Home

pSecTag/FRT/ V5-His-TOPO - Thermo Fisher Scientific

1. In addition the C terminal 6xHis tag is the epitope for the Anti His C term Antibody Catalog no R930 25 and the Anti His C term HRP Antibody Catalog no R931 25 Lindner et al 1997 BGH Reverse priming site Allows sequencing of the non coding strand Bovine growth hormone BGH polyadenylation signal Allows efficient transcription termination and poly adenylation of mRNA Goodwin and Rottman 1992 Flp Recombination Target FRT site Encodes a 34 bp 14 bp of non essential sequence that serves as the binding and cleavage site for Flp recombinase Gronostajski and Sadowski 1985 Jayaram 1985 Senecoff et al 1985 Hygromycin resistance gene no ATG Allows selection of stable transfectants in mammalian cells Gritz and Davies 1983 when brought in frame with a promoter and an ATG initiation codon through Flp recombinase mediated recombination via the FRT site SV40 early polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA pUC origin Allows high copy number replication and growth in E coli bla promoter Allows expression of the ampicillin bla resistance gene Ampicillin bla resistance gene B lactamase Allows selection of transformants in E coli pSecTag FRT V5 His PSA Map Description pSecTag FRT V5 His PSA is a 5902 bp control vector expressing prostate specific antigen PSA The PSA gene was amplifie
2. The table below describes the general steps needed to clone and express your gene of interest For more details refer to the pages indicated Step Action Page 1 Design PCR primers to clone your gene of interest in frame with the 5 6 N terminal Ig chain secretion signal and the C terminal peptide containing the V5 epitope and the polyhistidine 6xHis tag if desired Consult the diagram on page 6 to help you design your PCR primers 2 Produce your PCR product 7 3 TOPO Clone your PCR product into pSecTag FRT V5 His TOPO 8 10 and transform into One Shot TOP10 E coli Select transformants on LB plates containing 50 100 ug ml ampicillin 4 Analyze your transformants for the presence and orientation of insert 11 by restriction enzyme digestion 5 Select a transformant with the correct restriction pattern and sequence it 11 to confirm that your gene is cloned in frame with the Ig chain secretion signal and the C terminal peptide 6 Cotransfect your pSecTag FRT V5 His TOPO construct and pOG44 14 15 into the Flp In host cell line using your method of choice and select for hygromycin resistant clones see the Flp In System manual for more information 7 Assay for expression of your protein of interest 16 17 8 Purify your recombinant protein by chromatography on metal chelating 18 resin e g ProBond Methods PCR Primer Design Introduction General Molecular Biol
3. see the Appendix pages 27 28 IT CMV promoter CAAT AAAATCAACG GGACTTTCCA AAATGTCGTA ACAACTCCGC CCCATTGACG CAAATGGGCG CMV forward priming site TATA 3 end of CMV promoter putative transcriptional start ote all GTAGGCGTGT ACGGTGGGAG GTCTATATAA GCAGAGCTCT CTGGCTAACT AGAGAACCCA T7 promoter priming site Nhe l CTGCTTACTG GCTTATCGAA ATTAATACGA CTCACTATAG GGAGACCCAA GCTGGCTAGC lg K chain secretion signal SA CACC ATG GAG ACA GAC ACA CTC CTG CTA TGG GTA CTG CTG CTC TGG GTT Met Glu Thr Asp Thr Leu Leu Leu Trp Val Leu Leu Leu Trp Val ee ee CCA GGT TCC ACT GGT GAC GCG GCC CAG CCG GCC AGG CGC GCG CGC CGT Pro Gly Ser Thr Gly Asp Ala Ala Gln Pro Ala Arg Arg Ala Arg Arg A Signal Cleavage Site Asp7181 kon Bam H l l ACG AAG CTC GCC CT 7 GP GGC GAG CTT GGT ACC GAG CTC GGA G CGG GAM NN T TC CCG CTC Thr Lys Leu Ala Leu Lys Gly Glu Leu Gly Thr Glu Leu Gly V5 epitope Bo a oc L Ss sll ci ul LLY is a l TCC GAA GGT AAG CCT ATC CCT AAC CCT CTC CTC GGT CTC GAT TCT ACG Ser Glu Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Age Polyhistidine 6xHis region Pme CGT ACC GGT CAT CAT CAC CAT CAC CAT TGA GTT TAAACCCGCT GATCAGCCTC Arg Thr Gly His His His His His His BGH reverse priming site a GACTGTGCCT TCTAGTTGCC AGCCATCTGT TGTTTGCCCC TCCCCCGTGC Producing PCR Products Introduction Once you have decided on a PCR strategy and have synthesized the primers you are ready to pro
4. allows you to rapidly purify PCR products from regular agarose gels 1 Electrophorese amplification reaction on a 1 to 5 regular TAE agarose gel Note Do not use TBE Borate will interfere with the Nal step Step 2 2 Cut out the gel slice containing the PCR product and melt it at 65 C in 2 volumes of 6 M Nal Add 1 5 volumes of Binding Buffer 4 Load solution no more than 1 ml at a time from Step 3 onto a S N A P column Centrifuge 1 minute at 3000 x g in a microcentrifuge and discard the supernatant 5 If you have solution remaining from Step 3 repeat Step 4 6 Add 900 ul of the Final Wash Buffer 7 Centrifuge 1 minute at full speed in a microcentrifuge and discard the flow through 8 Repeat Step 7 9 Elute the purified PCR product in 40 ul of TE or sterile water Use 4 ul for the TOPO Cloning reaction and proceed as described on page 9 An even easier method is to simply cut out the gel slice containing your PCR product place it on top of the S N A P column bed and centrifuge at full speed for 10 seconds Use 1 2 ul of the flow through in the TOPO Cloning reaction page 9 Be sure to make the gel slice as small as possible for best results continued on next page 21 Purifying PCR Products continued Low Melt Agarose Method 22 If you prefer to use low melt agarose use the procedure below Note that the gel purification will result in a dilution of your PCR product and a potential
5. A General Approach to the Introduction of Macromolecules into Cells BioTechniques 6 742 751 Shuman S 1994 Novel Approach to Molecular Cloning and Polynucleotide Synthesis Using Vaccinia DNA Topoisomerase J Biol Chem 269 32678 32684 Shuman S 1991 Recombination Mediated by Vaccinia Virus DNA Topoisomerase I in Escherichia coli is Sequence Specific Proc Natl Acad Sci USA 88 10104 10108 Southern J A Young D F Heaney F Baumgartner W and Randall R E 1991 Identification of an Epitope on the P and V Proteins of Simian Virus 5 That Distinguishes Between Two Isolates with Different Biological Characteristics J Gen Virol 72 1551 1557 Wigler M Silverstein S Lee L S Pellicer A Cheng Y C and Axel R 1977 Transfer of Purified Herpes Virus Thymidine Kinase Gene to Cultured Mouse Cells Cell 717 223 232 2000 2004 2010 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 36 invitrogen by Lefe technologies Corporate Headquarters 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
6. Cloning reaction into a 0 1 cm cuvette containing 50 ul of electrocompetent E coli and mix gently Do not mix by pipetting up and down Avoid formation of bubbles Electroporate your samples using your own protocol and your electroporator Note If you have problems with arcing see next page Immediately add 250 ul of room temperature SOC medium Transfer the solution to a 15 ml snap cap tube e g Falcon and shake for at least 1 hour at 37 C to allow expression of the antibiotic resistance gene Spread 10 50 pl from each transformation on a prewarmed selective plate and incubate overnight at 37 C To ensure even spreading of small volumes add 20 ul of SOC We recommend that you plate two different volumes to ensure that at least one plate will have well spaced colonies An efficient TOPO Cloning reaction will produce hundreds of colonies Pick 10 colonies for analysis see Analysis of Positive Clones next page continued on next page TOPO Cloning Reaction and Transformation continued Note Analysis of Positive Clones Alternative Method of Analysis Addition of the Dilute Salt Solution in the TOPO Cloning Reaction brings the final concentration of NaCl and MgCl in the TOPO Cloning reaction to 50 mM and 2 5 mM respectively To prevent arcing of your samples during electroporation the volume of cells should be between 50 and 80 ul 0 1 cm cuvettes or 100 to 200 ul 0 2 cm cuvettes If you experience arcing d
7. DNA after ligating the PCR product and dissociating from the DNA The result is more intact molecules leading to higher transformation efficiencies If you do not include salt in the TOPO Cloning reaction the number of transformants obtained generally decreases as the incubation time increases beyond 5 minutes Because of the above results we recommend adding salt to the TOPO Cloning reaction A stock salt solution is provided in the kit for this purpose Note that the amount of salt added to the TOPO Cloning reaction varies depending on whether you plan to transform chemically competent cells provided or electrocompetent cells see below For this reason two different TOPO Cloning reactions are provided to help you obtain the best possible results Read the following information carefully For TOPO Cloning and transformation into chemically competent E coli adding sodium chloride and magnesium chloride to a final concentration of 200 mM NaCl 10 mM MgCl in the TOPO Cloning reaction increases the number of colonies over time A Salt Solution 1 2 M NaCl 0 06 M MgCl is provided to adjust the TOPO Cloning reaction to the recommended concentration of NaCl and MgCl For TOPO Cloning and transformation of electrocompetent E coli salt must also be included in the TOPO Cloning reaction but the amount of salt must be reduced to 50 mM NaCl 2 5 mM MgCl to prevent arcing when electroporating The Salt Solution provided
