PrecisionX Cas9 SmartNuclease User Manual
Contents
1. MSC cat WCAS960A SK CARBCASSBEDA 1 Target sequence to cleave f Your guide RNA sequence hspCas9 Gene tracrRNA promoter built into vectors Fig 2 RNA directed Cas9 SmartNuclease Expression Vector Cat CAS9xxA 1 Promoter Promoter Choice Choice myc tag myc tag Cas9 ti Cas9 SmartNickase NullNuclease su All in one sw All in one Vectors Vectors gRNA Scaffold hspCas9 Double Mutant J hspCas9 Nickase H1 H1 promoter promoter WPRE WPRE NLS NLS Fig 3 RNA directed Cas9 SmartNickase and Double Mutant NullNuclease Expression Vectors Cat CAS8xxA 1 C Validation Data for the Cas9 SmartNuclease System targeting the Human AAVS1 Locus Since the CRISPR Cas9 Nuclease system is relatively new and its efficacy has not yet been characterized to the extent of other competing technologies we have compared head to head against TALENs targeting the well established human AAVS1 locus The TALEN pair pZT AAVS1 L1 R1 SBI cat no GE601A 1 has been previously validated by Dr Jizhong Zou of the NIH for cleavage activity and HDR efficiency with rates of 25 for cleavage and Page 4 ver 3 11032014 www systembio com PrecisionX Cas9 SmartNuclease System Cat CAS8 9xxA 1 8 1 for HDR in 293T cells Using our Cas9 SmartNuclease Expression System EF 1a version Fig 4A we cloned in a guide RNA sequence per Mali et a and compared its efficacy of cleavage and HDR eff2. Cas9 SmartNuclease vector 0 5 ug and HR donor vector 0 5 ug for HDR applications Fig 5 We have also used a 1 1 5 ratio in 293T cells with good results In general we suggest optimizing the amounts and ratios of Cas9 SmartNuclease and donor vectors for optimal results in a target cell line 3 Allow at least 12 hours before changing transfection media to complete growth media 4 Assay for cleavage activity using Surveyor Nuclease mutation characterization by genotyping analysis or HDR activity if using donor vector in parallel 48 72 hours after transfection 5 If assaying for HDR of donor vector select cells with targeted insertion of donor vector using FACS based sorting of fluorescent marker or antibiotic selection e g Puro Neo using a suitable concentration of antibiotics for the targeted cell line lll Frequently Asked Questions Q How many guide RNA constructs do you have to design to target a DNA sequence of interest Due to the unpredictable efficacy of a particular guide RNA construct for optimal results we suggest designing multiple 2 or more constructs targeting a particular DNA sequence of interest By designing several constructs following the simple design rules outlined in Section Il B and C one has increased chances of finding a construct s to cleave target DNA with the highest efficiency Q We designed a guide RNA construct to transfect into target cells and there is no evidence of activity What are th
3. Target DNA Sequence 17 C Design of Guide RNA Oligonucleotides 0 ceeeee 18 D Cloning into the Cas9 SmartNuclease Vector 008 19 E Transfection of the Cas9 SmartNuclease Construct into Target Cells21 Ill Frequently Asked Questions eccceeeeeeeteeeeeeeseaeeeeaeeeenees 22 IV References tient stag tating alates 24 V Technical SUpport iseset aine entane aerie etana airna eenia 15 VII Licensing and Warranty information cccceseeeeeees 15 Introduction A Overview of CRISPR system In the past decade a great deal of progress has been made in the field of targeted genome engineering Technologies such as designer zinc finger nucleases ZFNs transcriptional activator like effector nucleases TALENs and homing meganucleases have made site specific genome modifications a reality in many different model organisms ranging from zebrafish to mammalian cells Based on the results to date however genome editing tools that are efficient flexible and cost effective have remained elusive to the general research community The recent discovery of the type Il prokaryotic CRISPR Clustered Regularly Interspaced Short Palindromic Repeats system originally discovered in the bacterium Streptococcus pyogenes as a mechanism to defend against viruses and foreign DNA has provided yet another tool for targeted genome engineering this time taking advantage of a 888 266 5066 Toll Free 650 968 2200 outside US Pag
