens estinieivern altace eater 100 4 2 7 Te ViVO transplantati n oeni esnin a di seotsa NEEE AT EA 101 4 2 8 Micro CT 3D image acquisition and analysis c ssseseesseeeeeeeceeeeeees 101 4 2 9 Histology and Morphological Analyses cccccccccssssssssssseseeeeeeeeeeeeees 103 4 3 FES UES varcada cru
128. harles River Laboratories Raleigh NC USA were used for each experiment Animals were anesthetized with intraperitoneal injections of ketamine xylazine 50 and 5 ug g respectively in saline A linear scalp incision was made from the nasal bone to the occiput and full thickness flaps were elevated The periosteum overlying the calvarial bone was resected A trephine was used to create a 5 mm craniotomy defect centered on the sagittal sinus The wounds will be irrigated with Hanks balanced salt solution HBSS while drilling The calvarial disk will be removed carefully in order to avoid injury to the underlying dura or brain After careful hemostasis gelfoam scaffolds D 5mm t 0 3mm previous loaded with cells will be placed into the defects 500 000 cells The scaffolds filled the entire defect and attached to the bone edges around the entire periphery The incisions were closed using 4 0 Chromic Gut suture Ethicon Johnson amp Johnson Sommerville NJ and the mice were let to recover from the anesthesia on a heating pad Kent Scientific After 4 8 and 12 weeks animals were sacrificed and the calvaria was removed for micro CT and histological analysis Micro CT 3D image acquisition and analysis 199 Ossicles were scanned on a high resolution cone beam micro CT system Enhanced Vision Systems now GE Healthcare Preclinical Imaging London Ontario Canada while immersed in distilled H20 The x ray source voltage and current were
129. hese findings are not limited to tissue engineering as they can also be applied to targeted gene therapy such as cancer therapy and development of 3D culture model systems that are highly coordinated The findings from this thesis propose important and novel strategies for the regeneration of 3D tissue engineered bone that can have an immediate impact in the clinical setting We have presented three exogenous strategies micromass seeding filtration seeding mineralized template and an endogenous one overexpression of Cx43 that significantly enhance cell differentiation and bone regeneration In both 132 exogenous and endogenous strategies it was shown that increased GJIC enhanced differentiation bone regeneration and distribution throughout the engineered tissue 5 2 Future work In addition to the combination of endogenous and exogenous strategies to regenerate larger volumes of tissue two main directions should follow the results presented in this thesis First it is important to examine the effects of other exogenous parameters such as nutrient flux and migration in tissue regeneration These parameters were taken into consideration when designing the seeding strategies and their specific and isolated roles in bone formation should be understood Secondly investigate both the mechanistic aspect of GJIC and the potential applications that expand outside the realm of tissue engineering such as targeted delivery and cancer thera
130. hest R increased to 1100 and 1300 at 8 and 12 weeks respectively Fig 2b and 2c The highest R for the pooled times occured at a threshold of 1000 R 0 9431 Fig 2d There was no significant difference in the BVF of ossicles calculated at a threshold of 1000 vs 1300 P values for the regressions in the 1000 1300 range are significant p 0 021 p 0 042 p 0 009 p 0 049 respectively while those for higher thresholds were not significant 31 Regressions on the quantity of bone determined on 2D uCT slices vs H amp E sections had the highest R values at a threshold of 1200 for all individual timepoints and the data pooled across timepoints Fig 3a through 3d The range of threshold values with high coefficients of correlation 1000 1300 are identical for the 3D comparison of uCT BVF to ash fraction data that occur for the 2D comparison of H amp E stained sections with corresponding planes of the uCT images von Kossa stained sections verified the location of mineral deposition in 2D and suggested that ossicles were less dense at the early stages of regeneration than at later timepoints Fig 4 left panel This increase in mineral content packing is also observed on comparable 2D planes of the uCT images Fig 4 right panel Regressions on the quantity of bone determined on 2D uCT images vs von Kossa stained sections demonstrated the highest R values at a threshold of 1000 after 4 weeks and 12 weeks of implantation and 1100
131. iameter of the chamber and placing a robber stopper over it will work Figure 2 shows the flowchart schematic Peristaltic PharMed PharMed CORPSE EOOEE OSE CS EOS ee sees res esiesi eres ies eet eeeeseresereser esses esses essere ess eseress essere ess essere ess ese ese ess eee ees eset iss tise ese tise terete terete tise tese tise tistiseteseteseteetiss ee Figure 2 Flowchart Pimn Reservoir to hold and change media Ontinnal Quantification l Silicone fn of suspension Susnension 172 Assembly of System and Priming After sterilizing all of the components the user will have to assemble the perfusion system The perfusion system should be assembled under a hood to prevent any contamination during assembly The basic setup however is as follows The pump is connected to the chamber entrance and reservoir by PharMed tubing Silicone tubing is used to connect the exit of the chamber to the reservoir Filling the perfusion system with cell suspension securing the inlet and outlet stoppers and checking for leaks are the next steps Working under the chemical hood prime suspension into the system and reservoir if necessary until the chamber reservoir and tubing are full and without air bubbles Priming can be done in a variety of ways pending on the size of the tubes and such I poured as much of the suspension as possible and then filled the remaining spaces with a syringe After checking for
132. id H Kohn 1 Load 20 to 25 microgram of whole cell lysate per lane in an SDS PAGE mini gel 2 Run at 20 mA per gel untill the dye front is close to the bottom 3 Transfer the proteins to a nitrocellulose membrane S amp S NCTM at 250 mA in transfer buffer for 1 4 h depending on the size of the target protein 4 Incubate the blot with blocking buffer 5 non fat dry milk in TBS overnight at 40C or 2 h at room temperature RT 5 Incubate the blot with primary antibody diluted 1 250 to 1 1000 in blocking buffer for 1 h in blocking buffer at RT 6 Wash the blot 3 x 10 min in washing buffer TBS containing 0 1 Tween 20 with shaking 7 Incubate blot with anti rabbit IgG HRP conjugate Sigma diluted 1 10 000 1 2 000 in blocking buffer for 1 h in blocking buffer at RT 8 Wash 3 x 10 min in washing buffer with shaking 9 Drain washing buffer add ECL solution Amersham and develop for 1 min 10 Expose to X ray film for 1 to 30 min 187 A13 Infection Protocol for Adherent Cell Types Ricardo Rossello Thomas Langinan Eddy Kizana and David Kohn This protocol may be used for the infection of adherent cell lines The use of qualified retroviral supernatant in custom infections is absolute To qualify the viability of retroviral supernatant use either the Titer Assay for Retrovirus protocol or the Qualification of FIV GFP Supernatant Infection Efficiency SOP Materials l 6 well Tissue Culture Plate at 5 0x105 cel
133. id for 5 days embedded in paraffin sectioned in Sum slices deparaffinized hydrated and stained with hematoxylin and eosin H amp E The remaining specimens remained undecalcified and were embedded in plastic sectioned to Sum and stained with von Kossa For both decalcified and undecalcified sections the first Sum section below the landmark was used for comparison with the first wCT slice below the landmark The next 3 serial sections 50um apart from each other were also compared with their corresponding uCT slices for thre regression analyses Since the histological sections were approximately 50um apart the maximum distance between the histological and uCT slices is lt 50um Both H amp E and von Kossa stained slides were photographed and processed blindly with respect to treatment group with Image Pro Plus 4 0 A 2D visual alignment followed to subjectively compare the histological sections with the analogous micro CT sections This approach although not an exact mathematical registration of the images allows for both good side by side visual comparison Figure 3 and quantitative comparison for the von Kossa and uCT data sets The amount of mineral present in the von Kossa images was set using a grayscale selection mechanism relative to a standard Image Pro Plus 4 0 The same approach was used to compare the actual amount of bone fraction in the H amp E stained sections with a wCT slice Here bone fraction in the H amp E slides was deter
134. igure 3 This may be due the short term nature of the experiments as other groups have shown that external influences by calcium can increase the GJIC in cells Altering seeding conditions had a significant impact in the number of adhered cells in culture cell density cell to cell communication differentiation and patterns of osteogenesis Filtration dynamic and micromass seeding showed significant increases in cell adhesion over static seeding This result is promising by enabling higher cell retention in constructs that may have other biologically favorable benefits but are hard to seed due to their rigid nature Filtration provides a mechanism for uniform and complete capacity seeding of a 3D structure figure 1 2 while micromass enables the targeted location of a dense cluster of cells Cells seeded by filtration and micromass were analyzed for their capacity to engage in cell to cell communication and compared to cells seeded statically We chose to investigate this factor as intracellular communication through gap junctions is essential for proper development of tissues and homeostasis specifically in bone 4 The data clearly shows significant increases in GJIC in both micromass and filtration seeded cells when compared to static seeded cells This suggests that the higher cell density increases the formation of gap junctions between cells enabling a higher grade of communication Whether it is the increased proximity of
135. ing conditions were as follows 48C 68 for 10 minutes and 95C for ten minutes followed by 4 cycles of 95C for 15 seconds and 60C for 1 minute No template control analyses were run for each primer set and 18s rRNA endogenous control was run for each sample The 2AACT relative quantization method was utilized to evaluate gene expression All reactions were performed in quintuplet and n 4 The results were normalized to the endogenous 18s expression ABI A 3 way ANOVA was used to determine significant differences as a function of seeding condition scaffold and time 3 2 9 Transplantation of cell scaffold constructs Cells were seeded by static filtration and micromass seeding as previously described All cell scaffold constructs were placed in an incubator for 1 hour at 37 C in 5 CO 95 until surgery began to ensure sterility until the moment of implantation 24 Mineralized and 24 PLGA constructs were transplanted subcutaneously into nude mice nu nu Each of the construct groups contained 6 filtered 6 micromasses 6 static 6 empty scaffolds Briefly nude mice nu nu were anaesthetized by an intraperitoeal injection of 1 mg 10 g ketamine and 0 1mg 10 g xylazine An incision was made on the back of each mouse and the implants were inserted within the subcutaneous cavities The cell scaffold specimens were assigned randomly to each pocket The wounds were closed with surgical clips aseptically The mice were euthanized after 6 weeks and
136. ing histograms and threshold calculating ON perseo ee A AE eer ee ee 42 Table 2 Linear transformations of threshold in Hounsfield units HU to physical mineral density Dresher MECO heor a E 43 xii List of Appendices Al FlowCulture Perfusion System Design and Specifications ccccceesseeeeeeeeeees 138 Ad ALP activity assay 24 Well DiAle keeren e es ccern 2s wan A A eae 161 A3 Cell Counting with Hemocy tometer ciiraim e a e a S 163 A4 Cell Proliferation by Flow Cytometry BrdU and PI eeeeeeeeeeeeeeees 167 A5 Designing a Filtration Device for Scaffold ccccccccccccccccceceeeeeeeeeeeeaeeeeeeeeees 168 A6 Protocol for Extracting Bone Marrow Stromal Cells from Rat Femur and Tibiae EE ORT ee TEE STS E E ne ne TT E T een Sere E Teer rer aer arrears 176 A7 Filtration Seeding of Scaffold 2 0 0 0 ccccccccccssssssssssssssssseeeeeeeccceeeeeesssueceeessssesseees 178 A8 Subcutaneous Transplantation of Gelform BMSCs into Mice ccccceeees 181 ADs Cell Seedine Dy MIcTromasSS ocenie E E un coecoiebeiesene 183 A10 Protocol for Flow Cytometry Activated Cell Separation FACS 0 185 A11 Immunohistochemistry stain on Connexin43 treated cranial defect sections 186 A12 Westernblot Protocol and Preocedures cccccccseseseesessssssseeeeeeeeeeeeeeeeeeeeeees 187 A13 Infection Protocol for Adherent Cell Types ccccccccccccceeeeeseeeeessssseeeees 188 xiii
137. iol 2002 193 2 233 243 Wyatt LE Chung CY Carlsen B et al Bone morphogenetic protein 2 BMP 2 and transforming growth factor betal TGF betal alter connexin 43 phosphorylation in MC3T3 El1 cells BMC Cell Biol 2001 2 14 Stains JP Civitelli R Cell cell interactions in regulating osteogenesis and osteoblast function Birth Defects Res C Embryo Today 2005 75 1 72 80 Civitell1 R Ziambaras K Warlow PM et al Regulation of connexin43 expression and function by prostaglandin E2 PGE2 and parathyroid hormone PTH in osteoblastic cells J Cell Biochem 1998 68 1 8 21 Pettway GJ Schneider A Koh AJ et al Anabolic actions of PTH 1 34 Use of a novel tissue engineering model to investigate temporal effects on bone Bone 2005 36 6 959 970 121 22 ZS 24 25 26 Zi 28 Schneider A Taboas JM McCauley LK Krebsbach PH Skeletal homeostasis in tissue engineered bone J Orthop Res 2003 21 5 859 864 Carter PH Schipani E The roles of parathyroid hormone and calcitonin in bone remodeling Prospects for novel therapeutics Endocr Metab Immune Disord Drug Targets 2006 6 1 59 76 Li YJ Batra NN You L et al Oscillatory fluid flow affects human marrow stromal cell proliferation and differentiation J Orthop Res 2004 22 6 1283 1289 Franceschi RT Xiao G Regulation of the osteoblast specific transcription factor Runx2 Responsiveness to multiple signal transduction pathways
