8/GW/TOPO
Contents
1. One Shot Chemical Transformation Protocol 12 For each transformation you will need one vial of One Shot competent cells and two selective plates e Equilibrate a water bath to 42 C for chemical transformation or set up your electroporator if you are using electrocompetent E coli e Warm the vial of S O C Medium from Box 2 to room temperature e Warm LB plates containing 100 ug ml spectinomycin at 37 C for 30 minutes see Important Note below If you are including the pUC19 positive control prewarm LB plates containing 100 ug ml ampicillin as well e Thaw on ice one vial of One Shot cells for each transformation If you are performing the rapid chemical transformation protocol it is essential that you prewarm your LB plates containing 100 ug ml spectinomycin prior to spreading Use the following protocol to transform One Shot TOP10 or Mach1 T1 chemically competent E coli 1 Add2 pl of the TOPO Cloning reaction from Performing the TOPO Cloning Reaction Step 2 page 10 into a vial of One Shot Chemically Competent E coli and mix gently Do not mix by pipetting up and down Note If you are transforming the pUC19 control plasmid use 10 pg 1 ul 2 Incubate on ice for 5 to 30 minutes Note Longer incubations on ice seem to have a minimal effect on transformation efficiency The length of the incubation is at the user s discretion Heat shock the cells for 30 seconds at 42 C without shaking2. continued on next page Setting Up the TOPO Cloning Reaction continued Materials Needed Performing the TOPO Cloning Reaction 10 You should have the following materials on hand before beginning Your PCR product freshly prepared pCR 8 GW TOPO vector supplied with the kit Box 1 keep at 20 C until use Salt Solution supplied with the kit Box 1 or Dilute Salt Solution as appropriate Water supplied with the kit Box 1 Use the procedure below to perform the TOPO Cloning reaction Set up the TOPO Cloning reaction using the reagents in the order shown and depending on whether you plan to transform chemically competent E coli or electrocompetent E coli Note The red color of the TOPO vector solution is normal and is used to visualize the solution Reagent Chemically Competent E coli Electrocompetent E coli Fresh PCR product 0 5 to4 ul 0 5 to 4 ul Salt Solution 1 ul Dilute Salt Solution 1 4 lul Water add to a final volume of 5 ul add to a final volume of 5 ul TOPO vector 1ul 1 pl Final volume 6 ul 6 ul Store all reagents at 20 C when finished Salt solution and water can be stored at room temperature or 4 C 1 Mix reaction gently and incubate for 5 minutes at room temperature 22 23 C Note For most applications 5 minutes will yield a sufficient number of colonies for analysis Depending on your needs the length of the TOPO Cloning r
3. Immediately transfer the tubes to ice Add 250 ul of room temperature S O C Medium Cap the tube tightly and shake the tube horizontally 200 rpm at 37 C for 1 hour Ov Ur 3 pe 7 Spread 10 50 ul from each transformation on a prewarmed selective plate and incubate overnight at 37 C To ensure even spreading of small volumes add 20 ul of S O C Medium We recommend that you plate two different volumes to ensure that at least one plate will have well spaced colonies 8 An efficient TOPO Cloning reaction should produce several hundred colonies Pick 10 colonies for analysis see Analyzing Transformants page 14 continued on next page Transforming One Shot Competent E coli continued Rapid One Shot Chemical Transformation Protocol One Shot Electroporation Protocol N MEN 7 C RE 94 z Now N I Use the alternative protocol below to rapidly transform One Shot TOP10 or Mach1 T1 chemically competent E coli Before beginning make sure to pre warm LB agar plates containing 100 ug ml spectinomycin at 37 C for 30 minutes 1 Add 4 ul of the TOPO Cloning reaction from Performing the TOPO Cloning Reaction Step 2 page 10 into a vial of One Shot Chemically Competent E coli and mix gently Do not mix by pipetting up and down Incubate on ice for 5 minutes Spread 50 ul of cells on a prewarmed selective plate and incubate overnight at 37 C An efficient TOPO Cloning reaction should produce sever
4. 831 c M13 reverse priming site bases 836 852 Spectinomycin promoter bases 930 1063 Spectinomycin resistance gene Spn 1064 2074 pUC origin bases 2141 2814 c complementary sequence continued on next page 24 Map and Features of pCR 8 GW TOPO continued Features of pCR 8 GW TOPO 2817 bp contains the following elements All features have pCR 8 GW TOPO been functionally tested Feature Benefit rrnB T1 and T2 transcription termination sequences Reduces potential toxicity in E coli by preventing basal expression of the PCR product 17 promoter priming site Allows in vitro transcription and sequencing through the insert M13 forward 20 priming site Allows sequencing of the insert GW1 priming site Allows sequencing of the insert attL1 and attL2 sites Bacteriophage derived recombination sequences that allow recombinational cloning of a gene of interest in the entry construct with a Gateway destination vector Landy 1989 TOPO Cloning site Allows rapid cloning of your Tag amplified PCR product GW2 priming site Allows sequencing of the insert M13 reverse priming site Allows sequencing of the insert Spectinomycin promoter Allows expression of the spectinomycin resistance gene in E coli Spectinomycin resistance gene aad A1 Allows selection of the plasmid in E coli Liebert et al 1999 pUC origin of replicati
5. C until the gel slice melts Place the tube at 37 C to keep the agarose melted Add 4 ul of the melted agarose containing your PCR product to the TOPO Cloning reaction as described on page 10 Incubate the TOPO Cloning reaction at 37 C for 5 to 10 minutes This is to keep the agarose melted Transform 2 to 4 ul directly into One Shot competent cells using the method on page 12 The cloning efficiency may decrease with purification of the PCR product e 2 PCR product too dilute You may wish to optimize your PCR to produce a single band see Producing PCR Products page 7 Addition of 3 A Overhangs Post Amplification Introduction Direct cloning of DNA amplified by proofreading polymerases into TOPO TA Cloning vectors is often difficult because proofreading polymerases remove the 3 A overhangs necessary for TA Cloning Invitrogen has developed a simple method to clone these blunt ended fragments Before Starting You will need the following items e Taq polymerase e A heat block equilibrated to 72 C e Phenol chloroform optional e 3M sodium acetate optional e 100 ethanol optional e 80 ethanol optional e TE buffer optional Procedure This is just one method for adding 3 adenines Other protocols may be suitable 1 After amplification with a proofreading polymerase place vials on ice and add 0 7 1 unit of Tag polymerase per tube Mix well It is not necessary to change the buffer A suffic
6. Gel Solubilization Buffer GS1 to the column Incubate at room temperature for 1 minute Centrifuge at gt 12 000 x g for 1 minute Discard the flow through Place the column back into the Wash Tube 9 Add 700 ul Wash Buffer W9 with ethanol add 96 100 ethanol to the Wash Buffer according to instructions on the label of the bottle to the column and incubate at room temperature for 5 minutes Centrifuge at gt 12 000 x g for 1 minute Discard flow through 10 Centrifuge the column at 212 000 x g for 1 minute to remove any residual buffer Place the column into a 1 5 ml Recovery Tube 11 Add 50 ul warm 65 70 C TE Buffer TE to the center of the cartridge Incubate at room temperature for 1 minute 12 Centrifuge at gt 12 000 x g for 2 minutes The Recovery Tube contains the purified DNA Store DNA at 20 C Discard the column 13 Use 4 ul of the purified DNA for the TOPO Cloning reaction continued on next page 21 Gel Purifying PCR Products continued Low Melt Agarose Method Note 22 If you prefer to use low melt agarose use the procedure below Note that gel purification will result in a dilution of your PCR product and a potential loss of cloning efficiency 1 Electrophorese as much as possible of your PCR reaction on a low melt agarose gel 0 8 to 1 2 in TAE buffer Visualize the band of interest and excise the band Place the gel slice in a microcentrifuge tube and incubate the tube at 65
