pYES2.1-E and pYC2-E Echo - Thermo Fisher Scientific
Contents
1. 10X LiAc solution 10 fold with sterile deionized water 100 mM Lithium Acetate pH 7 5 5 mM Tris HCl pH 7 5 0 5 mM EDTA 1 For 100 ml mix together 10 ml of 10X LiAc and 5 ml of 10X TE 2 Add deionized water to 100 ml 3 Filter sterilize and store at room temperature 100 mM Lithium Acetate pH 7 5 4090 PEG 3350 10 mM Tris HCl pH 7 5 1 mM EDTA 1 Prepare solution immediately prior to use For 100 ml mix together 10 ml of 10X LiAc 10 ml of 10X TE and 40 g of PEG 3350 2 Add deionized water to 100 ml and dissolve the PEG You may have to heat the solution to fully dissolve the PEG 3 Autoclave at 121 C 15 psi for 20 minutes Store at room temperature Maps of pYES2 1 E and pYC2 E pYES2 1 E Map The map below shows the features of pYES2 1 E 5825 bp The complete sequence of the vector is available for downloading from our Web site www invitrogen com or from Technical Service page 26 Features of pYES2 1 E 5825 nucleotides GAL 1 promoter bases 1 451 GAL 1 promoter priming site bases 414 437 T7 promoter priming site bases 475 494 loxH site bases 507 540 CYC1 transcriptional termination region bases 570 823 CYC1 reverse priming site bases 587 605 pUC origin bases 1007 1680 Ampicillin resistance gene bla base 1825 2685 C URAS gene 2703 3810 C 2 micron origin bases 3814 5285 f1 origin bases 5353 5808 C complementary Continued on next page 21 Maps of pYE2. is stable for only 1 month Continued on next page Recipes continued SC Minimal Medium and Plates Induction Medium 18 SC is synthetic minimal defined medium for yeast 0 67 yeast nitrogen base without amino acids but with ammonium sulfate 2 carbon source i e glucose or raffinose 0 01 adenine arginine cysteine leucine lysine threonine tryptophan uracil 0 005 aspartic acid histidine isoleucine methionine phenylalanine proline serine tyrosine valine 2 agar for plates 1 Dissolve the following reagents in 900 ml deionized water 800 ml if preparing medium containing raffinose Note We make medium and plates as we need them and weigh out each amino acid Many researchers prepare 100X solutions of each amino acid that they need Reminder Omit uracil to make selective plates for growing pYES2 1 E or pYC2 E fusion vector transformants 6 7 g Yeast Nitrogen Base 0 1 g each 0 05 g each adenine aspartic acid arginine histidine cysteine isoleucine leucine methionine lysine phenylalanine threonine proline tryptophan W serine uracil U tyrosine valine 2 If you are making plates add the agar after dissolving the reagents above 3 Autoclave at 15 psi 121 C for 20 minutes 4 Cool to 50 C and add 100 ml of filter sterilized 20 glucose or 200 ml of filter sterilized 10 raffinose 5 Pour plates and allow to harden Invert the plates and store at 4 C Plates are
3. plasmid fusion e URA3 auxotrophic marker for selection of yeast transformants e Ampicillin resistance for selection in E coli The vectors differ in their mechanism of replication e pYES2 I E contains the 2p origin for episomal maintenance and high copy replication e pYC2 E contains the CEN6 ARSH4 sequence for non integrative centromeric maintenance and low copy replication For more information and a map of each vector please see pages 21 23 Other acceptor vectors are available separately and are provided with their own manuals For more information on other available acceptor vectors please visit our Web site www invitrogen com or call Technical Service see page 26 The pYES2 1 E vector contains the 2u origin for maintenance and replication in yeast The sequence containing the 2u origin was originally isolated from the naturally occurring yeast 2u plasmid Hartley and Donelson 1980 When placed in a heterologous expression plasmid i e pYES2 1 E the presence of the 2p origin allows the plasmid to be episomally maintained and replicated at high copy number generally 10 40 copies per cell The pY C2 E vector contains the CEN6 ARSH4 sequence for maintenance and replication in yeast Sikorski and Hieter 1989 The CEN6 ARSH4 sequence is a 518 bp hybrid DNA fragment that contains a yeast centromere sequence CEN and an autonomously replicating sequence ARS Sikorski and Hieter 1989 The CEN6 sequence is derived from
4. plates e Equilibrate a water bath to 42 C e Thaw the vial of SOC medium from the One Shot kit and bring to room temperature e Warm LB plates containing 50 ug ml kanamycin at 37 C for 30 minutes e Thaw on ice 1 vial of One Shot TOP10 E coli for each transformation 1 Add 5 ul of the recombination reaction to a vial of One Shot TOP10 E coli and mix gently Do not mix by pipetting up and down Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tubes to ice Add 500 ul of room temperature SOC medium Cap the tube tightly and shake the tube horizontally at 37 C for 45 minutes Qv pA dm OX d Spread 50 ul from each transformation on a pre warmed plate Pellet the remaining cells and resuspend the cell pellet in 50 ul SOC and plate Incubate overnight at 37 C 7 An efficient recombination reaction will produce hundreds of colonies Pick 5 colonies for analysis Continued on next page Transforming the Recombination Reaction continued Analyzing Positive Clones 1 Culture 5 colonies overnight at 37 C in 2 5 ml LB or SOB medium containing 50 ug ml kanamycin Isolate plasmid DNA using your method of choice If you need ultra pure plasmid DNA for automated or manual sequencing we recommend the S N A P MiniPrep Kit Catalog no K1900 01 or the S N A P MidiPrep Kit Catalog no K1910 01 Analyze the plasmids by restriction analysis Use an enzyme or enzymes that cut
5. stable for 6 months If you are making induction medium follow Steps 1 3 above except dissolve the reagents in 800 ml of deionized water Cool the medium to 50 C and add 100 ml of filter sterilized 20 galactose and 100 ml of filter sterilized 10 raffinose to the medium Note Raffinose is included to increase growth rate When making stock solutions of raffinose do not autoclave the stock solution Autoclaving the solution will convert the raffinose to glucose Filter sterilize the stock solution Continued on next page Recipes continued YPD 0 1 M Sodium Phosphate pH 7 4 10X TE 1X TE Yeast Extract Peptone Dextrose Medium 1 liter 196 yeast extract 2 peptone 2 dextrose D glucose 1 Dissolve the following in 1000 ml of water 10 g yeast extract 20 g peptone 20 g dextrose see note below if making plates 2 Optional Add 20 g agar if making plates 3 Autoclave for 20 minutes on liquid cycle 4 Store medium at room temperature or cool the medium and pour plates The shelf life is approximately one to two months Note If making plates omit dextrose from Step 1 Autoclaving agar and dextrose together will cause the dextrose to caramelize Prepare a separate stock solution of 20 dextrose and autoclave or filter sterilize After the YPD broth 900 ml volume has been autoclaved add 100 ml of 20 dextrose to the medium Before beginning have the following reagents on hand e Sodium ph
