Cloning into pcDNA - Thermo Fisher Scientific
Contents
1. pcDNA 3 1 Zeo and pcDNA 3 1 Zeo vectors contain the human CMV immediate early promoter to allow high level constitutive expression of the gene of interest in mammalian cells Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 Although highly active in most mammalian cell lines activity of the viral promoter can be down regulated in some cell lines due to methylation Curradi et al 2002 histone deacetylation Rietveld et al 2002 or both Use the following outline to clone and express your gene of interest in pcDNA 3 1 Zeo 1 Consult the multiple cloning sites pages 3 4 to design a strategy to clone your gene into pcDNA 3 1 Zeo or pcDNA 3 1 Zeo 5 2 Ligate your insert into the appropriate vector and transform into E coli Select transformants on LB plates containing 50 100 pg ml ampicillin or TM Low Salt LB plates containing 25 ug ml Zeocin see page 9 for recipe 3 Analyze your transformants for the presence of insert by restriction digestion 4 Select a transformant with the correct restriction pattern and use sequencing to confirm that your gene is cloned in the proper orientation 5 Transfect your construct into the mammalian cell line of interest using your own method of choice Generate a stable cell line if desired 6 Test for expression of your recombinant gene by western blot analysis or functional assay Continued on next page Methods Cloning into pcDN2. Zeocin belongs to a family of structurally related bleomycin phleomycin type antibiotics isolated from Streptomyces Antibiotics in this family are broad spectrum antibiotics that act as strong antibacterial and anti tumor drugs They show strong toxicity against bacteria fungi including yeast plants and TM mammalian cells Zeocin is not as toxic as bleomycin on fungi As a broad bbs spectrum antibiotic Zeocin is particularly useful allowing selection in a number TM of cell types containing vectors with a Zeocin resistance gene The exact mechanism of action of Zeocin is not known however it is thought to be the same as bleomycin and phleomycin due to its similarity to these drugs and its inhibition by the Sh ble resistance protein see next section The copper glycopeptide complex is selective and involves chelation of copper Cu by the amino group of the 8 carbox amide single nitrogen atoms of both the pyrimidine chromophore and the imidazole moiety and the carbamoyl group of mannose The copper chelated form is inactive When the antibiotic enters the cell the copper cation is reduced from Cu to Cu and removed by sulfhydryl compounds in the cell Upon removal of the copper Zeocin is activated to bind DNA and cleave it causing cell death Berdy 1980 High salt concentrations and acidity or basicity inactivate Zeocin therefore it is necessary to reduce the salt in bacterial medium to 90 m
3. 0 5 0 7 Mix 0 85 ml of culture with 0 15 ml of sterile glycerol and transfer to a cryovial 5 Store at 80 C Transfection Introduction Plasmid Preparation Methods of Transfection Positive Control Assay for CAT Protein Once you have verified that your gene is cloned in the correct orientation and contains an initiation ATG and a stop codon you are ready to transfect your cell line of choice We recommend that you include the positive control vector and a mock transfection negative control to evaluate your results Plasmid DNA for transfection into eukaryotic cells must be very clean and free from phenol and sodium chloride Contaminants will kill the cells and salt will interfere with lipids decreasing transfection efficiency We recommend isolating DNA using the PureLink HiPure Miniprep Kit or the PureLink HiPure Midiprep Kit page vi or CsCl gradient centrifugation For established cell lines e g HeLa consult original references or the supplier of your cell line for the optimal method of transfection It is recommended that you follow the protocol for your cell line exactly Pay particular attention to medium requirements when to pass the cells and at what dilution to split the cells Further information is provided in Current Protocols in Molecular Biology Ausubel et al 1994 Methods for transfection include calcium phosphate Chen amp Okayama 1987 Wigler et al 1977 lipid m