7. MultiSite Gateway LR recombination reaction refer to the MultiSite Gateway Three Fragment Vector Construction Kit manual Troubleshooting TOPO Cloning Reaction and Transformation pages 19 20 in parallel with your samples The table below lists some potential problems and possible solutions that may help you troubleshoot the TOPO Cloning and transformation reactions To help evaluate your results we recommend that you perform the control reactions see Problem Reason Solution Few or no colonies obtained from sample reaction and the transformation control gave colonies Incomplete extension during PCR Include a final extension step of 7 to 30 minutes during PCR Longer PCR products will need a longer extension time Excess or overly dilute PCR product used in the TOPO Cloning reaction Reduce or concentrate the amount of PCR product PCR primers contain 5 phosphates Do not add 5 phosphates to your PCR primers Used a proofreading poly merase or a Tag proofreading polymerase mixture for PCR e Use Tag polymerase or another DNA polymerase that leaves 3 A overhangs to produce your PCR product e Add 3 A overhangs to your blunt PCR product by incubating with Tag poly merase see page 23 Large PCR product e Increase the amount of PCR product used in the TOPO Cloning reaction e Increase the incubation time of the TOPO Cloning reaction from 5
8. Shot 1 For each transformation thaw one vial of One Shot E coli cells on ice Chemically Competent 2 Add 2 ul of the TOPO Cloning reaction into a vial of One Shot chemically E coli competent E coli and mix gently 3 Incubate on ice for 5 to 30 minutes 4 Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tube to ice 5 Add 250 ul of room temperature S O C Medium 6 Incubate at 37 C for 1 hour with shaking 7 Spread 10 50 ul of bacterial culture on a prewarmed LB agar plate containing 100 ug ml spectinomycin and incubate overnight at 37 C Control Reaction We recommend using the Control PCR Template and the Control PCR Primers included with the kit to perform the control reaction See the protocol on pages 19 20 for instructions vi Kit Contents and Storage Types of Kits Shipping Storage This manual is supplied with the following kits PureLink Quick Plasmid Miniprep Kit Kit Catalog no pCR 8 GW TOPO TA Cloning Kit with One Shot TOP10 Chemically Competent E coli K2500 20 with One Shot Mach1 T1 Chemically Competent E coli K2520 20 with One Shot Mach1 T1 Chemically Competent E coli and K2520 02 Each pCR 8 GW TOPO TA Cloning Kit is shipped on dry ice and contains 2 or 3 boxes as described below Upon receipt store the boxes as detailed below Box Component Catalog no Storage K2500 20 K25
9. cm cuvettes or 100 to 200 ul 0 2 cm cuvettes If you experience arcing during transformation try one of the following suggestions Reduce the voltage normally used to charge your electroporator by 10 Reduce the pulse length by reducing the load resistance to 100 ohms Ethanol precipitate the TOPO Cloning reaction and resuspend in water prior to electroporation 13 Analyzing Transformants Analyzing Positive 1 Pick 2 6 colonies and culture them overnight in LB or SOB medium Clones Sequencing Important Long Term Storage 14 containing 100 ug ml spectinomycin Note If you transformed One Shot Mach1 T1 competent E coli you may inoculate overnight grown colonies and culture them for only 4 hours in pre warmed LB medium containing 100 ug ml spectinomycin before isolating plasmid For optimal results we recommend inoculating as much of a single colony as possible 2 Isolate plasmid DNA using PureLink Quick Plasmid Miniprep Kit supplied with cat no K2520 02 or available separately page x The plasmid isolation protocol is included in the manual supplied with the PureLink Quick Plasmid Miniprep Kit and is also available for downloading from www invitrogen com Other kits for plasmid DNA purification are also suitable for use 3 Analyze the plasmids by restriction analysis or PCR to confirm the presence and correct orientation of the insert Note pCR 8 GW TOPO contains EcoR I sites flanki
10. minutes to 30 minutes e Gel purify the PCR product to remove primer dimers and other artifacts PCR reaction contains artifacts i e does not run as a single band on an agarose gel Optimize your PCR conditions e Gel purify your PCR product Cloning large pool of PCR products or a toxic gene Increase the incubation time of the TOPO reaction from 5 minutes to 30 minutes continued on next page 17 Troubleshooting continued TOPO Cloning Reaction and Transformation continued 18 Problem Reason Solution Few or no colonies obtained from sample reaction and the transformation control gave colonies continued PCR product does not contain sufficient 3 A overhangs even though you used Taq polymerase e Increase the final extension time to ensure that all 3 ends are adenylated e Tag polymerase is most efficient at adding a non template 3 A next to a C and less efficient at adding a nontemplate 3 A next to another A You may have to re design your primers so that they contain a 5 G instead of a 5 T Brownstein et al 1996 Large number of incorrect inserts cloned PCR cloning artifacts e Gel purify your PCR product to remove primer dimers and smaller PCR products e Optimize your PCR conditions e Include a final extension step of 7 to 30 minutes during PCR Longer PCR products will need a longer extension time Few or no colonies obtain
11. the attL2 site of pCR 8 GW TOPO have been mutated This results in the following e Allows robust and efficient sequencing of inserts cloned into pCR 8 GW TOPO using the GW1 and GW2 primers e The GW1 and GW2 primer binding sites are located within the attL1 and attL2 sites thereby minimizing the amount of vector encoded DNA that needs to be read to less than 55 base pairs see the diagram on page 6 for the location of the primer binding sites e Does not affect the efficiency of LR recombination between pCR 8 GW TOPO and Gateway destination vectors Note The pCR 8 GW TOPO vector also contains the M13 forward 20 and M13 reverse primer binding sites to allow sequencing using the M13 forward 20 and M13 reverse primers if desired The T7 promoter priming site is also present in the vector The MultiSite Gateway Technology uses modifications of the site specific recombination reactions of the Gateway Technology see the previous page to allow simultaneous cloning of multiple DNA fragments in a defined order and orientation The MultiSite Gateway Three Fragment Vector Construction Kit available from Invitrogen Catalog no 12537 023 facilitates simultaneous cloning of DNA fragments in three entry vectors to create your own expression clone For more information about the MultiSite Gateway Technology and the MultiSite Gateway Three Fragment Vector Construction Kit refer to the MultiSite Gateway Three Fragment Vec
12. using Taq polymerase 1 Ina0 5 ml microcentrifuge tube set up the following 50 ul PCR Reagent Amount Control DNA Template 50 ng 1g 10X PCR Buffer 5ul dNTP Mix 0 5 pl Control PCR Primers 0 1 ug ul each 1u Water 41 5 ul Taq polymerase 1 U ul 1u Total volume 50 ul 2 Overlay with 70 ul 1 drop of mineral oil if required 3 Amplify using the following cycling parameters Step Time Temperature Cycles Initial Denaturation 2 minutes 94 C 1X Denaturation 1 minute 94 C Annealing 1 minute 60 C 25X Extension 1 minute 72 C Final Extension 7 minutes 72 C 1X 4 Remove 10 ul from the reaction and analyze by agarose gel electrophoresis A discrete 500 bp band should be visible Proceed to the Control TOPO Cloning Reactions next page continued on next page 19 Performing the Control Reactions continued Control TOPO What You Should See Transformation Control 20 Using the control PCR product produced on the previous page and the Cloning Reactions pCR 8 GW TOPO vector set up two 6 ul TOPO Cloning reactions as described below 1 Setup control TOPO Cloning reactions Reagent Vector Only Vector PCR Insert Water 4 ul 3 pl Salt Solution 1ul Tul Control PCR Product 1 ul pCR 8 GW TOPO vector 1 ul 1 pl Total volume 6 ul 6 ul 2 Incubate at room temperature for 5 minutes and place on ice 3 Tr
