phiC31 Integrase Vector System User Manual
Contents
1. Licensing and Warranty Statement cc eeeeeeeeenteeeeeenees 12 888 266 5066 Toll Free 650 968 2200 outside US Page 1 System Biosciences SBI User Manual Introduction A Background of C31 Integrase Technology The C31 integrase is a sequence specific recombinase encoded within the genome of the bacteriophage C31 The C31 integrase mediates recombination between two 34 base pair sequences termed attachment sites att one found in the phage and the other in the bacterial host This serine integrase has been shown to function efficiently in many different cell types including mammalian cells Calos 2006 In the presence of 6C31 integrase an attB containing donor plasmid can be unidirectionally integrated into a target genome through recombination at sites with sequence similarity to the native attP site These sites are termed pseudo attP sites C31 integrase can integrate a donor plasmid of any size as a single copy and requires no cofactors The integrated transgenes are stably expressed and heritable The C31 integrase system is an attractive and safer alternative to traditional viral mediated transgene delivery in mammalian cells The system has been widely utilized in gene therapy and regenerative medicine applications To date it has found use for in vivo and ex vivo applications including correction of hemophilia A and B Keravala et al 2011 Chavez et al 2012 Duchenne muscular dystrophy Quenneville et al 2007 a2. cm plate T 75 flask for continued propagation Remaining cells can be frozen down for archival purposes 8 Test the cell lines for expression of your transgene of interest by qPCR western blot immunofluorescence or any specific assays designed to give a readout of transgene expression 9 Select the cell line s that give the desired level of transgene expression for further characterization Expression may vary from line to line depending on chromatin structure surrounding the integration site D Verification of Insert Integration at Specific Genomic Loci using the Plasmid Rescue Assay In order to ascertain the precise genomic location s of donor vector integration a Plasmid Rescue Assay can be performed on genomic DNA isolated from cells which have been transfected with the donor plasmid and selected The general idea for this assay is to determine the sequence of the genomic DNA flanking the integrated donor vector by using a series of blunt cutting restriction enzymes that cut outside the donor vector induce intramolecular ligation of the cut fragments and sequencing the regions away from the insert with the provided attB sequencing primers The results of the sequencing can be mapped to the genome by BLAT analysis http genome ucsc edu cgi bin hgBlat command start which confirms integration of the donor vector at a specified locus Detailed Protocol for Plasmid Rescue Assay 1 Isolate cells from one well of a 6 well plate which w
3. donor For example for transfection of HEK293T cells using Lipofectamine 2000 a 50 1 ratio of C31 integrase donor plasmid successfully integrated the donor vector in a single copy fashion with a very low incidence of random integration 2 Seed 400 000 cells in a 6 well plate in suitable growth medium optimal for the cell type of interest and grow overnight at 37 C Please include well s for a positive and negative control vectors if desired Day 1 3 When cells are 60 80 confluent co transfect target cells with C31 integrase and donor vector at ata 50 1 ratio w w using the transfection reagent of your choice Day 2 4 Split co transfected cells at 1 10 and 1 20 ratios in 10cm plates and replace transfection medium with complete growth medium including antibiotics 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual Day 3 5 Add recommended amount of puromycin or neomycin G418 suitable for optimal selection of the transfected cells Days 4 14 6 Untransfected cells will begin to die and colonies will begin to form from cells that were successfully transfected When the colonies are large enough transfer them to a single well of a 6 well plate Keep cells under antibiotic selection at all times 7 When colonies become confluent isolate cells and split cells for seeding into a single well of a 6 well plate for the optional Plasmid Rescue assay see Section D and 10
4. Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein Limited Warranty SBI warrants that the Product meets the specifications described in this manual If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with a refund This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose Page 12 ver 6 040313 www systembio com PhiC31 Cloning and Expression System Cat 4FC200Pa 1 FC5 6xxA SBI is committed to providing our customers with high quality produc
5. Puro T2A GFP lt EF1 PGK gt MCS Neomycin FC501A 1 FC520A 1 10 ug CMV GFP Neomycin FC550A 1 10 ug EF1a RFP Puromycin FC551A 1 10 ug PGK GFP Puromycin When co transfected with the plasmid expressing the pC31 integrase catalog FC200PA 1 the cloning vector will be integrated into pseudo attP sites in the host genome through an attB x attP recombination By using an excess of the C31 integrase vector relative to the cloning vector e g 50 1 random integration of the donor vector is minimized and most integration events will have been mediated by C31 integrase Cells that have the donor plasmid successfully integrated can be selected using puromycin e g FC550A 1 FC551A 1 neomycin FC500A 1 FC501A 1 FC520A 1 or sorted by flow cytometry for GFP or RFP positive cells FC550A 1 FC551A 1 for downstream applications Plasmids can also be directly injected into animals for in vivo transgene studies The vector maps for each of the four donor cloning and C31 integrase plasmids is shown below Fig 2 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual puc CMV pFC CMV MCS f SV40 Kan Neo Single Promoter phic31 Vector Cat FC501A 1 pFC CAG MCS SV40 Kan Neo were Single Promoter phiC31 Vector Cat FC600A 1 attB site sv40 SV40 promoter promoter FC600A 1 MCS 5 Nhel Eco47IIl Agel Xhol Xbal Spel Notl 5 BsrGl Pvul Mlul Not Nhel SbfI Pstl BamH
6. SSB System Biosciences phiC31 Integrase Vector System Catalog s FC200PA 1 FC500A 1 FC501A 1 FC550A 1 FC551A 1 FC600A 1 User Manual Please see product certificate for proper storage conditions A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement ver 6 0403913 contained in this user manual PhiC31 Cloning and Expression System Cat 4FC200Pa 1 FC5 6xxA Contents Introductionis iaeiae iaraa E edn del 2 A Background of C31 Integrase Technology 0 eee 2 B C31 Donor Cloning Vector Maps amp Details 3 C Additional Materials Required c cecceeeeeeeeeeetetteees 4 Il Validation Data for 6C31 Integrase Cloning System 6 A Colony Counting ASSAY eceeeereeeettieeeeetiieeeeetnieeeeeeee 6 B C31 Donor Cloning Vector Integration by GFP and Puromycin Marker Expression 6 Ill Protocol for Transfection and Generation of Stable Cell Lines using 6C31 Cloning and Integrase Vectors A General COMMENTS 0 0 0 eee cnet eeteneeeeeenteeeeeetnneeeeetneeeeetee 7 B Cloning of Inserts into 6C31 Donor Vectors 7 C Stable Cell Line Generation eee eeeeeeeeeeeteeeeeenaes 9 D Verification of Insert Integration at Specific Genomic Loci using the Plasmid Rescue Assay 10 IMS RETELENCES atan E EEE 11 Vy Technical Support cen cnn nde eerie aes 12 VI
7. Tissue Culture Plates and Related Tissue Culture Supplies 1 Other specific media and additives specific for cell type of interest m Optional For difficult to transfect cells the use of an electroporation system e g Lonza s NucleoFector or Invitrogen s Neon system is highly recommended Page 4 ver 6 040313 www systembio com PhiC31 Cloning and Expression System Cat 4FC200Pa 1 FC5 6xxA 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual ll Validation Data for C31 Integrase Cloning System phiC31 phiC31 Integrase integrase A Colony Counting Assay HEK293T cells seeded onto 6 well plates were transfected the next day in triplicate according to the manufacturer s instructions with Lipofectamine 2000 Invitrogen and 40 ng pFC PGK MCS EF1 GFP Puro Dual Promoter C31 Donor Vector Cat FC551A 1 and either 1 96 wg carrier plasmid DNA or 1 96 ug C31 integrase expression plasmid The cells were trypsinized after 48 hours resuspended in 1 ml of media and split 1 20 onto 10 cm plates containing 10 ml of media After 24 hours puromycin 0 5 ug ml was added to the medium to begin selection After 11 days the cells were fixed and stained with a solution of 50 methanol plus 1 methylene blue The plates were washed twice with 1x PBS and allowed to air dry The number of visible colonies was imaged and colony number counts were assessed There were no visible colonies on th
