Home

Manual - Nuclear Sciences and Applications

1. 13 1 T EODECHVC e O 13 1 DB eZ Materials sipa a a a a aE a a Eaa 13 1 Toa MeO aaa A E E ee eee er rete ee 13 2 Lol Enzyme ex Irac HO Meese aA EEA EDEA EEEE ERNIE 13 2 13 3 2 Concentration of enzyme EXCEACHIONS nunaa a 13 3 13 3 3 Test of Mismatch Cleavage Activity ssesssssssssessressrrsnrnensnensrrsnrnsnnninnnenntennnenntnnnnnnnnnnnnnennnennnes 13 4 LARE ATION TOSUN aren E T NA e E 13 5 PSC OTUGLUS LOMAS nn a a a 13 6 SPECIFIC NUCLEASES FROM CELERY sunuciievndensncngensinecsedsndvewsliavsexuitentvendloumecieeetd needs 14 1 TE ODOCIV C orean aa A ee eee rere re 14 1 tA Me Material S nran a a A a Rencamee 14 1 T42 MEHO d Sarakai kaan eaaa sn eaa iaa Eaa E aaa akaa aaeoa 14 1 TAZ CELT preparalo ionin anA EN 14 1 142 2 ACtIVIy COS CS ara a ROn 14 5 TAS CONCUSSION Sonini a alec ophiren yee weka eae ects taaded va ccaheacab sear tatremterdde nate aesabteedea tata a 14 7 ACONI DUTOT S area ne tert tire weer arty en conic nt rien tr eet Stern Peet en nero era een eee ee Te ee 14 7 15 MULTIVARIATE ANALYSIS PHYLOGENETICS AND PRINCIPAL COMPONENT FUSE By I AEE PENET AEAEE eT PS ore Teen ee eee 15 1 Tacki PNY OCMCUES era A canes a easessneneent a ance enteaan aed arene 15 1 15 2 Inferring phylogeny from pairwise distances construction of a distance tree using clustering with the unweighted pair group method with arithmetic mean UPGMA 15 2 Page viii T53 DISTANCE MEAS UT OS aAA aide basecguation elec eee 1
2. Remove 4ul of samples 7 and 8 and put into new tubes for analysis of PCR product on agarose gel Step 12 1 3 12 1 2 Heteroduplex digestion preparation of Sephadex spin plates Page 12 2 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Heteroduplex digestion Add 4 ul of water to samples 7 and 8 to bring the volume back to 10 ul Because DNA has been removed for the agarose gel test these samples should appear weaker on the LI COR gel Prepare the following mix on ice Water 326ul 10X CEL I TILLING buffer 60ul CJE nuclease 14ul NOTES 10X CEL I buffer is 5 ml IM MgSO 100 ul 10 Triton X 100 5 ml 1M Hepes pH 7 5 5 ul 20 mg ml bovine serum albumen 2 5 ml 2M KCl 37 5 ml water The amount of enzyme required will vary depending on nuclease source or possibly from batch to batch of the same enzyme from the same source Mix components on ice Add 40ul of mix to the PCR product and mix by pipetting 2 3 times Incubate at 45 C for 15 min in thermal cycler Cool to 8 C and stop reaction by adding 10 ul of 0 25M EDTA to each sample Label a new 8 strip of PCR tubes a set 2 and transfer 35 ul of samples to these tubes Divide samples by transferring into a new set of 8 tube strip Set one will be used in Step 12 1 3 1 onwards Preparation of Sephadex spin plates Prior to loading nuclease digested samples onto the denaturing polyacrylamide gel salts must be separate
3. 14 LOW VOLUME NON TOXIC AND RAPID EXTRACTION OF SINGLE STRAND SPECIFIC NUCLEASES FROM CELERY 14 1 Objective The aim of this protocol is to provide a quick method for crude celery juce CJE extraction for 5000 reactions or more that removes the toxicity and use of specialzed equipment and methods preperatory centrifuge and dialysis so that it can be performed in a standard molecualar biology laboratory This enzyme is used for SNP and small indel discovery and genotyping applications such as TILLING and Ecotilling 14 1 Materials 1 Juicer e g Le Quipe 2 Celery 3 1M Tris HCl pH 7 7 4 Buffer A 0 1 M Tris HCl pH 7 7 5 Buffer B 0 1 M Tris HCl pH7 7 0 5 M KCI 6 Amicon Ultra 0 5ml 10K Centrifugal filters Millipore Amicon Ref No UFC501024 24Pk 14 2 Methods 14 2 1 CEL I preparation 1 Perform all steps at 4 C when possible Most steps can be performed at room temperature 2 Rinse desired amount of celery with water One bunch 1 Ib yields approximately enough CEL I for 500 000 standard TILLING reactions Remove any leaves and cut off tough tissue at base of stalk For this protocol we aim for the production of about 15mls of juice with 0 5kg of material typically giving 200 400mls 3 Juice the desired amount of material 4 Add 1M Tris to a final concentration of Buffer A 18 mL celery juice 2 mL IM Tris HCI buffer pH 7 7 5 Distribute liquid into 10 2 0 ml microcentrifuge tubes 6
4. 2 Wash material 3x in water and then ground using a hand held mixer and by adding about 300 mls of water to facilitate tissue disruption or optional in a juicer 3 Add 1M Tris HCl pH7 7 and 100mM PMSF to a final concentration of Buffer A 0 1M Tris HCI and 100uM PMSF NOTE Stocks and water should be kept at 4 C perform subsequent steps at 4 C 4 Centrifuge for 20 min at 2600 x g in Sorvall GSA rotor to pellet debris Save Supernatant 5 Bring the supernatant to 25 ammonium sulphate add 144 g per liter of solution Mix gently at 4 C cold room for 30 min 6 Centrifuge for 40 min at 4 C at 14 000 x g in sorvall GSA rotor 9000 rpm Discard the pellet 7 Bring the supernatant to 80 ammonium sulphate add 390 g per liter of solution Mix gently at 4 C for 30 min 8 Centrifuge for 1 5 hours at 4 C at 14 000 x g in sorvall GSA rotor SAVE the pellet Discard the supernatant be careful in decanting the supernatant The pellet can be stored at 80 C for at least two weeks 9 OPTIONAL Pellets can be frozen at 80 C for months 10 Resuspend the pellets in 1 10 the starting volume with Buffer B Frozen pellets of the weed juice extract were suspended in 15mL Buffer B and pellets of the celery juice extract in 10 mL Buffer B Ensure the pellet is thoroughly resuspended Page 13 2 FAO LTAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION DISCOVERY LOW COST MUTATION 11 Dia
5. 3 2 ger Pee ul Data analysis A PCR amplification and yield The figure above shows example data of what your first three gel lanes should look like You should see a single band of the correct size 992 bp The yield should be at least 7 10 ng ul of PCR product The Invitrogen low DNA mass ladder is quantitative and yields are determined Page 12 4 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION by estimating the intensity of amplified PCR products For example the intensity of the band in the first PCR sample is between 40 and 20 ng so the concentration is 30 ng 4 ul or 7 5 ng ul The second sample is around 25 ng ul Both samples indicate that PCR yield is sufficiently robust for TILLING NOTES Primer yields are typically not assayed before CEL I digestion of samples This is done here to evaluate your work The PBGL typically performs PCR amplification tests on all gene specific primers prior to purchasing expensive fluorescently labelled primers Primers passing standardized quality control tests almost always perform well in TILLING experiments B Evaluation of mutation cleavage by agarose gel lt Full length PCR product __ Cleavage fragment 1 Cleavage fragment 2 DNA used for PCR amplification of samples 1 8 each contains a single point mutation Cleavage of the mutation creates two fragments of lower molecular weight that migrate faster than the full length PCR
6. false homozygotes due to PCR problems and in that case the notation would indicate one un observed allele 1 population individual locus 1 allelel locus 1 allele 2 1 1 196 200 3 1 2 192 206 4 1 3 164 204 5 1 4 202 202 z 1 5 204 214 E 1 6 204 214 5 1 f 19 19 9 1 g 192 204 10 L 4 19 19 11 Fi 1 12 Fi Fi 13 Fi 3 E 14 Page 16 3 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 170 2 0 07 4 u CO Rel DNI ON Y CON 16 1 3 Categorical coding A second interpretation of this gel would be simply naming the alleles with letters or numbers preferred coding from 1 to 8 this is what is usually called categorical or allelic states coding of alleles that in this case disregards the size information present in the microsatellites bp s We will see that the size information is important for genetic distances such as Delta u and others but that allelic state is sufficient for genetic distances such as Nei s standard genetic distance widely used for allozyme data Figure 13 3 and Table 13 3 shows the coding in categorical or allelic states for the same gel 16 1 4 Presence absence coding of co dominant data Yes you are reading right A third coding scheme is the popular one that uses 0 s zeros and 1 s ones usually called presence absence coding that we just saw for Dominant data in the first section 13 1 1 Often times we are not interested in e
7. 1000 ml beaker 1 L2 N NaOH Squeeze bottle of di H2O 10 Tween 20 P 1 000 pipetter with barrier tips Some of these ought to have notches cut in Tip as per A Note on Technique P 20 pipetter with barrier tips EMS methanesulphonic acid ethyl ester Sigma Glass scintillation vials I D 2 5 cm Box for dry hazardous materials disposal Plastic bag for hazardous materials disposal Box of nitrile not latex gloves and a lab coat 12 7 2 Standard size batch In order to avoid variation in mutation rate that could arise from scaling properties the first 10 mutagenesis procedures for this project except the 6th were done in standard batches of 50 mg seed in 4ml of EMS solution Only flat bottomed glass scintillation vials of 2 5 cm ID were used so as to avoid subtle variations in the agitation of the seeds This standard procedure did not make the concentration of EMS a good predictor of the EL count Because of this and to allow reducing the number of people needed to care for a batch of M plants quantities of seeds less than 50 mg are now allowed Page 12 18 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 12 7 3 A note on technique Before beginning this procedure cut a couple of notches in the tip of several of the P1000 tips If the notch 1s too small to allow seeds to pass through the tip can be pressed against the bottom of the scintillation vial and the supernatant can be efficient
8. 15 5 What genetic distance estimator to choose for essential derivation In the framework of plant production and protection the choice of the genetic distance is crucial for determining the level of relatedness between cultivars accessions For the distinctness and without any genetic consideration J and NL are independent of the samples because only bands present in x and or in y are considered For SM negative matches are counted and if a new cultivar accession carries a new band absent in the previously registered ones this becomes a new negative matching for these cultivars and the distance will change For pragmatic reasons the stability of genetic distance is a very attractive quality for breeders Page 15 8 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION EVO Mua AN LU OTN Beast OS because a distance between two cultivars is constant when the number of cultivars in the reference collection increases But on the other side the disadvantage of J results in the difficulty of finding statistical distribution of this distance which is important to calculate a confidence interval This difficulty comes from the denominator which is not a constant but a random variable It is easier to work with euclidian distances like SM They can be modelled as a binomial variable and their statistical properties are well known Dillmann et al 1997 15 6 Genetic distances between populations Genetic distance me
9. 17 1 1 Phenol chloroform extraction NOTE Wear gloves goggles and lab coat at all times for safety and to prevent contamination of your preparations Removes protein from DNA preparations Advisable for example if A260nm A 280nm from the spectrophotometer readings of the DNA are below 1 6 Phenol extraction requires subsequent ethanol precipitation of the DNA Phenol freshly distilled and equilibrated with 20 0 5 M Tris Base Prepare a mixture of phenol chloroform isoamylalcohol PCI 25 24 1 NOTE Use caution as phenol is toxic 1 The DNA sample is mixed with an equal volume of PCI vortexed and centrifuged for about 5 minutes Remove the upper aqueous phase avoiding contamination with protein from interphase and transfer it to a fresh reaction tube 2 Remaining traces of phenol in the aqueous phase are extracted with 1 volume of chloroform isoamylalcohol 24 1 Vortex and centrifuge for 5 minutes Transfer the upper phase carefully to a fresh reaction tube 17 1 2 Ethanol precipitation NOTE Wear glasses at all time for safety 1 Determine volume of the sample add 0 1 volume 3 M sodium acetate and 2 5 volumes cold ethanol 96 Mix well and leave at 20 C for 2 hours 2 Centrifuge for 15 minutes in microcentrifuge at gt 12 000 rpm preferably at 4 C 3 Carefully remove ethanol and wash pellet with cold 70 ethanol to remove salt from the sample centrifuge for 5 minutes Dry DNA pellet in vacuum cen
10. MATERIALS FOR LOW COST DNA EXTRACTIONS reagent grade approx 99 Sodium acetate anhydrous Sigma S 2889 MW 82 03g mol NaCl Sodium chloride Sigma S 1314 1KG MW 58 44 mol 10 microgram per ml Ethanol absolute for analysis Merck 1 00983 2500 Gibco ultrapure distilled water DNase RNase free Optional Shaker for tubes Eppendorf Thermomixer comfort for 1 5mL tubes MATERIALS FOR GRINDING OF LEAF MATERIAL depending on grinding method Liquid nitrogen Mortar and pestle or TissueLyser e g Qiagen TissueLyser II Page 2 1 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Metal beads tungsten carbide beads 3mm Qiagen Cat No 69997 for TissueLyser EVALUATION OF DNA YIELD AND QUALITY Spectrophotometer optional mini gels OOO TILLING PCR Thermocycler Biorad C1000 Thermal cycler or equivalent dNTP Mixture 2 5mM of each dNTP Agarose gel equipment Any supplier providing horizontal mini gels Page 2 2 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 2 2 Solutions to Prepare BUFFER STOCK SOLUTIONS re 5M NaCl stock solution MW 58 44 mol If keeping stocks for a long 29 22 100mL period check to make sure high molarity stocks stay in solution If precipitate forms warm solution until back in solution or discard and make fresh 3M Sodium acetate pH 5 2 MW 82 03 mol Adjust pH value with glacial 2
11. Page 10 1 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION TOS17LTR 1 outward 3 end of LTR TTGGATCTTGTATCTTGTATATAC TOS17LTR 2 outward 3 end of LTR GCTAATACTATTGTTAGGTTGCAA TOS17LTR 3 outward 5 end of LTR CCAATGGACTGGACATCCGATGGG TOSI7LTR 4 outward 5 end of LTR CTGGACATGGGCCAACTATACAGT Table 10 2 LTR primers from the barley BARE 1 Kalendar et al 1999 d lt alendareteb 4999 sequence and PCR annealing temperatures Ta Primer Sequence T BARLTR 2 LTR forward CTCGCTCGCCCACTACATCAACCGCGTTT IRAP ATT BARLTR 3 LTR_ reverse GGAATTCATAGCATGGATAATAAACGAT _ 60 C IRAP REMAP TATC Table 10 3 Microsatellite SSR primers and PCR annealing temperatures Ta Sequence T GA oC CT 9G CA 0G CAC G GTG C CAC 7T GT CAC NOTE It is very important to try different combinations of LTR and microsatellite SSR primers for REMAP and LTR primers for IRAP Choose primers that have been derived from the species you are working with The figure below shows you the orientation of only the TOS 17 LTR primers A A o EEE Bo PP SEPAAAT A TATA TAS AACCTAATS EAE TGA TAG ETOCS o lt 4 to ae oe tr gt 59 LES avermi kS lt SAAS Tort AS tse fe rss Eas TEATS GOTATCAGAGCANT x aro PEL ace 700 Acoctwace GAAT occam e Cee 210 z530 236 L La SI ORASESREASTOSA 2 LTR 1 LTR 2 LTR 1 LTR 2 NOTE Gloves and lab coat should be worn th
12. Second cycle AC B D E F 8s u fs 9 Third cycle O ACB DE i g B 6 P 2 DE 6 5 95 s F 8 il 85 B O i Fourth cycle AC B D E D E 8 F 9 5 9 5 moon b Page 15 15 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION EVO Mua LUD ONE Beast OS Fifth cycle The final step consists of clustering the last OTU F with the composite OTU ABCDE ABC DE F 9 When the original correct tree and the final tree are compared it is obvious that we end up with a tree that has the wrong topology 1 1 A Wrong topology moan P F Conclusion The unequal rates of mutation have led to a completely different tree topology 15 8 UPGMA exercise UPGMA exercise AFLP results Lane identifications i gt l reference 1 _ a e gt 2 line 01 _ _ t gt 3 line 97 _ E gt 4 line 02 ee gt 5 line 09 gt 6 line 95 gt 7 reference 2 k E AAC M CAT Page 15 16 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION RAViGIMUAAU N OTN Beas OS E AAC M CAT Accessions 2 to 6 were obtained by mutation induction from supposedly accession 1 Accession 7 is a control Verify whether accessions 2 to 6 have been derived from accession 1 Sij My Noo N11 Noo Njo No1 dij sqrt 2 1
13. gentle agitation Meanwhile prepare the transfer apparatus see Figure 5 4 4 Discard denaturing solution and add 1M ammonium acetate to neutralize the gel shake for 10 minutes Page 6 4 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT 10 12 13 14 Whatman 3MM paper GERMPLASM CHARACTERISATION Wrap a piece of Whatman 3 MM paper around a piece of Plexiglas or a stack of glass plates to form a support that is longer and wider than the gel an empty box for pipette tips with plain surface is sufficient Place the wrapped support inside a large baking dish which is then filled with the transfer buffer 2OXSSC Cut a piece of nylon membrane to the size of the gel along with a similar piece of 3 MM paper do not touch the membrane wear gloves and lab coat and use forceps to handle membrane otherwise it will result in background signals after detection Wet both pieces in transfer buffer Place the gel face down on the wrapped support and smooth out all bubbles Place the nylon membrane on top of the gel and smooth out all bubbles Cut a corner of the membrane according to the orientation cut made on the gel Mask the surrounding 3 MM paper with Parafilm strips Place the wet 3 MM piece on top of the membrane excluding bubbles followed by a further dry piece and then a stack of paper towels 5 8 cm high Put a glass plate on top of the stack Wrap the whole apparatus with clingfilm to reduce evaporation and wei