6. the Appendix page 18 The INVSc1 strain is a suitable strain to use for expression purposes but should not be used for genetic analyses because it does not sporulate well To initiate a culture of INVSc1 from the stab provided with the kit streak a small amount from the stab on a YPD plate see Appendix for recipe page 19 and incubate at 30 C Once growth is established you may check the phenotype of the strain by streaking a single colony on an SC minimal plate supplemented with the appropriate amino acids INVSc1 will not grow in SC minimal medium that is deficient in histidine leucine tryptophan or uracil Be sure to make glycerol stocks of the strain Store glycerol stocks at 80 C If you plan to use the strain directly from plates be sure that the plates are less than 4 days old Isolate plasmid DNA from E coli for yeast transformation using your method of choice We recommend the S N A P MiniPrep Kit Catalog no K1900 01 or the S N A P MidiPrep Kit Catalog no K1910 01 Other resin based methods are suitable The pYES2 1 E and pYC2 E are supplied with a corresponding positive control vector pYES2 1 E Uni acZ and pYC2 E Uni acZ respectively to help you optimize expression conditions for your protein The gene encoding p galactosidase is expressed in yeast cells under the control of the GAL promoter Successful transformation and galactose induction will result in B galactosidase expression that can b
7. vector Continued on next page Overview continued loxP or loxH Sites Cre Recombinase Selection of Recombinants The sequence of the loxP site is shown below The loxP site consists of a 34 bp sequence containing two 13 bp inverted repeats see underlined bases separated by an 8 bp spacer Hoess et al 1982 The inverted repeats may form a stem and loop structure that may reduce expression of the gene of interest in some cases A variation of the loxP site loxH see below was created to eliminate the formation of a stem and loop structure and improve expression Mutated bases are shown in boldface Please note that some acceptor vectors including pYES2 1 E and pYC2 E contain a loxH site Cre mediated recombination can still occur between a loxP and a loxH site although the efficiency may be slightly reduced e loxP ATA ACT TCG TAT AGC ATA CAT TAT ACG AAG TTAT e loxH ATT ACC TCA TAT AGC ATA CAT TAT ACG AAG TTA T Cre recombinase MW 35 kDa is a site specific recombinase that binds to specific sequences loxP sites brings together the target sites cleaves and covalently attaches to the DNA Recombination occurs following two pairs of strand exchanges and ligation of the DNAs in a novel recombinant form A nucleophilic hydroxylated tyrosine initiates the DNA cleavage event by attack on a specific phosphodiester bond followed by the covalent attachment of the recombinase to the target sequence through a phosphoami
8. 2 E Uni lacZ eta im i te e ero e ta be test ie p eet Batok ete 25 Technical Serie era ttt ta iaa Be ids tatu mit ra fd tate ta Area IAE Ra ER 26 Purchaser Notification aee ana teen er als e e edet e deed ede eed eet 27 Product Qualification air bie e RE eT I RR Hr t HD RD 28 References is e re endet iet itr E DER 29 iii Kit Contents and Storage Shipping and Storage Types of Kits The pYES2 1 E or pYC2 E Echo Adapted Expression Vectors are shipped on dry ice The INVSc1 stab is shipped at room temperature Upon receipt store the reagents as follows e pYES2 1 E or pYC2 E reagents at 20 C e One Shot Chemically Competent E coli at 80 C e INVScl stab at 4 C Several pYES2 1 E and pYC2 E Echo Cloning System Kits are available The table below lists the kits that include the pYES2 1 E or pYC2 E Echo Adapted Expression Vectors Kit Reagents Supplied Catalog nos pYES2 1 E Echo Adapted pYES2 1 E vector ET200 01 Expression Vector Kit Expression Control vector Cre Recombinase 10X Recombinase buffer T7 Forward Sequencing Primer INVScl pYC2 E Echo Adapted pYC2 E vector ET210 01 Expression Vector Kit Expression Control vector Cre Recombinase 10X Recombinase buffer T7 Forward Sequencing Primer INVScl pYES2 1 E Echo Adapted pUni V5 His TOPO TA Cloning Kit ET200 10C Expression Vector Kit with a choice of Donor Vector Kit and pUniBlunt V5 His TOPO Cloni
9. 2 ml of LB containing 50 ug ml kanamycin 3 Grow overnight until culture is saturated Mix 0 85 ml of culture with 0 15 ml of sterile glycerol and transfer to a cryovial Store at 80 C Yeast Transformation Introduction Basic Yeast Molecular Biology Genotype Phenotype of INVSc1 Initiating INVSc1 Culture Plasmid Isolation Positive Control 10 In this section you will use a small scale yeast transformation protocol to transform your pYES2 1 E or pYC2 E construct into the INVSc1 yeast host strain included with each vector After transformation induce expression of your recombinant fusion protein from pYES2 1 E or pYC2 E using galactose The user should be familiar with basic yeast molecular biology and microbiological techniques Please refer to Current Protocols in Molecular Biology Unit 13 Ausubel et al 1994 and the Guide to Yeast Genetics and Molecular Biology Guthrie and Fink 1991 for information on preparing yeast media and handling yeast The genotype and phenotype of the INVSc1 host strain are provided below Genotype MATa MATa his3AI his3AI leu2 leu2 trp1 289 trp1 289 ura3 52 ura3 52 Phenotype His Leu Trp Ura Note that INVSc1 is a diploid strain that is auxotrophic for histidine leucine tryptophan and uracil The strain will not grow in SC minimal medium that is deficient in histidine leucine tryptophan or uracil A recipe for preparation of SC minimal medium is provided in
10. Comp Transformation Kit Catalog no K5050 01 is designed for rapid preparation of transformation competent Saccharomyces cerevisiae cells Many of the reagents supplied in the pYES2 1 E or pYC2 E Echo Adapted Expression Vectors as well as additional reagents that may be used for Echo Cloning are available separately from Invitrogen Ordering information is provided below Product Amount Catalog No T7 Forward Primer 2 ug N560 02 One Shot TOP10 Chemically Competent E coli 21x50 ul C4040 03 One Shot PIR1 Chemically Competent E coli 11x50 ul C1010 10 One Shot PIR2 Chemically Competent E coli 11x50 ul C1111 10 Cre Recombinase 10 reactions R100 10 Continued on next page vii Accessory Products continued Donor Vectors The table below lists a variety of donor vectors currently available from Invitrogen to facilitate cloning of your gene of interest for use with Echo Cloning System Product Application Quantity Catalog no pUniD V5 His TOPO Directional cloning of blunt PCR 10 reactions ETO04 10 Cloning Kit products pUni V5 His TOPO TA Cloning A tailed PCR products 10 reactions ETOO1 10 Cloning Kit pUniBlunt V5 His TOPO Cloning blunt PCR products 10 reactions ET002 10 Cloning Kit pUni V5 His A B and C Cloning DNA fragments using 10 reactions ET003 10 restriction enzymes Detection and Purification After expressing your pro