138. ion cells per T75 flask after second passage For Cx43 GFP GFP and MT transductions lentiviral vector with a titer of 10 transducing units ml was used on day 3 4 of culture Transduction was carried out in the presence of 8 ug ml of protamine sulfate to enhance the transduction efficiency Five ml of filtered vector containing media was added to the cell cultures for approximately 16 h transduction phase followed by replacing this media with fresh media for 6 8 h recovery phase The cells were exposed to three cycles of transduction After 12 days of incubation transduced BMSCs cells were examined under fluorescent microscopy to determine transduction efficiency through GFP fluorescence Transductions with ADCMVBMP7 and ADCMVMT were done as previously stated Briefly for in vitro transduction of BMSCs adenovirus at the desired titer to achieve a multiplicity of infection of 200 PFU was added to cells in serum free a MEM After 4 h FBS was added to a final concentration of 2 and medium was kept on cells for an additional 24 h Calvarial defect surgeries 198 All surgeries were performed in accordance with the University Committee on Use and Care of Animals UCUCA Animals were housed in a light and temperature controlled environment and given food and water ad libitum A sample size of 4 scaffolds per condition was determined based on the results of the previous subcutaneous experiments 5 week old female SCID mice N NIH bg nu xid C
139. ion in tissue engineering namely can altering simple exogenous initial conditions specifically surface chemistry and seeding conditions alter the fate tissue engineered bone equivalents To examine this question we compare cell adhesion cell to cell communication osteogenic differentiation and osteogenic patterns of regenerated bone in vivo in synthetic and biomimetic mineralized templates as well as in scaffolds seeded with cells via static filtration and micromass seeding The impact of this study may reach the clinical setting by providing tissue new simple in expensive and replicable strategies that regenerate larger and more evenly distributed amounts of bone 3 2 Materials and Methods 3 2 1 Bone marrow stromal cell BMSCs isolation and culture Five week old C57BL 6 mice were used to isolate bone marrow cells from the femoral tibial and humeral cavities six bones per animal as previously described Briefly the bone marrow was mixed with minimum essential medium a MEM Gibco 62 Laboratories Grand Island NY containing 10 fetal bovine serum FBS Gibco and antibiotics 100 ug ml penicillin G and 100 U ml streptomycin at 37 C in 5 CO2 95 air Cells were pelleted by centrifugation at 1000 rpm for 5 min at 4 C and resuspended in 10 ml a MEM Cells were plated at a density of 30 000 nucleated cells cm and cultured under the same conditions The culture medium was replaced three times per week and at near co
140. ises atisaarate vasceassnea ase E E 103 4 3 1 Characterization of Cx43 GFP modified BMSCS c cee eeeeeeeeeeeeeeeees 103 4 3 2 Overexpression of Cx43 increases GJIC 5 aoina ees eens 104 4 3 3 Cx43 overexpression enhances overall and spatial distribution of ditterentiation MAT KCTS isoitecteraet none seit wiv avite aa E E E E A ER E 105 4 3 4 Cx43 Gene Modified Cells Regenerated More Bone In Vivo 107 AG DISCUSSION eraa ecto earen awe Celeste nena 108 4 5 Se Fes dit et cree OnE are eee te meen TE De are ene sm umeT tenn TT ar arr ieete se mettre 119 Vil Chapter gt COMCINSIONS niaaa T aria sew T eas 5 1 General Conclusions 0cceccsceccsccscescaccecscaecsccscecsccscescascscescaccscescecccens 52 PVA 1S Wy OW E E E E A AAA E A A AA E Appendices vill List of Figures CHAPTER 1 Figure l 1 Generalized mechanism for the role of gap junction intercellular COMMUNICATION in bone cells cc ccc cc cece ec eececscececccecececccccuccsccecessccucecucecesecucececececeseseuceseses 9 CHAPTER 2 Figure 2 1 Autothresholding mechanisms use a bimodal to find a threshold value by finding the midpoint of the intermodal ZONEC ce eeeeeseesseeeeseeeeesessseesseesssssesessssseeeeegs 44 Figure 2 2 Correlation between volume fraction of regenerated bone determined by micro CT and ash fraction at different thresholds cccccccccececeeeeeeeeeeeeeeeeeeeeeeeeeeeeeees 45 Figure 2 3 Correl
141. issue The bone morphogenetic protein 7 BMP7 was used to test the effects of higher GJIC along with a tissue forming stimulus Cells were also transduced with a 7 base pair deletion on the Cx43 gene Cx43A7 in order to assess the dominant negative effects of Cx43 in GJIC both in vitro and in vivo Appendix 17 The final chapter summarizes the important findings and interpretations of this thesis and presents a framework for future works Primary Messenger Receptor Secondary Messenger Transcription Element Gap Junction Figure 1 1 Generalized mechanism for the role of gap junction intercellular communication in bone cells A primary messenger in the form of a hormone growth factor or mechanical stimulation elicits a response from the host cell This response is the production or influx of secondary messengers e g cADP IP3 Ca 2 that enable the activation of a cascade e g ERK This cascade produces a transcriptional response in the host cell The secondary messengers produced can modulate the gap junctions to either open or close If open these secondary messengers will go through the gap junction channel and elicit the same response as in the host cell in adjacent cells without the need for a primary messenger to stimulate that cell 1 6 References Cheung C The future of bone healing Clin Podiatr Med Surg 2005 22 4 63 1 41 Vill Amiel C Bailly C Friedlander G Multiple hormonal control of the thick as
142. ith ADCMVBMP7 and ADCMVMT were performed as previously stated Briefly for in vitro transduction of BMSCs adenovirus at the desired titer to achieve a multiplicity of infection of 200 plaque forming units PFU was added to cells in serum free a MEM After 4 h FBS was added to a final concentration of 2 and medium was kept on cells for an additional 24 h 4 2 3 Western Blot Western blot analysis was performed using mouse anti Cx43 with GAPDH as a sample loading control Cells were lysed in lysis buffer 66 mM Tris HCl 5 mM EDTA SmM EGTA 10 mM Na phosphate 5 mM NaF 5 mM Na3 V04 2 5mM PMSF 10 mM NEM 2 SDS 0 5 Triton X 100 pH 8 0 Loading protocols were followed from the western blot kit Zymed Blots were incubated in 1 nonfat dry milk solution in PBS overnight with gentle shaking The following morning blots were washed 3 times with 97 PBS incubated with primary antibodies for 2 5 hours The resulting bands were quantified by densitometry ImageQuant GE and were normalized to endogenous GAPDH expression In order to quantify the total Cx43 expression in Cx43 GFP transduced cells the 74kDa band sum of Cx43 and GFP fusion protein was analysed The results are reported as a ratio with the denominator being the endogenous Cx43 expression in non transduced BMSCs Experiments were performed in triplicate n 3 and were done 1 week after the end of transduction One way ANOVA was performed on the ImageQuant data for b
143. izing Template on Differentiation and Volume of Regenerated Bone 3 1 Introduction Skeletal defects present a major clinical challenge with over 5 5 million fractures and 1 million bone grafting procedures done each year Present surgical therapies for 4 5 gt and bone defects or bone loss in the skeleton include autografts allografts synthetic materials Each of these reconstructive and or regenerative strategies however has limitations and lacks clinical predictability Only a minimal amount of tissue can be harvested for autografts the harvesting procedure may lead to donor site discomfort and morbidity and it may be difficult to form this tissue into desired shapes Autografting the current gold standard for bone regeneration has failure rates as high as 30 Allografts have the potential of transferring pathogens ERER Freeze drying demineralization and irradiation which reduce immunogenic potential can also reduce structural integrity leading to graft fracture Other complications with autografts and allografts include unreliable incorporation resorption and non union of the graft bone interface Induction of new bone by growth factors requires large amounts of recombinant material which may not be realistic in cases of massive defects Additionally successful 59 use of growth factors relies on the presence of a sufficient population of undifferentiated progenitor cells capable of responding t
144. j Susep 4433 TAC GTA Nal 4326 CA TA_TC ByHI 79 T CATC A Sev 114 AAT ATT Srg 381 CCAnnnnannTCCnnnnnnannn nn Eeg 4 5 GC Asonnnn CGonennnanon_ean Seal 438 ACT ACT Fri 696 TGC GCA Ard 919 GACnn_n nnGIC SHI 1087 TCATG_A Bxy1 1803 C CCAC _C Ded 1706 GACnn_nn nnGTC Afi 1807 A CryG_T Pal 1807 A CATC T pPPT CXGFP 8614 bp Spa 3310 G_CATG C Bor 2323 ACannnCTIAyCnnunnns ennas Sas 2 526 GrTA Cnonnn G nnnnnannnn_annnn 4fn 2811 CTTAA_G Mol 2631 C CCCC C NEN 2632 GG OG_CC Sol 2633 CCC CCC Eis 2635 G_GCGCC Aral 2824 TCO CCA dam methylated Nog 3135 CC COCC_GC Esaf 3135 C GGCC_G ENI 3157 CCTan n_nnACc Ae 3176 C AATT_G SC 341 CC TCA_GC BXAPI 3440 CCAn ann 2TCC Sani 3971 GG GerC_CC Hipat 4009 CITAAC cal 4132 AT CG_AT 195 A17 Calvarial Defect Model Enhanced GJIC regenerates more bone in a critical sized defect Tissue engineering can be defined as the proccess by which a functional 3D tissue is generated using cells scaffolds and devices that enable cell growth organization and differentiation 253 Griffith L G 2006 60 Vacanti J P 1999 61 Langer R 1993 Successful and complete regeneration of tissues can be achieved for certain types of tissue that are either thin in nature skin or avascularized 263 Freed L E 2002 264 MacNeil S 2007
145. l growth by down regulation of monocyte chemotactic protein 1 as discovered using protein array technology Cancer Res 2002 62 10 2806 2812 Lai A Le DN Paznekas WA Gifford WD Jabs EW Charles AC Oculodentodigital dysplasia connexin43 mutations result in non functional connexin hemichannels and gap junctions in C6 glioma cells J Cell Sci 2006 119 Pt 3 532 541 Holy CE Shoichet MS Davies JE Engineering three dimensional bone tissue in vitro using biodegradable scaffolds Investigating initial cell seeding density and culture period J Biomed Mater Res 2000 51 3 376 382 123 36 e 38 39 40 41 42 Ishaug SL Crane GM Miller MJ Yasko AW Yaszemski MJ Mikos AG Bone formation by three dimensional stromal osteoblast culture in biodegradable polymer scaffolds J Biomed Mater Res 1997 36 1 17 28 Dorshkind K Green L Godwin A Fletcher WH Connexin 43 type gap junctions mediate communication between bone marrow stromal cells Blood 1993 82 1 38 45 Montecino Rodriguez E Leathers H Dorshkind K Expression of connexin 43 Cx43 is critical for normal hematopoiesis Blood 2000 96 3 917 924 Krebsbach PH Kuznetsov SA Bianco P Robey PG Bone marrow stromal cells Characterization and clinical application Crit Rev Oral Biol Med 1999 10 2 165 181 Rutherford RB Nussenbaum B Krebsbach PH Bone morphogenetic protein 7 ex vivo gene therapy Drug News Perspect 2003 16 1
146. l reconstruction of mature reconstructed uCT images can be used to determine bone architecture in three orthogonal directions The bone volume fraction BVF and bone mineral density BMD can also be calculated using algorithms that are independent of orientation using custom or commercially available software One concern however when performting these calculations is separating the bone tissue from the other tissues within the image This is particularly crucial for BVF calculations where care must be taken to accurately determine a threshold for the voxel intensity that distinguishes bone from marrow air fibrous tissue or surrounding scaffold Three thresholding approaches have been employed to solve this problem One approach employs an autothresholding function that uses the frequency distribution histogram of voxel values in the images to determine the threshold between two 22 populations This algorithm assumes that the image has a bimodal histogram a mid point of the intermodal zone is chosen as the cut off between bone and soft tissue based on optimization of the variance between the two histogram peaks The second approach 25 26 In this that has been used for trabecular bone thresholding is local thresholding approach the local neighborhood of every voxel within the uCT image is taken into account when determining if a voxel is bone This approach is powerful however it can be complex to implement Because of this compl
147. l seeding conditions of cells can modify the amount and distribution of bone and with future studies such regeneration patterns may be achieved by design In conclusion we showed that both a biomimetic mineral template and the manipulation of initial seeding conditions can have profound effects on the resulting differentiation and in vivo regeneration of bone Biomimetic templates provided a physiologically favorable environment for BMSCs for tissue formation while altering the seeding conditions in these rigid 3D scaffolds enabled higher cell adhesion cell to cell communication and larger volumes of bone with distinct patterns of regeneration Altogether our study addresses and provides a mechanism to solving the critical question of full tissue equivalent regeneration by showing that with simple manipulations of the initial cell and template conditions one can significantly enhance the regeneration and 79 spatial distribution of tissue in vivo which has a major impact on bone regeneration and 3D tissue engineering as a whole 80 PLGA gt p j D 80 i T eo am 2 0 ad O 20 4 os 0 E Static Seeding S Dynamic Seeding 0 Filtration Seeding B Mineralized PLGA 100 3 80 4 i oO T eo at 2 ab O 20 4 3S Figure 3 1 Percent of cells adhering to PLGA A and mineralized B scaffolds at different time points following seeding via different techniques Using a
148. l volume High density voxels outside of the 3D surface and unattached to the ossicle were discarded while voxels inside were evaluated at the specified thresholds to determine the BVF which was calculated as the number of voxels above the threshold relative to the total number of voxels Using this method a threshold of 1100 was used to re construct a rendered image of the ossicles and determine their distribution 3 2 11 Histological analyses The ossicles were rinsed in water and then decalcified in 10 formic acid for 5 days After decalcification the tissues were embedded in paraffin 5 um sections were 70 made and placed on 10 slides with 3 sections per slide The tissue was deparaffinized hydrated and the first fifth and tenth slides were stained with H amp E and von Kossa Image Pro Plus 4 0 was used to take pictures of the histological sections 3 2 12 Analysis of bone ingrowth A program was developed to determine the distribution of regenerated bone as a function of the distance from the geometric center of each ossicle Using von Kossa stained sections of bone ossicles regenerated in PLGA scaffolds the centroid was calculated using a MatLab script and used as a frame of reference to divide the ossicles into 4 regions Defining the centroid as the 0 percentile and the edge as the 100 percentile boundaries were calculated by lines that radially pointed into the center from the edges Using this criterion the pr