14. Allow NaOH that has been used for EMS disposal to stir for 30 min then gently pour contents of beaker into tub of 0 5 N NaOH placing beaker in tub as well then pour down drain and flush with cold running water for 15 min 7 Wipe off pipettes and inside of hood with dil NaOH and call Hazardous Materials Disposal to remove solid waste Se 12 7 4 DNA extraction DNA isolation is done per FastDNA a kit protocol revision 6540 999 1D04 http www qbiogene com fastprep protocols shtml with the following variations and warnings Page 12 19 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 1 Use only one ceramic bead per shaker tube 2 Run shaker for 45 min at 4 5 m s 3 The first centrifuge spin should be at 14 000 x g for up to 30 min Draw off as much as 800 900 ml supernatant from shaker tube in Step 3 of the FastDNA protocol 4 After DNA is bound in a pellet to the Binding Matrix take care not to disturb the pellet when discarding supernatants in Step 4 of the FastDNA protocol 5 To make re suspension easier all spins before a re suspension both minute spins in Step 4 of the Fast DNA protocol should be at 9 000 10 000 x g for 3 min 6 To re suspend a pellet Steps 4 and 5 of the Fast DNA protocol use the vortex or noisily rake the tube across a tube rack a practice known as ducking for the quack like sound made When ducking take care to hold down the cap of the tube to
15. B J S H REYNOLDS C WEIL N SPRINGER C BURTNER et al 2004b Discovery of induced point mutations in maize genes by TILLING BMC Plant Biol 4 12 TILL B J T ZERR L COMAI and S HENIKOFF 2006 A protocol for TILLING and Ecotilling in plants and animals Nat Protoc 1 2465 2477 ZERR T and S HENIKOFF 2005 Automated band mapping in electrophoretic gel images using background information Nucleic Acids Res 33 2806 2812 Page 12 21 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Page 12 22 FAO TAEA INTERREGIONAL TRAINING COURSE ON MUTANT LOW COST MUTATION GERMPLASM CHARACTERISATION DISCOVERY 13 ALTERNATIVE ENZYMOLOGY FOR MISTMATCH CLEAVAGE FOR TILLING AND ECOTILLING EXTRACTION OF ENZYMES FROM WEEDY PLANTS 13 1 Objective A crude celery extract containing the single strand specific nuclease CELI has been widely used in TILLING and Ecotilling projects around the world Yet celery is hard to come by in some Member States Based on previous studies and bioinformatic analysis suggestion homologies exist to CELI in all plants Therefore we developed a protocol for extraction of active enzyme from plants common across the world weeds We isolated weed plants from the grassland around the Seibersdorf laboratories and isolated a crude enzyme extract in parallel to the enzyme extracts from celery Since there was no or only very low mismatch digestion activity in the crude extract
16. J Hered 86 485 486 Goudet J Raymond M Demeeus T and Rousset F 1996 Testing differentiation in diploid populations Genetics 144 1933 1940 Hartl DL Clarck AG 1997 Principles of Population Genetics Third Edition Sinauer Associates Nei M 1972 Genetic distance between populations Am Nat 106 283 292 Nei M 1973 Analysis of gene diversity in subdivided populations Proc Natl Acad Sci USA 70 3321 3323 Nei M 1988 Molecular Evolutionary Genetics Columbia University Press New York Nei M and Chesser RK 1983 Estimation of fixation indices and gene diversities Ann Hum Genet 47 253 259 Pamilo P 1984 Genotypic correlation and regression in social groups multiple alleles multiple loci and subdivided populations Genetics 107 307 320 Petit RJ El Mousadik A and Pons O 1998 Identifying populations for conservation on the basis of genetic markers Conservation Biology 12 844 855 Queller DC and Goodnight KF 1989 Estimating relatedness using genetic markers Evolution 43 258 275 Raymond M amp Rousset F 1995 GENEPOP version 1 2 population genetics software for exact tests and ecumenicism Journal of Heredity 86 248 249 Raymond M and Rousset F 1995 An exact test for population differentiation Evolution 49 1280 1283 Reynolds J Weir BS and Cockerham CC 1983 Estimation of the coancestry coefficient Basis for a short term genetic distance Genetics 105 767 779 Rousset F 1996 Equilibr
17. NOTE Wear gloves and lab coat at all times for safety and to prevent contamination of preparation NOTE The buffer for gel preparation and for filling the electrophoresis tank is 0 S5xTBE 1 Agarose powder is dissolved in buffer by slowly boiling in a microwave or water bath 2 Let the agarose cool down to 60 C just cool enough to hold Page 6 2 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 3 Ethidium bromide EthBr is added to the gel at a concentration of 0 5 ug ml before the gel is poured alternatively the gel can be stained after electrophoresis in water containing EthBr Caution Ethidium bromide is toxic Gloves should be worn and avoid inhalation 4 As the agarose is cooling down prepare the gel tray by placing tape across the ends of gel tray such that there is no leakage and so the tray will be able to accommodate the desired thickness of the gel 5 Pour the agarose EthBr mixture into the prepared gel tray and insert combs using a comb size depending on the depth width and thickness of the desired well To avoid breaking the wells when the comb is removed leave 1mm between the comb teeth and the bottom of the gel tray Allow the gel to solidify 20 30 minutes 6 Remove tape and place tray in gel rig Pour enough 0 5x gel buffer into the gel rig to cover the gel then remove combs 7 Load the DNA samples containing the lane marker bromophenol blue dye into the wells L
18. This marker is codominant because we can see that individuals can bear two alleles at the same time In principle each product is originated in the two homologous parts for that particular locus and if the two alleles are the same a darker single band should be seen Figure 13 2 and Table 13 2 show a first interpretation of this gel in a codominant fashion upon which inbreeding little f or fis can be computed as well as other statistics see chapters 2 and so forth Page 16 2 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 170 2 OW CO Re DNI OND CON eee 415 blz 8 9 220 bp 210 bp 200 bp 190 bp 180 bp 170 bp Figure 16 2 Test gel of Quercus humboldtii Andean oak Colombia showing 9 individuals Fernandez unpublished data This gel presents many of the typical features of microsatellites many alleles stuttering bands more than two main bands and ambiguity of allele size A sequencer will also give you results of the type 202 14 bp that the researcher needs to round Rounding is necessary at this stage or at later steps as most programmes only accept integer numbers Table 16 1 2 Same data from example gel using a regular spread sheet programme Note individuals appear in rows records and particular data fields are in columns Note that individuals 7 and 9 are coded as homozygotes and not as one allele with missing data Some programs deal with null alleles 1
19. This will be distributed by the instructor 12 1 1 PCR reaction with IRDye labeled primers Make the following PCR master mix on ice 72 ul Water 11 4 ul 10x PCR buffer 13 6ul 25 mM MgCl 18 4 ul 2 5 mM each dNTP 8 0 ul primer cocktail 1 2 ul Ex Taq hot start version Page 12 1 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Add 10 ul of PCR mix to each DNA sample 10 ul Mix sample by pipetting up and down three times Place your set of 8 samples in the thermal cycler Once all teams have deposited their samples run the PCR cycling program titled PCRTM 70 cyc Primer annealing repeat steps 2 5 for 7 cycles repeat steps 7 10 for 44 cycles repeat step 14 for 70 cycles 0 3 C cycle NOTES For purposes of training we increase the volume of the master mix so that you have more than is needed Normally this is not done but the excess volume controls for pipetting errors and if one group makes a mistake excess from the other groups can be provided to them The primer cocktail was made in advance as follows 3 ul forward primer labeled with IRD700 dye 100uM 2 ul unlabeled forward primer 100UM 4 ul reverse primer labeled with IRD800 dye 100uM 1 ul unlabeled reverse primer 100uUM This mix was stored at 80 C Prior to use the mix is thawed on ice diluted 1 10 with TE 10 mM Tris HCl 1 mM ethylene diamine tetraacetic acid EDTA pH 7 4 and distributed to each team
20. Wash Buffer MAB 0 3 v v Tween 20 Buffer II 0 1 M TRIS HCI 12 11 g l 0 1 M NaCl 5 84 g l pH 9 5 Autoclave 20 SDS Dissolve 200 g sodium dodecylsulphate in ddH20 to final volume of 1 litre You can use a low grade Sigma L5750 for hybridization washes etc and a better grade Sigma L4390 for hybridization solution plasmid preps stop solutions etc 20XSSC NaCl 175 3 g Na citrate 2 H2O 88 2 g Adjust pH to 7 4 with 1 N HCl Add H2O to 1 litre Page 6 14 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 7 SSR SSR Microsatellite definition Any one of a series of very short 2 10 bp middle repetitive tandemly arranged highly variable hypervariable DNA sequences dispersed throughout fungal plant animal and human genomes Kahl 2001 Simple sequence repeats SSR or microsatellites are a class of repetitive DNA elements Tautz and Rentz 1984 Tautz 1989 The di tri or tetra nucleotide repeats are arranged in tandem arrays consisting of 5 50 copies such as AT 29 CAC 16 or GACA 32 SSRs are abundant in plants occurring on average every 6 7 kb Cardle et al 2000 These repeat motifs are flanked by conserved nucleotide sequences from which forward and reverse primers can be designed to PCR amplify the DNA section containing the SSR SSR alleles amplified products of variable length can be separated by gel electrophoresis and visualised by silver stai
21. in the select a squint action box Click the submit button to view the squint file Did you find all the mutations Did you find more than were reported Note that mutations are given a confidence score based on quality Confidence level A the bands in both channels are clear and add up to the full length size level B there are two corresponding bands but one of the bands is questionable level C data is available for one of the two channels but the band is most likely a mutation level D data is available for one of the two channels and the band is weak 20 Try some other features in GelBuddy For weak bands try the show inverted image box to view the inverted image Click the calibration box to show the horizontal calibration lines Under the options pull down menu try changing some of the calibration settings and see what happens to the lines Notice that GelBuddy is compensating for lane to lane variation such as gel smiling Want to see what the samples you processed should look like Below is a test gel of these samples run in Seattle a Page 12 12 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Mutations in the Arabidopsis OXII gene IRD700 left IRD800 right Lanes 1 8 equal samples 1 8 in the training course TPE L l 2 3 4 5 566 6 8 The mutation in lane 7 is homozygous and thus is not detected when screened alone For the course an equal amount of wild type DNA
22. s suggestion The pre sequencing amplification is performed with the unlabeled primers used in the TILLING screen Following the manufacturer s protocol HS Ex Taq Takara is used in a 20 ul final reaction volume with 0 005 ng genomic DNA for Arabidopsis Sequencing RXN Big Dye version 3 0 or higher ABI 3100 or higher Add 5 ul of 5 DMSO to PCR product and mix To new set of tubes add 4 ul diluted Big Dye version 3 0 or higher 1 1 dilution with PCR H20 1 ul forward primer 3 uM 5 ul PCR product diluted with DMSO Mix well and spin down Step Step 2 95 C ramp at 1 C sec Step 3 50 C ramp at 1 C sec Step 4 60 C ramp at 1 C sec Step 5 Cycling repeat steps 2 4 for 24 cycles Step 6 8 C ramp at 1 C sec Page 12 17 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Big dye removal and running the ABI is performed by a core facility Sequence trace analysis is performed using Sequencher 4 5 software Gene Codes Both heterozygous and homozygous mutations can be confirmed utilizing the mapping information gathered in the TILLING screens 12 7 EMS mutagenesis of Arabidopsis seed EMS mutagenesis of maize pollen for the population used in the Maize TILLING Project has been described TILL et al 2004b 12 7 1 Materials Orbital shaker Aros 160 with a 1 25 cm radius of gyration 10 15 L tub Microfuge tubes with 50 mg of seed each Stir plate and stir bar
23. sj 7A AIA Of atari ayaa i 2 7 4 N 1 N 1 n n ny n 1 5 Po 2 5 Too 3 5 Moo 4 5 Too No Nig Nig Nio No Noi No 7 Noi n n n n n 1 6 Noo 2 6 Noo 3 6 Nog 4 6 Noo 5 6 Noo Nio Nig No nio Ny No Ny No n M n nit n n 1 7 Moo 2 7 Po 3 7 oo 4 7 Too 5 7 Too 6 7 Moo No Nig nio No Nio No Noi Noi Noi Ny Noi Ny The choice of sij and dj is given by the problem verify relation to parent AFLP Possible simplification based on identity of rows 1 2 amp 6 and rows 3 4 amp 5 Page 15 17 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION EEV iO MUAA N IL UL ONE Beas OS _jalble dielfigi hlilj kit aitona ti on a 2 fohn hh opha shihni anioi onia shihni fora efor i onia 7a ator apr blel diel figi hlilj k l aaa TET Ce TE Tee ee TE 3445 1 1 1 0 1 0 1 0 1 1 1 1 7 ififilijojili ifii Sij My Noo Nyy Noo Njo No1 dj sqrt 2 1 s Sij 9 12 dj sqrt 6 12 0 7 Sij 9 12 dj sqrt 6 12 0 7 s 10 12 dj sqrt 4 12 0 6 three point condition dist 1 2 6 7 lt Max dist 1 2 6 3 4 5 dist 3 4 5 7 0 7 lt Max 0 7 0 6 Page 15 18 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION EEV iO MUANI IN ONE Beas OS 0 3 JI MB 0 3
24. the filter device and 400uL flow through and B after 5 centrifugation 35uL liquid retained in the filter and 465uL flow through 15 Elute sample To elute sample invert the filter and place inverted into a new collection tube Centrifuge at 1000g for 2min Table 2 Volumes of recovered liquid from each Amicon Ultra filter device after inverted centrifugation and calculated concentration factor of the enzyme 16 Combine all eluates Final volume of 4 tubes 155 uL Figure 7 Recovered eluates after centrifugation of the inverted Amicon filter devices 17 Centrifuge remove solid material 4 C for 30 min at 10 000g Centrifuged an aliquot of 70uL other 70 uL frozen without centrifugation 18 Use supernatant for activity test Page 14 4 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION LOL NS OM DG y TO y CON 14 2 2 Activity tests For standard TILLING applications test a range of amounts of CEL I for activity with known mutations polymorphisms following the high throughput TILLING protocol Target amount per reaction X 7 5x10 x total amount juice in ul For example the target range for a bunch of celery giving 400mls juice is 400000 x 7 5x10 or 0 03 ul per reaction To assay activity perform a standard titration curve with the outermost points flanking the target range on either side by a factor of 100 With excess enzyme full length PCR product will disappear as the amou
25. we would probably not exist Evolution or the change of heritable characters across generations in the case of genes it is simply the change of allele frequencies and genotype frequencies in time can only occur if there is enough genetic variability upon which natural and artificial selection can act Hence measuring genetic diversity is paramount in population genetics and we will see that we use several complimentary approaches First we will see the descriptive statistics Page 16 8 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 170 2 0 07 4 N CONNEC DNI ON Y CON Allelic Richness The first measure of genetic diversity is the number of alleles at a locus see glossary for definitions usually denoted A The more allelic variants are found in a population the more variable it is Rare Alleles Often we would like to mark a difference between the number of common and rare alleles One way is to define a threshold of considering all alleles with frequencies below 0 05 as rare These rare alleles are then considered important and 1f they are unique or private to the population we would stress them in our results It is somewhat less used today Effective Alleles Another way of estimating the number of alleles that contribute more to the diversity is by means of the effective number of alleles denoted Ae This measure uses the frequency of alleles to estimate the number of alleles if they were at