8. Flp In Expression Vectors vi The products listed in this section are intended for use with the pSecTag FRT V5 His TOPO TA Expression Kit For more information refer to our World Wide Web site www invitrogen com or call Technical Service see page 30 Some of the products included in the pSecTag FRT V5 His TOPO TA Expression Kit as well as other reagents that may be used with the Flp In System are available separately from Invitrogen Ordering information is provided below Product Amount Catalog no T7 Promoter Primer 2 ug lyophilized in TE N560 02 Hygromycin lg R220 05 Zeocin lg R250 01 5g R250 05 pFRT lacZeo 20 ug lyophilized in TE V6015 20 pFRT lacZeo2 20 ug lyophilized in TE V6022 20 pOG44 20 ug lyophilized in TE V6005 20 One Shot Kit 10 reactions C4040 10 TOP10 Chemically Competent Cells 20 reactions C4040 03 40 reactions C4040 06 One Shot Kit 10 reactions C4040 50 TOP10 Electrocompetent Cells 20 reactions C4040 52 Additional Flp In expression vectors are available from Invitrogen For more information about the features of each vector refer to our World Wide Web site www invitrogen com or call Technical Service see page 30 Ordering information is provided below Gateway Vector Pack Product Amount Catalog no pcDNAS FRT 20 ug lyophilized in TE V6010 20 pcDNAS FRT V5 His TOPO TA 1 kit K6020 01 Express
9. For detailed information about pOG44 and generation of the Flp In host cell line refer to the Flp In System manual A separate manual for the pOG44 plasmid is also available from our Web site www invitrogen com or by calling Technical Service see page 30 Several Flp In host cell lines which stably express the lacZ Zeocin fusion gene and contain a single integrated FRT site are available from Invitrogen see page vii for ordering information If you wish to express your gene of interest in 293 CV 1 CHO 3T3 BHK or Jurkat cells you may want to use one of the Flp In host cell lines to establish your expression cell line For more information refer to our World Wide Web site www invitrogen com or call Technical Service see page 30 We have observed down regulation of the viral CMV promoter and subsequent loss of gene expression when pcDNAS FRT based expression constructs are introduced into 3T3 or BHK cells This behavior is not observed with pEF5 FRT based expression constructs If you are generationg Flp In expression cell lines using a 3T3 or BHK host cell line we recommend that you clone your gene of interest into a pEF5 FRT based expression plasmid e g pEFS FRT V5 D TOPO or pEFS FRT V5 DEST For more information refer to our Web site www invitrogen com or call Technical Service see page 30 Plasmid DNA for transfection into eukaryotic cells must be clean and free from phenol and sodium chloride Cont
10. In System manual Before generating a stable cell line expressing your protein of interest Flp In expression cell line we recommend that you generate a kill curve to determine the minimum concentration of hygromycin required to kill your untransfected Flp In host cell line Generally concentrations between 10 and 400 ug ml hygromycin are required for selection of most mammalian cell lines General guidelines for performing a kill curve are provided in the Flp In System manual REMINDER Remember that the hygromycin resistance gene in pSecTag FRT V5 His TOPO lacks a promoter and an ATG initiation codon therefore transfection of the pSecTag FRT V5 His TOPO plasmid alone into mammalian host cells will not confer hygromycin resistance to the cells The SV40 promoter and ATG initiation codon required for expression of the hygromycin resistance gene are integrated into the genome in the Flp In host cell line and can only be brought into the correct proximity and frame with the hygromycin resistance gene through Flp recombinase mediated integration of pSecTag FRT V5 His TOPO at the FRT site continued on next page 15 Transfection and Analysis continued Generation of Flp In Expression Cell Lines Note Detection of Recombinant Fusion Proteins Detection of Secreted Protein from Medium Note 16 Refer to the Flp In System manual for detailed guidelines and instructions to cotransfect your pSecT
11. agar and poured onto LB plates After overnight incubation no plaques should be detected e Untransformed cells are plated on LB plates 100 ug ml ampicillin 25 pg ml streptomycin 50 ug ml kanamycin or 15 ug ml chloramphenicol to verify the absence of antibiotic resistant contamination References Andersson S Davis D L Dahlback H J rnvall H and Russell D W 1989 Cloning Structure and Expression of the Mitochondrial Cytochrome P 450 Sterol 26 Hydroxylase a Bile Acid Biosynthetic Enzyme J Biol Chem 264 8222 8229 Andrews B J Proteau G A Beatty L G and Sadowski P D 1985 The FLP Recombinase of the 2 Micron Circle DNA of Yeast Interaction with its Target Sequences Cell 40 795 803 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Boshart M Weber F Jahn G Dorsch Hisler K Fleckenstein B and Schaffner W 1985 A Very Strong Enhancer is Located Upstream of an Immediate Early Gene of Human Cytomegalovirus Cell 47 521 530 Brownstein M J Carpten J D and Smith J R 1996 Modulation of Non Templated Nucleotide Addition by Taq DNA Polymerase Primer Modifications that Facilitate Genotyping BioTechniques 20 1004 1010 Chen C and Okayama H 1987 High Efficiency Transformation of Mammalian Cells by P
12. in the kit must be diluted 4 fold to prepare a 300 mM NaCl 15 mM MgCl solution for convenient addition to the TOPO Cloning reaction see next page continued on next page TOPO Cloning Reaction and Transformation continued Materials Supplied by the User Note Preparation for Transformation Setting Up the TOPO Cloning Reaction In addition to general microbiological supplies e g plates spreaders you will need the following reagents and equipment e 42 C water bath or electroporator with cuvettes optional e LB plates containing 50 100 ug ml ampicillin two for each transformation e Reagents and equipment for agarose gel electrophoresis e 37 C shaking and non shaking incubator There is no blue white screening for the presence of inserts Individual recombinant plasmids need to be analyzed by restriction analysis or sequencing for the presence and orientation of insert Sequencing primers included in each kit can be used to sequence across an insert in the multiple cloning site to confirm orientation and reading frame For each transformation you will need one vial of competent cells and two selective plates e Equilibrate a water bath to 42 C for chemical transformation or set up your electroporator if you are using electrocompetent E coli e For electroporation dilute a small portion of the Salt Solution 4 fold to prepare Dilute Salt Solution e g add 5 ul of the Salt Solution to 15 ul ste
13. loss of cloning efficiency 1 Electrophorese as much as possible of your PCR reaction on a low melt agarose gel 0 8 to 1 2 in TAE buffer 2 Visualize the band of interest and excise the band Place the gel slice in a microcentrifuge tube and incubate the tube at 65 C until the gel slice melts 4 Place the tube at 37 C to keep the agarose melted 5 Add 4 ul of the melted agarose containing your PCR product to the TOPO Cloning reaction as described on page 9 6 Incubate the TOPO Cloning reaction at 37 C for 5 to 10 minutes This is to keep the agarose melted 7 Transform 2 to 4 ul directly into chemically competent One Shot TOP10 cells using the method on page 10 Addition of 3 A Overhangs Post Amplification Introduction Direct cloning of DNA amplified by Vent or Pfu polymerases into TOPO Cloning vectors is often difficult because of very low cloning efficiencies These low efficiencies are caused by the 3 to 5 exonuclease activity which removes the 3 A overhangs necessary for TOPO Cloning Invitrogen has developed a simple method to clone these blunt ended fragments Before Starting You will need the following items e Taq polymerase e heat block equilibrated to 72 C e Phenol chloroform optional e 3M sodium acetate optional e 100 ethanol optional e 80 ethanol optional e TE buffer optional Procedure This is just one method for adding 3 adenines Other protocols may be s
14. mammalian cell transfection and expression see page 29 for a map and may be used to assay for recombinant protein expression levels in your Flp In host cell line Cotransfection of the positive control vector and pOG44 into your Flp In host cell line allows you to generate a stable cell line expressing prostate specific antigen PSA at the same genomic locus as your gene of interest If you have several different Flp In host cell lines you may use the pSecTag FRT V5 His PS A control vector to compare protein expression levels between the various cell lines To propagate and maintain the plasmid 1 Resuspend the vector in 20 ul sterile water to prepare a 1 ug ul stock solution Use the stock solution to transform a recA endA E coli strain like TOP10 DH So JM109 or equivalent 2 Select transformants on LB agar plates containing 50 100 ug ml ampicillin 3 Prepare a glycerol stock of a transformant containing plasmid for long term storage The pSecTag FRT V5 His TOPO vector contains the hygromycin resistance gene Gritz and Davies 1983 for selection of transfectants with the antibiotic hygromycin B Palmer et al 1987 When added to cultured mammalian cells hygromycin B acts as an aminocyclitol to inhibit protein synthesis Hygromycin B liquid is supplied with the Flp In Complete System and is also available separately from Invitrogen Catalog no R220 05 For instructions to handle and store hygromycin B see the Flp
15. otherwise transfer any of the rights or obligations set forth herein except as expressly permitted by Life Technologies This product is licensed under U S Patent Nos 5 654 182 and 5 677 177 and is for research purposes only Inquiries about licensing for commercial or other uses should be directed to The Salk Institute for Biological Studies 10010 North Torrey Pines Road La Jolla CA 92037 Attn Department of Intellectual Property and Technology Transfer Phone 858 453 4100 ext 1703 Fax 858 450 0509 Email mwhite salk edu continued on next page Purchaser Notification continued Limited Use Label License No 5 Invitrogen Technology Limited Use Label License No 22 Vectors and Clones Encoding Histidine Hexamer The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such