4. adjacent motif PAM is present immediately downstream of the protospacer sequence whose canonical sequence in S pyogenes is 5 NGG 3 where N refers to any nucleotide Streptococcus pyogenes native type II CRISPR locus Direct repeats tracrRNA i x Y y l Cas9 Casi Cas2 Csn2 K a 4 Pre crRNA expression Pre crRNA _ AN__ 4 _Y SS SS SS eS 4 crRNA Processing by RNaselll and other enzymes DNA Double stranded Target DNA Cleavage Recognition Mediated by Cas9 Target Genomic Protospacer AN Mature crRNA tracrRNA Figure 1 Overview of the CRISPR system Figure adapted from Cong et al Multiplex Genome Engineering Using CRISPR Cas Systems Recently it has been demonstrated that the expression of a single chimeric crRNA tracrRNA transcript which normally is expressed as two different RNAs in the native type II CRISPR system is sufficient to direct the Cas9 nuclease to sequence specifically cleave target DNA sequences By adapting the endogenous type II CRISPR Cas system in S pyogenes for utility in mammalian cells several groups have independently shown that RNA guided Cas9 is able to efficiently introduce precise double stranded breaks at endogenous genomic loci in mammalian cells with high efficiencies and minimal off target effects Cong et al 2013 Mali et al 2013 Cho et al 2013 In addition several mutant forms of Cas9 nuclease have been developed to take advantage of their features for add
5. cultured cells on a pre warmed LB plate containing 50 ug ml Kanamycin and incubate overnight at 37 C Confirmation of Positive Clones Pick 1 to 2 colonies grow in LB Kanamycin medium overnight at 37 C with shaking Next day miniprep plasmid DNAs and send for sequencing using the provided sequencing primer Note Primer provided is ready to use concentrated at 5 uM simply use 1 ul per reaction Page 12 ver 3 11032014 www systembio com PrecisionX Cas9 SmartNuclease System Cat CAS8 9xxA 1 c Align your raw sequencing data with the top strand primer sequence E Transfection of the Cas9 SmartNuclease Construct into Target Cells 1 Plate 100 000 to 200 000 of target cells e g 293T cells into a single well of a 12 well plate in 1 ml of appropriate growth medium Include a single well of cells as negative control which can be non relevant plasmid DNA or linearized Cas9 SmartNuclease plasmid DNA 2 Next day or when cells are 50 60 confluent transfect target cells with the Cas9 SmartNuclease vector and donor vector if HDR is desired using a suitable transfection reagent following the manufacturer s recommended protocol for 6 well plates The use of reduced or serum free media containing no antibiotics to dilute the vector transfection complex is highly recommended Note For 293T cells we transfected 0 5 ug of the Cas9 SmartNuclease vector into cells for cleavage of target luciferase gene Fig 4A B and used a 1 1 ratio of
6. fitness of the Product for a particular purpose SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2013 System Biosciences SBI All Rights Reserved Page 16 ver 3 11032014 www systembio com
7. 0bp Wms E 20 00 oa Sas v 000 N Luc Luc 1008p Control gRNA1 gRNA2 Fig 7 Validation data showing cleavage efficiency of guide RNAs targeting Luciferase via A Luciferase assays and B Surveyor Nuclease Assays EF1 hspCas9 EF1 hspCas9 H1 Luc gRNA1 H1 Luc gRNA2 HR Donor HR Donor HR Donor Alone Control Phase RFP Fig 8 Homologous recombination efficiencies of RFP donor vector using Luc gRNA directed Cas9 SmartNuclease system to target Luciferase to RFP recombination 10X magnification E Validation Data for the Cas9 SmartNickase and NullNuclease Vectors 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual We have validated the activity of the Cas9 Nickase and Null Nuclease Double Mutant for inducing NHEJ compared to wild type Cas9 nuclease using a validated guide RNA targeting the human AAVS1 locus Section I C The results from the Surveyor Nuclease Assay Fig 9 indicates no detectable NHEJ induced mutations Surveyor Nuclease Assays 1 2 3 4 5 o 1 DNA marker 2 EF1 hspCas H1 AAVS gRNA 3 EF1 hspCas9 Nickase H1 AAVS gRNA 4 EF1 hspCas9 DM H1 AAVS gRNA 5 Negative control EGIP cell Fig 9 Surveyor nuclease assay results comparing wild type Cas9 with nickase and double mutant versions of Cas9 F Key Advantages of the Cas9 SmartNuclease System Each kit provides enough materials for 10 reactions to generate your own Cas9 S