26. 0 through 7 This is intended to provide the most accurate binning of DNA concentration estimates when performing visual analysis Prepare the standards as independent dilutions from the stock of shaken Lambda to avoid cumulative error in low concentration DNA references Prepare enough of each standard so that you have at least 3 ul for every 14 samples Note that the concentration of lambda DNA may vary from batch to batch Make sure to calculate dilutions based on the information printed on the stock tube Page 3 1 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION DNA QUANTIFICATION 3 1 2 Preparing agarose gels A Prepare a 1 5 Agarose gel in 0 5x TBE buffer with 0 15 ug ml ethidium bromide Use at least a 24 tooth comb when preparing the gel Place the solid gel into a rig containing 0 5x TBE buffer with 0 15 ug ml ethidium bromide CAUTION Ethidium bromide is mutagenic Wear gloves lab coat and goggle Dispose of gloves in toxic trash when through Avoid contaminating other lab items equipment phones door handles light switches with ethidium bromide 3 1 3 Preparing samples for loading into gels NOTE When you have many samples to quantify it is best to first test 28 to determine the range of DNA concentrations from your extraction method Samples above 62 ng ul will be diluted to 20 ng ul for accurate quantification If the majority of the small test subset have concentrations gt 62 n
27. 15 1 Phylogenetics Phylogenetics in the plant kingdom is based on genetic information from accessions The entities whose affinities are studied are called operational taxonomic units OTUs anything from a population to a phylum including sequence variation and other polymorphisms Phylogenetics studies the evolutionary relatedness among OTUs using genetic information and is mostly based on genetic distances calculations The results of these calculations are often synoptically presented as a phylogenetic tree rooted or dendrogram unrooted There are many methods using different models and assumptions on which the genetic distances calculations are based and ultimately the phylogenetic tree It 1s important to understand from the outset what model and apriori assumptions to apply in order to be able to infer valuable information from the raw data to be mined There are two different tree types that might be constructed based on two different purposes in analysing the raw data Rooted trees serve to unfold an evolutionary path wa Un rooted trees dendrograms are used to visualize relationships A multitude of tree reconstruction algorithms are available These can be roughly classified into 4 methods e Distance Matrix based on pairwise evolutionary distances e g UPGMA Neighbour Joining e Maximum Parsimony based on the shortest pathway to the present character state e Maximum Likelihood based on choosing the tree with the la
28. 2 3 5 1 8 2 8 haa PMs 1 Ea Le La La Ln a e fa a8 5 fe La 5 3 8 1 7 2 1 3 6 3 4 3 5 5 6 1 7 components of Qiagen DNeasy Plant Mini kit Page 2 6 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION L l 1l 2 2 3 3 4 4 SA 5B 6A 6B 7A 7B 8A 8B Figure 1 Quality of barley genomic DNA extractions using silica powder and different combinations of self made low cost buffers and buffers provided by Qiagen DNeasy kit 8 uL of each genomic DNA extraction were separated on a 0 7 agarose gel 1 8 Barley genomic DNA preparation using QIAshredder columns for the preparation of barley leaf lysates lysis procedure following the kit instructions preparation of leaf lysates using the kit instruction but without using QIAshredder columns A B technical replicates L size standard 1 kB Plus DNA ladder Invitrogen All of the genomic DNA preparations show similar DNA concentrations Table 1 and a good quality of the genomic DNA on the agarose gel Figure 1 Only the DNA preparations 2 and 2 buffer components from the kit in combination with our wash buffer show clearly higher concentrations and yields about 2 3 times higher than all other DNA preparations These results indicate that by modifications of the protocol i e modifications of buffers some improvements of the DNA yields are possible The DNA preparations of samples 8A and 8B were extracted exclusiv
29. 3 1 2 A Summary of Marker FOCHiNIGUeS wisscsecsiscsctsesezscesvasteeh ade cegetiateshentertesstictaehaatendeeitie le masbateente 1 4 i Sd Cale enmeric Marker Sinisi isis aot Seance eee E 1 4 14 Marker ap plicatlom SUI GA DINGY ssnin ndash domaine 1 5 LS EPEC TC CAEL OU aaa aaa aaia laiia alaaa 1 8 LO Regui rementi esei E E E eee tect rrr e 1 8 1 7 Comparison of different marker SYSTEMS qu eeeeeeseeteeeeeseseeeeseseeneieaeeeeseaseneeeseieeeneneaeeneneaeeneeaeeen 1 9 2 LOW CosT DNA EXTRACTION WITHOUT TOXIC ORGANIC PHASE SEPARATION 2 1 AMHER I see aes eat E aaa cel eae See cae a es te ae ta ed eee 2 1 De SOMUMIOMS LOU PTC alee sect irre ties sted E E A E E E A E 2 3 Zos Methods TOF CenUrilliee DES uera E E A 2 3 2 Example Dataa a reer erro eet re 2 6 Zedo CONCUSSIONS uai A ee ee ee eee 2 8 3 DNA OG ANTI IGA TION eiretie E E EE EE 3 1 we Protocolfor celelectrophoreSis asise nd ieee neve ennui 3 1 3 1 1 Preparation of DNA concentration standards ss esssssrrssressrensnssrrnsnrnsnnornnnnnnsnnnsnnonnnnnrennennns 3 1 512 Prepare agarose CE laea a A eden 3 2 34 3 Preparine samples for loading into SelS ccc ee ee 3 2 OLA RUMMING TG DE lerenn aAA ER 3 2 Page iv 52157 NOCOSTAD MING EC Cel aranera nnn AA nA 3 3 3 2 Quantification of DNA using image analysis SOFTWALE cssssssecestesesesteseeteeseeeseseenesesseisaeeteeseeeenees 3 3 4 RESTRICTION ENZYME DIGEST cccccccccececcccccccececccccceceteccccccesetecesece
30. 700 IRD 800 Taq dNTP PCR buffer Seq direct clean up kit EZPeel clear heat seal EZPeel aluminium heat seal LTS tips 10F LTS tips 10S LTS tips 200F LTS tips 250S LTS tips 1000F LTS tips 1000S 20uL LTS tips spacesaver 200uL LTS tips spacesaver 1000uLLTS tips spacesaver Matrix Marsh AB Gene Fisher VWR Rainin CDWG Fisher Rainin Fisher Company Gel Company MWG Molecular Bio Products Molecular Bio Products Li Cor Apogent Discoveries A Pharmacia Research Organics Fisher Research Organics Research Organics Fisher Sigma Island Scientific Island Scientific LI COR LI COR Pan Vera Qbiogene Marsh Bio Prod Marsh Bio Prod Rainin Rainin Rainin Rainin Rainin Rainin Rainin Rainin Rainin 2139 AB 0384 13 636 AR10 52434 232 L8 20 L8 200 323633 NC980061 1 L 20 L 200 11 500 49SH Catalog Number CAJ96 4050 000003 1043 60 5 1043 61 7 82705607 8094 17 0043 02 3002E BP525 25 30960T 1748B MAHVN 4550 F5786 IS 609 IS SEAL 4200 60 4000 45 TAK RROOIC 9904 200 AB 0812 AB 0745 GP LIOF GP L1OS GP L200F GP L2508S GP L1000F GP L1000S GPS L10 GPS L250S GPS L1000S Page 12 14 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Sephadex column loader 45ul Fisher MACL09645 Sephadex scraper replacement Fisher MACLOSCO3 12 5 Frequently asked questions Will TILLING work in my favourite organism TILLING is a general method a
31. Crops RFLP Medium High High High RAPD Low Low Low Low SSR High Medium High Low ISSR Low Low High Low AFLP Medium High Low High Low IRAP REMAP High Medium High Low Additional marker systems not covered in the course Morphological Depends Depends Limited to breeding aims Protein and isozyme High Medium High High SCARS CAPS High Medium High Low STS EST High Medium Medium High SNP High Medium Low Unknown Microarray Medium Low Unknown 1 6 Requirements Table 1 6 1 Requirements for marker techniques Marker technique Amount DNA Radioactive Gel system quality of DNA Sequence detection Required RFLP High High No Yes No Agarose RAPD Low Low No No Agarose SSR Low Medium Yes No Acrylamide Agarose ISSR Low Medium Yes No No Acrylamide Agarose AFLP Low High No Yes No Acrylamide IRAP REMAP Low Medium Yes No Acrylamide Agarose Additional marker systems not covered in the course Morphological No No No None Page 1 8 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Protein isozyme STS EST SNP Microarray SCARS CAPS 1 7 Comparison of different marker systems No No Low High Yes Low High Yes Low High Yes Low High Yes No Agarose Acrylamide Yes No Acrylamide Agarose No Sequencing required No None Yes No Agarose Table 1 7 1 Advantages and disadvantages of various marker techniques Marker RFLP a J J J RAPD e J J J J J J SSR e Advantages Un
32. E A 9 8 ARAM SLCC CLC Gases he packet antec acca a teens ddl eee ease ees 9 8 9 5 Sequence information of adapters and primers used for AFLP cscsseseesesesesesesesesseseseseseeeees 9 9 PRST Gla gL carretera arin nme eer mre eno nner eae ier ree pear erTe eer neat eee reer erere meer ere ne rere tree 9 10 Te REMAP GIRAP eroina E OE ONITE 10 1 TO a oe of oc 1 0x 0 Nan mrs near to mer nan NC naa OP Oar re On A nee nT nee Te one 10 1 t0 11 Prepare a 50M reaction Mix sng Meat eecliiada ieee a 10 2 10 1 2 PCR amp HICA 0 e E trees et nomrnrar terpenes earner 10 3 10 1 3 Separation and visualization of the amplification products se ssesssressrenrrssrrssnrsneennns 10 3 TO 2 RETCECIIC OS opa vedicerctnoxdetcesteeesteicetgeeileendstatmstiani dd eeleiei a lense dea ete 10 4 AROS Bae Reas nits Teede 6 Rememetpt are teeter rete A riers tees eet nr meer ene em reer ete 10 4 11 SINGLE NUCLEOTIDE POLYMORPHISMS SNPS ccccceccsssceesceesseeseeess 11 1 CELERE rO nC ES aeae A reer ete erern Cem en ren errr 11 2 ee NG a A tiaras a anecae A E E AT 12 1 TAE EREOLOCO Loirin aa A a S 12 1 12 1 1 PCR reaction with IRDye labeled primers s ss ssssssssssrsssrrssnenunenrnsonrsunnnnneonnsonnnnnnnnnnonnennnnnnennne 12 1 12 1 2 Heteroduplex digestion preparation of Sephadex spin plates 12 2 12 1 3 Agarose gel analysis of enzymatic mismatch cleavage and sample purification 12 4 12 1 4 Sample purification and volume reduction
33. H Roux 1999 Heteroduplex cleavage analysis using S1 nuclease Biotechniques 27 18 19 McCALLuM C M L COMAI E A GREENE and S HENIKOFF 2000 Targeted screening for induced mutations Nat Biotechnol 18 455 457 PERRY J A T L WANG T J WELHAM S GARDNER J M PIKE et al 2003 A TILLING reverse genetics tool and a web accessible collection of mutants of the legume Lotus japonicus Plant Physiol 131 866 871 SATO Y K SHIRASAWA Y TAKAHASHI M NISHIMURA and T NISHIO 2006 Mutant Selection from Progeny of Gamma ray irradiated Rice by DNA Heteroduplex Cleavage using Brassica Petiole Extract Breeding Science 56 179 183 Page 12 20 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION SLADE A J S I FUERSTENBERG D LOEFFLER M N STEINE and D FACCIOTTI 2005 A reverse genetic nontransgenic approach to wheat crop improvement by TILLING Nat Biotechnol 23 75 81 SOKURENKO E V V TCHESNOKOVA A T YEUNG C A OLEYKOWSKI E TRINTCHINA et al 2001 Detection of simple mutations and polymorphisms in large genomic regions Nucleic Acids Res 29 E111 TILL B J C BURTNER L COMAI and S HENIKOFF 2004a Mismatch cleavage by single strand specific nucleases Nucleic Acids Res 32 2632 2641 TILL B J S H REYNOLDS E A GREENE C A CODOMO L C ENNS et al 2003 Large scale discovery of induced point mutations with high throughput TILLING Genome Res 13 524 530 TILL
34. IAEA Programme of Nuclear Techniques in Food and Agriculture at the Plant Breeding and Genetics Laboratory PBGL formerly the Plant Breeding Unit of the Agriculture and Biotechnology Laboratory at the IAEA Laboratories in Seibersdorf Austria in 2001 Messrs J Bennetzen USA K Devos UK G Kahl Germany U Lavi Israel M Mohan ICGEB and S Nielen FAO IAEA contributed protocols to the first print version These contributions and others were formally compiled into the first early editions of the manual by Messrs P Gustafson USA B Forster UK currently head of PBGL M Gale UK R Adlam UK M Maluszynski and S Nielen of the Joint Programme Their efforts in establishing this manual are deeply appreciated In later editions J Fernandez Manjarres Colombia provided the section on population genetics and Plant Breeding and Genetics Section Head Pierre Lagoda provided the protocol on multivariate analysis While this series of courses ended in 2007 there has been a continual demand from trainees for a codified set of standard protocols and so the Plant Breeding and Genetics Laboratory PBGL has continued adapting this book by incorporating new protocols with the aim of assisting Member States in the appropriate application of molecular tools with minimal costs These include protocols for TILLING Ecotilling DNA quantification low cost and low toxicity DNA extraction alternative enzymology for enzymatic mismatch cleavage new
35. ISSR AFLP RAPD IRAP and REMAP and SNPs However techniques are continuously changing and evolving so technology transfer needs to keep pace with current developments in genomics Capacity for handling molecular marker data has been identified as a bottleneck to the integration of molecular techniques in germplasm management A module on population genetics dealing specifically with the analysis of molecular marker data is included in this edition of the manual 1 1 Use of molecular markers A cautionary tale Molecular biology is an exciting discipline with new techniques constantly being developed and high impact publications coming from the work As such it is tempting for the junior scientists to think of molecular tools as a starting point for their breeding objectives The downside however is that these tools are often challenging to master expensive and easy to mis apply It is important that experiments are carefully designed with proper controls and that the researcher understands the strengths and limitations of the chosen application In this section we focus on the use of molecular markers These tools can provide rapid valuable information on the nucleotide diversity of collections allowing deductions of evolutionary relationships and gene flow However this manual is focused on mutant germplasm characterization and when applying these tools for evaluation of induced mutant populations an understanding of the genetics of the sp
36. Romesburg H Ch 1990 Cluster Analysis for Researchers Florida Krieger Publishing Co original edition 1984 Smith O S Smith J S C Bowen S L and Tenborg R A 1991 Numbers of RFLP probes necessary to show associations between lines Maize Genet Newsltr 65 66 Sneath P H A and Sokal R P 1973 Numerical taxonomy San Francisco Freeman Sokal R P and Michener C D 1958 A statistical method for evaluating systematic relationships Univ Kansas Sci Bull 38 1409 1438 Swofford D L Olsen G J Waddell P J and Hillis D M 1996 Phylogenetic inference pp 407 514 Hillis D M C Moritz and B K Mable ed Molecular systematics Sinauer Sunderland Massachusetts Weir B S 1996 Genetic data analysis Sinauer Sunderland Massachusetts Page 15 26 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 170 2 0 07 4 u ORO DNI ON Y CON 16 POPULATION GENETICS Population genetics is that branch of genetics that attempts to describe how the frequency of the alleles of genes changes over time To study frequency changes populations rather than individuals are analysed The scope of this module however is not to provide an in depth resource on this branch of science rather it is aimed at guiding the researcher in a stepwise format through the collection including coding analyses and arriving at valid inferences on data for allelic frequencies of molecular markers The data coding schemes begin w
37. Spin the juice for 20min at 2600 g to pellet debris at 4C if possible 7 Pour supernatant into a beaker 8 Bring the supernatant to 25 NH4 2SO by adding 144 g per liter of solution Mix gently at 4 C for 30 min Using stir plate and magnetic stir bar Page 14 1 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION NUCLEASE EXTRACTION Total volume from 10 tubes 18 5 mL 2 66g NH4 SO4 added Figure 1 Protein precipitation with NH 4 2SO 4 9 Distribute liquid into 10 2 0 ml microcentrifuge tubes Spin at 15000 g at 4 C for 40 min Figure 2 Protein pellet after 25 NH 4 2SO precipitation discard 10 Pour supernatant into clean beaker Discard pellet 11 Bring the supernatant from 25 to 80 NH4 2SOx by adding 390 gram per liter of solution Mix gently at 4 C for 30 min Total volume from 10 tubes 18 mL 7 02g NH4 2SO4 added 12 Distribute liquid into 8 11 2 0 ml microcentrifuge tubes Spin 15000 x g for 1 5 hr Save the pellet and discard the supernatant being careful in decanting the supernatant The pellet can be stored at 80 C for months Figure 3 Protein pellet after 80 NH 4 2SO precipitation keep and resuspend 13 Resuspend the pellets in 1 10 the starting volume with Buffer B ensuring the pellet is thoroughly resuspended Target final volume for all 10 pellets is 1 5mls Add Page 14 2 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMP
38. TAEA INTERREGIONAL TRAINING COURSE ON MUTANT LOW COST MUTATION GERMPLASM CHARACTERISATION DISCOVERY oF Transfer 500 uL of the cleared supernatant to a filter device keep the rest of the supernatant as control before concentration 4 Centrifuge the filter device with a collection tube inserted per manufacturer s instructions for 30 min 14 000 x g 4 C 5 Remove filter device invert and place in new collection tube 6 Centrifuge for 2 min 1 000 x g 4 C 7 Measure the recovered volume This is your concentrated protein Calculate the concentration factor with the following formula Starting volume Final folume concentration factor 13 3 3 Test of Mismatch Cleavage Activity 1 Produce TILLING PCR products for mismatch cleavage tests with the concentrated enzyme extracts The exmple below is for barley GENES PRIMER nb2 rdg2a 1500bp PCR product nb2 rdg2a_F2 TCCACTACCCGAAAGGCACTCAGCTAC nb2 rdg2a_R2 GCAATGCAATGCTCTTACTGACGCAAA TILLING PCR REACTIONS TaKaRa ExTaq enzyme total volume 25uL 10x ExTaq buffer TaKaRa 2 5 uL dNTP mix 2 5 mM 2 0 uL Primer forward 10 uM 0 3 uL Primer reverse 10 uM 0 3 uL TaKaRa Taq 5U ul 0 1 uL Barley genomic DNA 5 ng uL 5 0 uL H20 to 25 uL 14 8 uL TILLING PCR cycling program for TILLING PCRTM70 95 C for 2 min loop 1 for 8 cycles 94 C for 20 s 73 C for 30 s reduce temperature 1 C per cycle ramp to 72 C at 0 5 C s 72 C for 1 min l