16. protein by polyacrylamide gel electrophoresis a wide range of pre cast NPAGE and Novex Tris Glycine polyacrylamide gels and electrophoresis apparatus are available from Invitrogen The NuPAGE Gel System avoids the protein modifications associated with Laemmli type SDS PAGE ensuring optimal separation for protein analysis In addition Invitrogen also carries a large selection of molecular weight protein standards and staining kits For more information about the appropriate gels standards and stains to use to visualize your recombinant protein refer to our World Wide Web site www invitrogen com or call Technical Service see page 30 If you use pSecTag FRT V5 His PSA as a positive control vector you may assay for PSA expression using your method of choice We generally use the Total PSA Enzyme Immunoassay Test Kit American Laboratory Products Catalog no 025 BC 1019 to assay for PSA expression Note that PSA is fused to the C terminal peptide so you can use Western blot analysis and either the Anti V5 antibody or the Anti His C term antibody to detect expression of PSA The PSA V5 His protein fusion migrates around 31 5 kDa on an SDS PAGE gel 17 Purification Introduction Purification of Secreted Recombinant Protein Purification of Recombinant Protein from Cells Preparation of Cells for Lysis Lysis of Cells Note 18 Once you have generated your Flp In expression cell line and have verified tha
17. see page 21 Take special care to avoid sources of nuclease contamination and long exposure to UV light Alternatively you may optimize your PCR to eliminate multiple bands and smearing Innis et al 1990 The PCR Optimizer Kit Catalog no K1220 01 from Invitrogen can help you optimize your PCR Call Technical Service for more information page 30 Note TOPO Cloning Reaction and Transformation Introduction Note Important Chemically Competent E coli Electrocompetent E coli TOPO Cloning technology allows you to produce your PCR products ligate them into pSecTag FRT V5 His TOPO and transform the recombinant vector into TOP10 E coli in one day It is important to have everything you need set up and ready to use to ensure that you obtain the best possible results If this is the first time you have TOPO Cloned perform the control reactions on pages 24 25 in parallel with your samples If you have previously TOPO Cloned read the Note below Recent experiments at Invitrogen demonstrate that inclusion of salt 200 mM NaCl 10 mM MgCl in the TOPO Cloning reaction results in the following e a2 to 3 fold increase in the number of transformants e allows for longer incubation times up to 30 minutes Longer incubation times can result in an increase in the number of transformants obtained Including salt in the TOPO Cloning reaction prevents topoisomerase I from rebinding and potentially nicking the
18. 89 5049 complementary strand continued on next page 27 pSecTag FRT V5 His TOPO Vector continued Features of pSecTag FRT V5 His TOPO 28 pSecTag FRT V5 His TOPO is a 5185 bp vector that expresses your gene of interest under the control of the human CMV promoter The table below describes the relevant features of pSecTag FRT V5 His TOPO All features have been functionally tested Feature Benefit Human cytomegalovirus CMV immediate early promoter Allows high level expression of your gene of interest Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 CMV Forward priming site Allows sequencing in the sense orientation T7 promoter priming site Allows in vitro transcription in the sense orientation and sequencing through the insert Murine Ig chain secretion signal Directs secreted expression of the recombinant fusion protein Coloma et al 1992 TOPO Cloning site Allows insertion of your PCR product in frame with the C terminal peptide containing the V5 epitope and polyhistidine 6xHis tag V5 epitope Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr Allows detection of your recombinant protein with the Anti V5 Antibody Catalog no R960 25 or Anti VS HRP Antibody Catalog no R961 25 Southern et al 1991 Polyhistidine 6xHis tag Allows s purification of your recombinant protein on metal chelating resin such as ProBond
19. Gel Electrophoresis Assay for PSA Before starting prepare Cell Lysis Buffer A recipe is provided on page 19 for your convenience but other recipes are suitable 1 Prepare an SDS PAGE gel that will resolve your expected recombinant protein 2 Remove the medium from each plate and prepare samples as detailed on the previous page 3 Wash cell monolayers 5 x 10 to 1 x 10 cells once with phosphate buffered saline PBS see the Appendix page 20 for a recipe Scrape cells into 1 ml PBS and pellet the cells at 1500 x g for 5 minutes 5 Resuspend in 50 ul Cell Lysis Buffer Vortex Incubate cell suspension at 37 C for 10 minutes to lyse the cells Note You may prefer to lyse the cells at room temperature or on ice if degradation of your protein is a potential problem 7 Centrifuge the cell lysate at 10 000 x g for 10 minutes at 4 C to pellet nuclei and transfer the supernatant to a fresh tube Assay the lysate for protein concentration Note Do not use protein assays utilizing Coomassie Blue or other dyes NP 40 interferes with the binding of the dye with the protein 8 Add SDS PAGE sample buffer see page 20 for a recipe to a final concentration of 1X and boil the sample for 5 minutes 9 Load 20 ug of lysate onto an SDS PAGE gel and electrophorese see the next page Use the appropriate percentage of acrylamide to resolve your fusion protein To facilitate separation and visualization of your recombinant fusion
20. Invitrogen by technologies pSecTag FRT V5 His TOPO TA Expression Kit For five minute cloning of Taq polymerase amplified PCR products into a vector for secreted expression in the Fip In System Catalog no K6025 01 Version E 7 November 2010 25 0359 A Limited Label License covers this product see Purchaser Notification By use of this product you accept the terms and conditions of the Limited Label License Table of Contents Table Of Contents eem TET iii Important Information 0 2 ococ cde ecce rude ecu ends enu rud a enu saura ans sand a anus aua a ane uM ERR ERR iv Accessory Oe UTC vi e HE 1 Le ME 1 GM EE EN 1 UE OOS M 5 PGR Primer Design mni iere o e tip t e audes 5 Producing Bd ee Miete EE H TOPO Cloning Reaction and Transtormatlon EEN 8 Optimizing the TOPO Cloning Reaction toa per tid ate teet Fab d btt qutt 13 Transfection and Analysis ermet t eU Eee e t tad en eed ie pui does 14 PUtifiCatione s ais ot a e d e E 18 PDD ONIX i aaie 19 ee 19 Puritying POR ele ele 21 Addition of 3 A Overhangs Post Amplification esses eee 23 pSecTag FRT V5 His TOPO Control Reactions etes 24 psecTag FRI VS His TOPO P Vector ai ted tst ub Lu Cede toe b ttd rone cs 27 pSecTag FRI V5 His PSA MAD idee teh e ede eed ipe dune edle ig dee cio e e Pe dyes e og dead ue 29 Technical Servi
21. Note that lower cloning efficiencies will result from the following variables Most of these are easily correctable but if you are cloning large inserts you may not obtain the expected 8596 or more cloning efficiency Variable Solution pH gt 9 in PCR amplification reaction Check the pH of the PCR amplification reaction and adjust with 1 M Tris HCl pH 8 Incomplete extension during PCR Be sure to include a final extension step of 7 to 30 minutes during PCR Longer PCR products will need a longer extension time Cloning large inserts 23 kb Increase amount of insert Or gel purify as described on page 21 Excess or overly dilute PCR product Reduce or concentrate the amount of PCR product Note that you may add up to 4 ul of your PCR to the TOPO Cloning reaction page 9 Cloning blunt ended fragments Add 3 A overhangs by incubating with Tag polymerase page 23 PCR cloning artifacts false positives TOPO Cloning is very efficient for small fragments 100 bp present in certain PCR reactions Gel purify your PCR product page 21 or optimize your PCR If your template DNA carries an ampicillin marker carryover into the TOPO Cloning reaction from the PCR may lead to false positives Linearize the template DNA prior to PCR to eliminate carryover PCR product does not contain sufficient Taq polymerase is less efficient at adding a 3 A overhangs even though you used nontemplate 3 A nex
22. ag FRT V5 His TOPO construct and pOG44 into the Flp In host cell line to generate stable Flp In expression cell lines Once you have generated your Flp In expression cell line see the next page for general guidelines to assay for expression of your recombinant fusion protein Your gene of interest will be expressed from pSecTag FRT V5 His TOPO under the control of the human CMV promoter Once you have generated the Flp In expression cell line note that your recombinant fusion protein will be constitutively expressed To detect expression of your recombinant fusion protein by Western blot analysis you may use Anti V5 antibodies or Anti His C term antibodies available from Invitrogen see page vii for ordering information or an antibody to your protein of interest In addition the Positope Control Protein Catalog no R900 50 is available from Invitrogen for use as a positive control for detection of fusion proteins containing a V5 epitope or a polyhistidine 6xHis tag The ready to use WesternBreeze Chromogenic Kits and WesternBreeze Chemiluminescent Kits are available from Invitrogen to facilitate detection of antibodies by colorimetric or chemiluminescent methods For more information refer to our World Wide Web site www invitrogen com or call Technical Service see page 30 The medium in which your Flp In expression cells are grown can be analyzed for secreted recombinant fusion protein by functional assay or We