8. For information concerning licenses for commercial use contact SBI Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein Limited Warranty SBI warrants that the Product meets the specifications described in this manual If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with a credit This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a credit limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or
9. M NaCl 1mM EDTA and set up the annealing reaction as follows Materials Amount 10uM Top strand oligo 5 ul 10uM Bottom strand oligo 5 ul Total volume 10 ul Incubate reaction mixture at 95 C for 5 minutes can be done in PCR machine Remove the tube and leave it on bench at room temperature to cool down to RT Alternatively you can set a thermocycler program to cool down the oligos at a rate of 1 C min will take 40min to 60min to complete Ligation of Oligo Duplex into Vector Since the tubes might be placed upside down during the shipping and some of reagents may end up at the top of tubes we recommend a brief spin to bring all the reagents down to the bottom of tubes before opening the tubes oaoop 4 Set up the ligation reaction as follows Materials Amounts Linearized vector 1 ul Annealed oligo mix 3 ul Mix reaction well and incubate for 5 7 minutes at room temperature If you are making several constructs at the same time we strongly recommend adding ligase and buffer separately and individually to the linearized vector i e do not make and aliquot a pre mixture of ligase and buffer to the linearized vector Transformation Reaction Add a vial of competent cells to the ligation mix Place cells on ice for 15 minutes Heatshock cells at 42 C for 50 seconds then immediately transfer cells to ice for 2 minutes Add 250 ul SOC medium and incubate at 37 C for 1 hour with shaking Spread 100 ul of
10. SSB System Biosciences PrecisionX Cas9 SmartNuclease Vector System Catalog s CAS8 9xx series User Manual Store at 20 C upon receipt A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement ver 311032014 contained in this user manual PrecisionX Cas9 SmartNuclease System Cat CAS8 9xxA 1 Contents kr IMtFOCUCTION cecce eiii yeni avec ive a 1 A Overview of CRISPR SySteMm cccccececeeeeeeeeeeeeteeeeneeeeees 1 B Product Information and Vector Map ccccccsseeeseeeeeees 3 C Validation Data for the Cas9 SmartNuclease System targeting the Human AAVS1 Locus 4 D Validation Data for the Cas9 SmartNuclease Expression System Targeting Luciferase Gene 10 E Validation Data for the Cas9 SmartNuclease Nickase and Null Nuclease 7 F Key Advantages of the Cas9 SmartNuclease System 8 G Applications of the Cas9 SmartNuclease Expression System 14 H List of COMPONENtS ceeceeeeeeeeeeeeeeeeeeeeeeseeeeeseaeeesaaeeeeeees 8 H Additional Materials REQuired ce eeeeeesseeeeeenaeeeeeeaes 15 ly Related Products ssi ereet ie ite ctiatieeevethdertevdend vents 15 J Shipping and Storage Conditions for Kit cece 9 Il Protocol for the Cas9 SmartNuclease Expression System 9 A Quick Overview of the Protocol 0 ccccesceeeeeeeesteeeeneeeeees 9 B Selection of
11. TAOTTOAACTTTTTCACCOTOOCTCAOCCACGAAAAAAA 5 4 6 Transfection 4 7 Perform surveyor assays Fig 10 General Workflow for RNA Guided Cas9 SmartNuclease Expression System B Selection of Target DNA Sequence The selection of the target DNA sequence is not limited by any constraints with exception of a PAM sequence in the form of 5 NGG 3 where N any base immediately following the target sequence The typical length of the target sequence is 20bp as shown here 5 NNNNNNNNNNNNNNNNNNNNNGG 3 In order to enhance genome editing specificity paired gRNA with hspCas9 D10A SmartNickase CAS800A 1 CAS820A 1 CAS840A 1 can be used to generate double nicking with 5 overhang Please follow the guideline below for paired gRNA selection and design Page 10 ver 3 11032014 www systembio com PrecisionX Cas9 SmartNuclease System Cat CAS8 9xxA 1 3 PASS z ERNA 1 r Targeting site TAGCCGTAACGAATGGCAAT 5 ATCGGCATTGCTTACCGTTA CGTAAGCTTACGCGATGCAC 5 en y Cas9 D10A Nil kass ap NGG 3 Cas9 D10A Nickase X nec HH g dt 3 GEN NNTAGCCGTAACGAATGGCAAT N GCATTCGAATGCGCTACGTG i 5 CGTAAGCTTACGCGATGCAC gRNA 2 A Pec 5 overhang Choose your gRNA1 from the anti sense strand upstream of your targeting site Choose your gRNA2 from the sense strand downstream of your targeting site Fig 11 Schematic illustration of generating 5 overhang double strand DNA breaks