39. Under file choose Open 700 and 800 channel images 4 Select the first image to load While holding down the shift key select the second image Click open Page 12 10 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 5 Adjust the 700 channel image to the desired intensity using the slider bars located on the upper region of the GelBuddy window Se 6 Adjust the 800 channel image Click the 700 800 box at the top of the window to switch to the 800 channel With the 800 channel selected adjust the image as in step 5 700 800 ee Call lanes Click the find lanes box located in the tool bar at the top of the window Set the number of sample lanes in the find lanes pop up window the default is 96 for a standard TILLING run Select segmented lane tracks Unless one of the channels is very bad use the both channels for detecting lanes Click ok Editing lanes The blue lane markers should run through the lanes with the 200 bp marker If they do not or one or more lanes are called wrong click the edit lanes mode in the toolbar aa a A2 10 Select the lane you wish to edit or the lane adjacent to the area where you wish to add a lane Under the edit menu select insert or delete lanes as required If a lane merely needs to be straightened select the boxed regions and drag to the desired location 11 Click the show lanes box to r
40. and phenograms e Smith et al 1991 used 200 RFLP markers dispersed across the maize genome to fingerprint 11 inbred lines the genetic distance matrix was comprised of 55 elements They estimated distance matrices by sampling 5 to 200 RFLP markers in increments of five e g five 10 15 200 They concluded that accuracy was sufficient with 100 or more markers e Bernardo 1993 concluded that 250 or more marker loci were needed to produce precise estimates of coefficients of co ancestry The number of genetic markers used in an analysis may be dictated by non statistical factors The outcome of the analysis might be one of the criteria used to select genetic markers for future analyses Ideally genetic markers for protecting intellectual property and classifying unknown genetic materials should be highly polymorphic and dispersed across the genome Page 15 23 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION EVO Mua AN LU OTN Beast OS Should analyses be performed on raw multivariate data or genetic similarities e Typically multivariate analyses of DNA genotypes fingerprints are performed on genetic similarity or distance matrices among entities rather than on raw multivariate data matrices e PCA of raw DNA genotypes although not widely done can be used to assess the importance of individual genetic markers by comparing principal component coefficients 1 e individual elements of characteristic ve
41. angle in degrees until the bands are in line with the grid lines The Interpolate feature should be selected Note that you can set negative degrees by placing a minus sign before the angle degree number You may have to use a decimal setting to get the lanes to line up When finished click OK Subtract background noise Process gt Subtract Background Deselect light background It is important that you don t set the rolling ball radius too small It should be no more than half the width of the box you draw for the band see step 7 Select the rectangle tool in the ImageJ toolkit dialog box Find the highest intensity band on the gel to be analysed and draw a box around it Make sure that the box surrounds the entire signal but does not overlap on the signal from another band Check the height h and width w values and make sure that the larger of the two values is not more than 2x the size of the rolling ball radius chosen in step 5 TIP Select the magnifying tool and make the gel image as large as reasonable 8 Left click and hold the mouse over the box and move it so that it is positioned around lane 1 CAUTION The box should contain only signal from the lane to be measured Failure to do 10 so will lead to an inaccurate reading Measure the box by hitting the m key A full screen table should appear with columns for sample Area Mean min and max values Minimize the table so that you can again view the g
42. at 45 C for 15 min e Add 2 5uL of 0 5M EDTA pH 8 0 to stop reaction e Load a 10uL aliquot on an 1 5 agarose gel SERIAL DILUTIONS OF CELI enzyme Table 3 Serial dilutions of isolated Cell enzyme and set up of Cel digestion mixes Seal I l fE0aD buffer re O S dialysis Ox SS Ole 0 35 E10 15u 815 x 035uL 3 5 1 10 Sub 5 SxS Mew hen oxo o bs swa s C a o S o B CELI from Dilution Amicon factor filters 12 9x C E o o pato se has 0 027 0 25 A 10 15 uL 8 25 uL Sx 5 NOY SL 725 Hox 2510 SUL 60 20x SSO SOx SS 5 doox SSO 1x concentration of the CELI purified with Amicon filter devices were calculated using the concentration factor 12 9x Page 14 6 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION NUCLEASE EXTRACTION CELI Amicon Ultra devices CELI Dialysis mm Ol TS A S07 100060 0 O01 E CE Figure 8 Activity tests of CELI enzyme isolated with Amicon Ultra filter devices left and with dialysis method right A serial dilution of enzyme activity is shown There are no cleavage bands present at the control without CELI enzyme 0x and at the lowest dilution 0 1x in both extracts Both enzyme extracts show activity from 1x diluted However the background in the CELI extracts purified with Amicon filter devices seems to be stronger than in the activity assays of CELI enzyme purified with dialysis 14 3 Conclusions The ac
43. cells A B 41 47 in excel Click the Chart Wizard button Select XY Scatter as chart type and scatter with no point connection as sub type Click next 16 Select the series in columns Click next and fill out the title Gel X axis density and Y axis ng ul Click next and save the graph as an object in the workbook Click finish Move this graph to the graph section of the worksheet 17 Inspect the graph Are there any points that are clearly off of the trend If so consider removing this data point and re drawing the graph This may become more evident once you have drawn the trendline Step 18 18 Add a trendline Chart gt Add Trendline Under type click polynomial and select 2nd order Click Options and select Display equation on chart and display r squared value on chart Click ok OPTIONAL You may try a higher order polynomial to evaluate how differences in curve fitting can affect your concentration estimation see figure below showing second and third order polynomial 140 y 0 cieo 0 151x 3 6603 120 100 y 6E 05x 0 0057x 0 7186x 1 9864 R 0 9982 m 0 998 ng ul Poly ng ul ng ul 60 Poly ng ul as ar ae density Page 3 5 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT 19 20 2l 22 GERMPLASM CHARACTERISATION DNA QUANTIFICATION Fill in the sample next to the lane number in the DNA concentration table to the right of the ra
44. data color could be changed to 1 2 and 3 etc to run all in the same analysis but all depends on the programme used Page 16 4 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 170 20 WU CO Rel DNI ON Y CON Table 16 1 3 Example of Co dominant data coded as presence absence of bands First the total number of alleles is counted and the corresponding number of bands is defined being 8 in our case Note that for homozygote individuals we are dealing with diploid data there is controversy about the scoring In the example below the individuals 7 and 9 were coded as 1 for allele 1 but some people think we should give them twice as much weight 1 e two copies are there so the genotype should be 2 instead of 1 This is no longer presence absence strictly but results change little in practice population individual band 01 band 02 band 03 band 04 band 05 band 06 band Of band 06 fruit color 1 1 0 0 1 1 0 0 0 0 red red 0 crimson green 1 red 1 red 0 crimson 1 red red Ph Ped Pi i a a k a a k D Pe a D A e e a e l D es a gets amp at st BS Ss D llalla Soa l e l l l amp Sa gee amp amp Se SS Sa aaa Co eo es a gad Lt 16 1 5 Formatting dominant data as co dominant As strange as it may sound we can code dominant data as codominant for using a codominant based data analysis software Some functions may not work
45. deciding this so empirical testing 1s needed When selecting among a large number of potential entities e g germplasm accessions or when resources are limiting which they nearly always are geographical or ancestral origin morphological phenotypes or other phenotypic or historical criteria can often be used to select accessions to represent a gene pool or a specific subset of a gene pool The genetic material chosen for study depend on economic resources the nature scale scope and goals of the study and a priori knowledge of genetic relationships Closely related genetic materials for example need not be sampled unless there is a compelling biological or economic reason to do so The ideal sample of genetic material for studying a particular question is profoundly affected by the nature and genetic origin Gif known of the genetic material The goal of a DNA fingerprinting study might be to classify every entity belonging to a particular biological or economic class of entities e g a seed company might fingerprint and classify every inbred line and hybrid they own and every hybrid sold by their competitors for the purpose of protecting intellectual property Many crop plant gene pools are comprised of hundreds or even thousands of germplasm accessions Depending on the mating biology and breeding systems of the species accessions could be comprised of outcrossing wild populations e g genetically heterogeneous segregating populat
46. dendrograms which are good starting points for discussions in an article Sometimes PCA principal component analysis eigenvector decomposition into major axes for 2D representation of clustering give a better synoptic background to discussions than dendrograms 15 4 Some reflexions on the comparison between genetic distances NL can be easily expressed as an increasing function of J NL J 2 J which means that one is to expect them to be very highly correlated and lead to identical rankings of genetic distances If this expectation is not met this is very significant and needs to be investigated In comparison a high correlation between J and SM is not obvious The difference between these distances formula 1 and 3 come from negative matches which are taken into account in the denominator of SM distance Peltier et al 1994 supported that in the case of intra specific studies an allelic relation exists between presence and absence of a band and a negative matching is an indication of similarity and might lead to the same kind of results with SM and J In addition if the weighting of Jaccard WJ distance by the inverse of the PIC provides similar relationships between cultivars accessions individuals to Jaccard ones this might be due to the structure of the marker frequency between individuals tested But WJ leads to take the most different individuals further away from each other enhancing differences and might clarify
47. estimated manually by comparing band intensity to the intensity of DNA standards of known concentration A computer programme that capable of measuring pixel density can provide a more accurate and objective estimation of DNA concentration In this method a standard curve is created with the DNA concentration standards and sample concentrations are estimated using the standard curve Many GelDoc systems provide software for automated or semi automated determination of DNA concentration based on pixel density We provide here an alternative that will work on any digital tiff image using free image analysis software and Microsoft excel The method can thus be applied to most labs 1 The free programme ImageJ http rsbweb nih gov ij is a public domain program developed by Wayne Rasband of the National Institutes of Health USA Download this onto your computer Full documentation can be obtained from the website 2 Open ImageJ 3 Open the tiff image to be analysed File gt Open A demonstration image titled Cassava DNA test2c tif can be found on URL for practice CAUTION Do not use compressed file formats such as jpeg Page 3 3 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION DNA QUANTIFICATION Straighten the image so that the lanes are parallel with the image dialog box Image gt Rotate gt Arbitrarily In the rotate dialog box select preview set the Grid Lines number to 30 and adjust the
48. following detection methods are independent of the method utilized in the FAO IAEA course and might provide useful alternatives Colourimetric detection NOTE Wear gloves and lab coat at all times for safety and to prevent contamination The dye solution 10 ml 100 cm is prepared by addition of 45 ul NBT solution and 35 ul BCIP solution to 10 ml buffer III The incubation takes place in the dark for up to 20 hours Avoid any shaking since this will cause a diffuse signal The reaction can be stopped by washing the filter in TE buffer as soon the desired bands are visible Chemiluminescent detection The chemiluminescence substrate AMPPD or CSPD emits light after a two step reaction At first the molecule is de phosphorylated by the enzyme alkaline phosphatase AP and in the second step the molecule decomposes and emits light The emitted light appears as a continuous glow for more than 24 hours and it can be documented on X ray films The advantages of chemiluminescence are remarkably improved sensitivity the possibility to test different exposure times and the facilitation of rehybridization experiments NOTE Wear gloves and lab coat at all times for safety and to prevent contamination 1 Dilute the CSPD solution in buffer II to a final concentration of 0 235M 1 100 1 5 ml 100 cm 2 Place membrane on a clean transparent sheet and pipette the diluted CSPD solution onto the membrane Cover the membrane slowly with anot
49. for 23 cycles 9 1 8 Polyacrylamide Gel Electrophoresis PAGE The single stranded AFLPs are separated in long denaturing polyacrylamide gels often referred to as sequencing gels 1 Take a 5 ul aliquot of the PCR amplified product from 10 1 3 above and place in a fresh 0 5 ml tube and add 2 ul formamide loading buffer The number of samples will be determined by the number of wells you have in your polyacrylamide gel 2 Denature for 5 minutes at 95 C 100 C and snap cool on ice 3 Centrifuge briefly 14 000 rpm for 5 seconds 4 Run 5ul samples in denaturing 6 polyacrylamide gels SequaGel XR http www nationaldiagnostics com electroproducts ec842 html Page 9 5 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 9 1 9 Silver staining of PAG Follow the procedure given in the SSR Protocol 6 1 6 Silver staining 9 1 10 PCR mix for selective amplification products to be visualized on an automated DNA analyser 1 Put on gloves and in a PCR tube add Tru91 selective primer 5umol 2 Mix by gently tapping against the tube 3 Centrifuge briefly 14 000 rpm for 5 seconds 9 1 11 PCR profile for selective amplification products to be visualized on an automated DNA analyser Place tube in the PCR machine and amplify using the following programme 30 seconds repeat steps 1 3 for 11 cycles 30 seconds repeat steps 5 7 for 29 cycles 9 1 12 Electrophoresis using a
50. for alleles is a 3 digit number 001 999 e Insert another row between now rows 2 and 3 and do the following o In the first column type pop OOOO 3 Step 3 Formatting the data as a tab delimited text file e Select all entries by highlighting starting from cell A1X1 to the end of the data entries e File gt Save as gt text tab delimited txt gt OK gt Yes e Save on same disk and folder as the Populations exe file To run the programme the text file txt must be in same folder as Populations exe 4 Step 4 e Formatting in NOTEPAD e Open NOTEPAD e From File menu locate the saved txt file open file Page 16 16 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 170 2 0 07 4 u CO Rel DNI ON Y CON e Put cursor in front of first locus and hit backspace so that it is now in the first column second row Highlight all entries by select all in Edit menu Cut the entries Paste in Word Select All Edit gt Replace gt In find what box type t and in replace with box hit the space bar once Select replace all option All the tabs have been replaced It helps to have the paragraph icon on in order to see that there are only single spaces e Delete the dots after the figures in the first row and after pop and insert comma each sample name Make sure that there are no spaces within a sample name Select all entries Cut the entri
51. gel box Gels can be poured in advance and stored wrapped in a damp paper towel at 4 C for several days Loading samples onto membrane combs All samples will be loaded onto a single loading tray Each team will load 0 25 ul of sample into the membrane comb loading tray The instructor will dip the comb into the tray to absorb the sample The sample should run 1 2 to 2 3 up the length of the comb NOTES Membrane combs are expensive To reduce the costs combs can be reused many times After the comb has been used rinse thoroughly with deionized water soak in water for at least 30 minutes and allow to dry completely before reuse Running LI COR gels Pre run gel 20 min Gel settings 1500 V 40 mA 40 W Temp 50 C Width 1028 Speed 2 Channels 700 amp 800 Make sure the back plate is clean and clear of any scratches in the data collection window Check that the machine is properly focused before loading samples Clean the gel slot out with a syringe and drain the top buffer reservoir until the level is below the glass edge Wick out the remaining buffer first with a paper towel and then with a 6 inch wide strip of Whatman 1 paper sliding it into the slot left by the spacer Using a Pipetteman P1000 fill the slot with 1 ml of 1 Ficoll leaving just a thin bead 1 mm above the slot Hold the comb at a 45 C vertical angle with lane 1 on the left aim for the slot and insert rapidly by pushing gently until it just touches th