4. TCCCACTG Continued on next page Cloning into pcDNA 3 1 Zeo Continued Multiple Cloning Below is the multiple cloning site for pPDNA 3 1 Zeo Restriction sites are Site of mn labeled to indicate the cleavage site The multiple cloning site has been pcDNA 3 1 Zeo confirmed by sequencing and functional testing enhancer region 3 end 689 CATTGACGTC AATGGGAGTT TGTTTTGGCA CCAAAATCAA CGGGACTTTC CAAAATGTCG CAAT TATA T 1 749 TAACAACTCC GCCCCATTGA CGCAAATGGG CGGTAGGCGT GTACGGTGGG AGGTCTATAT 3 end of hCMV z l putative transcriptional start 809 AAGCAGAGCT CTCTGGCTAA CTAGAGAACC CACTGCTTAC TGGCTTATCG AAATTAATAC T7 promoter priming site Nhe Pme Apa Xba I Xho Not mn I 1 I 869 GACTCACTAT AGGGAGACCC AAGCTGGCTA GCGTTTAAAC GGGCCCTCTA GACTCGAGCG BstX EcoR V n ER BsiX BamH 929 GCCGCCACTG TGCTGGATAT CTGCAGAATT CCACCACACT GGACTAGTGG ATCCGAGCTC Asp718 I Kpn I Hind III Aff Il Pme BGH reverse priming site I p gL I A A 989 GGTACCAAGC TTAAGTTTAA ACCGCTGATC AGCCTCGACT GTGCCTTCTA GTTGCCAGCC 1049 ATCTGTTGTT TGCCCCTCCC CCGTGCCTTC CTTGACCCTG GAAGGTGCCA CTCCCACTGT BGH poly A site ID a el 1109 CCTTTCCTAA TAAAATGAGG AAATTGCATC Continued on next page Cloning into pcDNA 3 1 Zeo Continued E coli Transformation EN Y BECO p Z Now I Preparing a Glycerol Stock 1 Transform your ligation mixtures into a competent
5. 3 1 Zeo Vectors Map of TM The figure below summarizes the features of the pcDNA 3 1 Zeo and pcDNA 3 1 Zeo pcDNA 3 1 Zeo vectors The complete nucleotide sequences for 10 pcDNA 3 1 Zeo and peDNA 3 1 Zeo are available for downloading from our web site at www invitrogen com or from Technical Support page 13 Comments for pcDNA3 1 Zeo 5015 nucleotides CMV promoter bases 209 863 T7 promoter priming site bases 863 882 Multiple cloning site bases 895 1010 BGH reverse priming site bases 1022 1039 BGH polyadenylation signal bases 1021 1235 fl origin bases 1298 1711 SV40 promoter and origin bases 1776 2101 EM7 promoter bases 2117 2183 Zeocin resistance gene bases 2184 2558 SV40 polyadenylation bases 2688 2817 pUC origin bases 3201 3874 C bla promoter bases 4880 4978 C Ampicillin bla resistance gene bases 4019 4879 C Features of pcDNA 3 1 Zeo and pcDNA 3 1 Zeo Vectors pcDNA 3 1 Zeo 5015 bp and pcDNA 3 1 Zeo 5014 bp contain the following elements All features have been functionally tested Features of pcDNA 3 1 Zeo Feature Benefit Human cytomegalovirus CMV immediate early promoter enhancer Permits efficient high level expression of your recombinant protein Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 17 promoter priming site Allows for in vitro transcription in the sense
6. orientation and sequencing through the insert Multiple cloning site in forward or reverse orientation Allows insertion of your gene and facilitates cloning BGH reverse priming site Allows sequencing through the insert in the reverse orientation Bovine growth hormone BGH Permits efficient transcription termination and polyadenylation signal polyadenylation of mRNA Goodwin amp Rottman 1992 fl origin Allows rescue of single stranded DNA SV40 early promoter and origin Allows efficient high level expression of the Zeocin resistance gene and episomal replication in cells expressing SV40 large T antigen EM7 promoter Permits expression of the Zeocin resistance gene in E coli TM Zeocin resistance gene Allows selection of transformants in E coli and stable transfectants in mammalian cells Drocourt et al 1990 Mulsant et al 1988 SV40 polyadenylation signal Permits efficient transcription termination and polyadenylation of mRNA pUC origin Permits high copy number replication and growth in E coli bla promoter Permits expression of the ampicillin resistance gene in E coli Ampicillin resistance gene B lactamase Allows selection in E coli 11 Map of pcDNA 3 1 Zeo CAT Map of pcDNA 3 1 Zeo CAT is a 5803 bp control vector containing the gene for CAT pcDNA 3 1 Zeo It was constructed by digesting pcDNA 3 1 Zeo with Xho I