12. and classification of the CRISPR Cas systems Nat Rev Microbiol 2011 Jun 9 6 467 77 doi 10 1038 nrmicro2577 Epub 2011 May 9 Wiedenheft B et al RNA guided genetic silencing systems in bacteria and archaea Nature 2012 Feb 15 482 7385 331 8 doi 10 1038 nature1 0886 Jinek M et al A programmable Dual RNA guided DNA endonuclease in adaptive bacterial immunity Science 2012 Aug 17 337 6096 816 21 doi 10 1126 science 1225829 Epub 2012 Jun 28 Barrangou R RNA mediated programmable DNA cleavage Nat Biotechnol 2012 Sep 30 9 836 8 doi 10 1038 nbt 2357 Mali P et al RNA guided human genome engineering via Cas9 Science 2013 Feb 15 339 6121 823 6 doi 10 1126 science 1232033 Epub 2013 Jan 3 Cong L et al Multiplex genome engineering using CRISPR Cas systems Science 2013 Feb 15 339 6121 819 23 doi 10 1126 science 1231143 Epub 2013 Jan 3 Page 14 ver 3 11032014 www systembio com PrecisionX Cas9 SmartNuclease System Cat CAS8 9xxA 1 Jinek M et al RNA programmed genome editing in human cells Elife 2013 2 e00471 doi 10 7554 eLife 00471 Epub 2013 Jan 29 Qi LS et al Repurposing CRISPR as an RNA guided platform for sequence specific control of gene expression Cell 2013 Feb 28 152 5 1173 83 V Technical Support For more information about SBI products and to download manuals in PDF format please visit our web site http Awww systembio com For additional information or technical assistance ple
13. are several options for performing HDR of a donor vector into cells that have been targeted with the Cas9 SmartNuclease system Option 1 Design an HDR donor vector containing the region of DNA to be inserted or corrected into target cells Typically this vector contains 5 and 3 arms homologous 800bp to the desired insert correction region and may contain selection or fluorescent markers for selection of cells after HDR Option 2 SBI provides a full suite of off the shelf HDR cloning vectors containing multiple MCS for cloning in of homology arms and insert sequences as well as selectable fluorescent and antibiotic selection markers Please inquire for availability of these vectors Option 3 SBI can build a custom HR donor vector targeting any sequence of interest as part of our custom cloning services Please inquire with services AT systembio com to discuss a custom project or request a quotation IV References Carr PA Church GM Genome engineering Nat Biotechnol 2009 Dec 27 12 1151 62 doi 10 1038 nbt 1590 Bhaya D et al CRISPR Cas systems in bacteria and archaea versatile small RNAs for adaptive defense and regulation Annu Rev Genet 2011 45 273 97 doi 10 1146 annurev genet 110410 132430 Terns MP Terns RM CRISPR based adaptive immune systems Curr Opin Microbiol 14 321 2011 Curr Opin Microbiol 2011 Jun 14 3 321 7 doi 10 1016 j mib 2011 03 005 Epub 2011 Apr 29 Makarova KS et al Evolution
14. ase call or email us at System Biosciences SBI 265 North Whisman Rd Mountain View CA 94043 Phone 650 968 2200 888 266 5066 Toll Free Fax 650 968 2277 E mail General Information info systembio com Technical Support tech systembio com Ordering Information orders systembio com Vil Licensing and Warranty information Limited Use License Use of the PrecisionX Cas9 SmartNuclease Expression System i e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms The purchaser of the Product is granted a limited license to use the Product under the following terms and conditions e The Product shall be used by the purchaser for internal research purposes only The Product is expressly not designed intended or warranted for use in humans or for therapeutic or diagnostic use e The Product may not be resold modified for resale or used to manufacture commercial products without prior written consent of SBI e This Product should be used in accordance with the NIH guidelines developed for recombinant DNA and genetic research 888 266 5066 Toll Free 650 968 2200 outside US Page 15 System Biosciences SBI User Manual SBI has pending patent applications related to the Product