23. aminants will kill the cells and salt will interfere with lipid complexing decreasing transfection efficiency We recommend isolating plasmid DNA using the SN AP MiniPrep Kit 10 15 ug DNA Catalog no K1900 01 the S N A P MidiPrep Kit 10 200 ug DNA Catalog no K1910 01 or CsCl gradient centrifugation TM For established cell lines e g HeLa CHO consult original references or the supplier of your cell line for the optimal method of transfection We recommend that you follow exactly the protocol for your cell line Pay particular attention to medium require ments when to pass the cells and at what dilution to split the cells Further information is provided in Current Protocols in Molecular Biology Ausubel et al 1994 Methods for transfection include calcium phosphate Chen and Okayama 1987 Wigler et al 1977 lipid mediated Felgner et al 1989 Felgner and Ringold 1989 and electroporation Chu et al 1987 Shigekawa and Dower 1988 Invitrogen offers the Calcium Phosphate Transfection Kit Catalog no K2780 01 and several lipid based reagents for mammalian cell transfection For more information refer to our World Wide Web site www invitrogen com or call Technical Service see page 30 continued on next page Transfection and Analysis continued Positive Control Hygromycin B Determination of Hygromycin Sensitivity Important pSecTag FRT V5 His PSA is provided as a positive control vector for
24. ce i nte gait A ela ee ENEE 30 Purchaser Notficatlo EE 32 Product Specifications ea pr gen del D ud de eae doa de cda dap eg ee 35 Referentes c 36 Important Information Shipping and Storage TOPO TA Cloning Reagents The pSecTag FRT V5 His TOPO TA Expression Kit is shipped on dry ice Each kit contains a box with pSecTag FRT V5 His TOPO TA Cloning reagents Box 1 and a box with One Shot TOP10 competent cells Box 2 Store Box 1 at 20 C Store Box 2 at 80 C pSecTag FRT V5 His TOPO TA Cloning reagents Box 1 are listed below Note that the user must supply Taq polymerase Store Box 1 at 20 C Item Concentration Amount pSecTag FRT V5 His TOPO vector 10 ng ul plasmid DNA in 20 ul linearized 50 glycerol 50 mM Tris HCl pH 7 4 at 25 C 1 mM EDTA 2 mM DTT 0 1 Triton X 100 100 ug ml BSA 30 uM phenol red 10X PCR Buffer 100 mM Tris HCl pH 8 3 at 100 ul 42 C 500 mM KCI 25 mM MgCl 0 01 gelatin dNTP Mix 12 5 mM dATP 10 ul 12 5 mM dCTP 12 5 mM dGTP 12 5 mM dTTP neutralized at pH 8 0 in water Salt Solution 1 2 M NaCl 50 ul 0 06 M MgCl Sterile Water 1 ml T7 Sequencing Primer 0 1 ng ul in TE Buffer pH 8 20 ul BGH Reverse Sequencing Primer 0 1 ng ul in TE Buffer pH 8 20 ul Expression Control Plasmid 0 5 ng ul in TE buffer pH 8 10 ul pSecTag FRT V5 His PS A Control PCR Pri
25. collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research For products that are subject to multiple limited use label licenses the terms of the most restrictive limited use label license shall control Life Technologies Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Life Technologies Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of the product with a full refund For informat
26. d using PCR and TOPO Cloned into pSecTag FRT V5 His TOPO PSA is expressed as a fusion to the V5 epitope and 6xHis tag The molecular weight of the fusion protein is approximately 31 5 kDa Map The figure below summarizes the features of the pSecTag FRT V5 His PSA vector The complete nucleotide sequence for pSecTag FRT V5 His PSA is available for down loading from our World Wide Web site www invitrogen com or by contacting Technical Service See page 30 for more information co S o Qc s o ED gearen CN GM pSecTag FRT V5 His PSA Comments for pSecTag FRT V5 His PSA 5902 nucleotides CMV promoter bases 232 819 pUC ori CMV forward priming site bases 769 789 T7 promoter priming site bases 863 882 IgK secretion signal bases 905 967 PSA ORF bases 1019 1729 V5 epitope bases 1763 1804 Polyhistidine 6xHis region bases 1814 1831 BGH reverse priming site bases 1854 1871 BGH polyadenylation signal bases 1860 2084 FRT site bases 2368 2415 Hygromycin resistance gene no ATG bases 2423 3442 SV40 early polyadenylation signal bases 3575 3705 pUC origin bases 4088 4761 complementary strand bla promoter bases 5767 5865 complementary strand Ampicillin b a resistance gene bases 4906 5766 complementary strand 29 Technical Service World Wide Web Visit the Invitrogen Web Resource using your World Wide Web browser At the site you can e Get the scoop on our hot new products a
27. duce your PCR product Materials Supplied You will need the following reagents and equipment by the User e Taq polymerase e Thermocycler e DNA template and primers for PCR product Polymerase If you wish to use a mixture containing Taq polymerase and a proofreading polymerase Mixtures Taq must be used in excess of a 10 1 ratio to ensure the presence of 3 A overhangs on the PCR product If you use polymerase mixtures that do not have enough Taq polymerase or a proof reading polymerase only you can add 3 A overhangs using the method on page 23 Producing PCR 1 Setup the following 50 ul PCR reaction Use less DNA if you are using plasmid Products DNA as a template and more DNA if you are using genomic DNA as a template Use the cycling parameters suitable for your primers and template Be sure to include a 7 to 30 minute extension at 72 C after the last cycle to ensure that all PCR products are full length and 3 adenylated DNA Template 10 100 ng 10X PCR Buffer 5 ul 50 mM dNTPs 0 5 ul Primers 100 200 ng each 1 uM each Sterile water add to a final volume of 49 ul Tag Polymerase 1 unit ul lul Total Volume 50 ul 2 Check the PCR product by agarose gel electrophoresis You should see a single discrete band If you do not see a single band refer to the Note below If you do not obtain a single discrete band from your PCR you may gel purify your fragment before using the pSecTag FRT V5 His TOPO TA Expression Kit
28. e minimal FRT site consists of a 34 bp sequence containing two 13 bp imperfect inverted repeats separated by an 8 bp spacer that includes an Xba I restriction site see figure below An additional 13 bp repeat is found in most FRT sites but is not required for cleavage Andrews et al 1985 While Flp recombinase binds to all three of the 13 bp repeats strand cleavage actually occurs at the boundaries of the 8 bp spacer region see figure below Andrews et al 1985 Senecoff et al 1985 Minimal FRT site Se i CS n a GAAGTTCCTATTCCGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTC Xba CS CS cleavage site The hygromycin resistance gene in pSecTag FRT V5 His TOPO lacks a promoter and an ATG initiation codon therefore transfection of the pSecTag FRT V 5 His TOPO plasmid alone into mammalian host cells will not confer hygromycin resistance to the cells The SV40 promoter and ATG initiation codon required for expression of the hygromycin resistance gene are integrated into the genome in the Flp In host cell line and are only brought into the correct proximity and frame with the hygromycin resistance gene through Flp recombinase mediated integration of pSecTag FRT V5 His TOPO at the FRT site For more information about the generation of the Flp In host cell line and details of the Flp In System refer to the Flp In System manual continued on next page Overview continued Experimental Outline
29. ed to as activated vector Taq polymerase has a nontemplate dependent terminal transferase activity that adds a single deoxyadenosine A to the 3 ends of PCR products The linearized vector supplied in this kit has single overhanging 3 deoxythymidine T residues This allows PCR inserts to ligate efficiently with the vector Topoisomerase I from Vaccinia virus binds to duplex DNA at specific sites and cleaves the phosphodiester backbone after 5 CCCTT in one strand Shuman 1991 The energy from the broken phosphodiester backbone is conserved by formation of a covalent bond between the 3 phosphate of the cleaved strand and a tyrosyl residue Tyr 274 of topoisomerase I The phospho tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5 hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase Shuman 1994 TOPO Cloning exploits this reaction to efficiently clone PCR products see below Topoisomerase e Co O ox Hee acce GGGA A PCR Product Srece HO D OO Topoisomerase The pSecTag FRT V5 His TOPO vector contains a single FRT site immediately upstream of the hygromycin resistance gene for Flp recombinase mediated integration and selection of the pSecTag FRT V5 His TOPO construct following cotransfection of the vector with pOG44 into a Flp In mammalian host cell line The FRT site serves as both the recognition and cleavage
30. eport it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 31 Purchaser Notification Limited Use Label License No 64 Fip In System 32 Life Technologies Corporation Life Technologies has a license to sell the Flp In System and its components System to scientists for research purposes only under the terms described below Use of the System for any Commercial Purpose as defined below requires the user to obtain commercial licenses as detailed below Before using the System please read the terms and conditions set forth below Your use of the System shall constitute acknowledgment and acceptance of these terms and conditions If you do not wish to use the System pursuant to these terms and conditions please contact Life Technologies Technical Services within 10 days to return the unused and unopened System for a full refund Otherwise please complete the User Registration Card and return it to Life Technologies Life Technologies grants you a non exclusive license to use the enclosed System for research purposes only The System is being transferred to you in furtherance of and re liance on such lice