7. Prokaryotes A General Approach to the Introduction of Macromolecules into Cells BioTechniques 6 742 751 Wigler M Silverstein S Lee L S Pellicer A Cheng Y C and Axel R 1977 Transfer of Purified Herpes Virus Thymidine Kinase Gene to Cultured Mouse Cells Cell 11 223 232 1996 2008 2010 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 16 invitrogen Corporate Headquarters Invitrogen Corporation 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
8. 3 1 Zeo Continued Multiple Cloning Site of 689 749 809 869 929 989 1049 1109 Below is the multiple cloning site for pcDNA 3 1 Zeo Restriction sites are a labeled to indicate the cleavage site The multiple cloning site has been pcDNA 3 1 Zeo confirmed by sequencing and functional testing enhancer region 3 end CATTGACGTC AATGGGAGTT TAACAACTCC 3 end ofhCMV GCCCCATTGA CGCAAATGGG CGG putative transcription CAAT rw AAGCAGAGCT CTCTGGC T7 promoter priming site 1 GACTCACTAT BamH I AGGGAGACCC AAGCTGGCTA AA CTAGAGAACC CAC Nhe TGTTTTGGCA CCAAAATCAA CGGGACT TTC CAAAATG al start AGGCGT GTACGG GCTTAC Pme Aff II TGGCTTA TTAAAC l TTAAGCT BstX EcoR l GGATCCACTA Xba l AGTCTAGAGG GCCCGTT GTCCAGTGTG GTGGAA Apa l Pme AA ACCCGC TCT GAT GCG Pst EcoR V l GCAGAT CAGCC BstX TATCC AGCACAGTGG CGGCCGCTCG Not I BGH reverse priming site GGG AGGTCTA CG AAA CG TATA res AT m TAATAC Hind Ill Asp718 I Kpn I I I GG TACCGAGCTC Xho CATCTGTTGT TTIGOCCC BGH poly A site ul TCCTTTCCTA A AAAATGAG GAAA CC CCCG GCCTT TGCAT CGAC TGTGCCT CT AG TGCCAGC CCTTGACCCT GGAAGGTGCC ACT
9. 5 cells per 60 100 mm dish Prepare 7 plates and add varying concentrations of Zeocin 0 50 125 250 500 750 and 1000 ug ml to each plate Replenish the selective media every 3 4 days and observe the percentage of surviving cells Count the number of viable cells at regular intervals to determine the appropriate concentration of Zeocin that prevents growth Once you have determined the appropriate Zeocin concentration to use you can generate a stable cell line with your construct 1 Transfect cells with your construct using the desired protocol and plate Remember to include a plate of untransformed cells as a negative control 24 hours after transfection wash the cells and add fresh medium to the cells 48 hours after transfection split the cells into fresh medium containing Zeocin at the pre determined concentration required for your cell line Split the cells such that the cells are no more than 2576 confluent Feed the cells with selective medium every 3 4 days until foci can be identified Pick and expand the foci to test for expression of your recombinant protein Recipes LB Luria Bertani Medium LB Plates Containing Ampicillin Low Salt LB Medium Containing Zeocin Appendix 1 0 Tryptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 0 with NaOH
10. A 3 1 Zeo Introduction General Molecular Biology Techniques E coli Strain Transformation Method Maintenance of pcDNA 3 1 Zeo Points to Consider Before Recombining into pcDNA 3 1 Zeo To recombine your gene of interest into pcDNA 3 1 Zeo you will need to ligate your gene of interest into either pcDNA 3 1 Zeo or pcDNA 3 1 Zeo Diagrams of the multiple cloning sites for each vector are provided on pages 3 4 For help with DNA ligations E coli transformations restriction enzyme analysis purification of single stranded DNA DNA sequencing and DNA biochemistry refer to Molecular Cloning A Laboratory Manual Sambrook et al 1989 or Current Protocols in Molecular Biology Ausubel et al 1994 Many E coli strains are suitable for the growth of this vector For the most efficient selection we highly recommended choosing an E coli strain that does not contain the full Tn5 transposon Note Any E coli strain that contains the complete Tn5 transposable element i e DH58F TQ SURE SURE2 encodes the ble bleomycin resistance gene These strains TM will be resistant to Zeocin We recommend that you propagate pcDNA 3 1 Zeo in E coli strains that are recombination deficient recA and endonuclease A deficient endA such as TOP10F and DH10B page vi You may use any method of your choice for transformation Chemical transformation is the most convenient for most rese