13. 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 Email outlicensing invitrogen com continued on next page Purchaser Notification continued Limited Use Label License No 19 Gateway Cloning Products Gateway Clone Distribution Policy This product and its use is the subject of one or more of U S Patent Nos 5 888 732 6 143 557 6 171 861 6 270 969 and 6 277 608 and or other pending U S and foreign patent applications owned by Invitrogen Corporation The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The purchase of this product does not convey a license under any method claims in the foregoing patents or patent applications or to use this product with any recombination sites other than those purchased from Invitrogen Corporation or its authorized distributor The right to use methods claimed in the foregoing patents or patent applications with this product for research purposes only can only be acquired by the use of Clonase purchased from Invitrogen Corporation or its authorized distributors The buyer cannot modify the recombination sequence s contained in this product for any purpose The buyer cannot sell or otherwise transfer a this product b its components or c materials made by
14. 20 20 K2520 02 1 pCR 8 GW TOPO Reagents Y y Y 20 C 2 One Shot Chemically Competent E coli Y V V 80 C 3 PureLink Quick Plasmid Miniprep Kit Y Room temperature continued on next page vii Kit Contents and Storage continued pCR 8 GW TOPO The following reagents are supplied with the pCR 8 GW TOPO vector Box 1 Note that the user must supply Taq polymerase Store Box 1 at 20 C Reagents Item Concentration Amount pCR 8 GW TOPO vector TOPO adapted 5 10 ng ul linearized plasmid DNA in 20 pl 50 glycerol 50 mM Tris HCl pH 7 4 at 25 C 1mM EDTA 1mM DTT 0 1 Triton X 100 100 ug ml BSA 30 uM phenol red 10X PCR Buffer 100 mM Tris HCI pH 8 3 at 42 C 100 ul 500 mM KCl 25 mM MgCl 0 01 gelatin dNTP Mix 12 5 mM dATP 10 ul 12 5 mM dCTP 12 5 mM dGTP 12 5 mM dTTP neutralized at pH 8 0 in water Salt Solution 1 2 M NaCl 50 ul 0 06 M MgCl Water 1ml GW1 Primer 0 1 ug ul in TE Buffer pH 8 0 20 ul GW Primer 0 1 ug ul in TE Buffer pH 8 0 20 ul Control PCR Primers 0 1 ug ul each in TE Buffer pH 8 0 10 ul Control PCR Template 0 05 ug ul in TE Buffer pH 8 0 10 ul Primer Sequences The table below provides the sequences of GW1 and GW2 primers Note that the sequences of the GW1 and GW2 primers are identical except for the last 2 nucleotides at the 3 end indicated in bold
15. 20 reactions 11791 020 100 reactions 11791 100 Gateway LR Clonase Plus Enzyme Mix 20 reactions 12538 013 MultiSite Gateway Three Fragment Vector 1 kit 12537 023 Construction Kit Spectinomycin For selection of pCR 8 GW TOPO transformants in E coli you will need to obtain spectinomycin Spectinomycin dihydrochloride is available from Sigma Catalog no 54014 For a recipe to prepare spectinomycin for use see page 26 Overview Introduction Advantages of Using pCR 8 GW TOPO Features of the pCR 8 GW TOPO Vector Introduction The pCR 8 GW TOPO TA Cloning Kit combines Invitrogen s TOPO Cloning and Gateway technologies to facilitate 5 minute one step cloning of Tag poly merase amplified PCR products into a plasmid vector with 95 efficiency As is the case with other pCR vectors e g pCR 2 1 TOPO clones may be easily sequenced and characterized Once characterized clones may also be transferred from the pCR 8 GW TOPO entry vector to a Gateway or MultiSite Gateway destination vector of choice for expression of the gene of interest in virtually any system For more information about how TOPO Cloning works and the Gateway and MultiSite Gateway technologies see the rest of this section Using the pCR 8 GW TOPO vector for cloning applications provides the following advantages e The vector is TOPO adapted to allow highly efficient 5 minute cloning of Taq polymerase amplified P
16. 4 Ow p 26 Technical 5ervice x ene DEI eU Re aet e E e Re dte EAE 27 Purchaser NotificatiOh sss niteh eiie etii en e bod feeit ss ss na 28 Gateway Clone Distribution ole y ent ue Ra test REA REN tU 30 Product Qualification 2 duda eec eet reed de tubus IR kenne 31 RETEFENCES Fir T 32 iii iv TOPO Cloning Procedure for Experienced Users Introduction This quick reference sheet is provided for experienced users of the TOPO Cloning procedure If you are performing the TOPO Cloning procedure for the first time we recommend that you follow the detailed protocols provided in the manual Step Action Produce PCR product Produce PCR products using Tag polymerase and your own protocol End the PCR reaction with a final 7 to 30 minute extension step Perform the TOPO 1 Setup one of the following TOPO Cloning reactions using the reagents in the Cloning Reaction order shown For electroporation dilute Salt Solution 4 fold to prepare Dilute Salt Solution Reagent Chemical Transfection Electroporation Fresh PCR product 0 5 to 4 ul 0 5 to 4 ul Salt Solution Tul Dilute Salt Solution Tul Water to a final volume of 5 ul to a final volume of 5 pl TOPO Vector 1ul lul Total volume 6 ul 6 ul 2 Mix gently and incubate for 5 minutes at room temperature 3 Place on ice and proceed to transform One Shot chemically competent E coli below Transform One
17. AGCAATG CTTTTTTATA ATGCCAACT TTG TAC AAA AAC ATG TTT Leu Tyr Lys EcoR I EcoR I r 659 AAA GCA GGC TCC GAA TTC GCC CTTEMIDQ product INAG GGC GAA TTC GAC CCA GCT TTC TTG TAC TTT CGT CCG AGG CTT AAG CGG GA TTC CCG CTT AAG CTG GGT CGA AAG AAC ATG Lys Ala Gly Ser Glu Phe Gly Leu Lys Gly Glu Phe Asp Pro Ala Phe Leu Tyr attL2 GW2 priming site 713 AAAGTTGG CATTATAAAA AATAATTGCT CATCAATTTG TTGCAACGAA CAGGTCACTA TCAGTCAAAA TAAAATCATT T7 promoter priming site M13 reverse priming site f l r 1 791 ATTTGCCATC CAGCTGATAT CCCCTATAGT GAGTCGTATT ACATGGTCAT AGCTGTTTCC TGGCAGCTCT If you have used other Gateway entry vectors note that the sequences of the recombination regions may vary slightly but the mechanism of recombination remains the same Note Producing PCR Products Introduction Materials Supplied by the User Polymerase Mixtures Producing PCR Products Once you have synthesized appropriate PCR primers you may use the primers and a suitable DNA polymerase to produce your PCR product Remember that your PCR product must have single 3 A overhangs You will need the following reagents and equipment for PCR Note dNTPs adjusted to pH 8 are provided in the kit e Taq polymerase or other suitable DNA polymerase Note For improved specificity and higher yields we recommend using Platinum Taq DNA Polymerase available from Invitrogen see page x for ordering information to generate your PCR pro
18. CR products No ligase post PCR procedures or restriction enzymes are required e The vector contains primer binding sites that are located within 55 base pairs of the TOPO Cloning site to facilitate sequencing of the PCR product while minimizing the amount of vector encoded DNA that needs to be read e The vector is Gateway adapted to allow easy recombination based transfer of the PCR product of interest into any Gateway destination vector for downstream analysis e EcoRIsites flank the TOPO Cloning to simplify excision of the cloned PCR product e The vector contains the spectinomycin resistance marker for efficient selection in E coli Use of this particular marker also allows recombination based transfer of the PCR product into ampicillin or kanamycin resistant Gateway destination vectors Features of the pCR 8 GW TOPO vector include e TOPO Cloning site for rapid and efficient cloning of Taq amplified PCR products see the next page for more information e attL1 and attL2 sites for recombination based transfer of the gene of interest into any Gateway destination vector e Specifically designed primer binding sites within the attL1 and attL2 sites for sequencing using the GW1 and GW2 primers e rrnB transcription termination sequences to prevent basal expression of the PCR product of interest in E coli e Spectinomycin resistance gene for selection in E coli e pUCorigin for high copy replication of the pla
19. Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Invitrogen Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Invitrogen Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to this product for purposes other than research contact Licensing Department Invitrogen Corporation
20. Invitrogen pCR 8 GW TOPO TA Cloning Kit Five minute TOPO Cloning of Taq polymerase amplified PCR products into an entry vector for the Gateway System Catalog nos K2500 20 K2520 20 and K2520 02 Version E 10 April 2006 25 0706 ii Table of Contents Table f Contents i sceau te ee t eet trente De Pe iie temet o rr Pete e Pe E Res iii TOPO Cloning Procedure for Experienced Users nenne De ea v Kit Contents and Stofage aee tt eti meret EE PP ble drea stet rae rete rne bere rte EE E dete eur eie vii Accessory Products ehe e ov En ee on oodd edes x Intr duclion aaa sur 1 eua ti EN 1 Experimental Outline etie emer ette ee E d as na 4 Methods ae ne RE Eee 5 Desigtung PCR Primers ins tede eee se M e ee ee edite Bits idu te that ide 5 Producing PER Products sauer ren finde e Rn etn 7 Setting Up the TOPO Cloning Reaction eis 9 Transforming One Shot Competent E coli rare 11 Analyzing Transtormants ission aea eae e enia A Re t a f HER EREE REOR E OKEERE 14 Guidelines to Perform the LR Recombination Reaction sse eene 15 Troubleshooting E 17 PRD DOIN dump M 19 Performing the Control ReacHoNS miis eissii isee se iiie Eere En Eiee seise tenete tenente tenete tenent 19 Gel Puritying PCR Products seii e aaa o etedibe beaut ede ee a 21 Addition of 3 A Overhangs Post Amplification seen 23 Map and Features ob BER B CWITOR REEL 2
21. al hundred colonies Pick 10 colonies for analysis see Analyzing Transformants page 14 Use ONLY electrocompetent cells for electroporation to avoid arcing Do not use the One Shot TOP10 or Mach1 T1 chemically competent cells for electroporation 1 Add 2 ul of the TOPO Cloning reaction from Performing the TOPO Cloning Reaction Step 2 page 10 into a sterile microcentrifuge tube containing 50 ul of electrocompetent E coli and mix gently Do not mix by pipetting up and down Avoid formation of bubbles Transfer the cells to a 0 1 cm cuvette Electroporate your samples using your own protocol and your electroporator Note If you have problems with arcing see below Immediately add 250 ul of room temperature S O C Medium Transfer the solution to a 15 ml snap cap tube i e Falcon and shake for at least 1 hour at 37 C to allow expression of the spectinomycin resistance gene Spread 10 50 ul from each transformation on a prewarmed selective plate and incubate overnight at 37 C To ensure even spreading of small volumes add 20 ul of S O C Medium We recommend that you plate two different volumes to ensure that at least one plate will have well spaced colonies An efficient TOPO Cloning reaction should produce several hundred colonies Pick 10 colonies for analysis see Analyzing Transformants page 14 To prevent arcing of your samples during electroporation the volume of cells should be between 50 and 80 ul 0 1
22. ansform 2 ul of each reaction into separate vials of One Shot competent cells using the procedure on page 12 4 Spread 10 50 ul of each transformation mix onto LB plates containing 100 ug ml spectinomycin and X gal When plating small volumes add 20 ul of S O C Medium to ensure even spreading Be sure to plate two different volumes to ensure that at least one plate has well spaced colonies 5 Incubate overnight at 37 C The vector PCR insert reaction should be produce hundreds of colonies Greater than 9595 of these will be blue The vector only reaction should yield very few colonies 5 of the vector PCR insert plate and these should be white pUC19 plasmid is included to check the transformation efficiency of the One Shot TOP10 or Mach1 T1 competent cells Transform one vial of One Shot TOP10 or Mach1 T1 cells with 10 pg of pUC19 using the protocol on page 12 Plate 10 ul of the transformation mixture plus 20 ul of S O C Medium on LB plates containing 100 ug ml ampicillin Transformation efficiency should be gt 1x 10 cfu ug DNA Gel Purifying PCR Products Introduction Using the PureLink Quick Gel Extraction Kit Smearing multiple banding primer dimer artifacts or large PCR products gt 3 kb may necessitate gel purification If you wish to purify your PCR product be extremely careful to remove all sources of nuclease contamination There are many protocols to isolate DNA fragme
23. ble protocol page 13 Note This procedure is less efficient the total number of transformants obtained may be lower than that obtained with the regular chemical transformation protocol In addition to general microbiological supplies i e plates spreaders you will need the following reagents and equipment e TOPO Cloning reaction from Step 2 previous page e One Shot TOP10 or Mach1 T1 chemically competent E coli supplied with the kit Box 2 e S O C Medium included with the kit Box 2 e pUC19 positive control to verify transformation efficiency if desired Box 2 e 42 C water bath or electroporator with cuvettes optional e 15 ml sterile snap cap plastic culture tubes for electroporation only e LB plates containing 100 ug ml spectinomycin two for each transformation see page 26 for a recipe to prepare spectinomycin e LB plates containing 100 ug ml ampicillin if transforming pUC19 control e 37 C shaking and non shaking incubator There is no blue white screening for the presence of inserts Most transformants will contain recombinant plasmids with the PCR product of interest cloned into the vector The GW1 and GW2 primers are included in the kit to allow you to sequence across an insert in the TOPO Cloning site to confirm orientation and reading frame continued on next page 11 Transforming One Shot Competent E coli continued Preparing for Transformation Important
24. cin 2 Isolate a single colony and inoculate into 1 2 ml of LB containing 100 ug ml spectinomycin 3 Grow until culture reaches stationary phase Mix 0 85 ml of culture with 0 15 ml of sterile glycerol and transfer to a cryovial 5 Store at 80 C Guidelines to Perform the LR Recombination Reaction Introduction Important Destination Vectors E coli Host Once you have obtained your entry clone you may e Perform an LR recombination reaction using Gateway LR Clonase II enzyme mix see page x for ordering information to transfer your gene of interest from the pCR 8 GW TOPO construct into any Gateway destination vector of choice to generate an expression clone e Performa MultiSite Gateway LR recombination reaction with 5 and 3 entry clones the appropriate MultiSite Gateway destination vector and LR Clonase Plus enzyme mix see page x for ordering information to generate an expression clone General guidelines are provided below For most applications we recommend performing the LR recombination reaction or the MultiSite Gateway LR recombination reaction using e Supercoiled entry clone s e Supercoiled destination vector A large selection of Gateway destination vectors is available from Invitrogen to facilitate expression of your gene of interest in virtually any protein expression system For more information about the vectors available see our Web site www invitrogen com o