15. e 1 System Biosciences SBI User Manual system that uses small RNAs as guides to cleave DNA in a sequence specific manner With its ease in designing guide sequences to target specific sequences unlike ZFNs and TALENs where construct assembly can be laborious and time consuming as well as its targeting efficiency this system has the potential to be a disruptive technology in the field of genome engineering The CRISPR CRISPR associated Cas system involves 1 retention of foreign genetic material called spacers in clustered arrays in the host genome 2 expression of short guiding RNAs crRNAs from the spacers 3 binding of the crRNAs to specific portions of the foreign DNA called protospacers and 4 degradation of protospacers by CRISPR associated nucleases Cas A well characterized Type II CRISPR system has been previously described in the bacterium Streptococcus pyogenes where four genes Cas9 Cas1 Cas2 Csn1 and two non coding small RNAs pre crRNA and tracrRNA act in concert to target and degrade foreign DNA in a sequence specific manner Jinek ef al 2012 The specificity of binding to the foreign DNA is controlled by the non repetitive spacer elements in the pre crRNA which upon transcription along with the tracrRNA directs the Cas9 nuclease to the protospacer crRNA heteroduplex and induces double strand breakage DSB formation Additionally the Cas9 nuclease cuts the DNA only if a specific sequence known as protospacer
16. e possible reasons for this There are many possibilities of why a particular guide RNA does not show any measureable effects Some of the possibilities include the following 1 Poor transfection efficiency of target cells For certain cell types e g primary stem suspension cells passive transfection may not be very efficient In these cases active transfection systems e g NucleoFection may provide better results 2 Errors in guide RNA design The sequences of oligo duplexes targeting the DNA should be carefully checked to follow design rules 888 266 5066 Toll Free 650 968 2200 outside US Page 13 System Biosciences SBI User Manual 3 Mutation s in DNA sequence targeted In certain cases the DNA sequence targeted may contain mutations which affect recognition of the gRNA sequence leading to failure of cleavage It is difficult to know in advance but if it happens repeatedly it may be necessary to follow up with another gRNA sequence or perhaps sequence verifying the genomic target prior to design of gRNA constructs 4 Length of Time Before Assaying We suggest a minimum of 48 hours post transfection to begin assaying for cleavage of a DNA target however in certain cases it may be useful to wait up to 1 week to observe the full effect of cleavage Q We want to perform HDR applications using the Cas9 SmartNuclease system but we do not have the corresponding donor vectors What are our options in this case There
17. eam of PAM with the gRNA expressed under the control of a robust H1 polymerase III promoter Our programmable all in one vector format allows for highly flexible targeting of any genomic loci in the form of NaNGG Table 1 List of available all in one Cas9 SmartNuclease expression vectors Cat Description Size EF1 hspCas9 H1 gRNA linearized PASAUNA SmartNuclease vector CAS920A 1 CAG hspCas9 H1 gRNA linearized 10 rxn SmartNuclease vector CAS940A 1 CMV hspCas9 H1 gRNA linearized 10 rxn SmartNuclease vector 10 rxn 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual CAS960A 1 MSCV hspCas9 H1 gRNA linearized 10 rxn SmartNuclease vector CAS980A 1 PGK hspCas9 H1 gRNA linearized 10 rxn SmartNuclease vector Cas9 Nickase EF1 hspCas9 D10A CAS800A 1 nickase H1 gRNA linearized 10 rxn SmartNickase vector Cas9 Nickase CAG hspCas9 D10A CAS820A 1 nickase H1 gRNA linearized 10 rxn SmartNickase vector Cas9 Nickase CMV hspCas9 D10A CAS840A 1 nickase H1 gRNA linearized 10 rxn SmartNickase vector Cas9 Null Nuclease EF1 hspCas9 CAS805A 1 DM H1 gRNA linearized 10 rxn NullNuclease vector Target Genomic Locus Protospacer cuv ra sy Oe Adjacent Motif T z b PAM gt 5 m MIUI zi SmartNuclease All in one sva Vector EF la cat CAS900A 1 CAG cat CAS920A 1 CMV cat CAS940A 1