11. HiPure Plasmid Midiprep Kit 25 preps K2100 04 Zeocin Selection Reagent lg R250 01 58 R250 05 Lipofectamine 2000 Transfection 15 ml 11668 500 Reagent 1 5 ml 11668 019 Overview Introduction Features of pcDNA 3 1 Zeo CMV Promoter Experimental Outline Introduction pcDNA 3 1 Zeo and peDNA 3 1 Zeo are 5 0 kb vectors derived from pcDNA 3 1 and are designed for high level stable and transient expression in mammalian hosts pcDNA 3 1 Zeo is available with the multiple cloning sites in the forward and reverse orientations to facilitate cloning High level stable and non replicative transient expression can be carried out in most mammalian cells A control plasmid pcDNA 3 1 Zeo CAT is included for use as a positive control for transfection and expression in your cell line of choice pcDNA 3 1 Zeo and peDNA 3 1 Zeo contain the following features e The human cytomegalovirus immediate early CMV promoter provides high level expression in a wide range of mammalian cells e Multiple cloning sites in the forward and reverse orientations to facilitate cloning of your gene of interest e The Zeocin resistance gene allows selection in both E coli and mammalian cells in the presence of the antibiotic Zeocin e SV40 early promoter allows episomal replication in cell lines that are latently infected with SV40 or that express the SV40 large T antigen e g COS 7
12. Invitrogen pcDNA 3 1 Zeo pcDNA 3 1 Zeo For high level stable and transient expression in mammalian hosts Catalog nos V860 20 and V865 20 Version J 12 November 2010 28 0110 Table of Contents Kit Contents and storage dn Gasa een v Accessory Products ise RE eH REI GRE de vi Introduction ss 1 OVER DEB NE PUER M dan dan danken eee ped tah ue 1 Methods fte DRE 2 Cloning into pcDNA 3 1 Zeo un anenenenenenennenenenennenen enen enenenenenensnenenenenennenenenenenevenerenensnnenenenenennenenenenen 2 TERMS COM tetten ih a lle anal an enne an rere eie eue 6 Creation of Stable Cell Eines smste RR e Rn e ERU D RR ERE RE Re doe 7 A PEEN RE NC E LM a aoa at Ba DD eN 9 Recipes n 9 Map of pcDNA 3 1 Zeo and pcDNA 3 1 Zeo Vectors sassen enen ensenenonenensenenennenenerseneneenen 10 Features of pcDNA 3 1 Zeo and pcDNA 3 1 Zeo Vectors nennen avensnnene enen enenennenenens 11 Map of peDNA 3 Zeo CAT ad isst eek 12 Technical Support am eL eta ee hee HU S et iere hee e 13 Purchaser Notification uae reote ime e eade e iii 14 References cui eese oe eoe DE ense irte detegere dial 15 iii iv Kit Contents and Storage Shipping and Storage vectors at 20 C pcDNA 3 1 Zeo vectors are shipped on wet ice Upon receipt store Kit Contents Each catalog number con
13. M 1990 Downstream Secondary Structure Facilitates Recognition of Initiator Codons by Eukaryotic Ribosomes Proc Natl Acad Sci USA 87 8301 8305 Kozak M 1991 An Analysis of Vertebrate mRNA Sequences Intimations of Translational Control J Cell Biology 115 887 903 Mulsant P Tiraby G Kallerhoff J and Perret J 1988 Phleomycin Resistance as a Dominant Selectable Marker in CHO Cells Somat Cell Mol Genet 14 243 252 Nelson J A Reynolds Kohler C and Smith B A 1987 Negative and Positive Regulation by a Short Segment in the 5 Flanking Region of the Human Cytomegalovirus Major Immediate Early Gene Molec Cell Biol 7 4125 4129 Neumann J R Morency C A and Russian K O 1987 A Novel Rapid Assay for Chloramphenicol Acetyltransferase Gene Expression BioTechniques 5 444 447 Perez P Tiraby G Kallerhoff J and Perret J 1989 Phleomycin Resistance as a Dominant Selectable Marker for Plant Cell Transformation Plant Mol Biol 13 365 373 Continued on next page 15 References Continued Rietveld L E Caldenhoven E and Stunnenberg H G 2002 In vivo Repression of an Erythroid Specific Gene by Distinct Corepressor Complexes EMBO J 21 1389 1397 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Ed Cold Spring Harbor Laboratory Press Plainview New York Shigekawa K and Dower W J 1988 Electroporation of Eukaryotes and