8. e minus C31 integrase negative control and gt 300 colonies on the C31 integrase plate colony assay data shown above B C31 Donor Cloning Vector Integration by GFP and Puromycin Marker Expression Approximately 400 000 HEK293T cells were co transfected with 1 96 ug C31 Integrase expression vector with 40 ng pFC PGK MCS EF1 GFP Puro Dual Promoter C31 Donor Vector Cat FC551A 1 The cells were split 1 10 24 hours post transfection Puromycin selection at 1 ug ml was initiated after another 24 hours with continuous selection for 4 days Cells were imaged at 4 and 11 days Representative GFP fluorescence and phase contrast fields are shown below 4 Days 11 Days Page 6 ver 6 040313 www systembio com PhiC31 Cloning and Expression System Cat FC200Pa 1 FC5 6xxA Protocol for Transfection and Generation of Stable Cell Lines using C31 Cloning and Integrase Vectors A General Comments We recommend propagation of the plasmids prior to starting the experiments The plasmids can be transformed using standard conditions suitable in any high quality RecA and EndA E coli competent cell For cells transformed with Catalog FC550A 1 or FC551A 1 vectors we suggest plating 50 200 ul of transformed cells on fresh ampicillin plates 50 ug ml For all other vectors including the C31 integrase vector cells should be plated on kanamycin plates 50 ug ml Incubate the plates at 37 C overnight Colonies picked from the transformation can be gro
9. ere previously plated for this assay and isolate genomic DNA from the cells using a suitable genomic DNA isolation kit 1 5 ug of genomic DNA will be sufficient for this assay 2 Digest between 1 5 ug of genomic DNA from each sample using 2 5 different blunt cutting restriction enzymes that do not cut within the donor plasmid and have good activity gt 50 activity in the same reaction buffer 3 Clean up the restriction digest using a suitable column purification kit and elute the digested DNA in 20 ul of elution buffer 4 Set up the following ligation reaction Page 10 ver 6 040313 www systembio com PhiC31 Cloning and Expression System Cat FC200Pa 1 FC5 6xxA Volume Item 5 Incubate the ligation reaction O N at 16 C overnight Performing ligations in a large volume minimizes intermolecular and favors intramolecular ligation events 6 Purify the ligation reactions in a suitable purification column and elute in 10 ul of elution buffer 7 Transform bacteria with 5 ul of the purified DNA and plate cells onto either kanamycin or ampicillin 50 ug ml antibiotic selection plates depending on the donor vector being tested 8 Select 2 4 colonies from the plates and inoculate 3 5 ml LB antibiotic for overnight growth at 37 C 9 Isolate the plasmid DNA from the cultures using a suitable plasmid DNA purification kit 10 Sequence the plasmids with the following primers to obtain the genomic sequences flanking the ligated donor
10. icillin or kanamycin broth and purify the construct using an endotoxin free plasmid purification kit Sequence verification of the insert is optional Page 8 ver 6 040313 www systembio com PhiC31 Cloning and Expression System Cat 4FC200Pa 1 FC5 6xxA C Stable Cell Line Generation Notes 1 Depending on the cell type being transfected please choose a transfection protocol which results in maximal transfection efficiencies For adherent cell lines such as HEK293T passive transfection methods using cationic lipid based methods e g Lipofectamine 2000 FuGene HD work very well in transfection of donor and integrase vectors For other types of cells such as primary stem or suspension cells we suggest transfection using electroporation methods NucleoFection or Neon for optimal results 2 The plasmids should be mixed well in minimal serum no antibiotic media cationic lipid transfection reagent or electroporation buffer to maximize efficiency of delivery 3 For selection of target cells we strongly recommend testing different concentrations of Puromycin or Neomycin G418 on untransfected cells to determine the optimal concentration of selection agent which is kills 90 100 of cells within 48 72 hours after drug administration Day 0 1 In order to limit the number of colonies resulting from random integration of the donor plasmid it is recommend to use the C31 integrase plasmid cat FC200PA 1 in a 50 1 ratio w w over the