149. lls J Biomed Mater Res A 2006 79 2 263 270 Franceschi RT Yang S Rutherford RB Krebsbach PH Zhao M Wang D Gene therapy approaches for bone regeneration Cells Tissues Organs 2004 176 1 3 95 108 Rutherford RB Nussenbaum B Krebsbach PH Bone morphogenetic protein 7 ex vivo gene therapy Drug News Perspect 2003 16 1 5 10 Krebsbach PH Gu K Franceschi RT Rutherford RB Gene therapy directed osteogenesis BMP 7 transduced human fibroblasts form bone in vivo Hum Gene Ther 2000 11 8 1201 1210 Rossello RA Krebsbach PH Kohn DH Effects of self mineralizing templates and cell seeding techniques on volume of regenerated bone Trans 31st Annual Meeting Soc for Biomat 2005 12 24 25 26 2i 28 29 30 David H Kohn Kyungsup Shin Sun Ig Hong Elena V Leonova Ricardo A Rossello Paul H Krebsbach Organic template mediated self assembly of mineral as a model system for biomineralization and bone tissue engineering MRS 2005 Cartmell SH Porter BD Garcia AJ Guldberg RE Effects of medium perfusion rate on cell seeded three dimensional bone constructs in vitro Tissue Eng 2003 9 6 1197 1203 Zhao F Ma T Perfusion bioreactor system for human mesenchymal stem cell tissue engineering Dynamic cell seeding and construct development Biotechnol Bioeng 2005 91 4 482 493 Burg KJ Holder WD Jr Culberson CR et al Comparative study of seeding methods for three dimensional po
150. lls in osteoconductivity the construct which 1s desired for increased cell cell communication This bone like apatite can form on the polymer scaffold and mimic physiological conditions by incubating it in simulated body fluid SBF ae producing ion concentrations are similar to blood plasma In this case the PLGA will function as a bulk material that degrades at a controlled rate while the mineral layer serves as a biological interface Additionally the surface mineralization is expected to provide a bioactive surface to moderate Ca flux into the cells for enhanced differentiation signaling and cellular growth This calcium flux is an important cell cell messenger in osteoblasts that may be important for proper bone remodeling and regeneration These seeding and substrate mineralization approaches exploit the initial exogenous physical conditions of the cells and substrate to overcome the incomplete regeneration of tissue Alternatively an endogenous approach to enhance cell cell communication gap junction intercellular communication could be employed to overcome some of these problems 1 4 Gap Junctions Gap junctions are present in all types of vertebrates except very few cases such as red blood cells platelets and some neurons This ubiquity makes it reasonable to consider gap junctions a fundamental structure necessary for cell differentiation and signal transfer Composed of two juxtaposed hemichannels pres
151. lot analysis c Quantification of the band intensities showed a significant increase 3 74 49 p lt 0 001 d in overall Cx43 expression in cells that were transduced d 113 a Transfer fraction BMSC Cx43 BMP Cx43 BMP Cx4 aA O Surface E Core Transfer fraction om BMSC Cx43 BMP Cx43 BMP 7 CX43A7 Figure 4 2 GJIC in BMSCs as measured by Calcenin AM transfer is enhanced with Cx43 overexpression The transfer fraction was measured for groups cultured in 2D monolayer and 3D cultures a Cells overexpressing Cx43 Cx43 and Cx43 BMP7 had a significantly higher transfer fraction than the control groups BMSC BMP7 p lt 0 001 and the negative control group Cx43A7 p lt 0 001 Transfer was enhanced in 3D when cells were overexpressing Cx43 relative to 2D culture Groups that did not overexpress Cx43 showed significant decreases in dye transfer from the top surface of the construct to the core section whereas no significant difference was evident in groups overexpressing Cx43 b Horizontal bars represents pairs that are significantly different p lt 0 005 114 i p ol 30 4 a pen e Cx4347 OBMSC OCx43 E BMP Cxd5 BMPY OCH expression normailzed to 2D day 2BMSC OCN Ro oO Day 2 Day amp Day 16 bad c i j ar ri n ng l i a 1 O20 k s O Surface mo a si tL m20 i Ecoe E Sou 3 1 L i E o ag I d CE L
152. ls per well and appropriate media l Disposable 9in Glass Pasteur Pipette 3 75ml Qualified 10x retroviral supernatant 2 5ul 4ug ml 0 22um Filter Sterilized Polybrene dissolved in Milli Q 2 5ul 4mg ml 0 22um Filter Sterilized Protamine Sulfate dissolved in Milli Q l 5ml Pipette l 30ul Pipette tip Equipment l Pipette Aid l 20ul Pipette Manu Tissue Culture Hood 37C Incubator w 5 CO2 32C Incubator w 5 CO2 Eppendorf 5810R Centrifuge w multi well plate swinging bucket Procedure 188 Prepare Cells For Infection Split target cells into a 6 well tissue culture plate at 2 5x105 and incubate overnight at 37C w 5 0 CO2 This will provide 50 confluent cells the following day Infection Observe cells under microscope to verify that they look healthy and are at the right confluence In a Tissue Culture Hood aspirate cellular media from the first row of wells and aliquot 1 25ml viral supernatant as described below Once the viral supernatant is applied to the cells aliquot the localization molecule into the wells as described below and gently rock the plate for even distribution of molecule The final concentration of each localization molecule is 8ug ml Table 1 Aliquot the retroviral supernatant into the corresponding wells as described The media plus localization molecule wells serve as controls to monitor any cell death 1 25ml 10x Sup 1 25ml 10x Sup 1 25ml 10x Sup 2 5ul 4mg ml Polybrene 2 5ul 4mg ml Prota
153. lymeric scaffolds J Biomed Mater Res 2000 51 4 642 649 Meyer U Wiesmann HP Berr K Kubler NR Handschel J Cell based bone reconstruction therapies principles of clinical approaches Int J Oral Maxillofac Implants 2006 21 6 899 906 Handschel J Wiesmann HP Depprich R Kubler NR Meyer U Cell based bone reconstruction therapies cell sources Int J Oral Maxillofac Implants 2006 21 6 890 898 Hollister SJ Maddox RD Taboas JM Optimal design and fabrication of scaffolds to mimic tissue properties and satisfy biological constraints Biomaterials 2002 23 20 4095 4103 13 31 32 33 34 35 36 op Taboas JM Maddox RD Krebsbach PH Hollister SJ Indirect solid free form fabrication of local and global porous biomimetic and composite 3D polymer ceramic scaffolds Biomaterials 2003 24 1 181 194 Cima LG Vacanti JP Vacanti C Ingber D Mooney D Langer R Tissue engineering by cell transplantation using degradable polymer substrates J Biomech Eng 1991 113 2 143 151 Rezwan K Chen QZ Blaker JJ Boccaccini AR Biodegradable and bioactive porous polymer inorganic composite scaffolds for bone tissue engineering Biomaterials 2006 27 18 3413 3431 Murphy WL Kohn DH Mooney DJ Growth of continuous bonelike mineral within porous poly lactide co glycolide scaffolds in vitro J Biomed Mater Res 2000 50 1 50 58 Ishaug SL Crane GM Miller MJ Yasko AW Yaszemski MJ Miko
154. mine Sulfate 1 25ml Media 1 25ml Media 2 5ul 4mg ml Polybrene 2 5ul 4mg ml Protamine Sulfate Spin inoculate the cells by placing the plate in a multi well plate swinging bucket rotor and place in Eppendorf 5810R Centrifuge Spin the plate at 2500rpm for 90m at 30C Incubate the cells at 32C with 5 CO2 for 24 48h Replace viral supernatant with appropriate cell media and return cells to incubator Analyze trans gene expression gt 72 hours post infection In some instances trans gene expression may take up to 7 days post Infection Extra Notes 189 The splitting of the cells preparation of infection conditions infection of target cells and changing the media must be done using sterile technique in a biological safety cabinet to prevent contamination At any step during the infection antibiotics may be added to the media or supernatant if contamination is present The starting number of cells may be varied to account for total cell availability Successful transductions have been carried with as little as 2 0 x 105 cells per well This does however translate into fewer total cells successfully transduced The cell death control wells may be disregarded in favor of more wells of cells to be transduced once the effects of the localization molecules have been noted The duration the viral supernatant is on the cells can go from overnight to 2 days We have seen that a longer exposure can produce higher tr
155. mined by careful visual examination of regions where bone was observed These selected sections 29 were quantified and the results were stated as a fraction of the complete area of the ossicle 2 2 9 Analysis of bone ingrowth A custom program was developed to determine the distribution of regenerated bone as a function of the distance to the geometric center of each ossicle Using the von Kossa stained sections the centroid was calculated using a MatLab script and used as a frame of reference to divide the ossicles into 4 regions Defining the centroid as the o percentile and the edge as the 100 percentile boundaries were calculated by lines that radially pointed into the center from the edges Using the same selection criterion for defining mineral as above the program determined the percent of bone present in regions 0 25 25 50 50 75 and 75 100 of the area away from the centroid 2 2 10 Statistical analyses Linear regression analyses were performed to determine the thresholds with highest R values and an optimal threshold range for defining de novo bone This optimal threshold is defined as a range where R gt 0 85 The BVF predicted by uCT was regressed against ash fraction over a range of thresholds 600 2000 in increments of 100 to determine a volumetric correlation Two dimensional correlations were also performed over the same threshold range to compare the 2D area fraction of bone determined from uCT vs the 2D are
156. mp 45 x 40 4 39 7 g a 25 4 weeks 8 weeks 12 weeks Figure 4 4 Micro CT renderings and histological sections of ossicles regenerated following subcutaneous transplantation of BMSCs The micro CT renderings exhibited differences in patterns of bone produced from BMSCs and BMSCs transduced to overexpress Cx43 a l BVF is quantified to assess for these differences m Cells overexpressing Cx43 d f regenerate larger volumes of tissue compared to BMSCs Bone regenerated by BMSCs a c is characterized by a thin periphery of bone tissue When Cx43 is overexpressed d f ossicles have both thicker peripheral bone formation and more bone regeneration in the core of the 3D construct Ossicles generated from BMP7 transduced cells g i are characterized by a thin cortex although larger than BMSCs while tissue regenerated with co transduced cells j k exhibits large amounts of bone in growth and overall bone regeneration Histological sections validate the CT renderings The volume fractions m reflect a significant increase in bone regeneration in all transduced groups over BMSCs Tissue regenerated by cells overexpressing Cx43 has significantly higher BVF than the ossicles regenerated from BMSCs at 4 8 and 12 weeks p 4 weeks lt 0 032 p 8 weeks lt 0 001 p 12 116 weeks lt 0 003 When cells were stimulated with BMP7 the co transduced group produced a significantly higher BVF relative to the BMP7 transduced group p lt 0
157. nce overall cell adhesion and GJIC as hypothesized Two main factors may have influenced these results First although mineralization was achieved using the simulated body fluid SBF procedure Chapter 3 complete scaffold mineralization was not attained Therefore the current mineralization procedure may have not been optimal Because of the low percentage of mineral the seeding effect was the dominant factor in adhesion This is evident in the static seeding technique where mineralized templates exhibited significantly higher adhesion than the PLGA substrate Thus the mineral did have a significant effect in cell adhesion when the novel techniques were not employed indicating that more mineral may enhance adhesion Efforts should be made to design a mineralization technique perhaps through perfusion or filtration that will enable the scaffolds to mineralize at higher percentages 129 A second reason for the observed effects is the time dependent release of ions from the substrate to the solution The release of ions such as calcium and phosphate may have an impact on differentiation and regeneration of tissue but may not have a significant impact in cell adhesion Although one would expect that a higher concentration of secondary messengers such as Ca would lead to higher GJIC our experiments were carried out at early times where the dissolution effects of the substrate may have been negligible Experiments Shin et al have shown
158. nfluence 90 the adherent cells were washed with phosphate buffered saline solution and enzymatically released by means of a 0 25 trypsin EDTA Sigma St Louis MO Cells were re plated at a density of 30 000 cells cm and passaged 7 10 days after when confluence was achieved Cells were passaged twice before they were used in the subsequent experiments 3 2 2 Scaffold Preparation Porous 3D organic templates 85 15 poly lactide co glycolide diameter 4mm x height Imm 90 porosity pore size 250 425um were prepared by a solvent particulate leaching process explained elsewhere ae 3 2 3 Mineralization of Scaffolds Scaffolds were each incubated in a 50 mL solution of modified simulated body fluid SBF for 7 days for mineral film formation The SBF solution was changed every 24 h to ensure sufficient ion concentrations for mineral growth The SBF was prepared by dissolving the following reagents in deionized water 141 mM NaCl 4 0 mM KCI 0 5 mM MgS0O4 1 0 mM MgCl2 4 2 mM NaHCO3 5 0mM CaCl2 and 2 0 mM KH2PO04 SBF was buffered to maintain a pH 6 8 with Tris HCl at 37 C for the duration of the incubation period 63 3 2 4 Pre Wetting Scaffolds Scaffolds were pre wet with 70 ethanol by pressing wet pads around the surface area for 5 minutes Afterwards scaffolds were submerged in 50ml falcon tubes filled with a MEM and agitated 30 minutes to remove the excess ethanol The scaffolds were removed from the tube and pl
159. ng Cx43 exhibited a cortical like barrier with enclosed marrow cavity However bone formed from Cx43 transduced cells exhibits a thicker cortex and a smaller amount of marrow Ossicles formed from co transduced cells produced large amounts of cortical and trabecular like bone Fig 4 j k 1 Bone regenerated from control groups transduced with LVGFP and or ADCMVMT were similar to those of BMSCs denoting no significant change due to vector transduction The BVF of ossicles produced by transplanted BMSC Cx43 cells was significantly higher at all time points than ossicles formed from BMSCs p 4 weeks lt 0 021 p 8 weeks lt 0 001 p 12 weeks lt 0 003 Ossicles formed from cells stimulated by BMP7 produced significantly higher BVF when Cx43 was overexpressed relative to the BMP7 only group p 4 weeks lt 0 033 p 8 weeks lt 0 001 p 12 weeks lt 0 001 Co transduced cells led to significantly higher BVF s than all other groups at 8 and 12 weeks p lt 0 001 against all groups at both times Control cell groups generated 107 volume fractions that were not significantly different from volume fractions generated by BMSCs at any time Cortical thickness was significantly greater in ossicles formed from transplanted BMSC Cx43 cells Fig 5b compared to the BMSCs p lt 0 001 for 4 8 12 week time points Similarly bone regenerated by co transduced BMSCs produced a thicker cortical like periphery than ossicles generated by BMP7 p lt 0 001