52. given species NOTE Wear gloves and lab coat at all times for safety and to prevent contamination Prepare 25 ul Reaction Mix 1 Take four sterile PCR tubes and to each add the following Page 7 2 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 2 Mix by gently tapping against the tube 3 Centrifuge briefly 14 000 rpm for 5 seconds NOTE Keep all reagents and reaction mix on ice until used 7 1 2 PCR amplification Place tubes in a PCR machine and amplify using a programme designed for the primers being used an example is given below Cycling repeat steps 2 5 for 34 cycles NOTE The annealing temperature Step 3 in particular can and does vary with primers used Please note this when changing primers 7 1 3 Separation of the amplification products in agarose gel NOTE Where SSR polymorphism is large bands can be separated in agarose gels however small base pair differences among alleles require separation in polyacrylamide gels 1 Take Sul of the PCR product into a fresh tube 2 Add 2 ul 5X loading buffer containing dye 3 Centrifuge briefly 14 000 rpm for 5 seconds 4 Load all 7ul of the mixture into a 1 5 agarose gel which is made up of 25 fine agarose and 75 normal agarose with 2ul 100ml ethidium bromide for staining DNA 5 Run gel until dark blue colour marker has run two thirds of the gel NOTE Do not run the dye off the gel or you will also lose
53. greater than zero indicates that diversity or inbreeding is not randomly distributed Several other parameters however have been proposed by different authors and the list grows almost every year We will highlight some of the most used e Weir s and Cokerham s theta also now as the co ancestry coefficient Reputedly more robust to sampling variation than the basic Fst e Excoffier s et al Phi statistics that are analogous to Fsr but based on variance components analyses e Rsr with its estimator p rho that uses the actual microsatellite size to estimate the genetic structure parameter Note if microsatellites are coded as allelic states we would be estimating Phi statistics e Nsr analogous to the others but for sequencing data seldom used more of a theoretical value 16 4 Population and individual divergence and phylogenetic trees So far we have seen that a complete description of genetic diversity entails first the estimation of various descriptive parameters for each subpopulation and then the use of synthetic values that will allow us to tell if genetic diversity is distributed at random or not i e Fst gt gt 0 However can we tell apart which population s is actually producing this structure Which populations are more divergent than others and in which direction These questions are then answered by using a divergence analysis based on genetic distances Strictly speaking unless we use p
54. indices In Statistical Methods in Biological and Medical Sciences Ed C R Rao and R Chakraborty Elsevier Science Publishers Page 16 17 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 170 2 0 07 4 u CO Rel DNI ON Y CON Cockerham CC 1969 Variance of gene frequencies Evolution 23 72 84 Cockerham CC 1973 Analysis of gene frequencies Genetics 74 679 700 Cockerham CC and Weir BS 1993 Estimation of gene flow from F statistics Evolution 4717 855 863 El Mousadik A and Petit RJ 1996 High level of genetic differentiation for allelic richness among populations of the argan tree Argania spinosa L Skeels endemic to Morocco Theor Appl Genet 92 832 839 Excoffier L 2001 Analysis of population subdivision In Handbook of statistical genetics Balding Bishop amp Cannings Eds Wiley amp Sons Ltd Fisher R 1954 Statistical Methods for Research Workers 12th Edition Oliver amp Boyd Edinburgh 356pp Goodman SJ 1997 Rst Calc a collection of computer programs for calculating estimates of genetic differentition from microsatellite data and a determining their significance Molecular Ecology 6 881 885 Glaubitz J C submitted CONVERT A user friendly program to reformat diploid genotypic data Molecular Ecology For commonly used population genetic software packages Molecular Ecology Notes Goudet J 1995 FSTAT vers 1 2 a computer program to calculate F statistics
55. magnesium ions In general the DNA sequence of both ends of the region to be amplified must be known to be able to synthesize proper primer oligonucleotides The PCR reaction is a cyclic process which is repeated 25 to 35 times One cycle consists of three basic steps with characteristic reaction temperatures 1 Denaturation of the double stranded DNA to make the template accessible for the primers and the DNA polymerase 94 C 30 seconds 2 Annealing of primers to complementary sequence on template between 45 and 60 C depending on the primer sequences 30 seconds 3 Extension of primers by DNA polymerase 72 C the optimum temperature of Tag DNA polymerase minute per kilobase of template to be amplified Page 17 2 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION APPENDICES primer DNA polymerase 3 Oot OTP dNTPs mom dGTP Mg IE dATP DOO acTP 4 5 Newly synthesised strand 3 WEENIE EA nn EE Figure A 2 1 Primer extension DNA polymerase extends a primer by using a complementary strand as a template McPherson et al 1991 MePhersonetat 499p By multiple repetition of this cycle the number of template molecules increases This result in exponential amplification of the DNA sequence that is bordered by the two primers used Figure A 2 2 Page 17 3 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION APPENDICES ist cycle m
56. of the calibration series For detection procedure see below 5 1 2 6 Table 6 1 1 DIG labelled control DNA Stepwise dilution Final concentration Total dilution diluted 1 5 starting in DNA dilution pg u1 concentration 1ug ml buffer A Ing ul Sul 45ul 100 1 10 B 100pg ul Sul 45ul 10 1 100 C 10pg ul Sul 45ul 1 1 1 000 D Ipg ul Sul 45ul 0 1 1 10 000 O 1pg ul Sul 45ul 0 01 1 100 000 Page 6 8 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 6 2 Hybridisation Pre hybridization NOTE Wear gloves and lab coat at all times for safety and to prevent contamination of your preparation 1 The nylon membrane is inserted into a heat resistant polythene bag 2 The hybridization solution without the probe is added 20 ml per 100 cm membrane 3 Before heat sealing the bag air bubbles are removed by rolling a pipette over the bag which should be placed on a sloping plane 4 Allow the sealed bag to gently shake in the water bath at 42 C for at least 1 hour Hybridization NOTE Wear gloves and lab coat at all times for safety and to prevent contamination 1 The pre hybridization solution can be exchanged with the hybridization solution containing the probe 2 5 ml per 100 cm membrane or as an alternative you could add the probe to the hybridization mixture directly into the bag 2 The DIG labelled probe has to be denatured as before see Section 4 1 2 3 Step S 1 and i
57. ou ccesesessesesesesesesesesesscscssssseseeessseseeseeceseesneees 12 5 12 1 5 Preparing loading and running LI COR gels eeeesseeteseeeetesssessenenesesesseneneeaeeeeneeaeey 12 6 DD MGs ACARI SUS iaa aA AA aR A E O meee taakdies 12 8 MDZ Computatio TOOLS aasman a a ccc eat Aare tet 12 8 12 2 1 Selecting the best region to screen and designing primers s sss sssssssssrrssressrenrrssrrssnensnennes 12 8 Ta Dattan aly SUS aa a a a Ea Sahat tleu aide 12 10 IZA Addinonal N Osse aA 12 13 12 4 1 List of consumables and equipment cssessssessessasscsessessecsesseseasecsnssesearsessesetersassestarseses 12 13 122 fregueniy asked QUCSCIONS asai a aa aai anaa Eaa anata E 12 15 IZO Adanali DE ORO COIS coar a a 12 16 A S DC EDEK E I 0T E ETE E E E E E TE E E A 12 16 Page vii 12 7 EMS mutagenesis of Arabidopsis SCC cssseseeseseeesteseeeseseeieesseneesseieeeteieeeneieaeeneieaeeneieaeeen 12 18 MN Mca NVM VAS ct ats ta ese eden a esac een tenere ian 12 18 127 2 ota nda ea IBV WA oom Da amp Ryeemernere nro rar ee nr Renn mre nen rr nC nS nee et erent mr nen ro eet 12 18 V2 SN ORC ON CCCI IG UC eset cece E nernsoaieen eet 12 19 IAE NINE EE AC LO Mice Sase hates saa ea Sec leeuaastchd vines ea ase teeisiies lcd lnole de as vind eestdeniestu ia asus 12 19 12 9 RE TENCO S emer rR ar eP eer Per Creare ee eee 12 20 13 ALTERNATIVE ENZYMOLOGY FOR MISTMATCH CLEAVAGE FOR TILLING AND ECOTILLING EXTRACTION OF ENZYMES FROM WEEDY PLANTB
58. prevent contamination 8 1 1 Prepare 20ul reaction mix 1 Take one PCR tube and add 10x PCR buffer MgCl 25mM Primer 10 mM dNTPs 10mM DNA 20ng ul Taq DNA polymerase 5 U pl Add sterile distilled water to bring volume to 20 ul 2 Mix by tapping bottom of tube 3 Centrifuge briefly 14 000 rpm for 5 seconds NOTE Keep all reagents and reaction mix on ice 8 1 2 PCR amplification Place tube in a PCR machine and amplify using a programme designed for the primer s In this example the following programme can be used Initial denaturing repeat steps 2 4 for 30 cycles 8 1 3 Separation and visualization of the amplification products Add 2 ul of 5x loading buffer to 8 ul of PCR sample Vortex briefly Centrifuge briefly 14 000 rpm for 5 seconds Load samples into a non denaturing 6 polyacrylamide gel 3M urea gel see Section 5 1 4 of SSR protocol for preparation of 6 acrylamide gel Step 4 Use 180 g urea 3M instead of 480 g 8M a NOTE Where the running of polyacrylamide gels is not feasible 1 5 agarose gel may be used for fragment separation For this load sample into 1 5 agarose gel A mixture of 25 fine Page 8 2 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION agarose and 75 routine agarose works very well see Section 6 1 3 of SSR protocol for preparation of agarose gel Step 4 8 1 4 Gel running conditions 1 Run gel under non d
59. product on the agarose gel The size of these two fragments equals the size of the full length PCR product The eight samples have mutations at different positions on the PCR fragment and so will produce different sized fragments Take some time to determine where you think mutations are based on the size of your bands 12 1 4 Sample purification and volume reduction All of the workshop samples will be loaded onto a single Sephadex plate Visually check the Sephadex plate for moistness and also check underneath for loose Sephadex If there is any lightly wipe the bottom with a wet paper towel and gently rinse the Page 12 5 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION bottom holding the plate on its side Assemble Sephadex plate blue plate adaptor and 96 well skirted 0 2 ml plate this plate is the waste plate Spin 2 min at 440g Replace the waste plate with a sample catch plate containing 1 5 ul formamide load dye and 2 ul 200bp marker in row D Transfer the entire CEL I reaction sample to each spin plate well Use a 20 200 ul 8 channel multi pipettor Caution Be sure to dispense liquid to the middle of each well in the Sephadex spin plate and do not touch the surface of the Sephadex Spin 2 min at 440g NOTES Formamide load dye is 250 ml deionized formamide 5 ml 0 5 M EDTA pH 8 60 mg bromophenol blue 7 200 bp marker is made by PCR using gene specific IRD labeled prime
60. q fpq fp 1 ee H 2pq 1 f q2 gt qf Im Q q 2 1 pq t var p ON H 2Poqo A Qo 27040 2N y 1 r _ p 1 r 1 PX 1 pr f 5 fao ft 1 1 1 f 0 H t t x In F 2N t var p ANmNf D z ln 1 e 2N pq Nf Nm 1 15 1 N ey ue y Ne tLNO f _ E E var p H 2p 1 p 2var p T EEN ST P 1 p t 1 Fir a 1 Fis 1 D x In 1 For en Fs Hr E Hs Hs o Ho Fsr H Fis T var p t Poqo 1 p x i 1 t H t 1 H 0 2N Nk 1 peip k N 4no0 d 1x xe ifx lt 0 Hr Ho Fir T 1 For x ST 4Nm 1 Page 16 1 POPULATION GENETICS FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION POPULATION GENETICS 1 For amp kN w Ne p p ko 1 F 4Nm z 7 1 sr w 1 W2 TF 2 2 q Q W p w11 2Zpqwy 2 G W2 W2 QW22 PW Ww W u Aq q qe pi 1 u fpo D men Oe ee ee T p 4N T p 2 In 2N F o H oP ey e 4Nu 1 0 1 e 64 1 2 1 u 2s T p InN c 1 E k n 0 140 1 K 1 a n 4Nus m0 1 4 3 Page 16 2 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION APPENDICES 17 APPENDICES 17 1 General DNA extraction techniques
61. relation to extract before centrifugation 3 5uL before 1x Page 13 5 FAO LTAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION DISCOVERY LOW COST MUTATION WEED CELERY L WI W2 W3 W4 Cl C2 C3 C4 U L Figure 2 Mismatch cleavage with celery and weed enzyme extracts TILLING PCR products of the target gene nb2 rdg2a 1500bp PCR product were produced from genomic DNA of barley The PCR products were digested with weed and celery enzyme extracts before and after concentration by centrifugation with Amicon Ultra 10K 10 uL of the digested PCR products were separated on a 1 5 agarose gel Position of SNPs are marked with blue arrows Concentrations of Weed W and Celery c extracts are listed above the lanes A 1kb ladder is loaded on either side of the samples 13 5 Conclusions Crude enzyme extracts of weeds show a similar activity to that of celery extract for the cleavge of single nucleotide polymorphisms The per unit activity however was lower than than for CEL I likely owing to the co precipitation of other plant proteins in weeds presumably including a larger amount of RUBISCO This limitation can be overcome through the use of a simple centrifugation based protein concentration step 150 mls of weed extract produces enough enzyme for approximately 2000 reactions with this protocol Page 13 6 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION NUCLEASE EXTRACTION
62. the definitions given in the text 16 1 Reading and coding genetic data 16 1 1 Presence absence coding of dominant data The most commonly used way for coding genotypes or genetic marker data is by doing a matrix of presence absence of bands usually with 1 s and 0 s This type of markers is easy to read provided the number of bands is reasonable and clear Band intensity is an issue and interpretations may change from person to person Page 16 1 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 170 2 0 07 4 u CO Rel DNI ON Y CON Sense of 0 78 i migration Figure 16 1 Typical dominant data gel consisting of 5 lanes and at least 10 well identifiable bands Bands are scored 1 if present zero otherwise Table 1 shows one reading of this gel into a spread sheet program interpretation may vary from person to person or from day to day Table 16 1 1 Basic transcription of a dominant marker gel into a spread sheet Data are organized by columns fields id b1 b10 and individuals are rows records As will be seen later this coding is not complete for analysis with corresponding software but is a good starting point Score bands are highlighted grey for clarity purposes 16 1 2 Allele size coding for microsatellites Figure 13 1 shows a typical microsatellite data with 7 alleles in 9 individuals the number of alleles may change according to the person that reads the gel
63. the film 11 2 Expose to room light for 15 17 seconds depending on the room light intensity NOTE The longer the light exposure the brighter the film gets following development Gels can be scanned or photocopied 7 5 References Cardle L L Ramsay D Milbourne M Macaulay D Marshall and R Waugh 2000 Computational and experimental characterisation of physically clustered simple sequence repeats in plants Genetics 156 847 854 Kahl G 2001 The Dictionary of Gene Technology Wiley VCH Weinheim Page 7 7 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Powell W G C Machray and J Provan 1996 Polymorphism revealed by simple sequence repeats Trends in Plant Sci 1 7 215 222 Tautz D 1989 Hypervariability of simple sequences as a general source for polymorphic DNA markers Nucleic Acids Res 17 6463 6471 Tautz D and M Rentz 1984 Simple sequences are ubiquitous repetitive components of eukaryotic genomes Nature 322 652 656 7 6 Reagents needed Use only sterile distilled water for all solutions Tag buffer dNTPs Alconox Repel silane Repelcote Sigmacote Bind silane Sterile distilled water Primers Tag DNA polymerase 5U wl DNA 10 20ng ul 10 x loading buffer Glycerol 80 600 ul Xylene cyanol 2 5 mg Bromophenol blue 2 5 mg Distilled water 400 ul 5 x loading buffer Glycerol 80 300 ul Xylene cyanol 1 3 mg Bro
64. the same frequency or at the maximum possible diversity using the formula A where p represents the 21Y iP frequency of each allele This number can be seen also as how many numbers of individuals need to be sample before we repeat an allele For example typical results for microsatellite data include A 10 and A 3 8 for example meaning that we observed 10 alleles but that 4 are common and six are rare Note that here rare is not exactly as in the previous definition but simply that contribute less to the general diversity Polymorphic Bands For dominant marker data a straight forward measure of diversity is the percentage of polymorphic bands which is simply the proportion of bands that present presence absence variability Usually they are counted with the 0 05 criterion Observed Heterozygosity For diploid individuals and polyploidy in general this is a key measure obtained when using Co dominant data It is simply the proportion of individuals per population that have different recognizable alleles at a given locus and it is denote as He or No being the former more used for an average of many populations and the latter for a single population measure Expected Heterozygosity This is the actual measure of genetic or gene diversity It represents the probability that two alleles in a locus are different and is usually denoted H He or he It is also known as Net s genetic diversity as most of the gene diversity t