25. duct e Thermocycler e DNA template and primers to produce the PCR product You may use a polymerase mixture containing Taq polymerase and a proofreading polymerase to produce your PCR product however the mixture must contain a ratio of Taq polymerase proofreading polymerase in excess of 10 1 to ensure the presence of 3 A overhangs on the PCR product We recommend using Platinum Tag DNA Polymerase High Fidelity available from Invitrogen see page x for ordering information If you use polymerase mixtures that do not have enough Taq polymerase or a proofreading polymerase only you may add 3 A overhangs to your PCR product using the method on page 23 1 Setup the following 50 ul PCR reaction Use less DNA if you are using plasmid DNA as a template and more DNA if you are using genomic DNA as a template Use the cycling parameters suitable for your primers and template Be sure to include a 7 to 30 minute extension at 72 C after the last cycle to ensure that all PCR products are full length and 3 adenylated DNA Template 10 100 ng 10X PCR Buffer 5 ul dNTP Mix 50 mM 0 5 ul PCR primers 100 200 ng each 1 uM each Water add to a final volume of 49 ul Tag Polymerase 1 U ul 1ul Total volume 50 ul 2 Use agarose gel electrophoresis to verify the quality of your PCR product You should see a single discrete band of the correct size If you do not see a single band refer to the Note on the next page continued on ne
26. eaction can be varied from 30 seconds to 30 minutes For routine subcloning of PCR products 30 seconds may be sufficient For large PCR products gt 1 kb or if you are TOPO Cloning a pool of PCR products increasing the reaction time may yield more colonies Place the reaction on ice and proceed to Transforming One Shot Competent E coli next page Note You may store the TOPO Cloning reaction at 20 C overnight Transforming One Shot Competent E coli Introduction Selecting a One Shot Chemical Transformation Protocol Materials Needed Note Once you have performed the TOPO Cloning reaction you will transform your pCR 8 GW TOPO construct into competent E coli One Shot TOP10 or Mach1 T1 Chemically Competent E coli Box 2 are included with the kit to facilitate transformation You may also transform electrocompetent cells if desired see page x for ordering information Protocols to transform chemically competent or electrocompetent E coli are provided in this section Two protocols are provided to transform One Shot TOP10 or Mach1 T1 chemically competent E coli Consider the following factors and choose the protocol that best suits your needs If you wish to Then use the maximize the number of transformants regular chemical transformation clone large PCR products gt 1000 bp protocol page 12 obtain transformants as quickly as rapid chemical transformation possi
27. ed from sample reaction and the transformation control gave no colonies One Shot competent E coli stored incorrectly Store One Shot competent E coli at 80 C If you are using another E coli strain follow the manufacturer s instructions Did not perform the 1 hour grow out period before plating the transformation mixture After the heat shock step add S O C Medium and incubate the transformation mixture for 1 hour at 37 C before plating Insufficient amount of E coli plated Increase the amount of E coli plated Transformants plated on selective plates containing the wrong antibiotic Use the appropriate antibiotic for selection Appendix Performing the Control Reactions Introduction Before Starting Producing the Control PCR Product We recommend performing the following control TOPO Cloning reactions the first time you use the kit to help you evaluate your results Performing the control reactions involves producing a control PCR product containing the lac promoter and the LacZa fragment using the reagents included in the kit Successful TOPO Cloning of the control PCR product in either direction will yield blue colonies on LB agar plates containing spectinomycin and X gal For each transformation prepare two LB plates containing 100 ug ml spectinomycin and X gal see page 26 for recipes Use the procedure below to produce the 500 bp control PCR product
28. esized PCR product from ligating into the pCR 8 GW TOPO vector continued on next page Designing PCR Primers continued TOPO Cloning Use the diagram below to help you design PCR primers and produce your PCR Site for product for TOPO Cloning into pCR 8 GW TOPO pCR 8 GW TOPO Features of the TOPO Cloning Region e Restriction sites are labeled to indicate the actual cleavage site e The primer binding sites for the GW1 and GW2 primers included with the kit are labeled The nucleotides that were mutated in the attL2 site to facilitate sequencing using the GW2 primer are underlined e The shaded region corresponds to the DNA sequences that will be transferred from the clone into the Gateway destination vector following LR recombination e If you plan to fuse your PCR product in frame with an N or C terminal tag after recombination with a destination vector remember to keep the translation reading frame of the fusion protein in frame with the triplets indicated in bold as appropriate The sequence of pCR 8 GW TOPO is available for downloading from our Web site www invitrogen com or by contacting Technical Service page 27 For more information about pCR 8 GW TOPO see pages 24 25 M13 forward 20 priming site f 1 501 TAACGCTAGC ATGGATGTTT TCCCAGTCAC GACGTTGTAA AACGACGGCC AGTCTTAAGC TCGGGCCCCA AATAATGATT attL 1 GW1 priming site 581 TTATTTTGAC TGATAGTGAC CTGTTCGTTG CAACAAATTG ATG
29. h to Molecular Cloning and Polynucleotide Synthesis Using Vaccinia DNA Topoisomerase J Biol Chem 269 32678 32684 Shuman S 1991 Recombination Mediated by Vaccinia Virus DNA Topoisomerase I in Escherichia coli is Sequence Specific Proc Natl Acad Sci USA 88 10104 10108 02003 2006 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 32 invitrogen Corporate Headquarters Invitrogen Corporation 1600 Faraday Avenue Carlsbad CA 92008 T 1 760 603 7200 F 1760 602 6500 E tech service invitrogen com For country specific contact information visit our web site at www invitrogen com
30. ient number of PCR products will retain the 3 A overhangs 2 Incubate at 72 C for 8 10 minutes do not cycle 3 Place on ice and use immediately in the TOPO Cloning reaction Note If you plan to store your sample overnight before proceeding with TOPO Cloning extract your sample with an equal volume of phenol chloroform to remove the polymerases Ethanol precipitate the DNA and resuspend in TE buffer using the starting volume of the PCR You may also gel purify your PCR product after amplification with a proofreading polymerase After purification add Tag polymerase buffer dATP and 0 5 unit of Tag polymerase Incubate the reaction for 10 15 minutes at 72 C and use in the TOPO Cloning reaction Note 23 Map and Features of pCR 8 GW TOPO pCR 8 GW TOPO The figure below shows the features of the pCR 8 GW TOPO vector The Map complete sequence of pCR 8 GW TOPO is available for downloading from our Web site www invitrogen com or by contacting Technical Service see page 27 Comments for pCR 8 GW TOPO 2817 nucleotides rrnB T2 transcription termination sequence bases 268 295 rrnB T1 transcription termination sequence bases 427 470 M13 forward 20 priming site bases 537 552 attL1 bases 569 668 GW1 priming site bases 607 631 TOPO recognition site 1 bases 678 682 TOPO recognition site 2 bases 683 687 attL2 bases 696 795 GW2 priming site bases 733 757 T7 Promoter priming site 812
31. in termination technique One Shot TOP10 and Mach1 T1 chemically competent cells are tested for transformation efficiency using the control plasmid included in the kit Transformed cultures are plated on LB plates containing 100 ug ml ampicillin and the transformation efficiency is calculated Test transformations are performed in duplicate Transformation efficiency should be greater than 1x10 cfu ug plasmid DNA In addition untransformed cells are tested for the appropriate antibiotic sensitivity and lack of phage contamination 31 References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Brownstein M J Carpten J D and Smith J R 1996 Modulation of Non Templated Nucleotide Addition by Tag DNA Polymerase Primer Modifications that Facilitate Genotyping BioTechniques 20 1004 1010 Innis M A Gelfand D H Sninsky J J and White T S 1990 PCR Protocols A Guide to Methods and Applications Academic Press San Diego CA Landy A 1989 Dynamic Structural and Regulatory Aspects of Lambda Site specific Recombination Ann Rev Biochem 58 913 949 Liebert C A Watson A L and Summers A O 1999 Transposon Tn21 Flagship of the Floating Genome Microbiol Mol Biol Rev 63 507 522 Shuman S 1994 Novel Approac