14. M 5 g liter or less and adjust the pH to 7 5 to make sure the drug remains active Zeocin is used for selection in mammalian cells Mulsant et al 1988 plants Perez et al 1989 yeast Baron et al 1992 and prokaryotes Drocourt et al 1990 Suggested concentrations of Zeocin for selection in mammalian tissue culture cells and E coli are listed below Organism Zeocin Concentration and Selective Medium E coli 25 50 ug ml in low salt LB medium Mammalian cells 50 1000 ug ml depends on cell line Efficient selection requires that the concentration of NaCl be no more than 5 g liter 90 mM Continued on next page Creation of Stable Cell Lines Continued Determining Antibiotic Sensitivity Selection of Stable Integrants To obtain a stable integrant you must first determine if the cell line in question can grow as an isolated colony You may already know this for your cell line If you do not seed 100 cells in a 60 mm plate and feed every 4 days for 10 12 days Count the number of colonies Growing in soft agar can help cells to grow when they are diluted however some cell lines e g NIH3T3 require plating at a certain density in order to grow properly see Ausubel et al 1990 Next determine the minimal concentration of Zeocin required to prevent growth of the parental cell line using the protocol below 1 Plate or split a confluent plate so there are approximately 2 5 x 10
15. and Xba I and CAT was treated with Klenow An 800 bp Hind III fragment containing the CAT gene 12 was treated with Klenow and then ligated into peDNA 3 1 Zeo TM The figure below summarizes the features of the pcDNA 3 1 Zeo CAT vector The complete nucleotide sequence for pcDNA 3 1 Zeo CAT is available by downloading it from our web site at www invitrogen com or from Technical Support page 13 ATG CAT pcDNA3 1 Zeo CAT Comments for pcDNA3 1 Zeo CAT 5803 nucleotides CMV promoter bases 209 863 T7 promoter priming site bases 863 882 CAT ORF bases 989 1779 BGH reverse priming site bases 1810 1827 BGH polyadenylation signal bases 1810 2024 fl origin bases 2086 2499 SV40 promoter and origin bases 2564 2889 Zeocin resistance gene bases 2972 3346 SV40 polyadenylation bases 3476 3605 pUC origin bases 3989 4662 C Ampicillin bla resistance gene bases 4807 5667 C Technical Support Web Resources Visit the Invitrogen web site at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are l
16. and bring the volume up to 1 liter 3 Autoclave on liquid cycle for 20 minutes Allow solution to cool to 55 C and add antibiotic if desired 4 Store at 4 C Follow the instructions below to prepare LB agar plates containing ampicillin 1 Prepare LB medium as above but add 15 g L agar before autoclaving 2 Autoclave on liquid cycle for 20 minutes 3 After autoclaving cool to 55 C add ampicillin to a final concentration of 100 pg ml and pour into 10 cm plates 4 Let harden then invert and store at 4 C in the dark For Zeocin to be active the salt concentration of the medium must remain low lt 90 mM and the pH must be 7 5 You must prepare LB broth and plates using the following recipe Note the lower salt content of this medium Failure to lower the salt content of your LB medium will result in non selection due to inactivation of the drug Low Salt LB Medium 10 g Tryptone 5 g NaCl 5 g Yeast Extract 1 Combine the dry reagents above and add deionized distilled water to 950 ml Adjust pH to 7 5 with 1 N NaOH Bring the volume up to 1 liter For plates add 15 g L agar before autoclaving 2 Autoclave on liquid cycle at 15 Ibs sq in and 121 C for 20 minutes 3 Allow the medium to cool to at least 55 C before adding the Zeocin to 25 ug ml final concentration 4 Store plates at 4 C in the dark Plates containing Zeocin are stable for 1 2 weeks Map of pcDNA 3 1 Zeo and pcDNA
17. archers Electroporation is the most efficient and the method of choice for large plasmids To propagate and maintain peDNA 3 1 Zeo or pcDNA 3 1 Zeo we recommend that you use 10 ng of the vector to transform a recA endA E coli 4 strain such as TOP10 TOP10F DH5a or equivalent using your method of choice Select transformants on LB plates containing 50 100 pg ml ampicillin or Low Salt LB plates containing 25 ug ml Zeocin see page 9 for recipe TM For long term storage of peDNA 3 1 Zeo be sure to prepare a glycerol stock of your plasmid containing E coli strain page 5 pcDNA 3 1 Zeo and peDNA 3 1 Zeo are nonfusion vectors Your insert should contain a Kozak consensus sequence with an ATG initiation