31. h is sufficient for 25 Westerns Product Epitope Catalog no Anti V5 Antibody Detects 14 amino acid epitope R960 25 Anti V5 HRP Antibody derived from the P and V proteins pg61 25 of the paramyxovirus SV5 Anti V5 AP Antibody Southern et al 1991 R962 25 GKPIPNPLLGLDST Anti His C term Antibody Detects the C terminal R930 25 Anti His C term HRP Antibody Polyhistidine 6xHis tag requires pg3j 55 mE the free carboxyl group for Anti His C term AP Antibody detection Lindner et al 1997 R932 25 HHHHHH COOH continued on next page vii Accessory Products continued Purification of The metal binding domain encoded by the polyhistidine tag allows simple easy Recombinant purification of your recombinant protein by Immobilized Metal Affinity Chromatography Protein IMAC using Invitrogen s ProBond Resin see below To purify proteins expressed from pSecTag FRT V5 His TOPO the ProBond Purification System or the ProBond resin in bulk are available separately See the table below for ordering information Product Quantity Catalog no ProBond Metal Binding Resin 50ml R801 01 150 ml R801 15 ProBond Purification System 6 purifications K850 01 ProBond Purification System with Anti V5 HRP 1 kit K854 01 Antibody ProBond Purification System with Anti His C term 1 kit K853 01 HRP Antibody Purification Columns 50 R640 50 10 ml polypro
32. hosphate Buffered Saline PBS 2X SDS PAGE Sample Buffer 20 137 mM NaCl 2 7 mM KCl 10 mM Na HPO 1 8 mM KH PO 1 Dissolve 8 g NaCl 0 2 g KCl 1 44 g NaHPO 0 24 g KH PO in 800 ml deionized water 2 Adjust pH to 7 4 with concentrated HCl 3 Bring the volume to 1 liter You may wish to filter sterilize or autoclave the solution to increase shelf life 1 Combine the following reagents 0 5 M Tris HCl pH 6 8 2 5 ml Glycerol 100 2 0 ml B mercaptoethanol 0 4 ml Bromophenol Blue 0 02 g SDS 0 4 g 2 Bring the volume to 10 ml with sterile water 3 Aliquot and freeze at 20 C until needed Purifying PCR Products Introduction Note Using the S N A P Gel Purification Kit TM Quick S N A P Method Smearing multiple banding primer dimer artifacts or large PCR products 23 kb may necessitate gel purification If you intend to purify your PCR product be extremely careful to remove all sources of nuclease contamination There are many protocols to isolate DNA fragments or remove oligonucleotides Refer to Current Protocols in Molecular Biology Unit 2 6 Ausubel et al 1994 for the most common protocols Three simple protocols are provided below Note that cloning efficiency may decrease with purification of the PCR product You may wish to optimize your PCR to produce a single band see Producing PCR Products page 7 The S N A P Gel Purification Kit Catalog no K1999 25
33. ical Resources select MSDS and follow instructions on the page continued on next page 30 Technical Service continued Limited Warranty Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service please contact our Technical Service Representatives Invitrogen warrants that all of its products will perform according to the specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please r
34. ion Kit pEFS FRT V5 Directional TOPO 1 kit K6035 01 Expression Kit pEFS FRT V5 DEST 6 ug V6020 20 continued on next page Accessory Products continued Flp In Host Cell Lines Detection of Recombinant Proteins For your convenience Invitrogen has available several mammalian Flp In host cell lines that stably express the acZ Zeocin fusion gene from pFRT lacZeo or PFRT lacZeo2 Each cell line contains a single integrated FRT site as confirmed by Southern blot analysis The cell lines should be maintained in medium containing Zeocin For more information see our World Wide Web site www invitrogen com or call Technical Service see page 30 Cell Line Amount Catalog no Flp In 293 3 x 10 cells frozen R750 07 Flp In CV 1 3 x 10 cells frozen R752 07 Flp In CHO 3 x 10 cells frozen R758 07 Flp In BHK 3 x 10 cells frozen R760 07 Flp In 3T3 3 x 10 cells frozen R761 07 Flp In Jurkat 3 x 10 cells frozen R762 07 Expression of your recombinant fusion protein can be detected using an antibody to the appropriate epitope The table below describes the antibodies available for detection of C terminal fusion proteins expressed using pSecTag FRT V5 His TOPO Horseradish peroxidase HRP or alkaline phosphatase AP conjugated antibodies allow one step detection using colorimetric or chemiluminescent detection methods Fifty microliters of each antibody is supplied whic
35. ion about purchasing a license to use this product or the technology embedded in it for any use other than for research use please contact Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 Phone 760 603 7200 or e mail outlicens ing lifetech com This product is licensed under U S Patent Nos 5 284 933 and 5 310 663 and foreign equivalents from Hoffmann LaRoche Inc Nutley NJ and or Hoffmann LaRoche Ltd Basel Switzerland and is provided only for use in research Information about licenses for commercial use is available from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany 33 Product Specifications Introduction Vectors TOPO Cloning Efficiency Primers One Shot Competent E coli 34 This section describes the criteria used to qualify the components in the pSecTag FRT V5 His TOPO TA Expression Kit The pSecTag FRT V5 His supercoiled vector parental vector of pSecTag FRT V5 His TOPO and pSecTag FRT V5 His PSA are qualified by restriction digest with specific restriction enzymes as listed below Please note that the pSecTag FRT V5 His plasmid is qualified by restriction digest prior to adaptation with topoisomerase I therefore restriction sites used to qualify the parental vector may no longer be present in the topoisomerase I adapted vector Restriction digests must demonstrate the correct banding pattern when electrophoresed on an agarose gel The table bel
36. lanking Sequences Proc Natl Acad Sci USA 82 5875 5879 Lindner P Bauer K Krebber A Nieba L Kremmer E Krebber C Honegger A Klinger B Mocikat R and Pluckthun A 1997 Specific Detection of His tagged Proteins With Recombinant Anti His Tag scFv Phosphatase or scFv Phage Fusions BioTechniques 22 140 149 Nelson J A Reynolds Kohler C and Smith B A 1987 Negative and Positive Regulation by a Short Segment in the 5 Flanking Region of the Human Cytomegalovirus Major Immediate Early Gene Molec Cell Biol 7 4125 4129 continued on next page 35 References continued Palmer T D Hock R A Osborne W R A and Miller A D 1987 Efficient Retrovirus Mediated Transfer and Expression of a Human Adenosine Deaminase Gene in Diploid Skin Fibroblasts from an Adenosine Deficient Human Proc Natl Acad Sci U S A 84 1055 1059 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition Plainview New York Cold Spring Harbor Laboratory Press Sauer B 1994 Site Specific Recombination Developments and Applications Curr Opin Biotechnol 5 521 527 Senecoff J F Bruckner R C and Cox M M 1985 The FLP Recombinase of the Yeast 2 micron Plasmid Characterization of its Recombination Site Proc Natl Acad Sci USA 82 7270 7274 Shigekawa K and Dower W J 1988 Electroporation of Eukaryotes and Prokaryotes
37. lasmid DNA Molec Cell Biol 7 2745 2752 Chu G Hayakawa H and Berg P 1987 Electroporation for the Efficient Transfection of Mammalian Cells with DNA Nucleic Acids Res 5 1311 1326 Coloma M J Hastings A Wims L A and Morrison S L 1992 Novel Vectors for the Expression of Antibody Molecules Using Variable Regions Generated by Polymerase Chain Reaction J Imm Methods 52 89 104 Craig N L 1988 The Mechanism of Conservative Site Specific Recombination Ann Rev Genet 22 77 105 Felgner P L Holm M and Chan H 1989 Cationic Liposome Mediated Transfection Proc West Pharmacol Soc 32 115 121 Felgner P L a and Ringold G M 1989 Cationic Liposome Mediated Transfection Nature 337 387 388 Goodwin E C and Rottman F M 1992 The 3 Flanking Sequence of the Bovine Growth Hormone Gene Contains Novel Elements Required for Efficient and Accurate Polyadenylation J Biol Chem 267 16330 16334 Gritz L and Davies J 1983 Plasmid Encoded Hygromycin B Resistance The Sequence of Hygromycin B Phosphotransferase Gene and its Expression in E coli and S Cerevisiae Gene 25 179 188 Gronostajski R M and Sadowski P D 1985 Determination of DNA Sequences Essential for FLP mediated Recombination by a Novel Method J Biol Chem 260 12320 12327 Jayaram M 1985 Two micrometer Circle Site specific Recombination The Minimal Substrate and the Possible Role of F
38. ls by treating with trypsin EDTA for 2 to 5 minutes or by scraping the cells in PBS 4 Inactivate the trypsin by diluting with fresh medium if necessary and transfer the cells to a sterile microcentrifuge tube 5 Centrifuge the cells at 1500 x g for 5 minutes Resuspend the cell pellet in PBS Centrifuge the cells at 1500 x g for 5 minutes You may lyse the cells immediately or freeze in liquid nitrogen and store at 70 C until needed TM If you are using ProBond resin refer to the ProBond details about sample preparation for chromotography Purification System manual for If you are using other metal chelating resin refer to the manufacturer s instructions for recommendations on sample preparation If you are not using metal chelating resin to purify your secreted recombinant protein we recommend that you culture the cells in serum free medium or in reduced serum medium to avoid or lessen the amount of bovine serum albumin present in your sample Whether you are able to culture your cells in serum free medium will depend on the nature of your cell line and the availability of commercial serum free media formulations for the particular cell type Refer to the supplier of your media or serum for more information Recipes LB Luria Bertani Medium and Plates X Gal Stock Solution Cell Lysis Buffer Appendix Composition 1 096 Tryptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 For liter disso
39. lve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave on liquid cycle for 20 minutes Allow solution to cool to 55 C and add 50 ug ml ampicillin if needed 4 Store at room temperature or at 4 C LB agar plates 1 Prepare LB medium as above but add 15 g L agar before autoclaving 2 Autoclave on liquid cycle for 20 minutes 3 After autoclaving cool to 55 C add 50 ug ml ampicillin and pour into 10 cm plates Let harden then invert and store at 4 C in the dark 5 To add X gal to the plate warm the plate to 37 C Pipette 40 ul of the 40 mg ml X gal stock solution see below spread evenly and let dry 15 minutes Protect plates from light 1 To prepare a 40 mg ml stock solution dissolve 400 mg X Gal in 10 ml dimethyl formamide 2 Protect from light by storing in a brown bottle at 20 C 50 mM Tris pH 7 8 150 mM NaCl 1 Nonidet P 40 1 3 This solution can be prepared from the following common stock solutions For 100 ml combine 1 M Tris base 5ml 5M NaCl 3ml Nonidet P 40 1ml Bring the volume up to 90 ml with deionized water and adjust the pH to 7 8 with HCl Bring the volume up to 100 ml Store at room temperature To prevent proteolysis you may add 1 mM PMSF 1 uM leupeptin or 0 1 uM aprotinin before use continued on next page 19 Recipes continued P