11. Introduction Materials Supplied by the User Important Preparing for Transformation One Shot Transformation Reaction Once you have performed the recombination reaction you are ready to transform your E coli host We recommend TOP10 E coli for transformation but other strains may be used Strains should be endA and recA to ensure quality plasmid preparations and reduce the chances of recombination respectively In addition to general microbiological supplies i e plates spreaders you will need the following reagents and equipment e 42 C water bath e LB plates containing 50 ug ml kanamycin see Important below e 37 C shaking and non shaking incubator e SOC included in the One Shot kit It is important to select for the fusion plasmid using kanamycin Remember that the donor vector contains the R6Ky origin This origin can only be maintained in E coli strains containing the pir gene By fusing the plasmids kanamycin is now linked to the pUC origin allowing the fusion to be maintained in strains that do not contain the pir gene i e TOP10 By selecting on kanamycin you ensure that only colonies that contain the fusion vector are selected The following transformation protocol is for use with the One Shot TOP10 available with the kit If you are using other competent cells please follow the manufacturer s protocol For each transformation you will need one vial of competent cells and two selective
12. Invitrogen pYES2 1 E and pYC2 E Echo Adapted Expression Vectors For cloning of the gene of interest using the Echo Cloning System and expression in Saccharomyces cerevisiae Catalog nos ET200 XX ET210 XX Version J 29 December 2010 25 0340 ii Table of Contents Kat Contents and Storage 3 0 tt Bro redeo d pa t ed p o A sania iv Accessory Products aec Rau e E Ce o eec LR ree UH E RUE CE lua WE tr dp ges vii INTFOQUCHION WR M 1 jen 1 Jw ippIpev C 5 Recombining Your Gene into pYES2 1 E or pYC2 E ueesersessesensnesnenesnensesnonsennnennnenensennonsensnnsennnenenenn 5 Transforming the Recombination Reaction seesseeeeeeeeeeeee nennen nennen nennen trennen nre trennen nennen rennen nnne n trennen 6 Yeast FransfOfmmatlOn 24 nre Gc t RR e De EEE GRON GROVE LA RE Hsu erat EA E ERE e dede tert 10 Expression of Your Recombinant Protein esses etre nnne trennen trennen ener 12 APPENGIX e aani 16 Small Scale Yeast Transformation sese eene enne trennen tnter terere ene nnne nnne 16 Recipes RE eua Rane ET ERO es 17 Maps of pYES2 1 E and pYC2 E onde beo E a t rede rte Does 21 Features of pYBS2 1 E and PY C2 Ei unse enter me rennen 23 Map of pYES2 I E Unmc l acZ ee dte tte te ette i ernannte 24 Map of pYC
13. S2 1 E and pYC2 E continued pYC2 E Map The map below shows the features of pYC2 E 4489 bp The complete sequence of the vector is available for downloading from our Web site www invitrogen com or from Technical Service page 26 Features of pYC2 E 4489 nucleotides GAL 1 promoter bases 1 451 GAL 1 Forward priming site bases 414 437 T7 promoter priming site bases 475 494 loxH site bases 507 540 CYC1 transcriptional termination region bases 570 823 CYC1 Reverse priming site bases 587 605 pUC origin bases 1007 1680 Ampicillin resistance gene bases 1825 2685 C URA3 gene bases 2703 3810 C CEN6 ARSH4 bases 3823 4341 f1 origin bases 4342 4447 C complementary strand 22 Features of pYES2 1 E and pYC2 E The important elements of pYES2 1 E and pYC2 E are described in the following table All features have been functionally tested Feature Benefit GALI promoter Permits galactose inducible expression of genes cloned into pYES2 CT West et al 1984 GALI forward priming site Allows sequencing through the insert T7 promoter priming site Allows for in vitro transcription in the sense orientation and sequencing through the insert loxH site Allows recombination between the donor vector and pYES2 1 E and pYC2 E Hoess et al 1982 CYCI transcription termination signal Permits efficient termination and stabilization of mRNA CYC reverse priming site Allo
14. Web site www invitrogen com or call Technical Service for more information see page 26 Materials Needed Be sure to have the following reagents on hand before starting YPD liquid medium see Recipe page 19 1X TE see Recipe page 19 1X LiAc 0 5X TE see Recipe page 20 Denatured salmon sperm DNA Sigma Aldrich Catalog no D9156 Fusion vector construct or other plasmid DNA to be transformed 1X LiAc 40 PEG 3350 1X TE See Recipe page 20 DMSO Selective plates Protocol 1 Inoculate 10 ml of YPD medium with a colony of INVSc1 and shake overnight at 30 C 2 Determine the OD of your overnight culture Dilute culture to an ODeoo of 0 4 in 50 ml of YPD medium and grow an additional 2 4 hours 3 Pellet the cells at 1500 x g and resuspend the pellet in 40 ml 1X TE 4 Pellet the cells at 1500 x g and resuspend the pellet in 2 ml of 1X LiAc 0 5X TE 5 Incubate the cells at room temperature for 10 minutes 6 Foreach transformation mix together 1 ug plasmid DNA and 100 ug denatured sheared salmon sperm DNA with 100 ul of the yeast suspension from Step 5 7 Add 700 ul of 1X LiAc 40 PEG 3350 1X TE and mix well Incubate solution at 30 C for 30 minutes Add 88 ul DMSO mix well and heat shock at 42 C for 7 minutes 10 Centrifuge in a microcentrifuge for 10 seconds and remove supernatant 11 Resuspend the cell pellet in 1 ml 1X TE and re pellet 12 Resuspend the cell pellet in 50 100 ul 1X TE and plate on a se
15. buyer cannot modify the recombination sequence s contained in this product for any purpose This product is the subject of U S and foreign patents Rights to use this product are limited to academic research use only Non academic entities are required to obtain a separate license from Washington Research Foundation to utilize this product for any use Washington Research Foundation 2815 Eastlake Avenue East Suite 300 Seattle Washington 98102 Tel 206 336 5600 Fax 206 336 5615 The INVSc1 yeast strain is genetically modified and carries the auxotrophic reporter gene HIS3 As a condition of sale this product must be in accordance with all applicable local legislation and guidelines including EC Directive 90 219 EEC on the contained use of genetically modified organisms 27 Product Qualification Vectors Primers INVSc1 Cre Recombinase One Shot TOP10 Competent E coli 28 pYES2 1 E pYES2 1 E Uni lacZ pYC2 E and pYC2 E Uni lacZ are qualified by restriction digest The restriction enzymes and the expected fragments are listed below Restriction pYES2 1 E pYES2 1 E pYC2 E pYC2 E Uni Enzyme Uni lacZ lacZ Apal I 4579 bp Not tested 3243 bp Not tested 1246 bp 1246 bp EcoR V Not tested 4634 bp Not tested 4634 bp 4103 bp 2767 bp 2457 bp 2457 bp Hind III 5725 bp 6120 bp 4489 bp 5074 bp 5074 bp 4784 bp Drd I Not tested Not tested 4489 bp Not tested BamH I Not tested Not tested Not test