65. this the researchers apply a set of SSR markers to 300 plants from the disease resistance line 300 parents and 300 of the elite variety They identify one new band with a set of SSR primers that is present in all mutants but not in either the parent or the elite variety They set out a crossing plan where they cross the mutant line with the elite variety They self the Fls and then select only plants with the mutant SSR band Starting in the F2 they select plants for disease resistance They also apply AFLP and choose disease resistant plants that share the majority of markers with the elite variety WHY IS THIS A GOOD APPROACH The researchers have developed a marker by evaluating plants that are genetically related and harbouring the same mutation Evaluation of a large number of plants allows the establishment that the marker is genetically linked to the mutation causing the phenotype The lack of such bands in the control material reduces the risk that the marker 1s from some source of natural genetic variation In the end using AFLP allows for a high density of information on the genetic background of the selected individuals It should be fairly straightforward to determine which plants have mostly elite variety background This is what the breeder wants Page 1 3 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION the elite variety with only that small amount of DNA conferring disease resistance introgresse
66. using 2 different chemicals bind silane and repel silane that must not contaminate the unintended glass plate One is a binder while the other repels and when properly applied ensure that the gel sticks only one surface and not the other Contamination can be brought about by not changing gloves and this will lead to breakage of the gel between the 2 plates 3 Clean the smaller plate using Alconox and water you may also need to use a razor blade to remove old bits of gel that have stuck Rinse and dry the plate clean the upper surface only with 95 ethanol 4 Prepare fresh bind silane solution by adding 3ul of binding solution to Iml of 95 ethanol mixed with 5ul of glacial acetic acid 5 Apply prepared bind silane solution to the upper surface of the plate and spread evenly using blue roll NOTE Clean everything following use and dispose of materials carefully according to the regulations of your organization NOTE The glass plates must be meticulously clean Detergent microfilm left on the glass plate may result in a high brown coloured background for the stained gel 6 Place clean dry spacer on the long edge of the IPC plate Make sure that there is no untrimmed adhesive underneath the spacer 7 Place the outer glass plate on the top of the spacers The raised plastic edges on the IPC plates will help position the spacer and plate Align the outer plate and spacer with bottom edge Precise alignment is necessary 8 Sl
67. your DNA samples NOTE See Section of RFLP Protocol Agarose gel electrophoresis for details of gel preparation and running 6 Stain gel with ethidium bromide Caution ethidium bromide is toxic wear gloves and lab coat and avoid inhalation 7 Visualise under UV light Caution wear gloves and UV protective glasses or a shield over your face when you are exposed to the UV light of the transilluminator Page 7 3 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 7 1 4 Denaturing gel electrophoresis NOTE Denaturing the samples produces single stranded DNA which is used for detection in polyacrylamide gels see below Single stranded detection is preferred as it results in a greater clarity in band separation for detection Setting up and casting a polyacrylamide gel using Sequencing apparatus involves the followings 7 1 5 Assembling the glass plate sandwich 1 Wear gloves and lab coat and place the Integral Plate Chamber IPC i e the big plate on the bench horizontally glass side up Clean the upper surface of the glass plate using Alconox and warm water Rinse and dry the plate 2 Clean the upper surface with 95 ethanol Apply a thin film of Sigmacote 2ml to the upper surface of the plate and spread evenly using blue roll and dry Repel silane or Repelcote are other brand names of the same product NOTE Change gloves between working with the bigger and smaller plates as you will be
68. 00 ng Taq DNA Polymerase 5 U ul 0 5 ul 2 5 U H20 4l Sul NOTE It is very important to prepare a master mix corresponding to the number of desired samples that contains all the reagents except for the template DNA Mix well and add the appropriate amount of the master solution to single reaction vials containing the individual template DNA samples you wish analysed This procedure significantly reduces the number of pipetting steps avoids errors derived from pipetting small amounts of liquid and finally ensures that every tube contains the same concentrations of reagents Page 17 5 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION APPENDICES For amplification of the Tos17 sequence the PCR machine was programmed as follows Step 1 Initial denaturation 94 C 4 00 minutes Step 2 Denaturation 94 C 0 30 minute Step 3 Primer annealing 56 C 0 30 minute Step 4 Primer extension 72 C 1 10 minutes Step 5 Cycling Repeat steps 2 4 29 times Step 6 Final extension 72 C 6 00 minutes Step 7 Hold 4 C hold NOTE The PCR programme can vary from primer to primer set and species to species with the annealing temperature being the most variable step 17 2 1 References McPherson M P Quirke and G Taylor 1991 PCR A Practical Approach Oxford University Press New York Page 17 6 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 17 3 Plant genome database conta
69. 1 sig OON a eres One ern en eRe ey ae a ee ee 17 1 17 2 Polymerase Chall reaction protocol ssion a denna eiaedea 17 2 17 Mes TMG ING GS psec rc sarc es ash A cee te detc eae aa 17 6 17 3 Plant genome database Contact information ceseeeseseeeeeseeteseeeeteaeeneteseeeesenseneseseeneaeeteneaeeneeaeeee 17 7 17 A ACFONyIMs OL CHEMICAIS and DUETS erena ia A AAR 17 8 Page x FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 1 INTRODUCTION TO MOLECULAR MARKERS Traditionally molecular markers have played a major role in the genetic characterization and improvement of many crop species They have also contributed to and greatly expanded our abilities to assess biodiversity reconstruct accurate phylogenetic relationships and understand the structure evolution and interaction of plant and microbial populations Molecular markers systems reveal variation in genomic DNA sequence and allow the tracking of this variation ideally linked to phenotypic trait variation in crossing programmes The first generation of molecular markers RFLPs were based on DNA DNA hybridisation and were slow and expensive The invention of the polymerase chain reaction PCR to amplify short segments of DNA gave rise to a second generation of faster and less expensive PCR based markers which became popular in genotyping of many species Today next generation sequencing technologies have become the dominant tool for marker assisted bre
70. 12 6 3 4 5 7 mel 0 34571 0 7 0 Conclusion Mutants 3 4 amp 5 are more related to the control 7 than to the putative parent 1 Possible explanations Mislabelling of part of the Mo and or M Outcrossing during M selfing Page 15 19 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION EVO Mua LUD ONE Beast OS 15 9 Principal Component Analysis PCA If a multivariate dataset is represented as a set of coordinates in an n dimensional data space 1 axis per variable PCA can reduce the dimensionality of the transformed data and supply a lower dimensional projection when viewed from its most informative viewpoint using only the first few principal components For a seemingly random distribution of data points in the n dimensional results space PCA starts with finding the analytical plane by slicing the results space into lower dimensional representations of uncorrelated parameters eigenvectors Principal Coordinates PCA eigenvectors efinding the analytical plane In mathematical terms PCA is a procedure to transform a set of potentially correlated observations into a set of uncorrelated data points principal components in number less than or equal to the original variables This orthogonal transformation is defined in such a way that the first principal component accounts for as much of the variability in the data as possible maximum variance and each succeeding
71. 4 61g 100mL acetic acid 95 v v Ethanol 95mLethanolabs 5mLH O Tris EDTA TE buffer 10x Composition For 100mL Tris and EDTA can be prepared 100mM Tris 10x from powder Note that the pH Cl pH8 0 10mL of 1M of tris changes with temperature 10mM EDTA Tris Cl stock 2mL of 0 5M EDTA stock LYSIS BUFFER standard 0 5 SDS w v in 10x TE PBGL has developed a range of 0 5g SDS 100mL lysis buffers for different crops If performance is poor contact PBGL for modified buffers DNA BINDING BUFFER 6M Guanidine thiocyanate it takes several hours until MW 118 2 g mol dissolved leave it approx 4 5 70 92 g 100mL 6M hours WASH BUFFER ImL of 5M NaCl 99mL of PREPARE FRESH because 95 EtOH the salt precipitates during storage DNA ELUTION BUFFER depending on application e g TE buffer Tris HCl buffer 2 3 Methods for centrifuge tubes PREPARATION OF SILICA POWDER DNA BINDING SOLUTION e Fill silica powder Celite 545 silica into 50 mL Falcon tube to about 2 5 mL approx 800mg Add 30 mL dH20O Shake vigorously vortex and invert Let slurry settle for approx 15 min Remove pipette off the liquid Repeat 2 times a total of 3 washes After last washing step resuspend the silica powder in about the same amount of water up to about 5 mL e STORE the silica solution at RT until further use silica HO 1 1 Page 2 3 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLA
72. 5 2 15 4 Some reflexions on the comparison between genetic distances uo 15 8 15 5 What genetic distance estimator to choose for essential derivation ccsseseeeseeen 15 8 15 6 Genetic distances between Population cccssessssssessssssescsesesessssssesseecscsessssesesessesseacecaeasseeess 15 9 ISA Frotocol ree PECONS ED UICE OM ninia cacao nities idibakvieeleebeie tude nseueees 15 10 TSB Yel Oa O44 ACETIS cae teeter arte a ri eters terete erry et rarer iver etarer tere sn errr 15 16 T5 9 Principal Component Analysis PGA rennin tn eure thes eea ee nen es 15 20 15 9 Considerations and TelLereNnceS durimit eden A 15 22 TETO ROTT OS csc siecaecte eects aes cece eee eee eae eee ees 15 25 IO POPOLATION GENETICS cccatetey tevcctsescecadeannsatcenettinkes dts A i 16 1 16 4 Reading and coding geneti Cate issar A AEE NE 16 1 16 1 1 Presence absence coding of dominant data ss ssssssssessressrrssrrensnensneesrrenrnennnennnnnsnnennnnenneennnes 16 1 16 1 2 Allele size coding for MicroSatellites sssessssssesesseseesssesseesseasessseaseeesessseeessseeseassneseesseeaeess 16 2 i creel me Gh 2X24 oi ore CoNo ra erent rere unr enr err Ten ere N rer Tf umrnenr err ter ore Perrier 16 4 16 1 4 Presence absence coding of co dominant data oo ecesesessssseseeeeteseeseeeeseseseseeneneseseeteneneaees 16 4 16 1 5 Formatting dominant data as CO COMINANC ceeeesseeseeteteeseeeeteteseseeneneteseateneneeaeateneeseey 16 5 16 1 6 Notes of form
73. AD distBD 2 6 dist A B E distAE distBE 2 6 dist A B F distAF distBF 2 8 In other words the distance between a simple OTU and a composite OTU is the average of the distances between the simple OTU and the constituent simple OTUs of the composite OTU Then a new distance matrix is recalculated using the newly calculated distances and the whole cycle is being repeated Page 15 12 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION RBI HUAN IEW DENT Bb AN DS Second cycle ABC D E Third cycle ABC DE 1 e 4 f l A DE 6 6 B F 8 8 8 2 Fourth ne SF DE 6 F 8 8 Page 15 13 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION EVO Mua LUD ONE Beast OS Fifth cycle The final step consists of clustering the last OTU F with the composite OTU ABC DE F 8 Although this method leads essentially to an unrooted tree UPGMA assumes equal rates of mutation along all the branches as the model of evolution used The theoretical root therefore must be equidistant from all OTUs We can here thus apply the method of mid point rooting The root of the entire tree is then positioned at dist ABCDE F 2 4 The final tree as inferred by using the UPGMA 1 ROOT modo ow gt So now we have reconstructed the phylogenetic tree using the UPGMA method However there are some pitfalls e UPGMA clustering i
74. AO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION EEV iO Mua AN TIN ONE Beas OS allele further all individuals are homozygotes Obviously genetic similarities should be 0 In our thought experiment to include 0 0 matches is wrong Unfortunately in real life matters are not so easy But our example shows what questions we have to answer before deciding which model to use heterozygosity a priori knowledge of the population structure phylogeny allelism number frequencies null alleles marker system dominant co dominant Unfortunately some of these data cannot be assessed A fruitful approach in my opinion is to compare the results of different models and look for consistencies differences which contradict our a priori expectations and trying to find an explanation to these puzzles In some cases the simple coefficients of correlation between these four genetic distances J NL SM and WJ may be calculated e g to test whether there is an effect due to the choice of the distance If the correlation is high for the six pairwise comparisons e g over 0 9 then one might not bother about the biology reproduction system vegetatively versus sexually propagated auto allogamous ploidy heterozygosity or population structure One has not to forget that genetic diversity analysis is not just number crunching it is the knowledge of the plant biology and the characteristics of the used marker system s
75. FICATION 3 DNA QUANTIFICATION This protocol is designed to provide a standardized method for evaluating the quality and quantity of genomic DNA samples extracted from different plant species Proper quantification and normalization of DNA samples to a common concentration is necessary prior to pooling samples for TILLING or Eco tilling A failure to combine genomes at an equal concentration can increase the false positive error rate because some polymorphisms will be represented at a concentration below the limits of detection 3 1 Protocol for gel electrophoresis 3 1 1 Preparation of DNA concentration standards Lambda DNA Invitrogen cat 25250 010 is used as a concentration standard A Estimate how much concentration standard will be needed for a project same organism DNA prepared using the same methods see 1 B Take this volume of DNA and vortex using the same settings as the genomic DNA extraction protocol used This should shear the DNA to the approximate same size fragments as the genomic DNA It is important to get the standard near to the same size as the genomic DNA because the intensity of ethidium bromide staining is a product of the size of DNA fragments Using the sheared DNA from 1 A prepare DNA concentration standards at 115 ng ul 76 9 ng ul 51 3 ng ul 34 2 ng ul 22 8 ng ul 15 2 ng ul 10 1ng ul 6 8ng ul 4 5 ng ul and 3 ng ul These are derived from the formula 3 x 1 5 i integers from
76. Go back to the gene page and copy the protein sequence Paste the protein sequence in the appropriate window Click the Begin Processing button The CODDLE input utility is now creating a gene model and searching for homology information that will help identify regions that are likely to be important for protein function A new window should appear with a summary of the Blocks family protein homology an intron exon join statement and the amino acid sequence Click the Proceed with CODDLE button In the CODDLE page select TILLING w EMS plants as the mutation method then click CODDLE your gene CODDLE will now evaluate every possible mutation and provide a high scoring window where the highest number of deleterious changes are likely to be found A new window will open with the CODDLE output The graphical output shows the gene model red boxes and lines protein homology green boxes and the score of the gene purple and blue lines The purple line indicates the score for predicted deleterious missense changes and the blue line is the score for the total number of non silent changes In the example below the highest scoring window for missense and truncation changes is centred at position 2008 CHO be a E i E 2 Fi_H Below the graph is information on the Blocks protein homology and an additional options box where you can examine a region of the gene that was not selected as the high scoring region Bel
