User Manual
Contents
1. 1 5 mL Nuclease free Water The kit should be stored at 20 C in a non frost free freezer Nuclease free Water can be stored at room temperature 4 C or 20 C Additional Materials Required Materials Not Provided with the Kit e Spin Columns e Thermocycler or incubator e optional Labeled nucleotide Generally 32P UTP or CTP at about 800 Ci mmol and 10 mCi mL or greater in aqueous solution is recommended for synthesis of radioactive probes 33P 3S 3H fluoresceinated biotinylated and digoxigenin nucleotides can also be used e optional Ammonium Acetate solution e optional Buffer saturated phenol chloroform IAA e optional DNase RNase free e optional Ethanol ACS reagent grade e optional lsopropanol e optional LiCl solution e optional Gels running buffers loading dyes and gel box Standard Procedure Take all precautions to avoid RNase contamination during the whole process Reactions are typically 20 uL but can be scaled up as needed 2 lt MCLAB A Preparation of Template DNA Generally any DNA with an RNA polymerase promoter site can be used as templates for in vitro transcription DNA should be relatively free of contaminating proteins and RNA Mostly used DNA templates are linearized plasmid DNA or PCR products that contains a promoter site for in vitro transcription B Transcription Reaction Setup 1 Thaw the frozen reagents and place on ice After thaw vortex the 10X Tra2. lt gt MCLAB Molecular Cloning Laboratories User Manual Version 2 0 Product name 17 High Yield In vitro Transcription Kit Cat T7HT 100 T7HT 200 Description Phage RNA polymerases are widely used for in vitro synthesis of RNA transcripts from DNA templates which have a double stranded promoter at least 19 bases upstream of the sequence to be transcribed T7 phage RNA polymerase has a high specificity for its respective promoter Once T7 RNA polymerase binds to its double stranded DNA promoter it separates the two DNA strands and uses the 3 to 5 strand as a tem plate for 5 to 3 transcription at the end of the DNA template run off transcription Figure 1 The initiation of transcription is the rate limiting step in in vitro transcript reactions Elongation of the transcript is very fast and efficient Cloning vectors usually contain two or more separate phage promoters flanking a multiple cloning site So either strand of the template can be transcribed from the promoter on the opposite strand The T7 High Yield In vitro Transcription Kit can also be used to transcribe from DNA templates produced via PCR or synthetic DNA oligonucleotides Because RNA RNA and RNA DNA hybrids are more stable than DNA DNA duplexes in solid base hybridiza tions and single stranded RNA probes are not depleted by rehybridization to a complementary probe strand the T7 High Yield In vitro Transcription Kit can be used to incorporate iso
3. me of chloroform Mix well Recover aqueous phase and transfer to a new tube c Adding 1 volume of isopropanol and mixing well d Chill the mixture for at least 15 min at 20 C Centrifuge at 4 C for 15 min at maximum speed Carefully remove the supernatant and resuspend the RNA in a solution appropriate to your application E Determine the RNA concentration and store frozen at 20 C or 80 C Ethidium bromide fluorescence UV light absorbance trace radiolabeling could be used for quantitating RNA yield RiboGreen and Bianalyzer kits are both convenient and sensitive methods as well Troubleshooting A Control Reaction The control template DNA is a linearized plasmid containing synthesized sequence under the transcriptional control of T7 promoter The size of the runoff transcript is 0 3 kb If the control reaction is not working there may be technical problems during the reaction set up B Low Yield of Short Transcript High yields of short transcripts lt 0 3 kb could be achieved by extending incubation time and increasing the amount of template To determine the optimum incubation time for maximum yield with a given template a time course experiment can be done C Low Yield of Full length RNA If the transcription reaction with your template generates full length RNA but the yield is significantly lower than expected it is possible that contaminants in the DNA template are inhibiting the RNA polymerase or the DNA concentra