16. cking uracil SC U Transformants should exhibit the uracil prototrophy See the Appendix page 18 for a recipe to prepare SC minimal media Once you have identified a transformant be sure to purify the colony and make a glycerol stock for long term storage Maintain yeast cells containing your pYES2 1 E or pYC2 E fusion vector in SC U medium containing 2 glucose or 2 raffinose see the next page Note The growth rate of yeast strains varies with the carbon source Yeast strains typically exhibit the fastest growth in medium containing glucose Expression of Your Recombinant Protein Introduction GAL1 Promoter 12 Once you have obtained a transformant containing your pYES2 1 E or pYC2 E fusion vector you are ready to induce expression of your recombinant fusion protein of interest This section provides information on how to induce and assay for expression of your protein of interest In INVScl transcription from the GALI promoter is repressed in the presence of glucose West et al 1984 Removing glucose and adding galactose as a carbon source induces transcription Giniger et al 1985 Maintaining cells in glucose gives the most complete repression and the lowest basal transcription of the GAL promoter Transferring cells from glucose to galactose containing medium causes the GAL promoter to become de repressed and allows transcription to be induced Alternatively cells may be maintained in medium containi
17. ditional international offices are listed on our Web page www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 1600 Faraday Avenue LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech_service invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com Material Data Safety Sheets MSDSs Limited Warranty 26 MSDSs are available on our Web site at www invitrogen com On the home page click on Technical Resources and follow instructions on the page to download the MSDS for your product Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Service Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invit
18. e Acid washed glass beads 0 4 0 6 mm size Sigma Aldrich Catalog no G8772 Protocol 1 You may prepare cell lysates from either frozen cells or fresh cells Reminder You will need to know the OD of your cell sample s before beginning see Step 5 previous page 2 Resuspend fresh or frozen cell pellets in 500 ul of breaking buffer Centrifuge at 1500 x g for 5 minutes at 4 C to pellet cells 3 Remove supernatant and resuspend the cells in a volume of breaking buffer to obtain an ODs of 50 100 Use the OD o9 determined in Step 5 previous page to calculate the appropriate volume of breaking buffer to use Add an equal volume of acid washed glass beads 5 Vortex mixture for 30 seconds followed by 30 seconds on ice Repeat four times for a total of four minutes to lyse the cells Cells will be lysed by shear force You can check for the extent of lysis by checking a small aliquot under the microscope Centrifuge in a microcentrifuge for 10 minutes at maximum speed 7 Remove supernatant and transfer to a fresh microcentrifuge tube Assay the lysate for protein concentration using BSA as a standard 8 Add SDS PAGE sample buffer to a final concentration of 1X and heat the sample for 5 minutes at 70 C 9 Load 20 ug of lysate onto an SDS PAGE gel and electrophorese Use the appropriate percentage of acrylamide to resolve your recombinant protein If you cloned your PCR product in frame with the C terminal peptide this will
19. e Plasmids Mol Cell Biol 6 2354 2363 Gietz D Jean A S Woods R A and Schiestl R H 1992 Improved Method for High Efficiency Transformation of Intact Yeast Cells Nuc Acids Res 20 1425 Gietz R D Schiestl R H Willems A R and Woods R A 1995 Studies on the Transformation of Intact Yeast Cells by the LiAc SS DNA PEG Procedure Yeast 11 355 360 Giniger E Varnum S M and Ptashne M 1985 Specific DNA Binding of GALA a Positive Regulatory Protein of Yeast Cell 40 767 774 Guthrie C and Fink G R 1991 Guide to Yeast Genetics and Molecular Biology In Methods in Enzymology Vol 194 J N Abelson and M I Simon eds Academic Press San Diego CA Hartley J L and Donelson J E 1980 Nucleotide Sequence of the Yeast Plasmid Nature 286 860 865 Hill J Donald K A and Griffiths D E 1991 DMSO Enhanced Whole Cell Yeast Transformation Nucleic Acids Res 9 5791 Hoess R H Ziese M and Sternberg N 1982 P1 Site Specific Recombination Nucleotide Sequence of the Recombining Sites Proc Natl Acad Sci USA 79 3398 3402 Liu Q Li M Z Leibham D Cortez D and Elledge S 1998 The Univector Plasmid Fusion System a Method for Rapid construction of Recombinant DNA Without Restriction Enzymes Current Biology 8 1300 1309 Liu Q Li M Z Liu D and Elledge S J 1999 Rapid Construction of Recombinant DNA by the Univector Plasmid Fusion Sy
20. e easily assayed see next page Continued on next page Yeast Transformation continued Assay for galactosidase Activity Reagents for Yeast Transformation Transforming Yeast Maintaining Transformants You may assay for B galactosidase expression by activity assay using cell free lysates Miller 1972 Invitrogen offers the B Gal Assay Kit Catalog no K1455 01 for fast and easy detection of f galactosidase expression Many protocols are suitable for the preparation of competent INVSc1 yeast cells The S c EasyComp Kit Catalog no K5050 01 provides a quick and easy method for the preparation of competent yeast cells that can be used immediately or stored frozen for future use Transformation efficiency is guaranteed at gt 10 transformants per ug DNA A small scale yeast transformation protocol is included in the Appendix see page 16 for your convenience Alternatively there are published references for other small scale transformation methods Gietz et al 1992 Gietz et al 1995 Hill et al 1991 Schiestl and Gietz 1989 Use one of the methods described above or one of your own choosing to transform your pYES2 1 E or pYC2 E fusion vector into competent INVSc1 We recommend that you include the appropriate control vector see the previous page as a positive control for expression and a sample with no DNA as a negative control for transformation Select for transformants on SC minimal media la
21. ed 9858 bp Pme I 5825 bp Not tested 4489 bp Not tested The T7 Forward Sequencing primer has been lot qualified by DNA sequencing experiments using the dideoxy chain termination technique The INVSc1 yeast strain is tested for growth on YPD medium Purity gt 95 homogeneity Endonuclease activity Negative Exonuclease activity Negative Functional Assay Cre recombinase is qualified using the assay on page 5 of this manual The donor vector is pUni lacZ and the acceptor vector is pcDNA3 1 E Five microliters of the recombination reaction is transformed into 50 ul One Shot TOP10 competent E coli using the protocol on page 6 Twenty five microliters of the transformation reaction is plated on LB plates containing 50 ug ml kanamycin and X gal performed in duplicate One microliter of Cre recombinase should yield 2500 blue kanamycin resistant transformants All competent cells are qualified as follows e Cells are tested for transformation efficiency using the control plasmid included in the kit Transformed cultures are plated on LB plates containing 100 ug ml ampicillin and the transformation efficiency is calculated Test transformations are performed in duplicate Transformation efficiency should be 1 x 10 cfu ug DNA for chemically competent cells e To verify the absence of phage contamination 0 5 1 ml of competent cells are added to LB top agar and poured onto LB plates After overnight incubatio