160. ng these two controls it is possible to more accurately determine the percent of voxels in a bone scaffold composite that actually represent new bone The amount of bone can be determined from the difference between percent of voxels above the threshold in a bone scaffold composite and the percent of voxels above the threshold in the starting scaffolds or scaffolds implanted without cells if the scaffold is highly resorbable Bounds on the contribution to BVF due to interference from a scaffold are therefore represented by the number of voxels in the scaffold at time zero upper bound and number of voxels in the remaining scaffold following implantation lower bound Using this technique with ceramic scaffolds we demonstrated that the optimal thresholds for engineered bone remain in the 1000 1300 range Fig 9 If sufficient amounts of bone form within the scaffold this should allow the amount of new bone to be calculated and validated histologically even though it may not be possible to directly visualize the new bone on a uCT image In tandem with the consistency in threshold range between different cell types this threshold range is therefore deemed to be generally valid for cell based tissue engineered bone 40 One final note on the transformation of the threshold data in hounsfield units to other systems Several systems give a threshold value in terms of a physical mineral density mg cc Recent studies have shown a linear relationship
161. nnnnnnn_ nenan DA 434 GACna_mm anGIC AUT 8426 CAA CannnnaTCCnnnanan nanna Drell 8390 CAC_nnn GTG Nadi 8284 CCC COC NEOMIV 8282 G CCGG_C Fmt 8132 TCCCCA EBI 7944 OGTCTCr nnnn_ Avil 7934 C CTAC_C Sug 7933 AGG CCT Sp 7901 CACanneanCTCnnaennnnn_ nanan SAI 7887 GGOCn_nnn nGGCC AN 7471 C TTAA C Kpa 7288 G_GTAC C Acoge 7284 C CTAC_C ERI 7272 G AATT_C Nodl 7194 COC COC MPOMTV 7192 G CCGG_C Saril 7183 CC _CCc cc Fh 6953 TCCnGG_A PAMO 6921 CCAn ann aTCC Xheq 6668 C TCGA_G PNI 6668 vC TCCA Ch Dal 6662 TCTAG_A Eesti 6682 C CCCC C Neg 6652 GO GGCC_GC BsrCI 6639 T CTAC_A P 6210 T CCnGG_A Be i 6084 CCAnnnnunTCConnensnnnn an Sey 6020 GC nannnnTCOGannnnnnann mo 4g 8917 a CCCC T Seni 3911 G GATC_C Br l 790 C CCAC_C Ewn 712 G_CTAGC Net 708 C CTAC_C Xew 5543 CCAnpnn_n nnnnTGG BmyBI 399 CAC CIC See 5376 A CCeGG_T dem methylated Sob 360 ACCTCCuann nnnn_ lt 2 5360 CACCTGCnnnn nann_ SraBl 186 CATnn nn ATC Tek 11 154 GACo n_nGIC Pri 017 CAC CTC TY 4833 GACn n_ GIC Ki 4789 C_CTAC C Argel 4785 G GTAC_C Sail 4779 C TICCA C Px 4778 C_TGCA G EveRI 4769 C AATT_C ESRI 4767 TT CG_AA Nhs 4783 C TCCA_C AA 476 AGC GCT BBI 4681 CCTCTCn nnnn_ CECI 4503 CAAnnnnn GT GGonnnaonnnnn_nn Di CoCI 4468 CCACunannTIC r
162. nson amp Johnson Sommerville NJ and the mice recovered for anesthesia on a heating pad Figure 1 Inject mice by grabbing the skin over the cervix and Holding the tail and leg if necessary with one of our loose fingers 192 A15 Transduction of BMSCs with LV Cx43 GFP Ricardo Rossello Zhuo Wang and David Kohn For the protocol prior to culturing 25 ml of fresh whole bone marrow cells in a 50 ml tube will be transduced with 25 ml of the produced lentiviral particles in suspension in a rotation incubator at a MOI of 50 in Media Transduction will be carried out for 5 h at room temperature in the presence of 100 M deoxynucleoside triphosphates Amersham Pharmacia Biotech Inc USA and protamine sulfate 8 ug ml or at 37 C in the presence of 8 ug ml polybrene Sigma USA After transduction cells will be washed twice by centrifugation at 100 g for 12 min followed by re suspension of the cells in 1xPBS After 12 days of culture the TRC3 cell product including adherent and non adherent cells will be evaluated for GFP expression by fluorescence microscopy Quantification of the proportion of GFP cells will also be performed after a week of transduction Non transduced BMSC will be used as negative control for GFP expression For transduction during culture BM MNC will be plated at a density of 22 5x10 cells per T75 flask The lentiviral vector with a titer of 10 cells ml will be used to perform a transduction at day 3 4 of cultu
163. o the inductive cues provided by the growth factor Synthetic materials are primarily designed to be permanently implanted Long term complications include stress shielding leading to loosening and mechanical or chemical breakdown of the material itself A more biological alternative to the permanent implantation of synthetic materials is a cell transplantation approach where a 3 dimensional natural or synthetic construct provides a temporary substrate for cells to organize grow differentiate and form a 6 14 15 functional extracellular matrix and new tissue Because bone regeneration is a complex process that requires autocrine paracrine and endocrine signals positional cues cell matrix interactions mechanical forces and cell cell contacts to mediate the formation of a complex 3D architecture and function an understanding of developmental processes may help identify strategies that can be used in tissue engineering Altering simple initial conditions may help maximize some of the necessary processes for tissue development while solving some of the clinical limitations present in current strategies Two such initial conditions that can be easily manipulated are the substrate chemistry and the initial cell seeding Of particular importance with the use of synthetic materials is that most problems manifest themselves at the biomaterial tissue interface in part because the tissue has the ability to functionally adapt
164. observation a Observe and monitor the cells every two days b Change media every 2 3 days c Passage the cell as specified in the tripsinizing and sub culturing cells protocol in 7 10 days 177 A7 Filtration Seeding of Scaffolds Ricardo Rossello and David H Kohn I Equipment and Supplies Chemicals 70 Ethanol bottle for instruments amp spray bottle Ice PBS 1X Hanks Balanced Salt Solution HBBS Gibco BRL 14170 120 Fetal bovine serum Gibco BRL 16000 044 Alfa MEM Gibco BRL Cat 12571 063 alfa MEM 1X Media Note All media preparation and other cell culture work must be performed in a laminar flow hood Use a Steril 500ml Nalgene filter to prepare the media For 500 ml 50ml Fetal calf serum Sml Penicillin Streptomycin Balance alfa MEM Consumables Gloves 24 well vials Plastic Vials Flasks Nalge Nunc Int 136196 polysterene sterilized filter cap flask angled neck 50 ml 25 cm 2 culture area Kim wipes Paper towels Nalgene Filter Plastic bags Equipment Laminar flow hood suction system tube large liquid waste flask Tweezers forceps sterile keep in EtOH under hood Test tube rack Microscope Incubator CO2 Filtration Device General Procedural Notes Autoclave Filtration Materials before usage II Procedure 178 Cell Suspension Trypsinize cells see 7rypsinizing Cells Observe flasks after trypsinization if there appears to be a large number of cells on the flask
165. of regenerated tissue Explicitly we showed that the initial conditions of mineralizing a polymer scaffold PLGA and seeding cells through the novel filtration and micromass techniques as opposed to the conventionally used static seeding ee enhanced osteogenic differentiation in vitro and regeneration of bone in vivo in the longer term Furthermore we showed that the filtration and micromass seeding enabled higher gap junction intercellular communication between cells in 3D an important 36 39 component for tissue development and homeostasis Coupled together we speculate 75 that our results provide simple alternatives that can have a profound impact on the regeneration of 3D tissue equivalents Mineralized templates had a significant effect both in cell differentiation in a 3D scaffold figure 4 and in the amount of regenerated bone in vivo figure 5 The examination of differentiation under 3D conditions was important recently our group and others have demonstrated differences in cell differentiation between a 2D monolayer and 3D cultures Chapter 5 The differentiation data contained a group that only contained soluble calcium In these cases there was moderate or significant increase in differentiation relative to cells seeded in PLGA scaffolds However cells in mineralized templates in general had significantly higher differentiation marker expression than the soluble calcium group This suggests that both soluble and ins
166. ogram determined the percent of bone present in regions 0 25 25 50 50 75 and 75 100 of the area away from the centroid A 2 way ANOVA was performed to differentiate between 1 sections in filtered and micromass generated ossicles and 2 topographical regions within each ossicle significance was measured at p lt 0 05 3 3 Results 3 3 1 Filtration seeding achieves a higher number of attached cells Filtration seeding led to significantly higher percentage of cells adhered than dynamic or static seeding figure 1 Scaffolds filtered with cells had high cell retention after 1 hour 82 4 4 1 and approached carrying capacity by the 6 hour 92 32 6 12 Both dynamic and static seeding increased as a function of time but had 71 significantly less cell adhesion than filtration at all times p lt 0 001 for all times Dynamic also achieved significantly higher number of attached cells than static seeding p Lhr 0 003 p 6hrs lt 0 001 p 24hrs 0 021 The effect of template was only significant in the static seeded scaffolds where the mineralized layer enhanced adhesion p hr 0 031 p 6hr 0 028 There was no significant difference in cell adhesion between mineralized and non mineralized scaffolds seeded by filtration and dynamic seeding Histology verifies the adhesion results The slides qualitatively show that filtration figure 2C has an increase in cell number and spatial distribution when compared to static figure 2A
167. ole calvaria were taken at this threshold to show the regeneration of bone on the defect form both an aerial and a sagital perspective 200 Histology and morphological analyses Ossicles were removed from the site of the defect in the calvaria The ossicles were rinsed in water and then decalcified in 10 formic acid for 5 days After decalcification the tissues were embedded in paraffin 5 um sections were made and placed on 10 slides with 3 sections per slide The tissue was deparaffinized hydrated and the first fifth and tenth slides were stained with H amp E Image Pro Plus 4 0 was used to take pictures of the histological sections in order to observe the overall bone formation cortical thickness and trabecular like bone formation Results Cells overexpressing Connexin 43 exhibit increased cell to cell communication and differentiation in core regions of the scaffold Regeneration of bone was also significantly altered both in volume fraction and apparent pattern of osteogenesis Regenerated bone was significantly affected based on GJIC figure 3 When cells were transduced to overexpress the mutant Cx43A7 bone regeneration fig 3a c BVF 4 week 6 1 1 1 8 week 4 8 0 9 12 week 5 2 1 3 was significantly less compared to all groups p lt 0 001 against all groups Furthermore there was no significant difference in regenerated bone between the different time points in cells overexpressing the mutant connexin Cells ove
168. oluble calcium in these biomimetic scaffolds play an important role in differentiation When cells were seeded in mineralized templates the ossicles regenerated had a significantly higher BVF relative to ossicles regenerated by cells seeded in PLGA Perhaps the most significant effect is observed in the static seeded scaffolds whereby the presence of a mineral layer enables bone formation to occur with entrapped cells in a peripheral shell formation and marrow cavities forming compared to partial sections of hard tissue with some entrapped cells observed in the polymer group These results suggest that a mineralized layer provides a favorable physiological environment for cells to thrive differentiate and regenerate tissue In our studies the effects of adhesion due to a biomimetic surface was also investigated Other studies have shown that such a calcium phosphate coating can 40 42 enhance cell adhesion However our results show that only when statically seeded did cells adhere at higher rates in mineralized scaffolds over PLGA figure 2 Scaffolds 76 seeded through dynamic and filtration seeding exhibited similar rates of adhesion The results for the statically seeded scaffolds are therefore consistent with results of others yet coupled with our dynamic and filtration data suggest that the effect of surface mineralization is less important than cell seeding strategy Also mineralized scaffolds did not have an effect on GJIC f
169. olume 4 2 9 Histology and Morphological Analyses The ossicles were rinsed in water and then decalcified in 10 formic acid for 5 days After decalcification the tissues were embedded in paraffin 5 um sections were made and placed on 10 slides with 3 sections per slide The tissue was deparaffinized hydrated and the first fifth and tenth slides were stained with H amp E Image Pro Plus 4 0 was used to take pictures of the histological sections in order to observe the overall bone formation cortical thickness and trabecular like bone formation 4 3 Results 4 3 1 Characterization of Cx43 GFP modified BMSCs Transfer efficiency of the GFP Cx43 fusion gene was measured at 83 4 by assessing the number of GFP positive cells Fig 1 B relative to the total number of nuclei per given field two weeks after transduction Similar efficiency was attained when cells were co transduced with AD BMP7 and LVC Cx43 GFP 85 5 and control cells with LVGFP 87 7 indicating that the co transduction did not alter the transduction efficiency of cells with Cx43 and that no differences in transduction occurred between Cx43 GFP and GFP containing lentivirus A significant increase in 103 expression of Cx43 occurred when cells were transduced with LVCx43GFP Fig 1C The total expression Cx43 in BMSCs transduced with Cx43 GFP was significantly higher 3 74 0 49 p lt 0 001 against both groups compared to the non transduced BMSC g