codon for proper initiation of translation Kozak 1987 Kozak 1990 Kozak 1991 An example of a Kozak consensus sequence is provided below Other sequences are possible but the G or A at position 3 and the G at position 4 shown in bold illustrates the most commonly occurring sequence with strong consensus Replacing one of the two bases at these positions provides moderate consensus while having neither results in weak consensus The ATG initiation codon is shown underlined G A NNATGG Your insert should also contain a stop codon for proper termination of your gene Note that the Xba I site contains an internal stop codon TCTAGA Continued on next page Cloning into pcDNA
18. ed amount of the product only to perform internal research for the sole benefit of the purchaser No right to resell this product or any of its components is conveyed expressly by implication or by estoppel This product is for internal research purposes only and is not for use in commercial applications of any kind including without limitation qual ity control and commercial services such as reporting the results of purchaser s activities for a fee or other form of consideration For information on obtaining additional rights please contact outlicensing lifetech com or Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 References Andersson S Davis D L Dahlback H J rnvall H and Russell D W 1989 Cloning Structure and Expression of the Mitochondrial Cytochrome P 450 Sterol 26 Hydroxylase a Bile Acid Biosynthetic Enzyme J Biol Chem 264 8222 8229 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology Greene Publishing Associates and Wiley Interscience New York Baron M Reynes J P Stassi D and Tiraby G 1992 A Selectable Bifunctional p Galactosidase Phleomycin resistance Fusion Protein as a Potential Marker for Eukaryotic Cells Gene 114 239 243 Berdy J 1980 in Amino Acid and Peptide Antibiotics Berdy J ed Vol IV Part I pp 459 497 CRC Press Boca Raton FL Bo
19. ediated Felgner et al 1989 Felgner amp Ringold 1989 and electroporation Chu et al 1987 Shigekawa amp Dower 1988 Invitrogen offers the Lipofectamine 2000 Transfection Reagent page vi as well as a selection of other transfection reagents for your convenience For more information on available reagents visit our web site at www invitrogen com or contact Technical Support page 13 TM pcDNA 3 1 Zeo CAT is provided as a positive control vector for mammalian transfection and expression see page 12 It may be used to optimize transfection conditions for your cell line The gene encoding chloramphenicol acetyl transferase CAT is expressed in mammalian cells under the CMV promoter A successful transfection will result in positive CAT expression and can be easily assayed below You may assay for CAT expression by ELISA assay western blot analysis fluorometric assay or radioactive assay Ausubel et al 1994 Neumann et al 1987 Creation of Stable Cell Lines Introduction Zeocin Zeocin Mechanism of Action Zeocin Applications The pcDNA 3 1 Zeo and pcDNA 3 1 Zeo vectors contain the Zeocin resistance gene for selection of stable cell lines using Zeocin We recommend that you test the sensitivity of your mammalian host cell to Zeocin as natural resistance varies among cell lines General information and guidelines are provided in this section for your convenience
20. isted on our web site www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech_support invitrogen com E mail E mail eurotech invitrogen com MSDS Certificate of Analysis Limited Warranty jpinfo invitrogen com MSDSs Material Safety Data Sheets are available on our web site at www invitrogen com msds Product qualification is described in the Certificate of Analysis CofA available on our website by product lot number at www invitrogen com cofa Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warrant