32. itrogen com msds Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Service Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential
33. ize Store the stock solution at 4 C for up to 2 weeks For long term storage store at 20 C 1 Dissolve 400 mg of X gal in 10 ml dimethylformamide to prepare a 40 mg ml stock solution 2 Store at 20 C protected from light Technical Service Web Resources Visit the Invitrogen Web site at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAOs formulations citations handbooks etc e Complete technical service contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our Web page www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 1600 Faraday Avenue LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech_service invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com MSDSs Limited Warranty MSDSs Material Safety Data Sheets are available on our website at www inv
34. lied in this section is intended to provide clarity concerning Invitrogen s policy for the use and distribution of cloned nucleic acid fragments including open reading frames created using Invitrogen s commercially available Gateway Technology Invitrogen understands that Gateway entry clones containing attL1 and attL2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by non profit organizations and by for profit organizations without royalty payment to Invitrogen Invitrogen also understands that Gateway expression clones containing attB1 and attB2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by academic and government organizations without royalty payment to Invitrogen Organizations other than academia and government may also distribute such Gateway expression clones for a nominal fee 10 per clone payable to Invitrogen We would ask that such distributors of Gateway entry and expression clones indicate that such clones may be used only for research purposes that such clones incorporate the Gateway Technology and that the purchase of Gateway Clonase from Invitrogen is required for carrying out the Gateway recombinational cloning reaction This sh
35. loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 27 Purchaser Notification Introduction Information for European Customers Limited Use Label License No 5 Invitrogen Technology 28 Use of the pCR 8 GW TOPO TA Cloning Kit is covered under the licenses detailed below The Mach1 T18 E coli strain is genetically modified to carry the lacZAM15 hsdR lacX74 recA endA tonA genotype As a condition of sale use of this product must be in accordance with all applicable local legislation and guidelines including EC Directive 90 219 EEC on the contained use of genetically modified organisms The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any
36. ne with a Gateway destination vector remember to design your PCR primers such that your PCR product will be in frame with the appropriate tag see Tips below Make sure that the PCR product includes or lacks a Kozak consensus sequence or stop codon as appropriate to permit proper expression of your recombinant protein Note that the first three base pairs of the PCR product will constitute a functional codon Use the diagram on the next page to help you design your PCR primers and your PCR strategy If you wish to fuse your PCR product to an N or C terminal tag after recombination of your entry clone with a destination vector use the tips below as appropriate to design your forward or reverse PCR primer Tip 1 To fuse your PCR product in frame with an N terminal tag after recombination of your entry clone with a destination vector keep the AAA AAA triplets in the attL1 site in frame with the translation reading frame of the fusion protein see bolded nucleotides in the diagram on the next page Tip 2 To fuse your PCR product in frame with a C terminal tag after recombination of your entry clone with a destination vector keep the TTT GTA TAC AAA on the complementary strand triplets in the attL2 site in frame with the translation reading frame of the fusion protein see bolded nucleotides in the diagram on the next page When synthesizing PCR primers do not add 5 phosphates to the primers as this will prevent the synth
37. ng the TOPO Cloning site You may use EcoR I digestion to check for the presence of inserts if desired Once you have identified the correct clone s you may sequence your construct to confirm that your gene is cloned in the correct orientation The GW1 and GW2 primers are included in the kit to help you sequence your insert see the diagrams on page 6 for the location of the priming sites in pCR 8 GW TOPO vector For the complete sequence of the pCR 8 GW TOPO vector see our Web site www invitrogen com or call Technical Service see page 27 The GW1 and GW2 primer sites are located less than 55 nucleotides from the PCR product insertion site and fall within the attL1 and attL2 sites respectively of pCR 8 GW TOPO Although Invitrogen offers other Gateway entry vectors containing attL1 and attL2 sites the GW1 and GW2 primers are only suitable for use in sequencing inserts cloned into pCR 8 GW TOPO This is because three nucleotides within the attL2 site in pCR 8 GW TOPO have been mutated see the diagram on page 6 for details These mutations allow GW1 and GW2 primer based sequencing but do not affect the LR recombination efficiency Once you have identified the correct clone be sure to purify the colony and make a glycerol stock for long term storage We recommend that you store a stock of plasmid DNA at 20 C 1 Streak the original colony out for single colonies on an LB plate containing 100 ug ml spectinomy
38. nts or remove oligonucleotides Refer to Current Protocols in Molecular Biology Unit 2 6 Ausubel et al 1994 for the most common protocols Two simple protocols are provided below TM The PureLink Quick Gel Extraction Kit page x allows you to rapidly purify PCR products from regular agarose gels 1 Equilibrate a water bath or heat block to 50 C 2 Cutthe area of the gel containing the desired DNA fragment using a clean sharp blade Minimize the amount of surrounding agarose excised with the fragment Weigh the gel slice 3 Add Gel Solubilization Buffer GS1 supplied in the kit as follows e For lt 2 agarose gels place up to 400 mg gel into a sterile 1 5 ml polypropylene tube Divide gel slices exceeding 400 mg among additional tubes Add 30 ul Gel Solubilization Buffer GS1 for every 10 mg of gel e For gt 2 agarose gels use sterile 5 ml polypropylene tubes and add 60 ul Gel Solubilization Buffer GS1 for every 10 mg of gel 4 Incubate the tube at 50 C for 15 minutes Mix every 3 minutes to ensure gel dissolution After gel slice appears dissolved incubate for an additional 5 minutes 5 Preheatan aliquot of TE Buffer TE to 65 70 C Place a Quick Gel Extraction Column into a Wash Tube Pipette the mixture from Step 4 above onto the column Use 1 column per 400 mg agarose 7 Centrifuge at 212 000 x g for 1 minute Discard the flow through Place the column back into the Wash Tube 8 Optional Add 500 ul
39. on ori Allows high copy replication and maintenance in E coli 25 Recipes LB Luria Bertani Medium and Plates Spectinomycin X Gal Stock Solution 26 Composition 1 0 Tryptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 Forlliter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave on liquid cycle for 20 minutes Allow solution to cool to 55 C and add antibiotic if needed 4 Store at room temperature or at 4 C LB agar plates 1 Prepare LB medium as above but add 15 g L agar before autoclaving 2 Autoclave on liquid cycle for 20 minutes 3 After autoclaving cool to 55 C add antibiotic and pour into 10 cm plates 4 Let harden then invert and store at 4 C in the dark 5 To add X gal to the plate warm the plate to 37 C Pipette 40 ul of the 40 mg ml X gal stock solution see below spread evenly and let dry for 15 minutes Protect plates from light Use this procedure to prepare a 10 mg ml stock solution of spectinomycin Materials Needed e Spectinomycin dihydrochloride Sigma Catalog no 54014 e Sterile deionized water Procedure 1 Weigh out 50 mg of spectinomycin and transfer to a sterile centrifuge tube 2 Resuspend the spectinomycin in 5 ml of sterile deionized water to produce a 10 mg ml stock solution Filter steril