170. ons were standardized for all scaffolds in 200um increments from the surface The number of cells per section was quantified and the mean number of attached cells per section is reported Differences in cell counts were assessed using a 1 way ANOVA on 6 hour sections and differences were assessed at p gt 0 005 3 2 7 Dye transfer studies Fluorescent dye transfer studies were performed to assess gap junctional intercellular communication GJIC between BMSCs seeded in mineralized and non mineralized scaffolds by static filtered and micromass seeding strategies The cell scaffold constructs 4x1mm were seeded as previously described for 24 hours and placed in 24 well plates Cells in these circumstances served as recipient cells Calcein AM 10uM and Vybrant Dil were used to label donor cells grown to confluence in a 12 well 66 plate As a negative control 50uM of the gap junction uncoupler alpha glyccirrhetinic acid AGA was used n 5 Donor cells were added to potential recipient cells at 1 8 ratio Cells were harvested by trypsinisation for quantitative assessment of GJIC by flow cytometry after 5 hours The transfer regions for recipient cells gt 2x10 FI and lt 5x10 FI and non labeled non recipient cells lt 2x10 FI were defined as the transfer regions based on the initial fluorescence range quantified for non recipient cells and cells containing both dyes Florescence above 5x10 FI was indicative of cells cont
171. ose of tubing properly Remove tubing from system while wearing gloves Place tubing in autoclave for 30 minutes at 30 PSI 270 F Once tubing is autoclaved place in red biohazard bin for waste disposal AR wh E PERFUSION SYSTEM DISPOSAL STERILIZE FIRST o Dispose of the perfusion system only once 1t 1s no longer in use 1 Disassemble perfusion system by removing tubing from pump as directed above 2 Place bottom half of chamber in autoclave along with tubing tubing connector o ring and thumb screws Autoclave components for 30 minutes at 30 PSI 270 F 3 Place autoclaved components in red biohazard bin for waste disposal 4 Soak chamber lid in 70 ethanol for a 1 minute and then dispose of in red biohazard bin 5 Clean pump with a dry cloth and wipe down with a 70 ethanol solution If it is still in working order store for future experiments 143 DETAILED HOW TO S EXPERIMENTATION PREPARATION A HOW TO DETERMINE TUBING LENGTH l t The PharMed tubing should be cut so there is an adequate amount of tubing to pass through the pump leaving extra for connections on either end The standard length is 1 5 ft The silicone tubing must be long enough to allow for sufficient perfusion of carbon dioxide between the media and incubator The necessary length depends on the amount of media being used and the flow rate Use trial and error to determine the length necessary for your experiments The standard length
172. own delayed ossification and osteoblasts dysfunctions Several studies indicate that the increase of Cx43 expression either by upregulation or transfection increases GJIC 66 68 and have elucidated potential mechanisms of cell cell communications To understand the role in bone formation null mice Gjaljrt carry a point mutation in the Cx43 gene that produces dominant negative properties Cx43 null mice exhibit profound mineralization defects in shape and mineralization of skeletal elements These mice die pre natally due to severe defect in the heart leading to swelling and blocking of the right ventricle outflow Cells obtained from the cranium of these null mice showed delayed differentiation and mineralization In order to understand the role of communication through gap junctions in bone cells Rat osteosarcoma cell line UMR 8 77 gt These cells are has been used as a model to determine the role of Cx43 in cells characterized for not expressing Cx43 but do in fact express Cx45 Gap junctions have been implicated in many important mechanisms in bone regeneration such as the regulation of Erk RankL Tbox expression responses to growth factors such as BMP 2 and the diffusion of paracrine agents such as PTH gt A generalized mechanism for the gap junctional role of Connexin in bone cells can be developed based on the research done on this area Figure 1 Our experiments investigate the effect
173. p into the graduated cylinder until the flow is on again Note that during this time no water should flow out of the tubing due to a vacuum formed in the tubing Turn the dial on the pump to the lowest setting 0 Turn the pump on and let the water collect in the graduated cylinder for a timed period of 5 minutes At the end of the 5 minute period turn the pump off and observe how much water was expelled by the pump Record the volume One convenient feature of using a graduated cylinder as the collecting container is that it already has markings to determine volume Divide the volume observed by 5 minutes to get the flow rate at that setting in mL min 144 12 Repeat steps 8 10 at the different pump settings to calibrate and quantify the flow rates at those settings 13 Once calibrated either add labels directly onto the face of the pump around the dial with the appropriate flow rates or record in a notebook the flow rates that correspond to each of the settings on the dial Figure 1 ATTACHING TUBING TO THE PUMP wo U j 2 GRIPPER INLET PORT Image From PTP 2408 User Manuai PORT C STERILIZATION PROTOCOLS FOR PERFUSION SYSTEM COMPONENTS 1 Chamber tao See 4 a Teflon base with inlet outlet ports thumb screws o ring and tubing connector 1 Autoclave Steam for 30 minutes at 30 PSI 270 F 11 The Teflon and inlet outlet ports remain connected during autoclave cycle There is no nee
174. period of time 13 14 15 Turn off the peristaltic pump and move the perfusion system to the chemical hood Take out a media sample and the cell plate to use for further testing Disassemble and clean the perfusion system Sterilize all components before doing another experiment 142 CARE AND MAINTENANCE A STORING PERFUSION SYSTEM l After all components have been sterilized Detailed How To s Experimentation Preparation C p 8 ensure that all components are dry and free of foreign material 2 Store ina dry place until needed for next experiment Leave the chamber open to prevent excessive bacterial growth while in storage Sterilize the perfusion system immediately before use particularly when system has been stored B PHARMED TUBING REPLACEMENT l Iftubing is worn cracked or leaking cut a new piece of 1 16 ID PharMed tubing to desired length typically 1 5 ft 2 Sterilize new piece of tubing Detailed How To s Experimentation Preparation C p5 C SILICONE TUBING REPLACEMENT l When the silicone tubing deteriorates replace it with new 1 16 ID silicone tubing Cut new silicone tubing to the desired length typically 4 ft Sterilize the new silicone tubing Detailed How To s Experimentation Preparation C p 8 U D TUBING DISPOSAL Silicone and PharMed l After each experiment inspect tubing for signs of wear and degradation If cracks holes or worn areas are present disp
175. py Micromass and filtration seeding were proposed Chapter 2 because the potential to take advantage of several factors believed to play a role in tissue formation Of these factors the effects of osteogenic differentiation and bone formation due to migration and effect of nutrient flux should be examined next The ability for nutrients to flow in and byproducts out may be a dominant factor with respect to cell viability while cell migration may dictate osteogenic patterns and distribution of bone Migration may play an important role by setting a gradient of differentiation that is that enables differentiation to occur at different locations and times Micromass seeding was aimed to produce such a gradient of differentiation as cells were seeded in the core of the scaffolds where they were presumed to migrate outward Time dependent and distribution studies need to be performed to examine 1 differentiation and 2 cell 133 motility in the scaffold To control motility the scaffold pore sizes may be altered The framework of the 3D experiments Chapter 4 5 may work to analyze the effect of motility and differentiation Micromass seeding was also designed with the aim to permit more nutrient and byproduct flux for the cells seeded in the scaffold An apparatus was designed and built Appendix 1 that controls several parameters including flux and gas exchange for in vitro experimentation of 3D tissue engineered structures By quantifying
176. r Res A 2004 71 2 258 267 Knackstedt MA Arns CH Senden TJ Gross K Structure and properties of clinical coralline implants measured via 3D imaging and analysis Biomaterials 2006 27 13 2776 2786 57 36 37 38 39 40 41 Fajardo RJ Ryan TM Kappelman J Assessing the accuracy of high resolution X ray computed tomography of primate trabecular bone by comparisons with histological sections Am J Phys Anthropol 2002 118 1 1 10 Thomsen JS Laib A Koller B Prohaska S Mosekilde L Gowin W Stereological measures of trabecular bone structure Comparison of 3D micro computed tomography with 2D histological sections in human proximal tibial bone biopsies J Microsc 2005 218 Pt 2 171 179 Chappard D Retailleau Gaborit N Legrand E Basle MF Audran M Comparison insight bone measurements by histomorphometry and microCT J Bone Miner Res 2005 20 7 1177 1184 Krebsbach PH Gu K Franceschi RT Rutherford RB Gene therapy directed osteogenesis BMP 7 transduced human fibroblasts form bone in vivo Hum Gene Ther 2000 11 8 1201 1210 Laurencin C Khan Y El Amin SF Bone graft substitutes Expert Rev Med Devices 2006 3 1 49 57 Kozloff K Thornton M Goldstein S A Validation of a Micro Ct System for Quantitative Densitometry 5th Combined Meeting of the Orthopaedic Research Societies of Canada USA Japan and Europe 2004 58 Chapter 3 Effects of Cell Seeding and Self Mineral
177. r communication via overexpression of connexin 43 can be on its own a powerful tool to overcome limitations inherent in cell to cell communication and regeneration of tissue in 3D and can complement the effect of another agent or stimulus leading to regeneration of larger volumes and more uniform tissue Our strategy may be broadly applied to a wide range of cells and 3 dimensional tissues with the aim to enhance cell cell communication enabling normal development and homeostasis This concept can also be applied in future therapies to combat many types of cancer As a preventive measure for malignant cancerous tumors Cx43 gene delivery can be targeted on cancerous and pre cancerous cells which are characterized for becoming GJIC deficient Ultimately our approach may be a fundamental component overcoming the longstanding problem of inducing synchronized cell behavior in 3D cultures of cells or tissues and developing clinically meaningful tissue engineered equivalents 112 C kDa BMSCs Cx43 BMSC LVGFP BMSC Cx43 GFP 74 Cx43 43 GAPDH 36 GFP 24 J 4 5 E BMSC 4 BMSC LVGFP E BMSC LVGFP Cx43 Expression of Cx43 relative to BMSC expression Figure 4 1 BMSCs are highly transduced with Cx43 GFP Expression of the Cx43 GFP gene in transduced BMSCs was observed under a phase contrast a and fluorescent microscope for GFP expression b The expression of Cx43 GFP Cx43 GAPDH and GFP was also measured using western b
178. r of bone containing entrapped cells fig 4d Some trabecular bone is observed and the regeneration of bone extends further outside the region of the defect Interestingly such large amounts of regenerated bone outside the defect region are not observed when cotransduced cells are used fig 4e 202 Cx43 BMP 7 m 4 Weeks E Weeks 12 Weeks Bcx43aAr OBMSC mista E EMP7 E C43 B MP7 Bone Volume Fraction 4 week 12 week Figure 1 Increased GJIC increases bone volume fraction of critical sized mouse calvarial defects Rendered images of aerial top and sagital bottom views defect sizes a o show the level of GJIC enhanced or inhibited the bone volume fraction Cx43 overexpression exhibits larger distribution of bone healing relative to the BMSCs group at all time points The same is observed when these groups are also treated with BMP7 where the co transfected group produced large coverage over the defect site at all time points Deletion mutants Cx43A7 exhibited little bone healing in the defect site To quantify these observations the BVF is determined b Groups overexpressing Cx43 exhibited significant increases in BVF over their control groups In this case of the co transformation the healing of the defect is maximized over all other groups in the 4 and 12 week b Deletion mutants were characterized by low BVF from the onset with no significant change in the growth of bone at later time period
179. rated from BMSCs transplanted on these scaffolds for 6 weeks was analyzed Regressions between BVF calculated as 34 the percentage of voxels above the threshold in the bone bioceramic composite minus the mean percentage of voxels above the threshold in a group of ceramic scaffolds implanted without cells and ash fraction calculated as the ash fraction of the bone bioceramic composite minus the mean ash fraction of a group of ceramic scaffolds implanted without cells showed that the highest correlation was achieved at 1200 and the range 1000 1300 exhibited R values greater than 0 95 Fig 9 2 4 Discussion l 18 19 25 Micro CT has been extensively used to characterize mature trabecular bone and more recently to characterize bone regenerated via a variety of tissue 70 23 as well as porous scaffolds themselves The engineering approaches strength of this technique lies in both the ability to nondestructively image the tissue in 3D and more importantly quantification of the structures within the three dimensional image However before any analyses can be performed the bone tissue must be separated from the marrow water air and other soft tissue within the image The differentiation between bone and nonbone is generally based upon differences in radiodensity The inherent difficulty in this procedure may cause image thresholding techniques to have a 19 25 major impact on the characterization of osteogenesis
180. re enters hood e Clean the hood with EtOH before and after the procedure e Autoclave dissection instruments before hand 176 e All culture vessels test tubes pipet tip boxes stocks of sterile eppendorfs etc should be opened only in the laminar flow hood II Procedure 1 Setup a Place the petri dish containing the bones inside the hood b Set up 3 additional petri dishes 1 Media 11 Bone remains 1 BMSC c Place about 15 ml of media to the media petri dish Use extreme caution when using the syringe only touch the part necessary for suction 2 Retrieval of BMSC a With forceps use a clipper to break the outer extremeties of the bones 1 A cut should be done at or close to where the bone marrow can be seen b Retrieve 3ml of media with the syringe Use the syringe to flush out the bone morrow out of the bone and into the BMSC plate c Use the same media decanted from the bone to further flush morrow cells This time flush the cells through the other side of the bone Do this procedure about 4 times Perform a c for all of the bones e See if there is any marrow left in the small peaces of the bone so that you could retrieve that too 3 Re suspend the morrow cells a Use the syringe to re suspend the BMSC 4 Observation and storage a Mark the date and strain of rat used b Count the cells with a Hemacytometer see Cell Counting with Hemacytometer Protocol c Place cells in a CO2 incubator 5 Further