4. nscription Buffer and keep it at room temperature All reagents should be spun briefly before opening to prevent loss and or contamination 2 Assemble the reaction Assemble the reaction at room temperature as the following chart when the RNA produced will be 20 5 kb in length For transcripts shorter than this we recommend add 1 fold more water to the reaction and increase incubation time longer than standard time as well Add the 10X Transcription Buffer after the water and template DNA are already in the tube Component Amount Nuclease free Water to 20 uL ATP solution 1 uL CTP solution 1 uL GTP solution 1 uL UTP solution 1 ul DTT 1 uL optional a 32P UTP 1 uL Template DNA x 10X Reaction Buffer 2 uL Enzyme Mix 1 uL Can be included in the reaction as a tracer 0 1 0 2 ug PCR product or up to 2 pg linearized plasmid DNA Denature first for un fresh linearized plasmid DNA 3 Mix thoroughly and then spin down briefly 4 Incubate at 37 C 2 4 hr The optimal incubation time for a given template will vary depending on the size and transcriptional efficiency of your template For short transcripts lt 0 5 kb a longer incubation time up to 16 hours may be necessary for maximum yield If the reaction is trace labeled remove an aliquot of trace radiolabeled reactions to assess yield after the incubation C optional DNase treatment DNase treatment removes the template DNA For many applications it may not be nece
5. ssary D Recovery of the RNA Different purification methods after the transcription reaction should be chosen according to your applica tion and resources Some commercial kits such as column purification are available specifically for purifying RNA from in vitro transcription reactions Applications that require primarily full length probe ribonuclease protection assays and mapping studies gel purification should be the choice Other common methods are listed as below 1 650 872 0245 www mclab com 3 1 Lithium chloride precipitation Lithium Chloride LiCl precipitation is a convenient and effective way to remove unincorporated nucleotides and most proteins for RNAs longer than 300 nucleotides and over 0 1 pg uL a Precipitate the RNA by adding 30 uL Nuclease free Water and 30 uL LiCl solution 7 5 M lithium chloride 50 mM EDTA b Mix thoroughly Chill for 30 min at 20 C c Centrifuge at 4 C for 15 min at maximum speed Carefully remove the supernatant d Wash the pellet once with 1 mL 70 ethanol and re centrifuge carefully remove ethanol e Resuspend the RNA in a solution appropriate for your application 2 Phenol chloroform extraction and isopropanol precipitation This is the most rigorous method for purifying transcripts a Add 115 uL nuclease free water and 15 uL ammonium acetate solution 5 M ammonium acetate 100 mM EDTA mix thoroughly b Add equal volume of phenol chloroform and then with an equal volu
6. tion may be incorrect D Significant fragments of RNA Transcript If the RNA appears degraded e g smeared on gel RNase contamination might be the issue either from DNA template or the reaction set up E RNA Transcript of Smaller Size than Expected Smaller than the expected sized bands are most likely due to premature termination by the RNA polymerase due to some sequences within template resemblance to T7 RNA Polymerase termination signals Incubating the transcription reaction at lower temperatures might be helpful For GC rich templates or templates with secondary structures incubation at 42 C or use of single stranded DNA binding protein SSB may improve the yield of full length transcript 4 lt MCLAB F RNA Transcript of Larger Size than Expected If the RNA transcript appears larger than expected template plasmid DNA may be incompletely digested Larger size band on gel may also be observed when the RNA transcript is not completely denatured due to the presence of strong secondary structures Reference Schendorn ET and Mierindorf RC 1985 Nucleic Acids Res 13 6223 6236 1 650 872 0245 www mclab com
7. topically labeled as well as noniso topically modified nucleotides into RNA transcripts as probes for hybridization reactions such as Northern and Southern blotting slot or dot blotting in situ hybridizations and nuclease protection assays If the RNA produced will be used as a probe to detect mRNA it is important that mRNA complementary antisense transcripts are synthesized With custom supplied cap analog fully functional capped mRNAs can be made through T7 High Yield In vitro Transcription reactions Applications In vitro transcription In vitro translation Hybridization probes Generation RNase protection assays RNA binding protein assays RNAi study Figure 1 ro 5 TAATACGACTCACTATAGGG AGA 3 Figure 1 T7 promoter sequence needed for transcription 1 650 872 0245 www mclab com 1 List of Components The kit contains sufficient materials for 20 or 100 reactions at 20 uL total reaction volume 20 rxns Component 20 uL T7 Enzyme Mix 20 uL ATP Solution 50 mM 20 uL CTP Solution 50 mM 20 uL GTP Solution 50 mM 20 uL UTP Solution 50 mM 20 uL 100 mM DTT 250 uL 10X Transcription Buffer 10 pL Control DNA Template 0 5 ug L 1 5 mL Nuclease free Water 100 rxns Component 100 pL T7 Enzyme Mix 100 uL ATP Solution 50 mM 100 uL CTP Solution 50 mM 100 pL GTP Solution 50 mM 100 uL UTP Solution 50 mM 100 pL 100 mM DTT 250 uL 10X Transcription Buffer 10 pL Control DNA Template 0 5 ug L
Download Pdf Manuals
Related Search