40. mers 0 1 ng ul each in TE Buffer pH 8 10 ul Control PCR Template 0 05 ug ul in TE Buffer pH 8 10 ul continued on next page Important Information continued Primer Sequences The sequence of each primer is provided below One Shot TOP10 Reagents Genotype One Shot Electrocomp Primer Sequence pMoles Supplied T7 5 TAATACGACTCACTATAGGG 3 328 BGH Reverse 5 TAGAAGGCACAGTCGAGG 3 358 The table below describes the items included in the One Shot TOP10 Chemically Competent E coli kit Transformation efficiency is at least 1 x 10 cfu ug DNA Note that One Shot TOP10 cells may be ordered separately Catalog no C4040 03 Store Box 2 at 80 C Item Composition Amount SOC Medium 2 Tryptone 6 ml may be stored at room 0 5 Yeast Extract temperature or 4 C 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO4 20 mM glucose TOP10 cells 21 x 50 ul pUC19 Control DNA 10 pg ul in 5 mM Tris HCl 0 5 mM 50 ul EDTA pH 8 TOP10 Use this strain for general cloning of PCR products in pSecTag FRT V5 His TOPO F mcrA A mrr hsdRMS mcrBC 80lacZAM15 AlacX74 recA1 araD139 A ara leu 7697 galU galK rpsL Str endA1 nupG TOP10 cells are also available as electrocompetent cells in a One Shot format Catalog no C4040 52 Transformation efficiency is 1 x 10 cfu ug supercoiled DNA Accessory Products Introduction Products Available Separately
41. nd special product offers e View and download vector maps and sequences e Download manuals in Adobe Acrobat PDF format e Explore our catalog with full color graphics e Obtain citations for Invitrogen products e Request catalog and product literature Once connected to the Internet launch your Web browser Internet Explorer 5 0 or newer or Netscape 4 0 or newer then enter the following location or URL http www invitrogen com and the program will connect directly Click on underlined text or outlined graphics to explore Don t forget to put a bookmark at our site for easy reference Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our Web page www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan K K Invitrogen Ltd 1600 Faraday Avenue Nihonbashi Hama Cho Park Bldg 4F Inchinnan Business Park Carlsbad CA 92008 USA 2 35 4 Hama Cho Nihonbashi 3 Fountain Drive Tel 1 760 603 7200 Tel 81 3 3663 7972 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Fax 81 3 3663 8242 Tel 44 0 141 814 6100 Fax 1 760 602 6500 E mail jpinfo Qinvitrogen com Tech Fax 44 0 141 814 6117 E mail E mail eurotech invitrogen com tech service invitrogen com MSDS Requests To request an MSDS visit our Web site at www invitrogen com On the home page go to Techn
42. nse You may not use the System or the materials contained therein for any Commercial Purpose without licenses for such purpose Commercial Purpose includes any use of the System or Expression Products in a Commercial Product any use of the System or Expression Products in the manufacture of a Commercial Product any sale of the System or Expression Products any use of the System or Expression Products to facilitate or advance research or development of a Commercial Product and any use of the System or Expression Products to facilitate or advance any research or development program the results of which will be applied to the development of a Commercial Product Expression Products means products expressed with the System or with the use of any vectors or host strains in the System Commercial Product means any product intended for sale or commercial use Access to the System must be limited solely to those officers employees and students of your entity who need access to perform the aforementioned research Each such officer employee and student must be informed of these terms and conditions and agree in writing to be bound by same You may not distribute the System or the vectors or host strains contained in it to others You may not transfer modified altered or original material from the System to a third party without written notification to and written ap proval from Life Technologies You may not assign sub license rent lease or
43. nstream of the native stop codon Note Cloning efficiencies may vary depending on the 5 nucleotide sequence of your primer see page 26 Use the diagram on the next page to design your PCR primers Once you have designed your PCR primers proceed to page 7 The Ig chain secretion signal is processed from your recombinant protein by a signal peptidase directed cleavage after aspartic acid 21 in the signal sequence For the location of the signal cleavage site refer to the diagram on the next page Note that you will not obtain native protein following cleavage of the signal sequence because of the intervening sequences between the signal cleavage site and the beginning of your PCR product see the next page continued on next page PCR Primer Design continued TOPO Cloning Site The diagram below is supplied to help you design appropriate PCR primers to correctly for clone and express your PCR product using pSecTag FRT V5 His TOPO Restriction pSecTag FRT V5 sites are labeled to indicate the actual cleavage site The vector is supplied linearized His TOPO between base pair 1012 and 1013 This is the TOPO Cloning site The complete 721 781 841 901 950 995 1040 1088 1141 sequence of pSecTag FRT V5 His TOPO is available for downloading from our World Wide Web site www invitrogen com or from Technical Service page 30 For a map and a description of the features of pSecTag FRT V5 His TOPO
44. ogy Techniques Note Fusion to the Ig x Chain Secretion Signal Fusion to the C terminal Peptide Signal Sequence Processing It is important to properly design your PCR primers to ensure that you obtain the recombinant protein you need for your studies Use the information below and the diagram on page 6 to design your PCR primers Remember that your PCR product will have single 3 adenine overhangs For help with E coli transformations restriction enzyme analysis DNA sequencing and DNA biochemistry refer to Molecular Cloning A Laboratory Manual Sambrook et al 1989 or Current Protocols in Molecular Biology Ausubel et al 1994 Do not add 5 phosphates to your primers for PCR The PCR product synthesized will not ligate into pSecTag FRT V5 His TOPO In order to obtain proper secreted expression of your protein you must design your 5 PCR primer such that the PCR product will clone in frame with the initiation ATG of the N terminal Ig chain secretion signal If you wish to include the C terminal peptide for detection with either the V5 or His C term antibodies or purification using the polyhistidine 6xHis tag you must design your reverse PCR primer to remove the native stop codon and maintain the frame through the DNA encoding the C terminal peptide If you do not wish to include the C terminal peptide include the native stop codon in the reverse PCR primer or design the primer to anneal dow
45. om 30 seconds to 30 minutes For routine subcloning of PCR products 30 seconds may be sufficient For large PCR products gt 1 kb or if you are TOPO Cloning a pool of PCR products increasing the reaction time will yield more colonies Place the reaction on ice and proceed to One Shot Chemical Transformation next page or Transformation by Electroporation next page Note You may store the TOPO Cloning reaction at 20 C overnight he pss E Add 2 ul of the TOPO Cloning reaction from Step 2 previous page into a vial of One Shot TOP10 Chemically Competent E coli and mix gently Do not mix by pipetting up and down Incubate on ice for 5 to 30 minutes Note Longer incubations on ice seem to have a minimal effect on transformation efficiency The length of the incubation is at the user s discretion see above Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tubes to ice Add 250 ul of room temperature SOC medium Cap the tube tightly and shake the tube horizontally 200 rpm at 37 C for 1 hour Spread 25 200 ul from each transformation on a prewarmed selective plate and incubate overnight at 37 C We recommend that you plate two different volumes to ensure that at least one plate will have well spaced colonies An efficient TOPO Cloning reaction will produce hundreds of colonies Pick 10 colonies for analysis see Analysis of Positive Clones next page Add 2 ul of the TOPO
46. ore the purified plasmid DNA at 20 C l Streak the original colony on LB plates containing 50 100 ug ml ampicillin 2 Isolate a single colony and inoculate into 1 2 ml of LB containing 50 100 ug ml ampicillin Grow the culture to mid log phase OD 9 0 5 0 7 Mix 0 85 ml of culture with 0 15 ml of sterile glycerol and transfer to a cryovial 5 Store at 80 C 12 Optimizing the TOPO Cloning Reaction Introduction Faster Subcloning More Transformants Cloning Dilute PCR Products The information below will help you optimize the TOPO Cloning reaction for your particular needs The high efficiency of TOPO Cloning technology allows you to streamline the cloning process If you routinely clone PCR products and wish to speed up the process consider the following Incubate the TOPO Cloning reaction for only 30 seconds instead of 5 minutes You may not obtain the highest number of colonies but with the high efficiency of TOPO Cloning most of the transformants will contain your insert After adding 2 ul of the TOPO Cloning reaction to chemically competent cells incubate on ice for only 5 minutes Increasing the incubation time to 30 minutes does not significantly improve transformation efficiency If you are TOPO Cloning large PCR products toxic genes or cloning a pool of PCR products you may need more transformants to obtain the clones you want To increase the number of colonies Incuba