181. re the scaffold is placed c Scaffold d Variable pump system a Contains velocity control and directional control Fig 2 Pipetting media over trypzinised cells N Tilt the flask slightly such that the media and cell suspension are in the bottom corner 2 Pipette over the whole surface a few times to recover more cells 180 A8 Subcutaneous Transplantation of Gelform BMSCs into Mice Purpose Gelform is the usual hemostatic sponge in dental clinic which consists of absorbable gelatiin To have the in vivo study of MSCs we cast Gelform blocks as carriers for tissue engineering cell scaffold implantation Chemicals Ketamine Xylacine Saline Consumables Sterile Gelfoam sponge 12 sq cmx 7 mm Sterile gauze Serum free alpha MEM serum 6 well culture plate Equipment Laminar Flow Hood Surgical scissors blade 15 and scalpel Procedure 1 Under sterile environment place the Gelform sponge onto a 100mm Petri Dish Slice the sponge horizontally in half with the scalpel 3 5 mm height each Use scissors to cut the Gelform into 3 5 mm cubes place the Gelform cubes onto a pre wet gauze by alpha MEM press with dry gauze to drive off the air bubbles Then dry Gelform with another dry gauze 2 Cells were harvested and counted then alliquote into ependorf tubes at 2 3 million ml tube Centrifuge and aspirate the supernatant reserve 30 50 ul medium and suspend cell pellet by pipetting 3 Place one sponge tube
182. re was a negligible amount of free cells left in the scaffold after the 5 wash The washed fraction was pooled and saved to count the free cells present in the media The apparatus and containers were also washed to determine the number of cells that did not adhere Free cell count was obtained using a hemacytometer The of cells that adhered to the scaffold was determined by subtracting the number of washed cells from the number of cells originally seeded To verify this counting strategy 4 scaffolds from 65 each seeding condition were treated with trypsin EDTA to remove the attached cells Trypsinization was performed for two minutes followed by flushing of cells with MEM This process was repeated 3 times per scaffold and the 3 resulting cell suspensions were pooled to obtain the number of attached cells Cell counts from micromass seeded scaffolds obtained via these two methods are not reported because the count was inconsistent and the treatment destroyed some cells A 3 way ANOVA on time template and seeding strategy was performed to determine significant differences in percentage of seeded cells p lt 0 005 As an alternative three scaffolds for each seeding strategy and time were analyzed histologically to quantify cell retention and qualitatively observe the distribution of attached cells Scaffolds were fixed in 10 buffered formalin and ethanol 5 um sections were made and placed on 10 slides with 3 sections per slide Secti
183. re when individual colony forming units are initiated which are at a high proliferative status susceptible to viral transduction In addition transduction will be carried out in the presence of 8 ug ml of protamine sulfate that can enhance the transduction efficiency 5 ml of filtered virus containing media will be mixed with 5 ml of fresh LTBMC and 8 ug ml protamine sulfate will be added to the cell cultures for approximately 16 h infection phase followed by replacing this media with fresh media for 6 8 h recovery phase The cells will be exposed to three cycles of virus infection After 1 2 4 8 12 days of incubation BMSCs cells will be examined under fluorescent microscopy and will be trypsinized for FACS analysis Controls will include non transduced cells cells subjected to transfection medium without viruses and cells transduced with the vector minus GFP I Equipment and Supplies Chemicals 70 Ethanol bottle for instruments amp spray bottle Ice PBS 1X Hanks Balanced Salt Solution HBBS Gibco BRL 14170 120 Fetal bovine serum Gibco BRL 16000 044 Alfa MEM Gibco BRL Cat 12571 063 alfa MEM 1X LV Cx43 GFP titers frozen at 10x Titer 10 cells ml Protamine 8ug ml Media Note All media preparation and other cell culture work must be performed in a laminar flow hood Use a Steril 500ml Nalgene filter to prepare the media For 500 ml 50ml Fetal calf serum 193 Sml Penicillin Streptomycin Balance alfa
184. rexpressing Cx43 BVF 4 week 21 8 6 1 8 week 53 9 13 2 12 week 46 9 5 however regenerated larger tissue equivalents of bone 201 than BMSCs alone BVF 4 week 21 8 6 1 8 week 53 9 13 2 12 week 46 9 5 at all time points p 4 weeks 0 012 p 8 weeks lt 0 001 p 12 weeks lt 0 001 Cells overexpressing BMP7 also exhibited larger volume fractions of regenerated bone when GJIC was enhanced figure 3p The cotransduced group regenerated significantly more bone than groups with BMP7 alone in the critical sized defect region However when cells overexpressed BMP7 only large volumes of bone were regenerated outside the region of the defect figure 3j l that are not observed in cotransduced cells 3m o Further qualitative depiction of regenerated bone was obtained through histological analysis figure 4 in the interface between the calvaria and the tissue engineered bone Cx43A7 overexpressing group exhibits no bone regeneration with undifferentiated cells still entrapped in the gelatin scaffold figure 4a BMSC regenerated bone is non continuous although some bone is regenerated containing entrapped cells and some marrow fig 4b When Cx43 is overexpressed the bone tissue is continuous with entrapped cells no marrow cavity is present and it is contained within the region of the defect fig 4c The presence of BMP7 in BMSCs enabled regeneration of bone with full marrow cavity encapsulated with a thin laye
185. rin F Salome M Cloetens P Laval Jeantet AM Ritman E Ruegsegger P Micro CT examinations of trabecular bone samples at different resolutions 14 7 and 2 micron level Technol Health Care 1998 6 5 6 391 401 Dedrick DK Goldstein SA Brandt KD O Connor BL Goulet RW Albrecht M A longitudinal study of subchondral plate and trabecular bone in cruciate deficient dogs with osteoarthritis followed up for 54 months Arthritis Rheum 1993 36 10 1460 1467 Kinney JH Ryaby JT Haupt DL Lane NE Three dimensional in vivo morphometry of trabecular bone in the OVX rat model of osteoporosis Technol Health Care 1998 6 5 6 339 350 54 15 16 17 18 19 20 PAR Lill CA Fluegel AK Schneider E Effect of ovariectomy malnutrition and glucocorticoid application on bone properties in sheep A pilot study Osteoporos Int 2002 13 6 480 486 McLaughlin F Mackintosh J Hayes BP et al Glucocorticoid induced osteopenia in the mouse as assessed by histomorphometry microcomputed tomography and biochemical markers Bone 2002 30 6 924 930 Nishida S Tsurukami H Sakai A et al Stage dependent changes in trabecular bone turnover and osteogenic capacity of marrow cells during development of type II collagen induced arthritis in mice Bone 2002 30 6 872 879 Feldkamp LA Goldstein SA Parfitt AM Jesion G Kleerekoper M The direct examination of three dimensional bone architecture in vitro by computed
186. rom engaging in GJIC was used as a dominant negative control group 4 2 2 Culture and Transduction of BMSCs Five week old C57BL 6 mice were used to isolate bone marrow cells from the femoral tibial and humeral cavities six bones per animal as previously described a BMSCs mixed with enriched minimum essential medium a MEM Gibco Laboratories Grand Island NY containing 10 fetal bovine serum FBS Gibco and antibiotics 100 ug ml penicillin G and 100 U ml streptomycin at 37 C in 5 CO2 95 air were plated 96 at a density of 2 25 million cells per T75 flask Cells were passaged twice before transduction For LVCx43GFP LVGFP and LVMT transductions lentiviral vector with a titer of 10 transducing units ml was used on day 3 4 of sub culture Transduction was carried out in the presence of 8 ug ml of protamine sulfate to enhance the transduction efficiency Five ml of filtered vector containing enriched a MEM was added to the cell cultures for approximately 16 h transduction phase followed by replacement of media with fresh media for 6 8 h recovery phase The cells were exposed to three cycles of transduction After 12 days of incubation transduced BMSCs were examined under fluorescent microscopy to determine transduction efficiency through GFP fluorescence Ten random fields per well were photographed and transduction was measured as the average fraction of fluorescent cells relative to total cells in the field Transductions w
187. roup 1 0 0 29 and the control LVGFP transduced group 0 89 0 11 4 3 2 Overexpression of Cx43 increases GJIC BMSCs transduced with Cx43 exhibited significantly higher transfer of Calcenin AM than BMSCs both in cells cultured in 6 well plates 2D and gelfoam scaffolds 3D relative to non transduced groups p lt 0 001 for all figure 2 There was no significant difference between Cx43 and Cx43 BMP7 or between BMSCs and BMSC BMP7 transduced cells suggesting that BMP7 does not modulate gap junction function Cells transduced with a seven base pair deletion Cx43 gene mutant Cx43A7 which enables proper docking of connexin hemichannels but inhibits GJIC exhibited significantly less transfer than both BMSCs and BMSCs transduced to overexpress Cx43 p lt 0 001 The data suggests that Cx43 plays a prominent role in cell to cell communication and inhibition or overexpression will lead to hindered or amplified GJIC respectively When cells overexpress Cx43 the percentage of cells that uptake calcenin in 3D cultures was significantly greater than the percentage of those that uptook calcenin in 2D cultures figure 2b p gt 0 001 in both Cx43 and Cx43 BMP7 vs all other cells BMSCs and BMSCs transduced with BMP7 showed no significant difference in transfer fraction Cells transduced with control vectors LVMT LVGFP ADCMVMT ADCMVMT LVMT showed no significant difference in GJIC from BMSC data not shown The results support the hypothesis th
188. s 203 a d Figure 2 Histological sections of 12 week transplants showing the interface between calvaria and new bone formation Cx43A7 ossicles are characterized by little or no bone formation in the interface between the ossicle and calvaria a Overexpression of Cx43 b produces more of a continuous cortical like bone formation throughout the defect compared to that generated by BMSCs c Expression of BMP7 increased healing with the periphery d e and the effect of Cx43 with BMP7 was to produce bone regenerates that were more specific to the defect size e compared to a larger bone ossicle with complete bone marrow cavities produced by the BMP7 only ossicles Red boxes indicate the interface site between ossicle and calvaria 204
189. s All sponges were pre wet in a MEM and air bubbles removed by applying gentle pressure on the sponge between two pieces of sterile filter paper 2 5 million cells were collected suspended in 50 ul medium and loaded onto each sponge by capillary action Both 2D and 3D cultures were induced to differentiate with osteogenic media 88 MEM a media 9 Fetal Bovine Serum 1 Pen Strep 1 100x B Glycerophosphate 1 L ascorbic acid phosphate 0 05 Dexamethasone one day after culturing After culture time the gelfoam cell constructs are removed from the well plate and separated for analysis of both surface and core cells 4 2 5 Dye transfer studies of Cx43 Fluorescent dye transfer studies were performed to assess gap junctional intercellular communication GJIC Calcein AM 10um gap junction permeable molecular probles and Vybrant Dil membrane tracker molecular probles were used to label donor cells grown to confluence in a 12 well plate As a negative control 50uM of the gap junction uncoupler alpha glyccirrhetinic acid AGA was used Sigma Donor cells were added to potential recipient cells cultured to confluence in monolayer 12 well plates or in 3D constructs Gelfoam 8 days at a ratio of 1 8 After 5 hours cells were harvested by trypsinisation for quantitative assessment of GJIC by flow cytometry BD Biosciences FaCSCalibur of homogeneous samples Dye studies were performed on all cell types in the experimental groups
190. s AG Bone formation by three dimensional stromal osteoblast culture in biodegradable polymer scaffolds J Biomed Mater Res 1997 36 1 17 28 Krebsbach PH Kuznetsov SA Bianco P Robey PG Bone marrow stromal cells Characterization and clinical application Crit Rev Oral Biol Med 1999 10 2 165 181 Kofron MD Zhang JX Lieberman JR Laurencin CT Genetically modified mesodermal derived cells for bone tissue engineering IEEE Eng Med Biol Mag 2003 22 5 57 64 14 38 39 40 41 42 43 44 El Amin SF Kofron MD Attawia MA Lu HH Tuan RS Laurencin CT Molecular regulation of osteoblasts for tissue engineered bone repair Clin Orthop Relat Res 2004 427 427 220 225 Glicklis R Shapiro L Agbaria R Merchuk JC Cohen S Hepatocyte behavior within three dimensional porous alginate scaffolds Biotechnol Bioeng 2000 67 3 344 353 Holy CE Shoichet MS Davies JE Engineering three dimensional bone tissue in vitro using biodegradable scaffolds Investigating initial cell seeding density and culture period J Biomed Mater Res 2000 51 3 376 382 Li YJ Batra NN You L et al Oscillatory fluid flow affects human marrow stromal cell proliferation and differentiation J Orthop Res 2004 22 6 1283 1289 Holtorf HL Sheffield TL Ambrose CG Jansen JA Mikos AG Flow perfusion culture of marrow stromal cells seeded on porous biphasic calcium phosphate ceramics Ann Biomed Eng 2005 33 9
191. s no significant difference in BVF between the filtered 27 3 2 5 and micromass 31 2 6 2 However the percentage of variability was higher on the micromass seeded construct than the filtration Filtered micromass and statically seeded mineralized scaffolds showed significantly higher BVF p values 0 013 0 037 0 009 respectively than the PLGA seeded counterparts 74 3 3 4 Different seeding techniques led to distinct patterns of osteogenesis Distribution analysis performed on Von Kossa sections verified the qualitative observation in the H amp E sections showing a quantitative difference in the distribution of mineral location in micromass and filtered ossicles figure 9a The filtered ossicles showed most of the mineral in the periphery while the micromass ones had a more even distribution figure 6B The ossicles generated by filtration seeding showed significantly higher BVF in the periphery 75 100 than in the core 0 25 p lt 0 001 The micromass seeded ossicles have significantly more mineral in the core p 0 0213 and significantly less p 0 0311 in the periphery than the filtered ones figure 9b There was no significant difference in BVF between topographical regions in the ossicles generated by micromass seeding 3 4 Discussion Our data suggests that altering the initial cell seeding conditions and or using a biomimetic mineral template can have a profound impact on both the amount and spatial distribution