22. increase the size of your protein by 3 kDa Continued on next page Expression of Recombinant Protein continued Scale up of Expression for Purification Purification Once you have determined the optimal induction time necessary to obtain maximal protein expression you may increase the protein yield by scaling up the procedure described on page 13 If you plan to use ProBond resin to purify your recombinant fusion protein please see the Note below To prepare cell lysates from culture volumes over 1 liter we recommend that you use a bead beater Biospec Products Bartlesville OK to lyse the cells Please refer to Current Protocols in Molecular Biology Unit 13 13 Ausubel et al 1994 for a suitable protocol to lyse cells with a bead beater For help with purification of your recombinant fusion protein please refer to the ProBond Purification System manual You can download the manual from our Web site www invitrogen com or request a copy from Technical Services see page 26 If you are using another type of resin please refer to the manufacturer s recommendations Appendix Small Scale Yeast Transformation Introduction A small scale yeast transformation protocol for routine transformations is provided below Other protocols are suitable The S c EasyComp Transformation Kit Catalog no K5050 01 is available from Invitrogen for rapid preparation of transformation competent yeast cells Please visit our
23. itrogen Corporation 1600 Faraday Avenue Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech service invitrogen com For country specific contact information visit our web site at www invitrogen com
24. lective plate Note at the number of yeast cells assume that 1 OD unit 2 0 x 107 yeast 16 Recipes LB Luria Bertani Medium and Plates SOB Medium with Kanamycin Composition 1 0 Tryptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 Forl liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter Autoclave on liquid cycle for 20 minutes at 15 psi Allow solution to cool to 55 C and add antibiotic if needed 4 Store at room temperature or at 4 C LB agar plates 1 Prepare LB medium as above but add 15 g L agar before autoclaving 2 Autoclave on liquid cycle for 20 minutes at 15 psi 3 After autoclaving cool to 55 C add antibiotic 50 ug ml of kanamycin and pour into 10 cm plates 4 Let harden then invert and store at 4 C in the dark SOB per liter 2 Tryptone 0 596 Yeast Extract 0 05 NaCl 2 5 mM KCI 10 mM MgCl 1 Dissolve 20 g tryptone 5 g yeast extract and 0 5 g NaCl in 950 ml deionized water 2 Makea250 mM KCI solution by dissolving 1 86 g of KCl in 100 ml of deionized water Add 10 ml of this stock KCI solution to the solution in Step 1 3 Adjust pH to 7 5 with 5 M NaOH and add deionized water to 1 liter 4 Autoclave this solution cool to 55 C and add 10 ml of sterile 1 M MgCL You may also add kanamycin to 50 ug ml 5 Store at 4 C Medium
25. ly transformed diploid strain Store at 4 C Genotype MATa his3Al leu2 trp1 289 ura3 52 MATa his3A1 leu2 trp1 289 ura3 52 Continued on next page Kit Contents and Storage continued One Shot TOP10 E coli Genotype of TOP10 vi The table below describes the items included in the One Shot TOP10 Chemically Competent E coli kit Store at 80 C Item Composition Amount SOC Medium 2 Tryptone 6 ml may be stored at room 0 5 Yeast Extract temperature or 4 C 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO4 20 mM glucose TOPIO E coli 11x50ul pUC19 Control DNA 10 pg ul in 5 mM Tris HCl 50 ul 0 5 mM EDTA pH 8 Use this strain for transformation of the fusion vector Note This strain cannot be used for transformation and growth of donor vectors F mcrA A mrr hsdRMS mcrBC 80lacZAM15 AlacX74 recAl araD139 A ara leu 7697 galU galK rpsL Str endA1 nupG Accessory Products Products Available Separately Transformation Kit Echo Cloning Products Many of the reagents in the pYES2 1 E and pYC2 E Echo Adapted Expression Vector Kits and additional reagents that may be used with the Echo Cloning System are available separately In addition reagents for expression detection and purification of your protein of interest from your pYES2 1 E or pYC2 E fusion vector are available from Invitrogen Ordering information is provided below The S c Easy
26. n no plaques should be detected e Untransformed cells are plated on LB plates 100 ug ml ampicillin 25 ug ml streptomycin 50 ug ml kanamycin or 15 ug ml chloramphenicol to verify the absence of antibiotic resistant contamination References Abremski K and Hoess R 1984 Bacteriophage P1 Site Specific Recombination Purification and Properties of the Cre Recombinase Protein J Biol Chem 259 1509 1514 Abremski K Hoess R and Sternberg N 1983 Studies on the Properties of P1 Site Specific Recombination Evidence for Topologically Unlinked Products Following Recombination Cell 32 1301 1311 Abremski K E and Hoess R H 1992 Evidence for a Second Conserved Arginine Residue in the Integrase Family of Recombination Proteins Protein Eng 5 87 91 Argos P Landy A Abremski K Egan J B Haggard Ljungquist E Hoess R H Kahn M L Kalionis B Narayana S V L Pierson III L S Sternberg N and Leong J M 1986 The Integrase Family of Site Specific Recombinases Regional Similarities and Global Diversity EMBO J 5 433 440 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Bouton A H and Smith M M 1986 Fine Structure Analysis of the DNA Sequence Requirements for Autonomous Replication of Saccharomyces cerevisia
27. ng Kit ET200 20C One Shot TOP10 Chemically Competent E coli see page viii pUni V5 His A B and C ET200 30C for more information on donor uniD VS His TOPO Cloning Kit ET200 40C vectors pYC2 E Echo Adapted pUni V5 His TOPO TA Cloning Kit ET210 10C Expression Vector Kit with a choice of Donor Vector Kit and pUniBlunt V 5 His TOPO Cloning Kit ET210 20C One Shot TOP10 Chemically Competent E coli see page viii pUni V5 His A B and C ET210 30C for more information on donor LmiD V5 His TOPO Cloning Kit ET210 40C vectors Continued on next page Kit Contents and Storage continued pYES2 1 E and pYC2 E Reagents INVSc1 S cerevisiae Strain pYES2 1 E and pYC2 E reagents are listed below Store at 20 C Item Concentration Amount pYES2 1 E or pYC2 E Supercoiled lyophilized in TE pH 8 20 ug Cre recombinase Please check the label on the tube for 15 ul exact concentration of the enzyme Enzyme supplied in 50 mM Tris HCl pH 8 0 5 mM EDTA 1 mM EGTA 10 mM f mercaptoethanol 2096 Glycerol 10X Recombinase Buffer 500 mM Tris HCl pH 7 5 25 ul 100 mM MgCl 300 mM NaCl 1 0 mg ml BSA T7 Forward Sequencing Lyophilized in TE Buffer pH 8 2 ug Primer 20 mer S TAATACGACTCACTATAGGG 2 327 pmoles Expression control Supercoiled lyophilized in TE pH 8 20 ug pYES2 1 E Uni lacZ or pYC2 E Uni lacZ INVScl Yeast strain 1 stab INVScl is a fast growing easi