40. ould allow researchers to readily identify Gateway containing clones and facilitate their use of this powerful technology in their research Use of Invitrogen s Gateway Technology including Gateway clones for purposes other than scientific research may require a license and questions concerning such commercial use should be directed to Invitrogen s licensing department at 760 603 7200 Product Qualification Introduction PCR 8 GW Vector TOPO Cloning Efficiency Primers One Shot Chemically Competent E coli This section describes the criteria used to qualify the components of the pCR 8 GW TOPO TA Cloning Kit Prior to adaptation with topoisomerase I the supercoiled pCR 8 GW vector is qualified by e Performing restriction enzyme digestion to verify its structure e Performing an LR recombination reaction with a Gateway destination vector to confirm its functionality After adaptation with topoisomerase I each lot of pCR 8 GW TOPO vector is functionally qualified using the control reagents included in the kit Under conditions described on pages 19 20 a 500 bp control PCR product is amplified TOPO Cloned into the pCR 8 GW TOPO vector and transformed into One Shot TOP10 or Mach1 T18 chemically competent E coli included with the kit Each lot of vector should yield greater than 95 cloning efficiency Primers are lot qualified by DNA sequencing experiments using the dideoxy cha
41. perties of bacteriophage lambda Landy 1989 to provide a rapid and highly efficient way to move your gene of interest into multiple vector systems To express your gene of interest using the Gateway Technology simply 1 TOPO Clone your Taq amplified PCR product into pCR 8 GW TOPO to generate an entry clone 2 Generate an expression construct by performing an LR recombination reaction between the entry clone and a Gateway destination vector of choice 3 Introduce your expression construct into the appropriate host e g bacterial mammalian yeast insect and express your recombinant protein For more information about the Gateway Technology refer to the Gateway Technology with Clonase II manual which is available for downloading from www invitrogen com or by contacting Technical Service see page 27 continued on next page Overview continued attL Sites and Sequencing MultiSite Gateway Technology Inserts cloned into most Gateway entry vectors e g PENTR D TOPO can be sequenced using M13 forward 20 and M13 reverse primers The M13 forward 20 and M13 reverse primer binding sites are located upstream and downstream of the attL1 and attL2 sites respectively requiring that at least 130 base pairs of vector encoded DNA be read before reaching the insert DNA To facilitate more efficient sequencing and to minimize the amount of vector encoded DNA that needs to be read three nucleotides within
42. r call Technical Service see page 27 Manuals supporting all of the destination vectors are available for downloading from our Web site or by contacting Technical Service Once you have performed the LR recombination reaction or the MultiSite Gateway LR recombination reaction you will transform the reaction mixture into competent E coli and select for expression clones You may use any recA endA E coli strain including TOP10 Mach1 T1 DH5a DH10B or equivalent for transformation Do not transform the Gateway or MultiSite Gateway LR reaction mixture into E coli strains that contain the F episome e g TOP10F These strains contain the ccdA gene and will prevent negative selection with the ccdB gene continued on next page 15 Guidelines to Perform the LR Recombination Reaction Performing the LR Recombination Reaction Performing the MultiSite Gateway LR Recombination Reaction 16 To perform the Gateway LR recombination reaction you will need e Purified plasmid DNA of the entry clone containing your gene of interest e A destination vector of choice e LRClonase II enzyme mix see Recommendation below and page x for ordering information e 2ug ul Proteinase K solution supplied with the LR Clonase II enzyme mix e TE Buffer pH 8 0 10 mM Tris HCl pH 8 0 1 mM EDTA e Appropriate chemically competent E coli host and growth media for expression e Appropriate selective plates For instr
43. re for greater than 5 minutes in the presence of salt can also increase the number of transformants This is in contrast to earlier experiments without salt where the number of transformants decreases as the incubation time increases beyond 5 minutes Including salt in the TOPO Cloning reaction allows for longer incubation times because it prevents topoisomerase I from rebinding and potentially nicking the DNA after ligating the PCR product and dissociating from the DNA The result is more intact molecules leading to higher transformation efficiencies You will perform TOPO Cloning in a reaction buffer containing salt i e using the stock salt solution provided in the kit Note that the amount of salt added to the TOPO Cloning reaction varies depending on whether you plan to transform chemically competent cells provided or electrocompetent cells see page x for ordering information e If you are transforming chemically competent E coli use the stock Salt Solution as supplied and set up the TOPO Cloning reaction as directed on the next page e If you are transforming electrocompetent E coli the amount of salt in the TOPO Cloning reaction must be reduced to 50 mM NaCl 2 5 mM MgCl to prevent arcing during electroporation Dilute the stock Salt Solution 4 fold with water to prepare a 300 mM NaCl 15 mM MgCl Dilute Salt Solution Use the Dilute Salt Solution to set up the TOPO Cloning reaction as directed on the next page
44. smid in E coli continued on next page Overview continued How Topoisomerase I Works The Gateway Technology The pCR 8 GW TOPO vector is supplied linearized with e Single3 thymidine T overhangs for TA Cloning e Topoisomerase I covalently bound to the vector referred to as activated vector Taq polymerase has a non template dependent terminal transferase activity that adds a single deoxyadenosine A to the 3 ends of PCR products The linearized vector supplied in this kit has single overhanging 3 deoxythymidine T residues This allows PCR inserts to ligate efficiently with the vector Topoisomerase I from Vaccinia virus binds to duplex DNA at specific sites CCCTT and cleaves the phosphodiester backbone in one strand Shuman 1991 The energy from the broken phosphodiester backbone is conserved by formation of a covalent bond between the 3 phosphate of the cleaved strand and a tyrosyl residue Tyr 274 of topoisomerase I The phospho tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5 hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase Shuman 1994 TOPO Cloning exploits this reaction to efficiently clone PCR products Topoisomerase dm e CCCTT PYAGGG GGGAPI PCR Product rece HO 9 adi Topoisomerase The Gateway Technology is a universal cloning method that takes advantage of the site specific recombination pro
45. sold for use in research Invitrogen Corporation will not assert a claim against the buyer of infringement of the above patents based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that none of i this product ii any of its components or iii a method claim of the foregoing patents was used in the manufacture of such product Invitrogen Corporation will not assert a claim against the buyer of infringement of the above patents based upon the use of this product to manufacture a protein for sale provided that no method claim in the above patents was used in the manufacture of such protein If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to use this product for purposes other than those permitted above contact Licensing Department Invitrogen Corp 1600 Faraday Avenue Carlsbad CA 92008 Phone 760 603 7200 For additional information about Invitrogen s policy for the use and distribution of Gateway clones see Gateway Clone Distribution Policy next page 29 Gateway Clone Distribution Policy Introduction Gateway Entry Clones Gateway Expression Clones Additional Terms and Conditions 30 The information supp