192. s of gap junctions when cells are stimulated with a potent osteoinductive agent 1 5 Outline of Thesis Content The coming chapters describe the experiments performed to addressed the aims of this thesis The second chapter of this thesis contains a preliminary study that was performed to validate the micro CT thresholds for tissue engineered bone These thresholds were used to analyze all in vivo data in the subsequent chapters Chapter number 3 addresses the effects exogenous seeding strategies and mineralized template on gap junction intercellular communication GJIC cell differentiation in 3D constructs and bone regeneration in vivo Chapter 4 examines enhancing endogenous cell cell communication in bone marrow stromal cells by transducing these cells with the most prevalent gap junction forming protein in bone Connexin 43 Cx43 Transfection efficiencies Cx43 expression and GJIC were quantified to measure the expression level and function of the gap junctions GJIC is measured and compared in both 2D and 3D cultures as well as cell differentiation Furthermore the distribution of GJIC and differentiation markers is quantified to quantify any differences in these parameters between cells on the surface of 3D scaffolds and those seeded at the core To assess the effect of enhanced GJIC on tissue engineering in vivo cells are transplanted subcutaneously in nude mice and examined for amount and spatial distribution of the regenerated t
193. should be clean sterile and under the sterile hood 2 Bring the cell plate from the incubator to the sterile hood 3 Remove lid of chamber by unscrewing all six thumb screws and lifting it off 4 Using sterile forceps or gloved hands slide one of the short ends of the cell plate into the indentation at the bottom of the chamber Q Every time you leave the sterile hood you should re sterilize your gloved hands with ethanol before re entering the sterile hood 5 Press the plate firmly into the indentation The plate should now be immovable and the top of the plate should be flush with the bottom of the chamber Touch the plate only around the edges and as little as possible Figure 4 INSERTION OF CELL PLATE Cell Plate Fea ee tee se 2 iaaii ui Teflon Chamber Thumb Screws Notch for t Cutout for insertion of cell plate removal Acrylite AR Lid plate F HOW TO CUT AND INSERT SPONGE 1 Determine the size of the sponge that is needed for testing 2 Open the sterile sponge packaging under the sterile hood 3 Using sterile scissors or a scalpel cut the sponge to the desired dimensions Note The inner dimensions of the chamber are 4 cm wide by 8 cm long by 4 em high 4 Under the sterile hood place the cut sponge directly over the cell plate before adding media to the chamber The larger the sponge is the less likely it is to move when the pump is turned on 148 G HOW TO SET UP PUMP
194. sion increased 4 5 times compared to day 2 in cells overexpressing Cx43 At day 16 cells overexpressing both Cx43 and BMP7 produced significantly more OCN mRNA p lt 0 001 relative to all other cell groups including cells overexpressing Cx43 only This data suggests a synergistic relationship between Cx43 and the stimulus provided by BMP7 Cells overexpressing 105 the mutant Cx43A7 produced significantly less OCN expression than all other cells in fact Cx43A7 overexpressing cells failed to produce significant levels of OCN mRNA at any time Control vectors LVMT LVGFP ADCMVMT ADCMVMT LVMT data not showed showed no significant difference in mRNA production compared to BMSC expression suggesting that the transduction through lentivirus and or adenovirus did not alter the expression or viability of the cells Important differences were observed between 2D and 3D cultures in osteocalcin expression Fig 3b First osteogenic differentiation as indicated by OCN expression was significantly greater in 2D cultures compared to 3D cultures in BMSCs p lt 0 021 BMSCs overexpressing BMP7 p lt 0 001 and all control empty vectors data not shown Levels of OCN mRNA in cells overexpressing Cx43A7 were not significant in both 2D and 3D culture However when cells overexpressed Cx43 there were no significant differences in OCN expression between the two and three dimensional cultures supporting the premise that 2D and 3D cultures are intrinsi
195. sis of expression intercellular coupling and cell proliferation Proc Natl Acad Sci U S A 1991 88 5 1883 1887 Saez JC Berthoud VM Branes MC Martinez AD Beyer EC Plasma membrane channels formed by connexins Their regulation and functions Physiol Rev 2003 83 4 1359 1400 Willecke K Eiberger J Degen J et al Structural and functional diversity of connexin genes in the mouse and human genome Biol Chem 2002 383 5 725 737 Li Z Zhou Z Saunders MM Donahue HJ Modulation of connexin43 alters expression of osteoblastic differentiation markers Am J Physiol Cell Physiol 2006 290 4 C1248 55 Stains JP Lecanda F Screen J Towler DA Civitelli R Gap junctional communication modulates gene transcription by altering the recruitment of Spl and Sp3 to connexin response elements in osteoblast promoters J Biol Chem 2003 278 27 24377 24387 120 15 16 17 18 19 20 21 Furlan F Lecanda F Screen J Civitelli R Proliferation differentiation and apoptosis in connexin43 null osteoblasts Cell Commun Adhes 2001 8 4 6 367 371 Schiller PC Roos BA Howard GA Parathyroid hormone up regulation of connexin 43 gene expression in osteoblasts depends on cell phenotype J Bone Miner Res 1997 12 12 2005 2013 Zhang W Green C Stott NS Bone morphogenetic protein 2 modulation of chondrogenic differentiation in vitro involves gap junction mediated intercellular communication J Cell Phys
196. stributed amounts of engineered tissue Based on our data we propose that enhanced GJIC via genetically engineering cells to overexpress Cx43 as a novel platform to produce spatially distributed communication in 3D and achieve larger volumes of evenly distributed tissue equivalents These results have a major impact in the strategic design of cell based tissue engineering and may be significant to directed therapies that aim to enhance cell communication in 3D tissue 95 4 2 Materials and Methods 4 2 1 Viral Vector Production Vectors encoding Cx43 and BMP 7 were produced by the University of Michigan Vector Core employing standard transient transfection methods to produce replication incompetent viral vectors The development and production of the lentiviral vector encoding Cx43GFP has been previously described The vector system was based on the human immunodeficiency virus Type 1 HIV 1 and the four plasmids required for vector production were kindly supplied by Professor Inder Verma from the Salk Institute San Diego USA The development and production of the adenovector encoding BMP7 under the transcriptional control the human CMV promoter has been previously described Empty vectors devoid of a transgene and vectors encoding GFP were also produced for lentivirus LVMT LVGFP and adenovirus ADCMVMT and employed as controls A seven base pair deletion mutant LV Cx43A7 that produces connexin structures but is disabled f
197. tarting point for analysis of regenerated tissue and efficacy of tissue engineering strategies These techniques are useful but they cannot be easily used to measure the amount of new bone tissue nor the mineral content of that bone tissue in three dimensions The gold standard for accurately measuring the amount of new bone tissue is histomorphometry where two dimensional sections of a region with the scaffold are stained and the amount of new bone tissue is quantified The gold standard for measuring 21 the bone mineral content is ash weighing In this procedure bone is heated to temperatures upwards of 800 C eliminating organic phases and the remaining non organic weight is measured and normalized to starting weight or tissue volume Although these techniques provide an accurate determination of the amount of mineral and the mineral content their usefulness in analyzing tissue engineering strategies is limited because specimens are destroyed in the process eliminating the possibility of further molecular and biochemical analyses Micro computed tomography uCT has become an important tool to overcome these limitations This imaging modality has a wide range of biological applications including vascular and pulmonary trees adipose tissue embryonic development cartilage and hepatic tissue and it is particularly well suited for bone For bone uCT provides 18 19 20 23 gt and regenerated bone These detailed spatia
198. the cells that in compartments A B C and D a Take an average of these counts b The number you get in a multiply it by 104 cells c Finally multiply that number by your fixed volume and you will have the total number of cells in that suspension 164 Number of Cells Tea 10 cells ml fixed volume Figure 1 Hemacytometer Pipette 10uL of Figure 2 Counting Chambers Count the number of cells in each of the chambers under the microscope and take the average of them 165 166 A4 Cell Proliferation by Flow Cytometry BrdU and PI Ricardo Rossello and UM FLOW CYTOMETRY CORE This method modified from Hoy CA et al is applied to adherent cell cultures It may also work with suspension cultures with modifications germane to their culture conditions Notes 6 e An ideal sample is 1 2 x10 cells Keep all samples to about the same number of cells to avoid artifacts associated with cell concentration changes e Flow cytometry setup controls needed 1 Cells stained with PI alone 2 Cells with no BrdU pulse and only the antibodies added e Amount of BrdU added may vary according to cell type and proliferative potential e BrdU is light sensitive and should be added in the dark e Cells pulsed with BrdU may be photosensitive incubations should be in the dark as well Reagents Product code BrdU 5 bromo deoxyuridine Sigma B 5002 RNAse A from bovine pancreas Boehringer Mannheim 109 1
199. the chamber may deteriorate over time If this occurs holes can be drilled through the lid and the top of the chamber walls at new locations around the top of the chamber to extend the life of the product 4 ADDITIONAL CELL PLATES The Chemistry Instrument Shop has the pattern for the cell plates so more cell plates can be cut quickly as needed The cell plates were originally cut out of a Corning CellBIND Polystyrene CellSTACK chamber 155 Problem o flow Pump not working o flow Pump not working N N L B B L Cell plate stuck in chamber Components become disconnected when moving from hood to incubator Components become disconnected when moving from incubator to hood TROUBLESHOOTING Cause No power to pump No power to pump Tubing not connected properly Tubing clogged Components not connected properly Lid is loose Component failure Did not prime system correctly Leak in system Too tight or sticky f Correction Plug in pump power cord Check to make sure that the outlet has electricity Turn off pump and connect tubing correctly Turn off pump clean and sterilize tubing re connect Turn off pump and connect all components securely Use plastic pull ties to secure tubing if necessary Press o ring completely into groove slide lid onto top of chamber walls tighten all screws Check all components for deterioration Replace or fix cracked parts or t
200. thresholding can be a problem because the thresholds may have been determined for mature bone of larger volume and therefore may underestimate the amount of newly formed bone This problem can be exacerbated if the heterogeneity within a specimen is large and if used between specimens These techniques are useful for bone tissue engineering Hedberg et al but the details of their application are seldom discussed The underlying concept in this study is that the gelatin scaffold used to deliver transplanted cells will not directly affect bone measurements in a wCT image This vehicle causes little to no interference because it has a radiodensity different than mineralized tissue and furthermore it degrades completely within 4 weeks eliminating the possibility of artifact from residual scaffold The lack of peaks in the histogram between the bone and water regions Fig 1 prove that degradation of the gelatin was 36 complete Therefore a direct analysis could be made to compare the BVF calculated from the uCT data to the actual values determined from ashing the ossicles Ash content was normalized to the original tissue weight to account for any discrepancies in size between the samples The optimal threshold range for determining volume fraction of regenerated bone was in the 1000 1300 grayscale value range Confidence in this range of thresholds comes from 3 sources 1 the range of 1000 1300 has a R gt 0 87 and p lt 0 05 Fig 2
201. tinue easing tubing into the groove until the tubing is secured around the rotary device See Figure 2 Exercise caution when pushing in the tubing because your fingers can easily be caught between the rollers and the plastic base This can lead to injury Use the slowest setting to minimize the possibility of harm Figure 5 BASIC PUMP ASSEMBLEY lllustration of the pump assembly Pump Housing 2 Tube 3 Washer 4 Roller Bracket Assembly 5 Pump Cover w bearing 6 Thumb Screws 149 After the thick segment of the tubing is in place turn pump off and check to make sure there is enough PharMed tubing extending from the pump to connect the inlet of the chamber and the silicone tubing 8 If there is not enough exposed tubing on one side repeat steps 5 8 until sufficient tubing is exposed on both sides 9 Place the plastic cap mentioned in step 3 over the pump tubing interface Secure the plastic cap tightly onto the metallic pump using the four screws provided The pump is now ready for use The screws serve not only to hold the plastic cap over the tubing but also to secure the entire plastic pump tubing interface tightly against the immovable metallic outer covering of the pump H HOW TO SET PUMP FOR DESIRED FLOW RATE Below is a table with the pump dial settings from 0 to 50 and their corresponding flow rates for 1 16 PharMed tubing The maximum flow rate that can be achieved occurs when the dial is turned