28. ng raffinose as a carbon source The presence of raffinose does not repress or induce transcription from the GALI promoter Addition of galactose to the medium induces transcription from the GAL promoter even in the presence of raffinose Induction of the GAL promoter by galactose is more rapid in cells maintained in raffinose when compared to those maintained in glucose You may choose to grow cells containing your pYES2 1 E or pYC2 E fusion vector in glucose or raffinose depending on how quickly you want to obtain your expressed protein after induction with galactose and on the toxicity of the expressed protein For more information about expression in yeast please refer to the Guide to Yeast Genetics and Molecular Biology Guthrie and Fink 1991 For a protocol to induce expression of your fusion protein with galactose proceed to Time Course of Protein Induction by Galactose on the next page Continued on next page Expression of Recombinant Protein continued Time Course of To induce expression of your protein of interest from the GALI promoter galactose is Protein Induction added to the medium For cells that have been maintained in glucose recombinant fusion by Galactose protein can be detected in as little as 4 hours after galactose induction Recombinant fusion protein can be detected in cells that have been cultured in raffinose by 2 hours after galactose induction If you are assaying for expression of your recombinant f
29. ng site bases 414 437 T7 promoter priming site bases 475 494 loxH site bases 507 540 lacZ ORF bases 561 3617 V5 epitope bases 3630 3671 6xHis tag bases 3681 3698 pUni Reverse priming site bases 3760 3781 BGH polyadenylation region bases 3779 3987 T7 transcriptional termination region bases 4002 4130 Kanamycin resistance gene bases 4309 5103 C kan promoter region bases 5104 5241 C R6Ky origin bases 5464 5855 pUni Forward priming site bases 5823 5841 loxP site bases 5876 5909 CYC7 transcription termination region bases 5939 6192 CYC1 Reverse priming site bases 5956 5974 pUC origin bases 6376 7049 Ampicillin resistance gene bla bases 7194 8054 C URAS gene bases 8072 9179 C 2 micron origin bases 9183 10654 f1 origin bases 10722 11177 C complementary strand Map of pYC2 E Uni lacZ Description Map of Control Vector pYC2 E Uni lacZ is a 9858 bp control vector expressing B galactosidase The lacZ gene was amplified and TOPO Cloned into pUni V5 His Gene TOPO The resulting vector was recombined with pYC2 E using Cre recombinase to create pYC2 E Uni lacZ Note pUni V5 His Gene TOPO is similar to pUni V5 His TOPO TA except that it contains additional DNA between the TOPO Cloning site and the V5 epitope The figure below summarizes the features of the pYC2 E Uni lacZ vector The complete nucleotide sequence for pY C2 E Uni acZ is available for downloading from our Web site w
30. no acid bond Abremski and Hoess 1992 Argos et al 1986 The reaction does not require any host factors or ATP but does require Mg or spermidine for activity Abremski et al 1983 Recombination between two supercoiled substrates each containing a loxP site results in a supercoiled dimer The extent of the reaction is 10 20 under optimal conditions Abremski and Hoess 1984 Abremski et al 1983 By fusing the two plasmids kanamycin resistance from the donor vector is now linked to the pUC origin of replication The recombination reaction is transformed into TOP10 E coli and recombinants selected by plating the transformation reaction onto plates containing kanamycin Because the donor plasmid carries the R6Ky origin of replication it will not propagate in TOP10 In addition the acceptor vector which carries the ampicillin resistance gene will not be selected Therefore every colony that is selected on kanamycin will represent a recombined fusion plasmid Continued on next page Overview continued pYES2 1 E and pYC2 E 2y Origin CEN6 ARSH4 Sequence pYES2 1 E or pYC2 E allow you to induce expression of your protein of interest in S cerevisiae Both pYES2 1 E and pYC2 E contain the following features e Yeast GALI promoter for high level inducible protein expression in yeast by galactose and repression by glucose Giniger et al 1985 West et al 1984 see page 12 for more information e AloxH site for
31. once in the donor vector and once in the acceptor vector to yield two fragments that are distinguishable from one another Please note that other strategies are possible Optional To sequence the fusion plasmid to confirm the fusion junctions we recommend using the T7 Forward and Unil Forward sequencing primers Refer to the diagram on the following page for the sequences around the pYES2 1 E or pYC2 E loxH site Refer to the donor vector manual for the sequence around the donor vector loxP site If you need help with setting up restriction enzyme digests or DNA sequencing refer to general molecular biology texts Ausubel et al 1994 Sambrook et al 1989 Continued on next page Transforming the Recombination Reaction continued Sequencing Your Aside from the origin of replication the pYES2 1 E and pYC2 E sequences are identical Construct in Recombination into either vector produces the same sequence upstream of your insert pYES2 1 E or This sequence is shown below Unique restriction sites are labeled for your convenience pYC2 E Note that the complete sequence of pYES2 1 E and pYC2 E can be downloaded from our Web site www invitrogen com or requested from Technical Service page 26 GAL 1 promoter TATA box 300 TTAACAGATA TATAAATGCA AAAACTGCAT AACCACTTTA ACTAATACTT TCAACATTTT m start of transcription m 360 CGGTTTGTAT TACTTCTTAT TCAAATGTAA TAAAAGTATC AACAAAAAAT TGTTAATATA GAL1 forward priming site 9 end of GALT
32. ormation below and on the next page before performing the recombination reaction To prepare pYES2 1 E or pYC2 E for use add 20 ul of sterile deionized water to the lyophilized plasmid This will yield a 1 ug ul stock solution You can further dilute a small aliquot or use as is Store at 20 C when you are finished If you wish to propagate this plasmid or prepare more plasmid DNA you may transform this plasmid into TOP10 E coli as described on pages 6 7 Use 10 100 ng plasmid for transformation and select on LB plates containing 50 100 ug ml ampicillin You will need the following reagents and equipment 100 ng of your donor vector 100 ng of pYES2 1 E or pYC2 E e Microcentrifuge tubes e Heat blocks set at 37 C and 65 C e Ice bucket with ice e Cre recombinase included in the kit e 10X Recombinase buffer included in the kit 1 Set up each 20 ul recombination reaction on ice as follows Donor vector 100 ng x pl pYES2 1 E or pYC2 E 100 ng yul 10X Recombinase buffer 2 ul Deionized water add to a total volume of 19 pl Cre recombinase lul Final volume 20 ul Incubate at 37 C for 20 minutes Incubate at 65 C for 5 minutes to inactivate the recombinase Bo Place tube on ice and proceed to Transformation next page If you run out of time you may store the recombination reaction at 4 C or 20 C overnight Longer storage times have not been tested Transforming the Recombination Reaction