77. ISATION Klenow DIG random primed dNTP mix Q dUTP DNA labeling ne Immobilized target nucleic acid e g Southern or Northern Blot _ lt a AE e Sef F Binding of anti DIG AP Detection with CSPD Multicolor Detection Colorimetric detection red biue green with NBT and X phosphate blue color blue color Fig 2 DIG labeling and detection alternatives Figure 6 6 DIG labelling and detection alternatives source DIG DNA Labelling and Detection Kit 6 1 3 Labelling the probe and dot blot quantification NOTE Wear gloves and lab coat at all times for safety and to prevent contamination 1 Dilute template DNA 0 5 ug 3 ug to a total volume of 15 ul and denature by heating for 10 minutes in a boiling waterbath then quickly chill on ice NaCl 2 Add on ice 2 ul hexanucleotide mixture 2 ul dNTP mixture containing Dig 11 dUTP and 1 ul Klenow enzyme DNA polymerase Page 6 7 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT i 6 7 8 GERMPLASM CHARACTERISATION Mix centrifuge briefly and then incubate for at least 60 minutes 20 hours is better at 37 C Add 2 ul 0 2 M EDTA pH 8 0 to stop the reaction Precipitate the labelled DNA by adding 2 5 ul 4M LiCl and 75 ul pre chilled ethanol Mix well and leave for 2 h at 20 C Spin in a microcentrifuge for 15 minutes Wash the pellet with 50 ul cold ethanol 70 Dry the DNA pellet and dissolve in 50 ul TE bu
78. L TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 170 2 0 07 4 u CO Rel DNI ON Y CON COOK BOOK FORMATTING POPULATION GENETIC DATA 1 Step 1 Scoring the data Record data in excel file and transform as necessary For the programme populations to be used in our demonstration a 2 digit formatting is required o For dominant markers ISSR AFLP IRAP or others scored as present or absent i e 1 or 0 transform as follows Manually select all data input taking care not to select the names of the individuals populations or loci First replace all 1 with 22 Second replace all 0 with 11 At this point it is helpful to check for missing data For codominant markers e g SSR data are already scored as 2 digits so no need for transformation o For mixture of dominant and codominant markers transform the dominant to codominant by scoring as 2 digit 2 Step 2 Formatting the data for populations programme e Insert a new row between the header row i e A B C and first row such that newly inserted row becomes row no and then do the following in the new row i e Row No 1 First column type in the number of populations or samples Second column type in the number of loci or markers Third column type in the highest number used to label an allele Fourth column data coding type J if the code for alleles is one digit number 1 9 2 if code for alleles is a 2 digit number 01 99 or a 3 if code
79. LASM CHARACTERISATION NUCLEASE EXTRACTION 1 5mls buffer B to tube 1 resuspend by pipetting up and down or vortexing Then transfter this liquid to tube 2 and repeat continue until the last tube In total it were 11 tubes with pellets I resuspended 5 pellets in 750uL and 6 pellets in 75OuL then combined to 1 5 mL total volume of liquid pellets 2 mL oe Figure 4 2 mL liquid after re suspension and combination of 11 pellets derived from 80 NH 4 2SO precipitation 14 Desalting Use Amicon ultra filters Distribute liquid into four filter devices making sure not to exceede 500ul in any filter Attach collection tube and spin at 14000g for 30minutes When complete remove liquid from collection tube and add 500ul buffer B and repeat Repeat this step a total of 4 times Figure 5 Transfer of liquid after resuspension to 4 Amicon Ultra filter devices Table 1 Volume of retained liquid in the Amicon Ultra filter devices after the 5 centrifugation steps and a resulting calculated desalting factor Centrifugation Starting End Desalting Desalting factor calculated 30 min at volume volume 15000 g buffer added 100 400 50 450 no 30 475 11620x 500 Forelution no S 35 470 Page 14 3 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION NUCLEASE EXTRACTION Figure 6 Amicon Ultra filter device A after 1 centrifugation 100uL liquid retained in
80. MAWICH ee eessssesesesseseeseseeeeteseseeneneeseeseneneseaseneneeaeaseneneaeaeaseneeaeey 7 4 AGMA GR Brahh oie A E eter errr ere T ter ture ter Etre cet A terre ko tere rears A emer re 7 5 POSE CUI SU ECO el AUT ON E AA A A E AE E E A E E E 7 5 7 3 Polyacrylamide gel running conditionS sssssssssrsssressssnrnssreesnennnennnssninnnennntnnnnnnnnnnnnntnnnnnnnnnnnnnnnannn annene 7 6 TA over stain E n a A E a eames eeasica 7 6 KRETO O e A A neue ae aeeear le 7 7 i MSI cies cee sates N rates EE NEE 8 1 B LAP LOUOC Oli crecen tees toed a cteetece O anne E RN 8 1 8 11 Prepare Z OUl reaction TIX aiaiai a 8 2 PL od 521100 9 DIG I O 0 emenrerteee re rree a erie rs Eeeee en rrr 8 2 8 1 3 Separation and visualization of the amplification Product 8 2 Os bee GOL RUA CON GITION S sajauicaitis icaavisisianciaattnns A 8 3 Be ioe LUCIA NMI a A E E E E E E 8 3 8 2 Primers available at Plant Breeding amp Genetics Laboratory FAO IAEA sssssssssssesrsressss 8 3 Boe RECITEN CCS urea olancs ideal aeediniesidentiteedtviac nace 8 4 ees vo gees 24 2 GW ECs Cal 216 56 a A A E Pree ree Merci reese 8 4 Og AF EP aoaaa sata Giacsbiduetal R 9 1 gt po Ue 0 10 1 0 lnia a A O a 9 2 9 1 1 Restriction of genomic DNA and ligation of adapters to the DNA fragments 4 9 2 Os Lado Feral OLIV MOM sesters corm cearciee teria arneteaise euseieeins eee ndesnathtdercomaionnn tent ease ie renee eadonitadts 9 3 Lro PCR pre amp iCat ss
81. Molecular Characterization of Mutant Germplasm A Manual Prepared by the Joint FAO IAEA Programme of Nuclear Techniques in Food and Agriculture IAEA Joint FAO IAEA Division of Nuclear Techniques in Food and Agriculture Plant Breeding and Genetics Laboratory Seibersdorf 2014 FOREWORD Plant biotechnology applications must not only respond to the challenges of improving food security and fostering socio economic development but in doing so promote the conservation diversification and sustainable use of plant genetic resources for food and agriculture Today the biotechnology toolbox available to plant breeders offers many new possibilities for accelerating the breeding process and increasing productivity crop diversification and production while developing a more sustainable agriculture The early versions of this manual provided a companion to training courses on plant mutant germplasm characterization As such the content was tailored to the curricula of the course It has now developed to include new technologies as they emerge in providing a contemporary tool kit for genotypic analysis and selection in plant breeding and genetics The first print of this manual on selected molecular marker techniques was prepared using the hand outs and other materials distributed to participants of the FAO IAEA Interregional Training Course on Mutant germplasm characterisation using molecular markers The course was hosted by the Joint FAO
82. NDIDATE GENES AND PRIMER DESIGN FOR MOLECULAR TESTING AN EXAMPLE FROM THE ANNOTATED SORGHUM BICOLOR GENOME 5 1 Overview There are several levels of genome annotation The goal of this method is to quickly identify annotated genes and recover gene and transcript protein sequences from the Sorghum genome that have potentially interesting biological function without extensive bioinformatics expertise or tools The same methods can be applied to many other annotated genomes Genome project websites typically have text files of genome annotations Many genome projects use the same generic genome browser architecture and so retrieval of sequences described here will work for different species For example there are many genomes available on Phytozome Retrieve a list of annotated genes in the Sorghum genome This file ftp ftp jgi psf org pub compgen phytozome v8 0 Sbicolor annotation Sbicolor_79_annotation_info txt while not the most verbose annotation it is easily opened and searchable Open this file up and hit control F you can do a quick text match search for keywords like disease If you search for disease you get gt 100 hits The first hit for a text search of disease is Sb0019s003010 1 Recover sequences for your favourite gene There are at least two ways to retrieve the sequence for primer design First you can search NCBI http www ncbi nlm nih gov You need to remove the 1 at the end because this delineation is
83. NG COURSE ON MUTANT GERMPLASM CHARACTERISATION WHY IS THIS A BAD IDEA Current data suggests that most mutagenesis is random In other words different plants will have different changes in the DNA Therefore you don t expect the same mutations to be found in progeny from different M1 plants Applying statistical probability you might see this once or twice in a large population but never 20 times Therefore you don t expect to find bands in the mutants that arise due to common mutations BUT HOW COME THEY ARE ALL DISEASE RESISTANT If a trait is polygenic there may be many genes involved in a trait Different plants in the example population may have mutations in different genes that give a similar phenotypic response So you don t need to mutate the same gene to get a similar phenotype Additionally there may be many possible mutations within the same gene that could give you a phenotype The different alleles may not give the same signal in a marker assay 1 1 2 An example of efficient application of markers The researchers working with the barley population above have produced one line that is highly disease resistant after backcrossing to the parental line and applying selective pressure through five generations The issue with the parental line and the mutant line is that they are low yielding The researchers would like to introgress the disease resistance into a high yielding cultivar that farmers are growing To aid in
84. Q is orthogonal if its transpose is equal to its inverse Q Q and thus it follows that Q Q QQ I I being the identity matrix An orthogonal matrix Q is thus square invertible unitary Q7 Q and normal QQ QQ As a linear transformation an orthogonal matrix preserves the dot product of vectors and therefore acts as an isometry of Euclidean space such as a rotation or reflection thus it is a unitary transformation The eigenvectors of a square matrix are the non zero vectors that after being multiplied by the matrix remain parallel to the original vector For each eigenvector the corresponding eigenvalue is the factor by which the eigenvector is scaled when multiplied by the matrix The prefix eigen is adopted from the German word eigen for own in the sense of a characteristic description In mathematical terms if A is a square matrix a non zero vector v is an eigenvector of A 1f there is a scalar lambda such that Av Av The scalar A lambda is said to be the eigenvalue of A corresponding to v An eigenspace of A 1s the set of all eigenvectors with the same eigenvalue together with the zero vector which however is not an eigenvector Page 15 21 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION EVO Mua LUD ONE Beast OS 15 9 1 Considerations and references Planning experiments and analyses Which entities should be sampled There are no formal statistical rules for
85. SM CHARACTERISATION Before use e suspend stored silica solution silica H2O 1 1 by vortexing e Transfer 50 uL of silica solution to 2mL tubes prepare 1 tube per sample NB try to keep the silica suspended during pipetting to ensure an equal distribution Add ImL H20 a final wash step Mix by vortexing Centrifuge full speed 13 200 for 10 20 sec Pipette off liquid Add 700 uL DNA binding buffer 6M Guanidine thiocyanate Suspend the silica powder in DNA binding buffer The silica binding solution is now ready for further use in the protocol see Methods PREPARATIONS For TissueLyser Prepare 2 mL tubes 1 per sample add 3 metal beads tungsten carbide beads 3mm per tube Harvest leaf material starting amount of material about 100 mg fresh weight GRINDING Use appropriate available grinding protocol mortar amp pestle Qiagen TissueLyser For the TissueLyser LYSIS Freeze 2 mL tubes containing leaf material and 3 metal beads in liquid nitrogen Grind in TissueLyser by shaking 10 sec at 1 30 speed Re freeze in liquid nitrogen gt 30 sec Grind again in TissueLyser by shaking 10 sec at1 30 speed Re freeze in liquid nitrogen gt 30 sec Store in liquid nitrogen until lysis buffer is added Add 800u Lysis buffer Add 4 uL RNaseA 10 ug ml Vortex 2 min until the powder is dissolved in the buffer Incubate 10min at room temperature Add 200 uL 3M Sodium Acetate pH 5 2 Mix by inversion of tub
86. Switch on the power pack and adjust the reading roughly to 900 1500 V and 70W 6 Pre run the gel at 125 watts The gel temperature will stabilize near 55 C Pre running the gel at 45 C for an hour or two may result in better resolution particularly if you use high catalyst concentration 7 3 Polyacrylamide gel running conditions 1 Prepare samples by adding 2 ul of formamide dye mix to 8 ul of your PCR reaction second half Denature the samples for 5 minutes and place on ice Caution formamide is harmful 2 Load 1 kb marker ladder 10 ul 1 kb ladder 50 ng ul add 6 ul formamide loading buffer load 5 ul into first lane and at convenient intervals across the gel 3 Load 8 ul of each sample containing the formamide dye mix into individual wells of the gel 4 Run gel for approximately hour and 20 minutes at 75 watts or until just before the dark blue runs off the bottom of the gel You will need to quantify the best time for your particular PCR products NOTE Do not run the dye off the gel or you will also run your sample off the gel and lose it 7 4 Silver staining 1 While the gel is polymerising prepare the developer solution Dissolve 60 g sodium carbonate in 2 litres of distilled water then add 400 ul of sodium thiosulphate solution 10 mg ml and 3 ml formaldehyde 37 solution and store at 4 C Caution Both sodium carbonate and formaldehyde are toxic avoid inhalation and wear gloves and lab coat For best resu
87. Tru91 CCA Tru91 CAA Tru91 ACG Tru91 CAG 5 Tru91 CAT Tru91 CGA Tru91 CGT Tru91 CCT Tru91 CTA Tru91 CTC Tru91 CTG Tru91 CTT 5S GATGAGTCCTGAGTAACTT 3 5 Tru91 GAC Tru91 GAG Tru91 GAT Tru91 GTA Tru91 GTC Tru91 GTG Tru91 GTT Tru91 GAA GATGAGTCCTGAGTAAGAA 3 Page 9 9 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Eco RITA Eco RITT Eco RI AC Eco RI AG EcoRI TG Eco RITC Eco RI CTG Ec RI GAC Eco RI GAA Eco RI CTA Eco RI AAC Eco RI AAG Ec RI ACA Eco RI ACC Eco RI ACG Eco RI ACT Ec RI AGC Eco RI AGG Eco RI GAT Ec RI GAG Ec RI CTT Eco RI CTC The same PCR primers are used for both the silver stained PAGE and automated DNA analyser options except that for the latter primers labelled with either HEX or FAM fluorescent dye are used 9 6 References Vos P R Hogers M Bleeker M Reijans T van de Lee M Hornes A Frijters J Pot J Peleman M Kuiper and M Zabeau 1995 AFLP a new technique for DNA fingerprinting Nucleic Acids Res 23 21 4407 4414 Page 9 10 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 10 REMAP amp IRAP REMAP definition Any difference in DNA sequence between two genomes detected by polymerase chain reaction mediated amplification of the region between a long terminal repeat of a retrotransposon and a nearby microsatellite Kahl 2001 The dispersion ubiquity and pr
88. V K is a bilinear form which is Hermitian in the sense that B x y is always the complex conjugate of B y x Then B is called positive definite if B x x gt 0 for every nonzero x in V If B x x gt 0 for all x B is said to be positive semidefinite A Hermitian matrix or self adjoint matrix is a square matrix with complex entries which is equal to its own conjugate transpose a a that is the element in the ith row and jth column is equal to the complex conjugate of the element in the jth row and ith column for all indices and j Or written with the conjugate transpose A A Ati 1 all non zero x C it is called positive semi definite if x Mx gt 0 The three most common distance estimators which are computed throughout the majority of the literature for different purposes are the Jaccard s distance J 1908 the Nei amp Li s distance NL 1979 and the Sokal amp Michener s distance SM 1958 Jy 1 n i 10 N01 1 NLy 1 2 x n x n 110 N01 2 SMay 1 n11 noo n11 710 No1 No0 3 where n is the number of bands shared by the individuals cultivars clones accessions etc x and y tested 1 e positive matching between pairs 179 1s the number of bands present in x and absent in y No the number of bands present in y and absent in x and noo the number of bands absent both in x and y i e negative matching In addition one may also using the