18. ector Maps To make the RNA directed Cas9 system more efficient affordable and convenient to use SBI has developed the all in one programmable PrecisionX Cas9 SmartNuclease expression system including a human codon optimized Cas9 hspCas9 and custom guide RNA gRNA consisting of a chimeric crRNA tracrRNA transcript expressed from a single construct see vector map Fig 2 SBs all in one Cas9 gRNA SmartNuclease expression constructs include the following features 1 The hspCas9 and hspCas9 mutants used in this system include two nuclear localization signals NLS at the N terminus and C terminus to ensure efficient import of the hspCas9 protein into the nucleus 2 The expression vectors also contain a Myc tag at the N terminus for ease of detection and purification of the recombinant Cas9 protein 3 To facilitate diverse applications of the system hspCas9 may be expressed from a number of different commonly utilized promoters that are active in mammalian cells See Table 1 4 The hspCas9 ORF is followed by a regulatory element called WPRE Woodchuck virus post transcriptional regulatory element to boost gene expression and stabilize the mRNA transcript To avoid reconstituting the CRISPR Cas9 RNA processing machinery a custom gRNA crRNA tracrRNA chimeric transcript can be generated from the pre cut ready to use linearized vectors through the use of annealed oligonucleotide duplexes encoding the 20bp target sequence upstr
19. gy directed event HDR by monitoring the presence of RFP signal as the luciferase gene is replaced by homologous recombination A EF 1 hspCas9 H1 Luc gRNA SmartNuclease vector NLS NLS gt LT gt ME Luc gRNA B Luciferase reporter cell line T2A Sv TS Luciferase MIE X T2A X gt gt a HR Donor J Homologous TA Recombination nce gt gt MIL HR Result Page 6 ver 3 11032014 www systembio com PrecisionX Cas9 SmartNuclease System Cat CAS8 9xxA 1 Fig 6 Design of gRNA and donor vectors targeting a luciferase gene for functional validation of the RNA directed Cas9 SmartNuclease Expression System Based on initial results we have seen a reduction up to 40 in luciferase levels Fig 7A using one of the gRNAs targeting luciferase Luc gRNA1 and 30 cleavage via the Surveyor Nuclease assay Fig 7B which illustrates the efficacy of the system To further demonstrate the utility of the system to effect homology directed recombination we show that we can obtain robust HDR efficiency compared to donor vector only when using the gRNAs expressed via the all in one SmartNuclease expression vector in conjunction with an RFP bearing donor vector to replace the stably integrated luciferase gene in a reporter cell line Fig 8 A Luciferase Assays B Surveyor Assays 120 003 1 100bp ladder D 2 EF1 hspCas9H1 LucgRNA1 100 00 Z 3 EF1 hspCas9H1 Luc gRNA2 lt 80 00 12 3 4 5 6000 5 40 00 50
20. iciency to the TALEN pair targeting a stably integrated EGIP Enhanced Green Fluorescent Inhibited Protein cell line This construct contains a stop codon in the middle of the coding region thus truncation of full length EGFP as well as a 53bp sequence from the human AAVS7 gene Fig 4B for targeting via Cas9 SmartNuclease or TALENs A EF 1 hspCas9 H1 AAVS1 gRNA SmartNuclease vector NLS NLS gt LS AN MAIL AAVSI gRNA B EGIP reporter cell line tcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaagectacgtccaggagcgcaccatcttcttcaaggacga cggcaactacaagacctaaGTCCCCTCCACCCCACAGTGGGGCCACTAGGGACAGGATTGGTGACAGAAAAG cgececce aggtgaagttcgagggcgacaccctgetgaaccgcatcgagctgaaggegcatcgacttcaaggaggacegcaacat Target X Region EGFP HR Donor Fragment y Homologous Recombination gt EGFP Restored Fig 4 A Design of the Cas9 SmartNuclease construct targeting human AAVS1 locus and B EGIP cell line for monitoring HDR efficiency of donor vector bearing EGFP fragment The Cas9 SmartNuclease with guide RNA targeting the AAVS1 Safe Harbor locus is available as Catalog CAS601A 1 For those new to Cas9 technology we recommend use of the Cas9 SmartNuclease AAVS1 Positive Control Kit Catalog CAS605A 1 which includes the CAS601A 1 vector EGIP 293T reporter line AAVS1 GFP rescue donor and primers for Surveyor assay The following data were generated using the AAVS1 targeting Cas9 SmartNuclease Cat CAS601A 1 and Positive Con