33. osphate monobasic NaH PO H O Sigma Aldrich S9638 e Sodium phosphate dibasic Na HPO 7H 0 Sigma Aldrich S9390 1 Prepare 100 ml of 1 M NaH PO H50 by dissolving 13 8 g in 90 ml of deionized water Bring volume up to 100 ml Filter sterilize 2 Prepare 100 ml of 1 M Na HPO 7H 0 by dissolving 26 81 g in 90 ml of deionized water Bring volume up to 100 ml Filter sterilize 3 For liter of 0 1 M sodium phosphate pH 7 4 mix together 22 6 ml of 1 M NaH3PO and 77 4 ml of 1 M Na HPO Bring up the volume to 1 liter with sterile water 4 Filter sterilize and store at room temperature 100 mM Tris pH 7 5 10 mM EDTA 1 For 100 ml dissolve 1 21 g of Tris base and 0 37 g of EDTA in 90 ml of deionized water 2 Adjust the pH to 7 5 with concentrated HCl and bring the volume up to 100 ml 3 Filter sterilize and store at room temperature Alternatively you can make the solution using 1 M Tris HCl pH 7 5 and 0 5 M EDTA pH 8 0 10 mM Tris pH 7 5 1 mM EDTA Dilute 10X TE 10 fold with sterile water Continued on next page 19 Recipes continued 10X LiAc 1X LiAc 1X LiAc 0 5X TE 1X LiAc 40 PEG 3350 1X TE 20 1 M Lithium Acetate pH 7 5 1 For 100 ml dissolve 10 2 g of lithium acetate in 90 ml of deionized water 2 Adjust pH to 7 5 with dilute glacial acetic acid and bring up the volume to 100 ml 3 Filter sterilize and store at room temperature 100 mM Lithium Acetate pH 7 5 Dilute
34. promoter zz ea dun u 420 CCTCTATACT TTAACGTCAA GGAGAAAAAA CCCCGGATCG GACTACTAGC AGCTGTAATA T7 promoter priming site Hind III loxH site 1 480 CGACTCACTA TAGGGAATAT TAAGCTT ATT ACC TCA TAT AGC ATA CAT TAT ACG AAG Uni1 Forward priming site RBS fi Geneof Ic i rom terminal ta 537 TTA T PR interest optional donor vector Pme l GTTTAAACCC GCTGATCCTA GAGGGCCGCA TCATGTAATT AGTTATGTCA Continued on next page Transforming the Recombination Reaction continued Fusion Vector It should be clear from restriction analysis that you have a dimer fusion plasmid consisting Analysis of the donor vector and pYES2 1 E or pYC2 E Occasionally trimers will result Trimers usually consist of two donor vector molecules and one acceptor molecule Please note that trimers usually express as well as the dimer product In theory trimers may result from two sequential fusion events or a single fusion event between a pre existing monomeric substrate and a dimeric substrate The production of trimers can be eliminated if gel purified monomeric supercoiled DNA is used in the recombination reaction Preparing Glycerol Once you have identified the correct clone prepare a glycerol stock for long term Stock for Long storage In addition store a stock of plasmid DNA at 20 C Term Storage 1 Streak out the original colony on LB plates containing 50 ug ml kanamycin 2 Select a single colony and inoculate into 1
35. rifuge the cells at 1500 x g for 5 minutes at 4 C Decant the supernatant Resuspend cells in 500 ul of sterile water Transfer cells to a sterile microcentrifuge tube Centrifuge samples for 30 seconds at top speed in the microcentrifuge 9 Remove the supernatant 10 Store the cell pellets at 80 C until ready to use Proceed to the next section to prepare cell lysates to detect your recombinant protein see the next page Continued on next page Expression of Recombinant Protein continued Detection of Recombinant Fusion Protein Note 14 To detect expression of your recombinant fusion protein by western blot see below you may use the Anti V5 or the Anti His C term antibodies available from Invitrogen see page viii for ordering information or an antibody to your protein of interest You will also need to prepare a cell lysate from your yeast transformant A general protocol for small scale preparation of cell lysates using acid washed glass beads is provided below for your convenience Other protocols are suitable Please refer to Current Protocols in Molecular Biology Unit 13 13 Ausubel et al 1994 for more information For large scale preparations culture volumes over liter see Scale up on the next page Materials Needed e Breaking buffer 50 mM sodium phosphate pH 7 4 1 mM EDTA 5 glycerol 1 mM PMSF please refer to Appendix page 19 for instructions to prepare the sodium phosphate stock buffer
36. rogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Limited Use Label License No 119 Echo Cloning Products Limited Use Label License No 141 Expression of Polypeptides in Yeast Information for European Customers No license is conveyed to use this product with any recombination sites other than those purchased from Invitrogen Corporation or its authorized distributor The
37. stem Methods in Enzymology in press Miller J H 1972 Experiments in Molecular Genetics Cold Spring Harbor New York Cold Spring Harbor Laboratory Panzeri L and Philippsen P 1982 Centromeric DNA from Chromosome VI in Saccharomyces cerevisiae Strains EMBO 1605 1611 Continued on next page 29 References continued Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition Plainview New York Cold Spring Harbor Laboratory Press Schiestl R H and Gietz R D 1989 High Efficiency Transformation of Intact Cells Using Single Stranded Nucleic Acids as a Carrier Curr Genet 16 339 346 Sikorski R S and Hieter P 1989 A System of Shuttle Vectors and Yeast Host Strains Designed for Efficient Manipulation of DNA in Saccharomyces cerevisiae Genetics 122 19 27 Sternberg N Hamilton D Austin S Yarmolinsky M and Hoess R 1981 Site Specific Recombination and its Role in the Life Cycle of Pl CSH Symp Quant Biol 45 297 309 West R W J Yocum R R and Ptashne M 1984 Saccharomyces cerevisiae GAL1 GAL 10 Divergent Promoter Region Location and Function of the Upstream Activator Sequence UAS Mol Cell Biol 4 2467 2478 1999 2006 2010 Invitrogen Corporation All rights reserved For research use only Not for any animal or human therapeutic or diagnostic use 30 invitrogen Corporate Headquarters Inv
38. tein of interest from your pYES2 1 E or pYC2 E fusion vector use the reagents below to detect and purify your protein of interest Product Amount Catalog No Anti His C term Antibody 50 ul R930 25 Anti His C term HRP Antibody 50 ul R931 25 Anti V5 Antibody 50 ul R960 25 Anti V5 HRP Antibody 50 ul R961 25 ProBond Purification System 6 purifications K850 01 ProBond Metal Binding Resin 50 ml R801 01 precharged resin provided as a 50 slurry in 20 150 ml R801 15 ethanol Purification Columns 50 R640 50 10 ml polypropylene columns Enough for 25 Westerns viii Overview Introduction Echo Cloning System Plasmid Fusion Introduction The Echo Cloning System allows direct recombination of your gene of interest downstream of an appropriate promoter for expression in the host system of choice The vectors pYES2 1 E and pYC2 E are specifically designed for regulated expression of recombinant proteins in S cerevisiae The GALI promoter regulates expression in yeast The Echo Cloning System is based on the univector plasmid fusion system UPS described by Elledge and coworkers to quickly and easily recombine a gene of interest into a series of recipient acceptor vectors Liu et al 1998 Liu et al 1999 The system consists of the univector donor vector containing the gene of interest and recipient acceptor vectors containing various regulatory sequences for e