11. ion about SBI products or to download manuals in PDF format please visit our website http www systembio com For additional information or technical assistance please call or email us at tech systembio com 650 968 2200 VI Licensing and Warranty Statement Limited Use License Use of the PhiC31 Expression System i e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms The purchaser of the Product is granted a limited license to use the Product under the following terms and conditions e The Product shall be used by the purchaser for internal research purposes only The Product is expressly not designed intended or warranted for use in humans or for therapeutic or diagnostic use e The Product may not be resold modified for resale or used to manufacture commercial products without prior written consent of SBI e This Product should be used in accordance with the NIH guidelines developed for stem cell research SBI has pending patent applications related to the Product For information concerning licenses for commercial use contact SBI Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the
12. l Bglll EcoRV Hindill Mlul 3 BamHl Bglll EcoRV Hindlll 3 puc CMV puc pFC MCS f SV40 Kan Neo Promoterless phiC31 Vector Cat FCSOOA 1 pFC CMV GFP S V40 Kan Neo Positive Control phic31 Vector Cat FCS20A 1 SV40 sv40 promoter promoter FCSOOA 1 MCS S Xhol Xbal Spel Noti Nhel BamHI Bglll EcoRVHindill Ndel 3 S phic31 Amp attB site pFC EF1 MCS PGK RFP Puro Dual Promoter phiC31 Vector Cat FCSSOA 1 pFC PGK MCS EF1 GFP Puro Dual Promoter phiC31 Vector Cat FC551A 1 Af Efta phic31 attB site 5 EcoRI EcoRV Acc65I Kpni Nhel Avril Mlul 3 5 BamHI EcoRV Kpnl Acc65 Nhel Clal 3 Fig 2 Schematic of the available vectors in the C31 Integrase Cloning System C Additional Materials Required a LB Agar and Broth containing 50 ug ml kanamycin or ampicillin b Any high transformation efficiency RecA and EndA E coli competent cells c Dulbecco s Modified Eagle s Medium D MEM high glucose with sodium pyruvate and glutamine Invitrogen Cat 11995073 d Lipofectamine 2000 transfection reagent Invitrogen Cat 11668019 e Qiagen EndoFree Plasmid Maxi Kit Qiagen Cat 12362 f Qiagen QiaQuick PCR Purification Kit Qiagen Cat 28104 g Qiagen DNeasy Blood and Tissue Kit Qiagen Cat 69504 h Fetal Bovine Serum Invitrogen Cat 16000036 i Penicillin Streptomycin Invitrogen Cat 15070063 j Trypsin EDTA Sigma Cat T3924 k 6 well
13. nd inherited skin disorders in transgenic mouse disease models Ortiz Urda et al 2002 Due to the tractability of the C31 integrase system it is widely considered to be one of the leading technologies for gene delivery in mammalian cells Transgenes attB donor plasmid re with transgenes Attachment site vt pseudo attP y Target genome D I phiC31 Integrase y attL attR Transgenes Page 2 ver 6 040313 www systembio com PhiC31 Cloning and Expression System Cat FC200Pa 1 FC5 6xxA Fig 1 Schematic of the C31 Integrase mediated recombination of donor plasmid sequence into pseudo attP sites in host genome B C31 Donor Cloning Vector Maps amp Details We have generated a suite of attB bearing donor cloning vectors as well as a positive control vector based on the C31 Integrase system for cloning of any cDNA or microRNA insert of choice into each vector for insertion into target cells of interest These cloning vectors offer the user maximum flexibility in the choice of the promoter to drive expression of the insert as well as fluorescent and antibiotic selection markers Table 1 Table 1 List of vectors for phiC31 Cloning System FC5xxA 1 Amount igor Built In Driving of DNA GOI Markers Per user construct 10 ug CMV Neomycin 07 V a Le DESCRIPTION FCSO0A 1 pFC MCS SV40 Neo 10 ug pFC CMV MCS SV40 Neo pFC CMV GFP SV40 Neo positive control pFC Puro T2A RFP lt PGK EF 1 gt MCS pFC