202. tion hemichannels Biorheology 2003 40 1 3 119 121 Romanello M D Andrea P Dual mechanism of intercellular communication in HOBIT osteoblastic cells A role for gap junctional hemichannels J Bone Miner Res 2001 16 8 1465 1476 Zaman MH Matsudaira P Lauffenburger DA Understanding effects of matrix protease and matrix organization on directional persistence and translational speed in three dimensional cell migration Ann Biomed Eng 2006 Zaman MH Trapani LM Sieminski AL et al Migration of tumor cells in 3D matrices 1s governed by matrix stiffness along with cell matrix adhesion and proteolysis Proc Natl Acad Sci U S A 2006 103 29 10889 10894 Schwiebert EM Extracellular ATP mediated propagation of ca 2 waves focus on mechanical strain induced ca 2 waves are propagated via ATP release and purinergic receptor activation Am J Physiol Cell Physiol 2000 279 2 C281 3 11 17 18 19 20 21 22 23 Lecanda F Warlow PM Sheikh S Furlan F Steinberg TH Civitelli R Connexin43 deficiency causes delayed ossification craniofacial abnormalities and osteoblast dysfunction J Cell Biol 2000 151 4 93 1 944 Stains JP Civitelli R Cell to cell interactions in bone Biochem Biophys Res Commun 2005 328 3 721 727 Leonova EV Pennington KE Krebsbach PH Kohn DH Substrate mineralization stimulates focal adhesion contact redistribution and cell motility of bone marrow stromal ce
203. tion for each primer The crossing value of this threshold was determined C for each sample Using the manufacturer s protocols ABI Prism 7700 Sequence Detection System User Bulletin 2 mRNA expression levels for each sample primer were normalized to endogenous rRNA 18S levels and the results were reported as a fold change relative to the OCN expression of 100 BMSCs day 2 All reactions were performed in quintuplets Two l way ANOVAs were used to determine significant differences as a function of dimension 3D vs 2D and cell types Differences between surface peripheral segments and core bottom segments were assessed with a two tailed student t test using SigmaSTAT version 3 1 4 2 7 In vivo transplantation Surgery was performed in nude mice nu nu by transplanting gelatin scaffolds 3x32 mm seeded with 2x10 cells The mice were anaesthetized by an intraperitoneal injection of 1 mg 10 g ketamine and 0 1mg 10 g xylazine A 3 cm longitudinal incision was made overlying the spine Four subcutaneous pockets were made using blunt dissection through the minimal subcutaneous tissue of the mice In each pocket one of the prepared cell gelfoam specimens BMSC BMSC Cx43 BMSC BMP7 BMSC Cx43 BMP7 BMSC LVMT BMSC ADCMVMT or acellular gelfoam specimen was implanted The cell gelfoam specimens were assigned randomly to each pocket The incision site was closed with wound clips or sutures The mice were allowed to recover on a r
204. tions bone HU threshold bone HU was calculated for all of the thresholds in order to make the results applicable to any wCT device The bone HU Hounsfiled units was obtained from the calibration scans of actual bone Auto thresholds generated using a previously described method that operates on the histogram of all grayscale values oe 24 within the image were also recorded for comparison 2 2 7 Mineral ashing After wCT scanning 5 ossicles from each group were weighed placed in a muffle furnace at 100 C for 36 hrs to remove the soft tissue in the ossicles and reweighed This fraction was heated to 800 C for 48 hrs to obtain the final inorganic weight The final inorganic weight was normalized to the ossicle weight without soft tissue to determine ash fraction 2 2 8 Histology To assist in matching histological sections to wCT slices a landmark was created in each ossicle by making a small cut with a scalpel before it was scanned in the uCT 25 system The longitudinal and transverse distances to the landmark from a reference point on the surface were recorded to define the approximate location and orientation of 28 the slices of interest thus making it easier to locate when viewing the uCT and histological sections After uCT scanning the remaining ossicles from each group were rinsed in dIH2O dehydrated in graded ethanol and processed for histology Some of the specimens were decalcified in 10 formic ac
205. to make micro masses of 0 2 million cells aliquot 1 5 of the cell suspension to 5 tubes and centrifuge them After centrifuge extract the supernatant as much as you can and leave the pellet In order to do this carefully retrieve the final micro liters of supernatant with a micropipette Place 1 5ml tubes containing the pellet into the CO2 Incubator for 30mins 1hr Micropipette these micro masses into the scaffolds which are on a 24 well plate or Petri Dish by placing the dense glob on the geometrically desired position Slightly hydrate with some media Place the seeded scaffolds into the incubator for another hour Retrieve the plate and hydrate the scaffolds more than before Place Scaffolds in incubator until ready for use 184 A10 Protocol for Flow Cytometry Activated Cell Separation FACS Ricardo Rossello and UM FLOW CYTOMETRY CORE Device BD Biosciences FACSCalibur Materials Sterile 10 cm tissue culture dishes 6 12 24 well plates cell strainers Falcon 2235 Falcon Tubes Cell culture medium Trypsin EDTA PBS Calcenin AM stock Solution Sigma Vybrant Dil stock solution Molecular probes Gap Junction Competent Cell Line e g BMSCs 1 All solutions need to be stored in 4 C Pre loading solution 1 Add luL of Calcenin stock solution to 1mL medium mix 2 Add luL of Dil stock solution and mix again 3 Vary mixes accordingly to specifications 4 Make 1 5 2mL of solution for each 6cm plate o
206. to the 100 setting and 1s 8 1 mL min Table 1 PUMP CALIBRATION Pump Dial Flow Rate Setting ml min 0 78 If your experiment calls for a flow rate within the range of the 1 16 diameter tubing that is not among the flow rates listed in the table above read off the required setting from the figure below Figure 6 PUMP CALIBRATION CURVE 9 6 How Rate mimm a 0 o 20 40 60 80 100 Pump Daal Setting 150 I HOW TO PRIME THE PERFUSION SYSTEM WITH MEDIA O Connect the tubing to the chamber before putting media into the system 1 Pipette media into the corners of the chamber avoid dumping it directly onto the cells Fill the chamber with media in such a way as to minimize bubble formation in the chamber Continue filling chamber until media is 5 mm below the top of the chamber With the lid still off turn the pump on and watch the inlet of the chamber Once bubbles have stopped coming out of the inlet turn the pump off Check that there are no bubbles in the system If there are remove them immediately Troubleshooting p 19 4 Pipette more media into the chamber until the media is 5 mm below the top of the chamber w p J HOW TO INSERT O RING INTO LID AND SECURE LID TO CHAMBER 1 Line up o ring along groove in chamber lid see below Press o ring into lid If o ring pops out of groove hold the o ring into groove while sliding the lid onto the top of the chamber 4 Screw the lid onto the chamber tightening
207. ubing that has cuts or holes in it Use thin tool to remove bubbles and or re prime system See above corrections for leaks Try again with a different tool or wait for chamber to cool down and try again Disconnect system components and sterilize then reconnect system Place under hood immediately Clean any spills Continue experiment as normal unless notable contamination has occurred If the sterility of the system is ever seriously jeopardized as a result of a leak or component disconnection the experiment must be started over with new cells fresh media and clean sterile components 156 9 CAUTIONARY NOTES Do not drop the chamber or pump Be gentle with the chamber to avoid damaging the connections with the metal tubing connectors Never hold the chamber by the metal tubing connectors Avoid unscrewing the metal tubing connectors because you could damage the threading Note These end pieces may be unscrewed occasionally if tubing of a different diameter is desired Teflon tape can be used to seal them See Additional Features If there is any physical damage to the chamber take it to the machine shop for repair Do not autoclave the chamber for too long or at higher pressures because you could damage the interface between the Teflon and the metal Always dry all components thoroughly before storage to prevent corrosion and bacterial growth Do not over tighten screws for top of chamber
208. um minimum essential medium a MEM Gibco Laboratories Grand Island NY 10 fetal bovine serum 24 FBS Gibco 100 ug ml penicillin G 100 U ml streptomycin Cells were pelleted by centrifugation at 1000 rpm for 5 min at 4 C and resuspended in 10 ml a MEM Cell number was determined with a hemocytometer and cells were plated in 75 cm flasks at a density of 50 000 nucleated cells cm and cultured in complete medium at 37 C in 5 CO2 95 air The medium was replaced twice per week and at near confluence 90 the adherent cells were washed with phosphate buffered saline and released by means of a 0 25 trypsin EDTA solution Sigma St Louis MO Cells were replated in 75 cm flasks at a density of 50 000 cells cm and passaged 1 2 more times 2 2 2 Generation of recombinant adenovirus and cell transduction AdCMVBMP7 was constructed by Cre ox recombination as previously described Briefly a full length mouse BMP 7 cDNA was cloned into pAdlox to produce pAdlox BMP 7 pAdlox and w5 virus were co transduced into CRE8 cells A plaque assay was used to purify the virus from the cell lysate and serial dilutions were used to infect 293 cells Positive plaques were purified by CsCl gradient ultracentrifugation The purified virus was stored in glycerol phosphate buffered saline and titered by the method described above Mouse C4 cells a widely used cell strain from C57L J mice from American Type Culture Collection ATCC were cult
209. ured in complete medium at 37 C in 5 CO 95 air Transduction was performed ex vivo for 24 hrs C4 cell infection with AACMVBMP 7 was at a multiplicity of infection MOI of 200 Plaque forming units PFU cell Cells 80 90 confluent in 75 cm flasks were exposed to the appropriate dilution of virus in 8 ml of medium for 24 hrs at 37 C in a humidified atmosphere of 5 CQO before trypsinization counting and resuspension in complete medium 29 2 2 3 Gelatin sponge preparation Gelatin sponges Gelfoam Pharmacia amp Upjohn Kalamazoo MI were cut to have 3x3x2 mm dry dimensions The sponges were pre wet in complete medium and air bubbles were removed by applying gentle pressure on the sponge between two pieces of sterile filter paper Two million BMSCs or transduced C4 cells were collected suspended in 50 ul complete medium and loaded onto each sponge by capillary action 2 2 4 Preparation of bioceramic Mineralized PLGA scaffold Porous 3D organic templates 85 15 poly lactide co glycolide diameter 4mm x height Imm 90 porosity pore size 250 425um were prepared by solvent casting particulate leaching process Scaffolds were each be incubated in a 50 mL solution of simulated body fluid SBF for 7 days for mineral film formation The SBF solution will was changed every 24 h to ensure sufficient 10n concentrations for mineral growth The SBF was prepared by dissolving the following reagents in deionized water 141 m
210. versity of Michigan Chemistry Instrument Shop Room A509 Chemistry Building 930 North University Avenue Ann Arbor MI 48109 1055 Phone 734 764 7363 Fax 734 615 4314 Email kff umich edu 160 A2 ALP activity assay 24 well plate Ricardo Rossello and David H Kohn Solutions a Hank s balanced solution or EBSS solution b Harvest buffer 10 mM Tris HCl pH 7 4 0 2 Igepal CA 630 Add PMSF to the final concentration 2 mM freshly make 200mM PMSF 0 3484 10ml EtOH aliquot to 1ml each and add 1 100 of the total volume Assay buffer 100 mM glycine 3 785g 500ml 1 mM MgCl 47 61mg 500ml pH 10 5 d PNPP 50 mM of p nitrophenylphosphate e Stop solution 0 1N NaOH Procedure 1 Wash cells twice with Iml of Hank s solution Harvest cells in 400ul 2 times x 200ul of the harvest buffer into 1 5ml eppendorf tube on ice 3 optional step Keep the tube at 80 C or 20 C for storage 4 Homogenize at low power 7 8 level 3 times x 10sec sonicator in Dr Franchesk1 s lab Keep the tube on ice before and after the homogenization Keep the tube on a beaker ice ethanol during the homogenization so that the sample is not overheated by the sonicator tip 5 Centrifuge the homogenized sample at 12 500 rpm for 10 min Set the centrifuge at 4 C in advance 6 Mix the following components in a new eppendorf tube placed in 37 C water bath 250ul assay buffer 140ul harvest buffer 100ul
211. w Calculations The following formulas were used for deriving the flow dynamics within the chamber The effective diameter for an arbitrary shape is De 4A 20 2 A The velocity of the fluid is yo E WA The Reynolds Number is given by H Le Fp H The entrance length is Le 0 06 Le ok The pressure differential is give by p 12 al F D The shear stress at the wall is given by mp PD 4L 175 A6 Protocol Tibiae for Extracting Bone Marrow Stromal Cells from Rat Femur and Ricardo Rossello and David H Kohn I Equipment and Supplies Chemicals Media Consumables Equipment 70 Ethanol bottle for instruments amp spray bottle PBS 1X Hanks Balanced Salt Solution HBBS Gibco BRL 14170 120 Note All media preparation and other cell culture work must be performed in a laminar flow hood Use a Steril 500ml Nalgene filter to prepare the media For 500 ml 50ml Fetal calf serum Sml Penicillin Streptomycin Balance alfa MEM Gloves Glass Pasteur pipettes canister sterile Pipette tips Petri Dishes 3 0 ml Syringe 1 5 ml tubes Flasks Nalge Nunc Int 136196 polysterene sterilized filter cap flask angled neck 50 ml 25 cm 2 culture area Kim wipes Nalgene Filter Sharpie marker Laminar flow hood Tweezers forceps sterile keep in EtOH under hood Microscope Markers Vortexer Hemacytometer General Procedural Notes e Rinse gloves w EtOH every time one
212. whereas the synthetic material does not Manipulating the surface chemistry to be more biologically interactive biomaterials could potentially improve the clinical treatment of bone defects A mineralized layer on the surface of a porous synthetic 3D scaffold can provide a physiologically favorable environment that 60 17 Asides from substrate effects enhances cell adhesion and osteoconductivity calcium phosphate apatites may have a solution mediated effect when the mineral layer starts dissolving releasing ions that can serve as both extracellular and intracellular messengers For example the release of calcium ions Ca into the solution can enhance 17 21 osteogenic differentiation cell growth and cell to cell signaling Furthermore once up taken by cells Ca ions become an important intracellular messenger in all bone forming cells enabling remodeling and regeneration 7 Substrates biologically active or synthetic are typically seeded with cells via the commonly employed static seeding technique This technique relies on gravity as a gradient to percolate cells into a porous scaffold allowing cells to passively attach to the surface of the 3D construct Although simple in nature this approach has limitations due to initial cell adhesion as well as diminished transport of nutrients signals and messengers As such tissue regenerated from cells seeded statically typically exhibits only partial regeneration Th

Cell-to-Cell Communication as a Strategy to

Contents

Download Pdf Manuals

Related Search

Related Contents