39. the CEN6 locus of yeast chromosome 6 Panzeri and Philippsen 1982 while the ARSH4 sequence is derived from the yeast histone H4 associated ARS Bouton and Smith 1986 When placed in a heterologous expression plasmid i e pYC2 E the presence of the CEN6 ARSH4 sequence allows non integrative centromeric maintenance and low copy number replication of the plasmid generally 1 2 copies per cell Continued on next page Overview continued Experimental Outline The table below describes the general steps needed to recombine transform and express your protein of interest Step Action Page 1 Perform the recombination reaction using your donor vector and 5 pYES2 1 E or pYC2 E 2 Transform the recombination reaction into competent TOP10 E coli and 6 select recombinants on LB plates containing 50 ug ml kanamycin 3 Pick transformants and analyze by restriction digestion 7 4 Isolate plasmid DNA transform into INVSc1 and select for uracil 10 11 prototrophy 5 Induce with galactose to express your gene of interest 12 13 Assay for expression of your protein 14 7 Purify your protein if desired 15 Methods Recombining Your Gene into pYES2 1 E or pYC2 E Introduction Preparing pYES2 1 E or pYC2 E Before Starting Recombination Reaction At this point you should have a plasmid preparation of your donor vector in addition to pYES2 1 E or pYC2 E Please review the inf
40. usion protein for the first time we recommend that you perform a time course to optimize expression of your recombinant protein e g 0 4 8 12 16 24 hours after galactose induction A standard protocol is provided below to perform a time course experiment Other protocols are suitable 1 Inoculate a single colony of INVSc1 containing your pYES2 1 E or pYC2 E fusion vector into 15 ml of SC U selective medium containing 2 glucose or 2 raffinose Grow overnight at 30 C with shaking 2 Determine the OD o of your overnight culture Calculate the amount of overnight culture necessary to obtain an OD6o of 0 4 in 50 ml of induction medium SC U selective medium containing 2 galactose Example Assume that the OD of an overnight culture is 3 ODeo per ml Then the amount of overnight culture needed to inoculate a 50 ml culture to OD 0 4 is 0 4 OD ml 50 ml 6 67 ml 3 OD ml 3 Remove the amount of overnight culture as determined in Step 2 and pellet the cells at 1500 x g for 5 minutes at room temperature Discard the supernatant Resuspend the cells in 50 ml of induction medium Grow at 30 C with shaking 5 Harvest an aliquot of cells at 0 4 8 12 16 and 24 hours after addition of cells to the induction medium For each time point remove 5 ml of culture from the flask and determine the OD6oo of each sample You will use this information when assaying for your recombinant fusion protein see Step 3 on the next page Cent
41. ws sequencing through the insert pUC origin Allows maintenance and high copy replication in E coli Ampicillin resistance gene Allows selection of transformants in E coli URA3 gene Permits selection of yeast transformants in uracil deficient medium 2u origin pYES2 1 E Permits episomal maintenance and high copy replication in yeast CEN6 ARSH4 sequence pYC2 E Permits non integrative centromeric maintenance and low copy replication in yeast Sikorski and Hieter 1989 fl origin Allows rescue of single stranded DNA 23 Map of pYES2 1 E Uni lacZ Description Map of pYES2 1 E Uni acZ is a 11194 bp control vector expressing galactosidase The lacZ gene was amplified and TOPO Cloned into pUni V5 His Gene TOPO The resulting vector was recombined with pYES2 1 E using Cre recombinase to create pYES2 1 E Uni lacZ Note pUni V5 His Gene TOPO is similar to pUni V5 His TOPO TA except that it contains additional DNA between the TOPO Cloning site and the V5 epitope The figure below summarizes the features of the pYES2 1 E Uni lacZ vector The Control Vector complete nucleotide sequence for pYES2 1 E Uni acZ is available for downloading 24 from our Web site www invitrogen com or by contacting Technical Service see page 26 pYES2 1 E Uni acZ 11194 bp Features of pYES2 1 E Uni acZ 11194 nucleotides GAL 1 promoter bases 1 451 GAL 1 forward primi
42. ww invitrogen com or by contacting Technical Service see page 26 Features of pYC2 E Uni acZ 9858 nucleotides GAL 1 promoter bases 1 451 GAL 1 Forward priming site bases 414 437 T7 promoter priming site bases 475 494 loxH site bases 507 540 lacZ ORF bases 561 3617 V5 epitope bases 3630 3671 6xHis tag bases 3681 3698 pUni Reverse priming site bases 3760 3781 BGH polyadenylation region bases 3779 3987 T7 transcription termination region bases 4002 4130 Kanamycin resistance gene ORF bases 4309 5103 C kan promoter bases 5104 5241 C R6Ky origin bases 5464 5855 pUni Forward priming site bases 5823 5841 loxP site bases 5876 5909 CYC1 transcriptional termination region bases 5939 6192 CYC1 Reverse priming site bases 5956 5974 pUC origin bases 6576 7049 Ampicillin resistance gene bla ORF bases 7181 8041 C URA3 gene bases 8072 9179 C CEN6 ARS4 bases 9192 9710 f1 origin bases 9711 9816 C complementary strand 25 Technical Service Web Resources Visit the Invitrogen Web site at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical service contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Ad
43. xpression in the host of choice The system utilizes the cre lox site specific recombination system of bacteriophage P1 to recombine the gene of interest into the acceptor vector of choice Abremski et al 1983 Sternberg et al 1981 The product of the cre gene is a site specific recombinase that catalyzes recombination between two 34 bp loxP sequences to resolve P1 dimers generated by replication of circular lysogens The donor vector pUni and the acceptor vector i e pYES2 1 E or pYC2 E each contain a single lox site The donor vector contains a loxP site while pYES2 1 E and pYC2 E each contain a loxH site for more information on loxP and loxH please see the next page Construct the donor vector containing the gene of interest via the TOPO Cloning method or traditional restriction enzyme mediated cloning see page viii pYES2 1 E and pYC2 E contain the appropriate transcription regulatory sequences that will control expression of the gene of interest in Saccharomyces A unique loxH site is located downstream of these sequences in both vectors By mixing the donor vector containing the gene of interest with pYES2 1 E or pYC2 E in the presence of Cre recombinase a plasmid fusion is created that expresses the gene of interest in Saccharomyces A generic diagram is shown below pUni 2 3 kb gene Recombinant Plasmid 4 8 kb gene to 8 1 kb gene pAcceptor 2 5 to 5 8 kb lox loxP or loxH depending on acceptor
Download Pdf Manuals
Related Search