47. ow lists the restriction enzymes and the expected fragments The size of the parental pSecTag FRT V5 His vector is 5167 bp Vector Restriction Enzyme Expected Fragments bp pSecTag FRT V5 His BamHI 5167 EcoRI 5167 Mlu I 839 4328 Dun I 1804 3363 pSecTag FRT V5 His PSA BamHI 741 5161 EcoR I 5902 Mlu I 1574 4328 Dun ll 973 1802 3125 Once the pSecTag FRT V5 His vector has been adapted with topoisomerase I it is lot qualified using the control reagents included in the kit Under conditions described on pages 24 25 a 500 bp control PCR product was TOPO Cloned into pSecTag FRT V5 His TOPO and subsequently transformed into the One Shot competent E coli included with the kit Each lot of vector should yield greater than 85 cloning efficiency Both primers have been lot qualified by DNA sequencing experiments using the dideoxy chain termination technique All competent cells are qualified as follows e Cells are tested for transformation efficiency using the control plasmid included in the kit Transformed cultures are plated on LB plates containing 100 pg ml ampicillin and the transformation efficiency is calculated Test transformations are performed in duplicate Transformation efficiency should be 1 x 10 cfu ug DNA for chemically competent cells and 1 x 10 for electrocompetent cells e To verify the absence of phage contamination 0 5 1 ml of competent cells are added to LB top
48. pylene columns viii Overview Introduction pSecTag FRT V5 His TOPO Vector Introduction The pSecTag FRT V5 His TOPO TA Expression Kit combines the Flp In System with TOPO Cloning technology to provide a highly efficient rapid cloning strategy for the direct insertion of Taq polymerase amplified PCR products into a plasmid vector for targeted and secreted expression of the gene of interest in mammalian cell lines TOPO Cloning requires no ligase post PCR procedures or PCR primers containing special additional sequences For more information about TOPO Cloning see the next page pSecTag FRT V 5 His TOPO is a 5 2 kb expression vector designed to facilitate rapid cloning and expression of PCR products using the Flp In System Catalog nos K6010 01 and K6010 02 available from Invitrogen When cotransfected with the pOG44 Flp recombinase expression plasmid into a Flp In mammalian host cell line the pSecTag FRT V 5 His TOPO vector containing the PCR product of interest is integrated in a Flp recombinase dependent manner into the genome The pSecTag FRT V5 His TOPO vector contains the following elements e The human cytomegalovirus CMV immediate early enhancer promoter for high level constitutive expression of the gene of interest in a wide range of mammalian cells Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 e Murine Ig chain leader sequence for directing secreted exp
49. ression of the gene of interest Coloma et al 1992 e TOPO Cloning site for rapid and efficient cloning of Taq amplified PCR products see the next page for more information e C terminal peptide containing the V5 epitope and a polyhistidine 6xHis tag for detection and purification of recombinant protein e FLP Recombination Target FRT site for Flp recombinase mediated integration of the vector into the Flp In host cell line see pages 2 3 for more information e Hygromycin resistance gene for selection of stable cell lines Gritz and Davies 1983 see important note on page 3 The control plasmid pSecTag FRT V5 His PS A is included for use as a positive control for transfection and secreted expression in the Flp In host cell line of choice For more information about the Flp In System the pOG44 plasmid and generation of the Flp In host cell line refer to the Flp In System manual The Flp In System manual is supplied with the Flp In Complete or Core Systems but is also available for downloading from our World Wide Web site www invitrogen com or by contacting Technical Service see page 30 continued on next page Overview continued How TOPO Cloning Works FRT Site in the pSecTag FRT V5 His TOPO Vector The plasmid vector pSecTag FRT V5 His TOPO is supplied linearized with e Single 3 thymidine T overhangs for TA Cloning e Topoisomerase covalently bound to the vector this is referr
50. rile water e Warm the vial of SOC medium from Box 2 to room temperature e Warm selective plates at 37 C for 30 minutes e Thaw on ice 1 vial of One Shot cells for each transformation The table below describes how to set up your TOPO Cloning reaction 6 pl for eventual transformation into either chemically competent One Shot TOP10 E coli provided or electrocompetent E coli Additional information on optimizing the TOPO Cloning reaction for your needs can be found on page 13 Note The red or yellow color of the TOPO vector solution is normal and is used to visualize the solution Reagent Chemically Competent E coli Electrocompetent E coli Fresh PCR product 0 5 to 4 ul 0 5 to 4 ul Salt Solution lu Dilute Salt Solution lul Sterile Water add to a final volume of 5 ul add to a final volume of 5 pl TOPO vector 1 ul 1 ul Store all reagents at 20 C when finished Salt solutions and water can be stored at room temperature or 4 C continued on next page TOPO Cloning Reaction and Transformation continued Performing the TOPO Cloning Reaction One Shot Chemical Transformation Transformation by Electroporation 10 Mix reaction gently and incubate for 5 minutes at room temperature 22 23 C Note For most applications 5 minutes will yield plenty of colonies for analysis Depending on your needs the length of the TOPO Cloning reaction can be varied fr
51. s Reagent Vector Only Vector PCR Insert Sterile Water 4 ul 3 ul Salt Solution or Dilute Salt Solution 1 ul lu Control PCR Product lul TOPO vector Iul 1 ul 2 Incubate at room temperature for 5 minutes and place on ice 3 Transform 2 ul of each reaction into separate vials of TOP10 One Shot cells page 10 4 Spread 10 50 ul of each transformation mix onto LB plates containing 50 100 ug ml ampicillin and X Gal see page 19 Be sure to plate two different volumes to ensure that at least one plate has well spaced colonies For plating small volumes add 20 ul of SOC to allow even spreading 5 Incubate overnight at 37 C Hundreds of colonies from the vector PCR insert reaction should be produced Greater than 85 of these will be blue The vector only plate should yield very few colonies 15906 of the vector PCR insert plate and these should be all white pUC19 plasmid is included to check the transformation efficiency of the One Shot competent cells Transform one vial of One Shot TOP10 cells with 10 pg of pUC19 using the protocol on page 10 Plate 10 ul of the transformation mixture plus 20 pl of SOC to help ensure even spreading on LB plates containing 50 ug ml ampicillin Transformation efficiency should be 1 x 10 cfu ug DNA continued on next page 25 pSecTag FRT V5 His TOPO Control Reactions continued Factors Affecting Cloning Efficiency 26
52. s the first time you have used this technique we recommend that you perform restriction analysis in parallel to confirm that PCR gives you the correct result Both false positive and false negative results can be obtained because of mispriming or contaminating template The following protocol is provided for your convenience Other protocols are suitable 1 Prepare a PCR cocktail consisting of PCR buffer dNTPs primers and Taq polymerase Use a 20 ul reaction volume Multiply by the number of colonies to be analyzed e g 10 2 Pick 10 colonies and resuspend them individually in 20 ul of the PCR cocktail Don t forget to make a patch plate to preserve the colonies for further analysis 3 Incubate the reaction for 10 minutes at 94 C to lyse the cells and inactivate nucleases 4 Amplify for 20 to 30 cycles using the appropriate conditions see text above 5 For the final extension incubate at 72 C for 10 minutes Hold at 4 C Visualize by agarose gel electrophoresis continued on next page 11 TOPO Cloning Reaction and Transformation continued If you have problems obtaining transformants or the correct insert perform the control Important reactions described on page 24 25 These reactions will help you troubleshoot your experiment Long Term Once you have identified the correct clone be sure to isolate a single colony and prepare Storage a glycerol stock for long term storage We recommend that you also st
53. site for the Flp recombinase and allows recombination to occur immediately adjacent to the hygromycin resistance gene The flp recombinase is expressed from the pOG44 plasmid For more information about the FRT site and recombination see the next page For more information about pOG44 refer to the pOG44 manual or the Flp In System manual continued on next page Overview continued Flp Recombinase Mediated DNA Recombination FRT Site Important In the Flp In System integration of your pSecTag FRT V5 His TOPO expression construct into the genome occurs via Flp recombinase mediated intermolecular DNA recombination The hallmarks of Flp mediated recombination are listed below e Recombination occurs between specific FRT sites see below on the interacting DNA molecules e Recombination is conservative and requires no DNA synthesis the FRT sites are preserved following recombination and there is minimal opportunity for introduction of mutations at the recombination site e Strand exchange requires only the small 34 bp minimal FRT site see below For more information about the Flp recombinase and conservative site specific recombination refer to published reviews Craig 1988 Sauer 1994 The FRT site originally isolated from Saccharomyces cerevisiae serves as a binding site for Flp recombinase and has been well characterized Gronostajski and Sadowski 1985 Jayaram 1985 Sauer 1994 Senecoff et al 1985 Th