14. th a transformation efficiency of at least 1x10 colonies ug pUC19 with the whole ligation reaction 10 pl following the protocol provided with the competent cells Plate the transformed bacteria on 50 ug ml ampicillin or kanamycin agar plates depending on the vector s being ligated 3 Identify clones with the correct insert a Depending on the ratio of colony numbers for the cDNA sample vs the negative control sample randomly pick 5 or more well isolated colonies and grow each clone in 100 ul of LB Broth with 100 pg ml ampicillin or kanamycin at 37 C for 2 hours with shaking b Use 1 ul of each bacterial culture for screening DNA inserts by PCR and continue to grow the culture for another 4 hours Store the culture at 4 C c Prepare a PCR Master Mix with PCR primers flanking the insert Composition PCR primer 1 10 uM i d Mix the master mix very well and aliquot 24 ul into each well of 96 well PCR plate or individual tubes e Add 1 ul of each bacterial culture from step b into each well or tube f Proceed with PCR using the following program 94 C 4 min 1 cycle 94 C 0 5 min then 68 C 1 min 1 kb 25 cycles 68 C 3 min 1 cycle Depending on the size of final PCR product use a shorter or longer time g Take 5 ul of the PCR reaction and run it on a 1 2 agarose EtBr gel in 1X TAE buffer to identify clones with correct insert h Grow a positive clone containing insert in an appropriate amount of LB amp
15. ts If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2013 System Biosciences SBI 888 266 5066 Toll Free 650 968 2200 outside US Page 13
16. vector attBR2 5 actaccgccacctcgac 3 attBF2 5 atgtaggtcacggtctcgaag 3 11 Analyze the sequence data and map the results to the genome using BLAT analysis to identify the integration locus IV References Calos M 2006 phiC31 integrase system for gene therapy Curr Gene Ther 2006 Dec 6 6 633 45 Chalberg TW et al 2006 Integration specificity of phage phiC31 integrase in the human genome J Mol Biol 2006 Mar 17 357 1 28 48 Thyagarajan B et al 2001 Site specific genomic integration in mammalian cells mediated by phage phiC31 integrase Mol Cell Biol 2001 Jun 21 12 3926 34 Ortiz Urda S et al 2003 PhiC31 integrase mediated nonviral genetic correction of junctional epidermolysis bullosa Hum Gene Ther 2003 Jun 10 14 9 923 8 Quenneville SP et al 2004 Nucleofection of muscle derived stem cells and myoblasts with phiC31 integrase stable expression of a full length dystrophin fusion gene by human myoblasts Mol Ther 2004 Oct 10 4 679 87 Keravala A et al 2011 Long term phenotypic correction in factor IX knockout mice by using C31 integrase mediated gene therapy Gene Ther 2011 Aug 18 8 842 8 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual Chavez CL et al 2012 Long term expression of human coagulation factor VIII in a tolerant mouse model using the C31 integrase system Hum Gene Ther 2012 Apr 23 4 390 8 V Technical Support For more informat
17. wn at 37 C overnight in 200 ml of LB media containing either 50 ug ml of ampicillin C550 551 or kanamycin all other vectors After overnight growth plasmid DNA can be harvested from culture using an endotoxin free DNA plasmid maxiprep kit For confirmation of the plasmid we recommend performing restriction digestion analysis or direct sequencing to confirm integrity of the amplified plasmids B Cloning of Inserts into C31 Donor Vectors For rapid and efficient cloning of any insert into donor vectors we recommend SBI s Cold Fusion Cloning Kit as a ligase and restriction enzyme free cloning method More details can be found here http Awww systembio com molecular tools cold fusion cloning overview For standard cloning strategies please refer to the following protocol for more details 1 Ligation of insert into vector a Dilute gel purified digested vector to 10 ng ul b Setup 10 ul ligation reactions for each control and test samples as below Volume Item 1 0 ul C31 empty donor vector 7 0 ul DNA insert 30 50 ng or water control 1 0 ul 10X T4 DNA ligase buffer 1 0 ul T4 DNA Ligase 40 U ul 10 0 pl Total Reaction Volume c Incubate reactions at 25 C for 1 2 hours sticky end ligation or O N at 16 C for blunt end ligation 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual 2 Transform E coli with the ligation product Transform competent cells wi
Download Pdf Manuals
Related Search