46. the employment of this product or its components to a third party or otherwise use this product or its components or materials made by the employment of this product or its components for Commercial Purposes The buyer may transfer information or materials made through the employment of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Notwithstanding the preceding any buyer who is employed in an academic or government institution may transfer materials made with this product to a third party who has a license from Invitrogen under the patents identified above to distribute such materials Transfer of such materials and or information to collaborators does not convey rights to practice any methods claimed in the foregoing patents or patent applications Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are re
47. tor Construction Kit manual which is available for downloading from our Web site or by contacting Technical Service Experimental Outline Flow Chart The flow chart below describes the general steps required to produce and TOPO Clone your Tag amplified PCR product Produce your PCR product TOPO Cloning Reaction Mix together PCR product and pCR 8 GW TOPO vector at room temperature Transform into competent E coli cells Select and analyze colonies Incubate 5 minutes Choose a positive transformant and isolate plasmid DNA Proceed to the LR recombination reaction with a Gateway destination vector Methods Designing PCR Primers Introduction Factors to Consider Tips Important Before you may use the pCR 8 GW TOPO TA Cloning Kit you must first design PCR primers and produce your PCR product Guidelines are provided in this section to help you design PCR primers It is important to properly design your PCR primers to ensure that you obtain the PCR product you need for your studies Consider the following when designing your PCR primers If you plan to transfer your PCR product into a Gateway destination vector for downstream expression studies remember to include the sequences required for proper translation initiation and termination of your PCR product If you wish to fuse your PCR product to an N or C terminal tag after recombination of your entry clo
48. uctions to perform the LR recombination reaction refer to the LR Clonase II Enzyme Mix manual or to the manual for the destination vector you are using To catalyze the LR recombination reaction we recommend using Gateway LR Clonase II Enzyme Mix The LR Clonase II enzyme mix combines the proprietary enzyme formulation and 5X LR Reaction Buffer previously supplied by Invitrogen as separate components in LR Clonase enzyme mix Catalog no 11791 019 into an optimized single tube format for easier set up of the LR recombination reaction Note You may perform the LR recombination reaction using LR Clonase enzyme mix if desired Follow the instructions included with the product to perform the LR recombination reaction Before you can perform the MultiSite Gateway LR recombination reaction you will first need to generate 5 and 3 entry clones using Invitrogen s MultiSite Gateway Three Fragment Vector Construction Kit Catalog no 12537 023 Once you have generated the 5 and 3 entry clones you will use the 5 and 3 entry clones the entry clone containing your gene of interest and the other reagents supplied in the MultiSite Gateway Three Fragment Vector Construction Kit including LR Clonase Plus enzyme mix and the pDEST R4 R3 destination vector in a MultiSite Gateway LR recombination reaction to generate an expression clone For instructions to generate 5 and 3 entry clones and to perform the
49. ureLink Quick Plasmid Miniprep Kit Box 3 supplied with cat no K2520 02 refer to the manual supplied with the miniprep kit ix Accessory Products Introduction The products listed in this section may be used with the pCR 8 GW TOPO TA Cloning Kit For more information refer to our Web site www invitrogen com or call Technical Service see page 27 Additional Some of the reagents supplied in the pCR 8 GW TOPO TA Cloning Kit and Products other reagents suitable for use with the kits are available separately from Invitrogen Ordering information for these reagents is provided below Note Other reagent quantities may be available Item Quantity Catalog no Platinum Tag DNA Polymerase 100 reactions 10966 018 250 reactions 10966 026 500 reactions 10966 034 Taq DNA Polymerase Recombinant 100 units 10342 053 250 units 10342 012 500 units 10342 020 Platinum Tag DNA Polymerase High 100 units 11304 011 Fidelity 500 units 11304 029 One Shot TOP10 Chemically Competent 10 reactions C4040 10 E coli 20 reactions C4040 03 One Shot TOP10 Electrocompetent E coli 10 reactions C4040 50 One Shot Mach1 T1 Chemically 20 reactions C8620 03 Competent E coli LB Broth 500 ml 10855 021 LB Agar 500 g 22700 025 PureLink Quick Plasmid Miniprep Kit 50 reactions K2100 10 PureLink Quick Gel Extraction Kit 50 reactions K2100 12 Gateway LR Clonase II Enzyme Mix
50. viii Primer Sequence pmoles Supplied GW1 5 GTTGCAACAAATTGATGAGCAATGC 3 260 GW2 5 GTTGCAACAAATTGATGAGCAATTA 3 260 continued on next page Kit Contents and Storage continued One Shot Reagents Genotype of E coli Strains Information for Non U S Customers Using Mach1 T1 Cells PureLink Quick Plasmid Miniprep Kit The following reagents are included with the One Shot TOP10 or Mach1 T1 Chemically Competent E coli kit Box 2 Transformation efficiency is 2 1 x 10 cfu ug plasmid DNA Store Box 2 at 80 C 0 5 mM EDTA pH 8 Reagent Composition Amount S O C Medium 2 Tryptone 6ml may be stored at room 0 5 Yeast Extract temperature or 4 C 10 mM NaCl 25mMKCI 10 mM MgCb 10 mM MgSO 20 mM glucose TOP10 or Mach1 T1Fcells 21x50 ul pUC19 Control DNA 10 pg ul in 5 mM Tris HCl 50 ul TOP10 F mcrA A mrr hsdRMS mcrBC 80lacZAM15 AlacX74 recA1 araD139 A ara leu 7697 galU galK rpsL StrF endA1 nupG Mach1 T18 F 80lacZAM15 AlacX74 hsdR rc m ArecA1398 end A1 ton A confers resistance to phage T1 The parental strain of Mach1 T1 E coli is the non K 12 wild type W strain ATCC 9637 S A Waksman Although the parental strain is generally classified as Biosafety Level 1 BL 1 we recommend that you consult the safety department of your institution to verify the Biosafety Level For kit components of the P
51. xt page Producing PCR Products continued Note If you do not obtain a single discrete band from your PCR try the following Optimize your PCR to eliminate multiple bands and smearing Innis et al 1990 The PCR Optimizer Kit available from Invitrogen Catalog no K1220 01 incorporates many of the recommendations found in this reference For more information refer to our Web site www invitrogen com or contact Technical Service see page 27 Gel purify your fragment using one of the methods on pages 21 22 Take special care to avoid sources of nuclease contamination Setting Up the TOPO Cloning Reaction Introduction Note Using Salt Solution in the TOPO Cloning Reaction Once you have produced the desired PCR product you are ready to TOPO Clone it into the pCR 8 GW TOPO vector and transform the recombinant vector into One Shot competent E coli You should have everything you need set up and ready to use to ensure that you obtain the best possible results We suggest that you read this section and the section entitled Transforming One Shot Competent F coli pages 11 13 before beginning If this is the first time you have TOPO Cloned perform the control reactions on pages 19 20 in parallel with your samples We have found that including salt 200 mM NaCl 10 mM MgCl in the TOPO Cloning reaction can increase the number of transformants 2 to 3 fold In addition incubating the reaction mixtu
Download Pdf Manuals
Related Search
8/GW/TOPO 8 g to oz 8 g to ounces