21. recA endA E coli strain e g TOP10 TOP10F DH10B 2 Select on LB plates containing 50 100 ug ml ampicillin or Low Salt LB plates containing 25 ug ml Zeocin see page 9 for recipe 3 Select 10 20 clones and analyze for the presence and orientation of your insert We recommend that you sequence your construct with the T7 Promoter and BGH Reverse primers page vi to confirm that your gene is in the correct orientation for expression and contains an ATG initiation codon and a stop codon Refer to the multiple cloning sites on pages 3 4 for the sequences and location of the priming sites Primer Sequence BGH Reverse 5 TAGAAGGCACAGTCGAGG 3 T7 Promoter 5 TAATACGACTCACTATAGGG 3 For your convenience Invitrogen offers a custom primer synthesis service Visit www invitrogen com for more details or contact Technical Support page 13 Once you have identified the correct clone purify the colony and make a glycerol stock for long term storage You should keep a DNA stock of your plasmid at 20 C 1 Streak the original colony out on an LB plate containing 50 100 ug ml ampicillin or Low Salt LB plates containing 25 pg ml Zeocin see page 9 for recipe Incubate the plate at 37 C overnight 2 Isolate a single colony and inoculate into 1 2 ml of LB containing 50 100 pg ml ampicillin page 9 or Low Salt LB plates containing 25 pg ml Zeocin page 9 Grow the culture to mid log phase OD
22. shart M Weber F Jahn G Dorsch H sler K Fleckenstein B and Schaffner W 1985 A Very Strong Enhancer is Located Upstream of an Immediate Early Gene of Human Cytomegalovirus Cell 41 521 530 Chen C and Okayama H 1987 High Efficiency Transformation of Mammalian Cells by Plasmid DNA Mol Cell Biol 7 2745 2752 Chu G Hayakawa H and Berg P 1987 Electroporation for the Efficient Transfection of Mammalian Cells with DNA Nucleic Acids Res 15 1311 1326 Curradi M Izzo A Badaracco G and Landsberger N 2002 Molecular Mechanisms of Gene Silencing Mediated by DNA Methylation Mol Cell Biol 22 3157 3173 Drocourt D Calmels T P G Reynes J P Baron M and Tiraby G 1990 Cassettes of the Streptoalloteichus hindustanus ble Gene for Transformation of Lower and Higher Eukaryotes to Phleomycin Resistance Nucleic Acids Res 18 4009 Felgner P L Holm M and Chan H 1989 Cationic Liposome Mediated Transfection Proc West Pharmacol Soc 32 115 121 Felgner P L a and Ringold G M 1989 Cationic Liposome Mediated Transfection Nature 337 387 388 Goodwin E C and Rottman F M 1992 The 3 Flanking Sequence of the Bovine Growth Hormone Gene Contains Novel Elements Required for Efficient and Accurate Polyadenylation J Biol Chem 267 16330 16334 Kozak M 1987 An Analysis of 5 Noncoding Sequences from 699 Vertebrate Messenger RNAs Nucleic Acids Res 15 8125 8148 Kozak
23. tains the following vectors All vectors are supplied in aliquot detailed below Store the vectors at 20 C Catalog nos Vector Quantity Composition supplied as V860 20 pcDNA 3 1 Zeo 20 ug 40 ul of 0 5 ug pul pcDNA 3 1 Zeo vector in 10 mM Tris HCl 1 mM EDTA pH 8 0 pcDNA 3 1 Zeo CAT control 20 ug 40 ul of 0 5 ug ul pcDNA 3 1 Zeo CAT control vector in 10 mM Tris HCl 1 mM EDTA pH 8 0 V865 20 pcDNA 3 1 Zeo 20 ug 40 ul of 0 5 ug ul pcDNA 3 1 Zeo vector in 10 mM Tris HCl 1 mM EDTA pH 8 0 pcDNA 3 1 Zeo CAT control 20 ug 40 ul of 0 5 ug pul pcDNA 3 1 Zeo CAT control vector in 10 mM Tris HCl 1 mM EDTA pH 8 0 Accessory Products Introduction vi The following additional products may be used with the pcDNA 3 1 Zeo vectors For more information visit our web site at www invitrogen com or contact Technical Support page 13 Item Quantity Catalog no One Shot TOP10F chemically 20 x 50 ul C3030 03 competent E coli One Shot TOP10 chemically competent 10 reactions C4040 10 E coli One Shot TOP10 Electrocompetent E Coli 10 reactions C4040 50 20 reactions C4040 52 MAX Efficiency DH10B chemically 1 ml 18297 010 competent cells T7 Promoter Primer 2 ug N560 02 BGH Reverse Primer 2 ug N575 02 S N A P Miniprep Kit 100 reactions K1900 01 PureLink HiPure Plasmid Miniprep Kit 100 preps K2100 03 PureLink
24. y limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose 13 Purchaser Notification Introduction Limited Use Label License No 358 Re search Use Only 14 Use of the pcDNA 3 1 Zeo vectors is covered under a number of different licenses including those detailed below The purchase of this product conveys to the purchaser the limited non transferable right to use the purchas
Download Pdf Manuals
Related Search