21. ides to generate a duplex 3 Clone the duplex into the provided linearized Cas9 vector by ligation reaction 4 Transform into competent cells and grow in LB Kanamycin plate 50 ug ml 5 Confirm positive clones by direct sequencing 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual 6 Transfect sequence verified all in one construct into mammalian cells using standard transfection protocols 7 Perform Surveyor Nuclease assay or other suitable mismatch cleavage assays to check the site specific genome cleavage or perform homology recombination assays for genome modification using a suitable donor vecior 20bp target sequence PAM 5 NNNNNNNNNNNNNNNNNNNNNGG 3 4 1 Design of two oligos encoding target sequence General form of target sequence STGTATGAGACCACNN NN NNNNNN NNN NNN NNN N3 FACTCTGGTGNNNNNNNNNNNNNNNNNNNNNNNCAAA 5 2 Anneal the two oligos 5 TGTATGAGACCAC NNNNNNNNNNNNNNNNNNNN 3 3 ACTCTGGTG NNNNNNNNNNNNNNNNNNNNCAAA S 4 3 Ligation TAOCAROTPARAATAAGOCTASTOCOPTATCAACTTGAAARAOTOSCACCGRGTCOSTUCTIITIT Y ATCTOGATCTTTATCOTTCAATTTTATPOOGATCAGOCAATAOTTOAACTTTTTCACOOTOOCTCAGOCAOJAAAAAAA 5 Chimeric gRNA Scaffold Cas9 H1 Vector 4 4 Transformation 4 5 Sequencing Custom gRNA s TITTET NNN NNNNNNNNNNNNNNNOTTTTAGAGCTAGAAATAOCAAOTTAAAATAAGOCTAGTCCOTTATCAACTTGAAAAAGTOOCACCOAGTCOGTOCTTTTTT V INNNNNNCAAAATCTCGATCTTTATCOTTCAATTTTATTCCOATCAGOCAA
22. itional applications in genome engineering and transcriptional regulation Biochemical characterization of a mutant form of Cas9 nuclease D10A functions as a nickase Jinek et al 2012 generating a break in the complementary Page 2 ver 3 11032014 www systembio com PrecisionX Cas9 SmartNuclease System Cat CAS8 9xxA 1 strand of DNA rather than both strands as with the wild type Cas9 This allows repair of the DNA template using a high fidelity pathway rather than NHEJ which prevents formation of indels at the targeted locus and possibly other locations in the genome to reduce possible off target toxicity effects while maintaining ability to undergo homologous recombination Cong et al 2013 Recently paired nicking has been shown to reduce off target activity by 50 to 1 500 fold in cell lines and to facilitate gene knockout in mouse zygote without losing on target cleavage efficiency Ran et al 2013 Finally tandem knockout of both RuvCl and HNH nuclease domains which control cutting of the DNA strands shows that the null nuclease mutant double mutant can act as a transcriptional repressor Qi ef al 2013 with minimal off target effects which leads to possibilities for studying site specific transcriptional regulation Taken together the RNA guided Cas9 system defines a new class of genome engineering tools creating new opportunities for research across basic sciences biotechnology and biomedicine B Product Information and V
23. martNuclease expression construct with the following features e All in one vector system combining codon optimized hspCas9 and gRNA cloning and scaffolding sequences no need for multiple plasmid constructs e Pre linearized vector is ready to use no need to prepare or modify the vector backbone e Precise directional cloning of the gRNA insert into vector backbone e Rapid highly efficient cloning with low background 99 cloning efficiency e Cloning compatibility the same gRNA insert can be easily exchanged into other CasQ linearized vectors with a one step cloning reaction G Applications of the Cas9 SmartNuclease Expression System We have developed the all in one expression system to target a wide range of researchers who are interested in the following but not limited to research areas e Genome editing and engineering of model organisms e Synthetic biology applications e Gene Cell based therapy H List of Components The kit contains enough reagents to perform up to 10 ligation reactions in an easy to use format Table 2 Page 8 ver 3 11032014 www systembio com PrecisionX Cas9 SmartNuclease System Cat CAS8 9xxA 1 Table 2 List of components included in the Cas9 SmartNuclease Expression System including SmartNickase and NullNuclease mutant versions Reagent Amount Linearized Cas9 H1 10 ul SmartNuclease Vector H 5x ligation buffer 10 pl Fast ligase 2 5 pl Fwd Sequencing prime