54. ssful TOPO Cloning of the control PCR product in either direction will yield blue colonies on LB agar plates containing antibiotic and X gal Be sure to prepare LB plates containing 50 100 ug ml ampicillin and X gal see page 19 for recipe before performing the control reaction 1 To produce the 500 bp control PCR product containing the lac promoter and LacZa set up the following 50 ul PCR Control DNA Template 50 ng lu 10X PCR Buffer 5 pl 50 mM dNTPs 0 5 ul Control PCR Primers 0 1 ug ul each lu Sterile Water 41 5 ul Tag Polymerase 1 unit ul lul Total Volume 50 ul 2 Overlay with 70 ul 1 drop of mineral oil Amplify using the following cycling parameters Step Time Temperature Cycles Initial Denaturation 2 minutes 94 C IX Denaturation minute 94 C Annealing 1 minute 60 C 25X Extension minute 72 C Final Extension 7 minutes 72 C IX 4 Remove 10 ul from the reaction and analyze by agarose gel electrophoresis A discrete 500 bp band should be visible Proceed to the Control TOPO Cloning Reactions next page continued on next page pSecTag FRT V5 His TOPO Control Reactions continued Control TOPO Cloning Reactions Analysis of Results Transformation Control Using the control PCR product produced on the previous page and the TOPO vector set up two 6 ul TOPO Cloning reactions as described below 1 Setup control TOPO Cloning reaction
55. stern blot analysis If you are also harvesting cells see Preparation of Cell Lysates next page Before starting prepare 2X SDS PAGE sample buffer A recipe is provided on page 20 for your convenience but other recipes are suitable If you are using pre cast polyacrylamide gels see the next page refer to the manufacturer s instructions to prepare the appropriate sample buffer 1 Prepare an SDS PAGE gel that will resolve your expected recombinant protein 2 Harvestthe medium from the cells Note Depending on the sensitivity of your antibody you may wish to concentrate the media samples prior to Western blot analysis You may use any method to concentrate the media samples We suggest using commercially available ultrafiltration devices e g Centricon or a Speed Vac 3 For each media sample mix 20 pl of media with 20 ul of 2X SDS PAGE sample buffer Boil the samples for 5 minutes Centrifuge briefly Load samples electrophorese blot and probe with a suitable antibody see above Visualize proteins using your desired method The amino acids between the Ig chain secretion signal and the TOPO Cloning site will add approximately 1 5 kDa to the size of your protein while the C terminal tag containing the V5 epitope and the polyhistidine 6xHis tag will add approximately 3 6 kDa to the size of your protein continued on next page Transfection and Analysis continued Preparation of Cell Lysates Polyacrylamide
56. t to another A Taq is Taq polymerase most efficient at adding a nontemplate 3 A next to a C You may have to redesign your primers so that they contain a 5 G instead of a 5 T Brownstein et al 1996 pSecTag FRT V5 His TOPO Vector Map Comments for pSecTag FRT V5 His TOPO 5185 nucleotides CMV promoter bases 232 819 o E ATG IgK Leader The figure below summarizes the features of the pSecTag FRT V5 His TOPO vector 5185 bp The vector is supplied linearized between nucleotides 1012 and 1013 TOPO Cloning site For a more detailed explanation of each feature see the next page The complete sequence of pSecTag FRT V5 His TOPO is available from our Web site www invitrogen com or from Technical Service see page 30 P PCR Product I E irme mm Kpn pSecTag FRT V5 His TOPO pUC ori CMV forward priming site bases 769 789 T7 promoter priming site bases 863 882 IgK secretion signal bases 905 967 TOPO Cloning site bases 1012 1013 V5 epitope bases 1046 1087 Polyhistidine 6xHis region bases 1097 1114 BGH reverse priming site bases 1137 1154 BGH polyadenylation signal bases 1143 1367 FRT site bases 1651 1698 Hygromycin resistance gene no ATG bases 1706 2725 SV40 early polyadenylation signal bases 2858 2988 pUC origin bases 3371 4044 complementary strand bla promoter bases 5050 5148 complementary strand Ampicillin b a resistance gene bases 41
57. t your recombinant fusion protein expresses you may use metal chelating resin such as ProBond to purify the recombinant protein General guidelines are provided below For more details about purification using Probond refer to the ProBond Purification System manual To purify secreted recombinant protein from the medium follow the manufacturer s instructions for the metal chelating resin that you are using Start with about 3 to 5 ml of medium and load onto 1 to 2 ml of resin Scale up or down depending on the level of expression and the capacity of your resin You may also purify recombinant protein from cell lysates In this case you will need 5 x 10 to 1 x 10 transfected cells for purification of your protein on a 2 ml ProBond column or other metal chelating column If you are using ProBond to purify your protein refer to the protocol below to prepare cells for lysis If you are using another metal chelating resin refer to the manufacturer s instructions to prepare your cells Use the procedure below to prepare cells for lysis prior to purification of your protein on ProBond You will need 5 x 10 to 1 x 10 stably transfected cells for purification of your protein on a 2 ml ProBond column see ProBond Purification System manual for details 1 Seed cells in either five T 75 flasks or 2 to 3 T 175 flasks 2 Grow the cells in selective medium until they are approximately 80 90 confluent 3 Harvest the cel
58. te the salt supplemented TOPO Cloning reaction for 20 to 30 minutes instead of 5 minutes Increasing the incubation time of the salt supplemented TOPO Cloning reaction allows more molecules to ligate increasing the transformation efficiency Addition of salt appears to prevent topoisomerase from rebinding and nicking the DNA after it has ligated the PCR product and dissociated from the DNA To clone dilute PCR products you may Increase the amount of the PCR product Incubate the TOPO Cloning reaction for 20 to 30 minutes Concentrate the PCR product by precipitation 13 Transfection and Analysis Introduction l BECO p Z z S AE N Important Plasmid Preparation Methods of Transfection 14 Once you have TOPO Cloned your gene of interest into pSecTag FRT V5 His TOPO and have prepared purified plasmid DNA of your expression construct and pOG44 you are ready to cotransfect the plasmids into your mammalian Flp In host cell line to generate your stable Flp In expression cell line We recommend that you include the pSecTag FRT V5 His PSA positive control vector see the next page and a mock transfection negative control in your experiments to evaluate your results General information about transfection selection and expression analysis is provided in this section Specific guidelines and protocols for generating the Flp In expression cell line can be found in the Flp In System manual
59. uitable 1 After amplification with Veni or Pfu polymerase place vials on ice and add 0 7 1 unit of Taq polymerase per tube Mix well It is not necessary to change the buffer 2 Incubate at 72 C for 8 10 minutes do not cycle 3 Place the vials on ice The DNA amplification product is now ready for ligation into pSecTag FRT V5 His TOPO Note If you plan to store your sample s overnight before proceeding with TOPO Cloning you may want to extract your sample s with phenol chloroform to remove the polymerases After phenol chloroform extraction precipitate the DNA with ethanol and resuspend the DNA in TE buffer to the starting volume of the amplification reaction You may also gel purify your PCR product after amplification with Vent or Pfu see page 21 After purification add Taq polymerase buffer dATP and 0 5 unit of Tag polymerase and incubate 10 15 minutes at 72 C Use 4 ul in the TOPO Cloning reaction Note Vent is a registered trademark of New England Biolabs 23 pSecTag FRT V5 His TOPO Control Reactions Introduction Before Starting Producing Control PCR Product 24 If you have trouble obtaining transformants or vector containing insert perform the following control reactions to help troubleshoot your experiment Performing the control reactions involves producing a control PCR product containing the ac promoter and the LacZa fragment using the reagents included in the kit Succe
60. uring transformation try one of the following suggestions e Reduce the voltage normally used to charge your electroporator by 10 e Reduce the pulse length by reducing the load resistance to 100 ohms e Ethanol precipitate the TOPO Cloning reaction and resuspend in water prior to electroporation 1 Culture 10 transformants overnight in 2 5 ml LB or SOB medium containing 50 100 pg ml ampicillin 2 Isolate plasmid DNA using your method of choice If you need ultra pure plasmid DNA for automated or manual sequencing we recommend the S N A P MiniPrep Kit Catalog no K1900 01 or the S N A P MidiPrep Kit Catalog no K1910 01 3 Analyze the plasmids for the presence and orientation of insert by restriction analysis We recommend sequencing your constructs to confirm that your gene of interest is cloned in frame with the C terminal peptide Sequencing primers are included to help you sequence your insert see page iv Refer to the diagram on page 6 for the sequence surrounding the TOPO Cloning site If you need help with setting up restriction enzyme digests or DNA sequencing refer to general molecular biology texts Ausubel et al 1994 Sambrook et al 1989 You may wish to use PCR to directly analyze positive transformants You may use either the forward or reverse sequencing primers included in the kit and a primer that hybridizes within your insert You will have to determine the amplification conditions If this i

pSecTag/FRT/ V5-His-TOPO - Thermo Fisher Scientific

Contents

Download Pdf Manuals

Related Search

Related Contents