24. r 5 uM 20 ul 5 GTCATCAACCCGCTCCAAGG 3 H H Additional Materials Required 1 LB Agar and Broth containing 50ug m Kanamycin 2 Any high transformation efficiency E coli competent cells 3 Zyppy Plasmid MiniPrep Kit Zymo Research Cat D4019 4 Qiagen EndoFree Plasmid Maxi Kit Qiagen Cat 12362 5 PureFection Transfection Reagent System Biosciences Cat LV750A 1 or equivalent I Related Products SBI offers a number of Homologous Recombination HR Donor Vectors including the popular piggyBac HR Donor for seamless excision Cat PBHR100A 1 The full selection of HR Donor vectors may be viewed on the following webpage http www systembio com genome engineering precisionx HR vectors ordering J Shipping and Storage Conditions for Kit PrecisionX Cas9 SmartNuclease Expression System components are shipped on blue ice Upon receiving store the kit at 20 C Shelf life of the product is 1 year after receipt if stored in 20 C ll Protocol for the Cas9 SmartNuclease Expression System A Quick Overview of the Protocol The general workflow of the cloning validation and transfection of the gRNA Cas9 SmartNuclease expression construct into cells is depicted in Fig 10 Briefly here are the steps involved in the process l Design two DNA oligonucleotides that are sense and antisense sequences of the target DNA which is 20bp upstream of the PAM 5 NGG 3 2 Anneal the two oligonucleot
25. trol Kit CAS605A 1 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual A Surveyor AAVS1 Assay B EGFP Restoration Images 1 100bp ladder 2 EF1 hspcas9 H1 AAVS1 gRNA EF1 hspCas9 1 2 H1 AAVS1gRNA Donor Alone Donor Control 500bp Si a 100bp EGFP Fig 5 A Cleavage efficiency of the Cas9 SmartNuclease targeting the AAVS7 locus measured by T7 endonuclease assay and B HDR efficiency of donor EGFP fragment for Cas9 SmartNuclease system vs TALENs pZT AAVS1 L1 R1 as measured by GFP positive clones at day 2 top panel and 1 week post transfection bottom panel using EGIP cell line Acknowledgements Design of the pZT AAVS1 L1 R1 and EGIP 293T stable cell line are kindly provided by Dr Jizhong Zou of the NIH Center for Regenerative Medicine a Common Fund initiative of the U S National Institutes of Health D Validation Data for the Cas9 SmartNuclease Expression System Targeting Luciferase Gene To further validate our RNA directed Cas9 SmartNuclease system we designed and cloned two gRNAs which target the luciferase gene Fig 6A In addition we designed a donor vector Fig 6B which contains homology sequences flanking the luciferase gene which was stably integrated into a reporter cell line and contains a red fluorescent protein RFP sequence This allows measurement of 1 cleavage activity using either Surveyor Nuclease or luciferase assay and 2 efficiency of a homolo
26. using paired gRNAs with hspCasQ9 D10A Nickase Please note that only gRNA pairs creating 5 overhangs with less than 8bp overlap between the guide sequences were able to mediate detectable indel formation Ran et al 2013 To achieve high cleavage efficiency using Cas9 Nickase with paired gRNAs make sure each gRNA is able to efficiently induce indels when coupled with wide type Cas9 C Design of Guide RNA Oligonucleotides Design two DNA oligonucleotides a top strand and a bottom strand according to the following structure shown below 5 TGTATGAGACCACNNNNNNNNNNNNNNNNNNNN 3 3 ACTCTGGTGNNNNNNNNNNNNNNNNNNNNCAAA 8 The top strand has a TGTATGAGACCAC overhang at its 5 end followed by the selected target sequence The bottom strand has an AAAC overhang at its 5 end followed by a target sequence complementary to the top strand and a GTGGTCTCA overhang at its 3 end Example If your target sequence is AGCGAGGCTAGCGACAGCATAGG AGG PAM sequence then the oligo sequences would be Top strand oligo 5 T TATGAGACCACAGCGAGGCTAGCGACAGCAT 3 Bottom strand oligo 5 AAACATGCTGTCGCTAGCCTCGCTGTGGTCTCA 3 D Cloning into the Cas9 SmartNuclease Vector 1 Anneal the two single strand DNA oligonucleotides 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual 2 Dilute your stock primers to 10uM using 1x Annealing Buffer 10mM Tris pH7 5 50m
Download Pdf Manuals
Related Search