89. absent O b nio mismatch absent 0 present 1 c nNo1 mismatch absent O absent O d noo negative match The two most widely used similarity measures for binary data are the simple matching coefficient and Jaccard s coefficient e The simple matching coefficient is the ratio of the sum of matches to the sum of matches and mismatches at d i Gtbtctd e Jaccard s coefficient is the ratio of positive matches to the sum of positive matches and mismatches a S Oe J a b Based on defined genetic similarity coefficients genetic distance measures can be inferred The Euclidean genetic distance between the ith and jth entity is Page 15 3 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION EEV iO MUANI LUD ONCE Beas OS dij SOR 2 1 sij J if the genetic similarity matrix is positive semi definite Gower 1971 Both simple matching coefficient and Jaccard s coefficient matrices are positive semi definite In linear algebra a positive definite matrix is a Hermitian matrix which in many ways is analogous to a positive real number The notion is closely related to a positive definite symmetric bilinear form In mathematics a definite bilinear form is a bilinear form B such that B x x has a fixed sign positive or negative when x is not 0 To give a formal definition let K be one of the fields R real numbers or C complex numbers Suppose that V is a vector space over K and B V x
90. ad out platform the machine used can affect the level of allowable pooling rate of false positives and negatives robustness of the assay as well as other factors Thus the choice of read out platform can have a large impact on the cost and throughput of your operation STP has exclusively used LI CORs and therefore it is difficult to comment directly on other platforms Perry et al published TILLING work using an ABI 377 PERRY et al 2003 Other end labeling strategies such as using radioactivity should work Again the throughput efficiency and screening cost associated with the platform should be considered An alternative to end labeling is body labeling Body labeling DNA may not be as efficient as end labeling either the DNA or a probe That said one can use single strand specific nucleases to induce double strand breaks in DNA allowing visualization on native agarose gels BURDON and LEES 1985 CHAUDHRY and WEINFELD 1995 HOWARD et al 1999 SOKURENKO et al 2001 Most likely this will prove to be a lower throughput option Page 12 15 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION I am more interested in EcoTILLING How is it different EcoTILLING is a method for the discovery and genotyping of natural polymorphisms COMAI et al 2004 The starting material for EcoTILLING is DNA from natural populations rather than mutagenized ones Depending on the population one might expect a subst
91. age e Can be automated e Species specific Additional marker systems Morphological e Usually fast e Usually cheap Protein and e Fairly cheap Isozyme e Fairly fast analysis e Protocol for any species e Codominant e No sequence information required Disadvantages e Usually single loci even in polyploids e Usually dominant e Species specific e Evaluation of up to 100 loci e Marker clustering e Dominant e Technique is patented e Can be technically challenging e Alleles cannot be detected e Can be technically challenging e Few in number e Often not compatible with breeding aims e Need to know the genetics e Often rare e Often different protocol for each locus e Labour intensive e Sometimes difficult to interpret Page 1 10 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Marker STS EST SNP SCARS CAPS Microarray Advantages Fast cDNA sequences Non radioactive Small DNA quantities required Highly reliable Usually single specific Can be automated Robust in usage Polymorphism are identifiable Different detection methods available Suitable for high throughput Can be automated Codominant Small DNA quantities required Highly reliable Usually single locus Species specific Single base changes Highly abundant Highly polymorphic Codominant Small DNA quantities required Highly reliable Usually single locus Species specific Suitabl
92. aminomethane Page 17 8 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Page 17 1 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Page 17 2 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Page 17 3 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Page 17 4 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Page 17 5
93. and the measure of inbreeding will be totally false but genetic distances using shared allele distances can be computed In this case we would code as follows e 22 for the presence of a band e 11 for the absence of a band e 99 if missing data are allowed not easy to know for dominant markers The file should look similar to that in Table 3 categorical or allelic state coding before we transform it in its final form as shown in Table 5 We can no longer use zeros because in this context zeros are usually reserved for missing data Table 16 1 4 Dominant data vhs aa coded as codominant i e 2 alleles per band 1 rrr id 3J JE I IAN b7 b8 EIN z 1 1 11 i 1 2 2 i 1112222221111 3 12 112222111122221 1111411 1 1 3 d ee 1 1 eee 1 1 1 1 ee eee 5 14 112222111111111122 1 1 6 152211222211112 21122 1 1 Page 16 5 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 170 2 0 07 4 u CO Rel DNI ON Y CON 16 1 6 Notes of formatting diploid data with spread sheets Many programmes for analysing diploid data have the bad habit among many of using fixed length characters for each marker For example our first individual with genotype 198 200 may need to be coded as 198200 in a single string of characters Moreover the same genotype in categorical coding 3 4 may need to be coded 0304 in a so called two allele coding or 003004 in a three allele coding This is particularly t
94. antially higher frequency of polymorphisms than the rare induced mutations found in a chemically mutagenized population The wet bench protocols used for TILLING and EcoTILLING are the same GelBuddy has been designed to work with EcoTILLING data and some EcoTILLING specific features are available in GelBuddy Will a chemical mutagen be effective on all genes What about background mutations in the lines Do I need a license to TILL For answers to these questions please see the STP FAQ page http tilling fhcrc org files FAQ html 12 6 Additional protocols 12 6 1 Sequencing This protocol is a scaled down version of the standard high throughput sequencing protocol H 0 54 8u1 Ex Taq buffer 10ul dNTP forward primer 10 uM reverse primer 10 uM HS Ex Taq Add 15 ul mix to 5 ul DNA and mix well Page 12 16 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Run the following programme Primer annealing 73 C 1 C cycle repeat steps 2 5 for 7 cycles Primer annealing 0 5 C per second to 72 C repeat steps 7 10 for 44 cycles Quantify yield on an agarose gel this is normally done only on 1 row of a 96 well plate Pre sequencing clean up To 10 ul PCR product add and mix well 4 ul Shrimp alkaline phosphatase 1 ul Endonuclease I keep enzymes on ice at all times Check company protocol for units ul Incubate 37 C for 15 min 80 C for 15 min Follow manufacturer
95. articular methods that can validate a direction of Page 16 12 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 170 2 0 07 4 u CO Rel DNI ON Y CON evolutionary changes uses of out groups identification of ancestral characters or states etc we would be doing phenetic analysis This means that we are able to pinpoint out the separation of populations or individuals but we cannot know which end of the phylogenetic tree precedes the rest In crop improvement however this is not usually a big problem as groups are arbitrarily chosen and what matters is what is different from the others Similarly as for genetic structure see section 3 there exist several ways of estimating individual or population genetic distances but the procedure is always the same e Define a distance metric e Calculate distances among groups or among individuals results are usually stored in a pairwise matrix of genetic distances whose diagonal is zero If possible bootstrap loci or individuals i e resample information to validate observed results to get a support for the branches of the tree e Visualize the resulting distance using a particular algorithm In our case the two most used algorithm for visualizing distances among groups are UPGMA Un weighted Pair Group Method with Arithmetic Mean and Neighbor joining The former is the simplest method of tree construction It was originally developed for constructin
96. asures between populations are a generalization from the distance measures we have seen above Nei s genetic distance between the ith and jth population using the notation of Weir 1996 1S Xp lu P lu l u Di In dy In m gt 2 Phu 2 Plu l u l u where Piui is the frequency of allele A for locus in the ith population and pj is the frequency of allele A for locus in the jth population Ner s genetic identity between the ith and jth population corrected for sampling bias Nei 1978 is n D DP uP gt Pu EI P where n is the canbe of ene sampled within each population Hillis 1984 proposed a genetic distance estimator to overcome the problem of Nei s genetic distance estimator producing greatly different estimates when polymorphisms within populations vary The Hillis genetic distance estimator is gt PiuPiu Dy n 5 i p Sin Dra Y w u m Page 15 9 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION RAVIGIMUAAU IUD OTN Beast OS where Piui is the frequency of allele A for locus in the ith population Pi is the frequency of allele A for locus in the jth population 1 2 m and m is the number of loci Roger s genetic distance 1972 between the ith and jth population is defined by D lt sD Piy j where Piui is the frequency of allele A for locus in the ith population Piu 1s the frequency of allele A for lo
97. atting diploid data with spread sheets ccsssssesesesesesessseseseseseaeseseseseees 16 6 16 1 7 Transforming data types USING SOLtWAL EQ essssssseseseeseseeseseeteteseeteeseenssesseneaeasensseaseeeaeseeeaeess 16 6 To LS bl ov coal Fo TAT Oaa Ball cmemeceereeeee ret errcreerernr treet are rnrtyr arene erry rare reer sre ator nearer sneer ene ore Seen trere 16 7 TOZ GTC TLE CV S Uy aaa ase a tae aes aise AN diated dale 16 8 LO We es gel ah cacy ei U E a E ir terre et or rer tener si carer E ten cere erro Te 16 11 16 3 1 Nei s population genetics parameters Gst fAMILY c sesssesesesessesesesesesesssesesesesseereeeeseess 16 11 T632 SE Wall WIASHES FESTAUS TICS iii idee nae iideeinandd eee 16 11 16 4 Population and individual divergence and phylogenetic trees cccesessesesecssssseseeeeteseeaeens 16 12 16 5 Web resources and Software NON CXNAUSTIVE cesses eeeeseseeeeeeeeneseeteneaeeneeaeeneteaeeneeaeeee 16 13 WG Gs TROT CE GUNG S oo caes ct feta nsec ie oe cas tetas a ee dc greed ecb ented oe en td vteal deb vanaledmes Dadi ladee 16 17 LOS OME KEY COCCI ES stereos esos rac selec aoc Se accel cae cee see ea seco eae ete 16 19 TOO EqUAUON S earner a eer ae ee eee eee reer a eer 16 1 Df APPENDICE S rerasan AT AE A T Gana siracet al mace asadiass 17 1 T7 hG emeral DNA extraction techniques ssion a aN 17 1 Page ix 17 1 1 Phenol chloror orm exacti ON scien seis vcicccercis AN AAi 17 1 7A 2s CATON precipiti LION anan are deeds 17
98. bbles during the filling Perfect clean plates will not allow bubbles to form If bubbles do form tap the glass plate gently to dislodge them NOTE Gel will start to polymerize after adding APS be prepared to move quickly 6 Insert the flat side of a 0 4mm shark s tooth comb between plates before the gel polymerizes Place the binder clamps over the glass plates to insure that the plates are held firmly against the comb 7 Leave to polymerise for approximately 1 hour NOTE Make up the developer for silver staining while the gel 1s polymerising see section 5 1 6 below 7 2 Setting up the operation 1 Place the IPC assembly into the universal base against the back of the wall Stick a gel temperature indicator on to the outer plate somewhere near the centre of the gel to monitor the temperature during electrophoresis 2 Fill the upper buffer chamber with 1X TBE buffer The level of the buffer should be about 1cm from the top all the time during the run Page 7 5 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 3 Fill the lower buffer chamber and adjust the levelling screws Do not fill the lower chamber with more than 500ml of buffer 4 Remove the comb from the gel and clean the well space using distilled water Replace comb carefully teeth first this time NOTE You can only replace the comb once so be very careful 5 Pull the plastic hood over the gel tank and insert the electrodes
99. component in turn has the highest variance possible under the constraint that it is uncorrelated with orthogonal to the preceding components Principal components are guaranteed to be independent only if the data set is jointly normally distributed PCA is the simplest of the true eigenvector based multivariate analyses It might be visualized as uncovering the internal structure of the data in a way which best explains their variance Sensitive to the relative scaling of the original variables it can be done by eigenvalue decomposition of a data covariance matrix or singular value decomposition of a data matrix usually after mean centring the data for each attribute The results of a PCA are usually discussed in terms of component scores the transformed variable values corresponding to a particular data point and loadings the weight by which each standardized original variable is to be multiplied to get the component score PCA is closely related to factor analysis and some statistical packages deliberately merge the two techniques True factor analysis makes Page 15 20 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION EEV iO MUANI IN LONE Beast OS different assumptions about the underlying structure and solves eigenvectors of a slightly different matrix In linear algebra an orthogonal matrix is a square matrix with real entries whose columns and rows are orthogonal unit vectors This means that a matrix
100. cs 131 479 491 Flury B 1988 Common principal components and related multivariate methods Wiley New York Gower J C 1971 A general coefficient of similarity and some of its properties Biometrics 27 857 872 Hamming R W 1950 Error detecting and error correcting codes Bell System Technical Journal 29 2 147 160 Hillis D M 1984 Misuse and modification of Nei s genetic distance Syst Zool 33 238 240 Hillis D M Moritz C and Mable B K 1996 Molecular systematics Sinauer Sunderland Massachusetts Jaccard P 1908 Nouvelles recherches sur la distribution florale Bull Soc Vaud Sci Nat 44 223 270 Nei M 1972 Genetic distance between populations Am Nat 106 283 292 Nei M 1978 Estimation of average heterozygosity and genetic distance from a small number of individuals Genetics 89 583 590 Nei M and Li W H 1979 Mathematical model for studying genetic variation in terms of restriction endonucleases Proc Natl Acad Sci 76 5269 5273 Peltier D Chacon H Tersac M Caraux G Dulieu H and Bervill A 1995 Utilisation des RAPD pour la construction de ph nogrammes et de phylogrammes chez Petunia In Techniques et utilisations des marqueurs mol culaires Coll Les colloques INRA Rogers J S 1972 Measures of genetic similarity and genetic distance Univ Texas Publ 7213 145 153 Page 15 25 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION EVO Mua LUD ONE Beast OS
101. ct information APPENDICES Table 17 3 1 Taken from an IAEA TECDOC on Radioactively Labelled DNA Probes For Crop Improvement VIENNA SEPTEMBER 6 8 1999 DATABASE AAtDB Alfagenes Bean Genes ChlamyDB CoolGenes CottonDB GrainGenes MaizeDB MilletGenes PathoGenes RiceGenes RiceGenome Project SolGenes SorghumDB Soybase TreeGenes National Center for Genome Resources CROPS Arabidopsis Alfalfa Medicago sativa Phaseolus and Vigna Chlamydomonas reinhardtii Cool season food legumes Gossypium species Wheat barley rye and relatives Maize Pearl millet Fungal pathogens of small grain cereals Rice Rice Solanaceae Sorghum bicolor Soybeans Forest trees Various CURATOR David Flanders Daniel Z Skinner Phil McClean Elizabeth H Harris Fred Muehlbauer Sridhar Madhavan Olin Anderson Mary Polacco Matthew Couchman Henriette Giese Susan McCouch Molly Kyle Russel Kohel Bob Klein David Grant Kim Marshall E MAIL ADDRESS flanders genome stanford edu Dzolek ksu ksu edu mcclean beangenes cws ndsu nodak edu chlamy acpub duke edu muehlbau wsu edu msridhar tamu edu oandersn pw usda gov maryp teosinte agron missouri edu Matthew Couchman bbsrc ac uk h giese risoe dk srm4 cornell edu mmk9 cornell edu nus6389 tam2000 tamu edu dgrant 1astate edu kam s27w007 pswfs gov DATABASE ADDRESS http genome www stanford edu Arabidops
102. ctors eigenvectors Page 15 24 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION EVO Mua LUD ONE Beast OS 15 10 References http www icp ucl ac be opperd private upgma html Bernardo R 1993 Estimation of coefficient of coancestry using molecular markers in maize Theor Appl Genet 85 1055 1062 Cavalli Sforza L L and Edwards A W F 1967 Phylogenetic analysis models and estimation procedures Am J Hum Genet 19 233 257 Dice L R 1945 Measures of the amount of ecological association between species Ecology 26 297 302 Dillmann C Charcosset A Goffinet B Smith J S C and Datt e Y 1997 Best linear estimator of the molecular genetic distance between inbred lines In Krajewski P Kaczmarek Z eds Advances in biometrical genetics Proceedings of the tenth meeting of the EUCARPIA section biometrics in plant breeding 14 16 may 1997 Poznan pp 105 110 Dudley J W 1993 Molecular markers in plant improvement Manipulation of genes affecting qualitative traits Crop Science 33 660 668 amp Munn R and Dudley J 1995 A PC computer program to generate a dissimilarity matrix for cluster analysis Crop Sci 35 925 927 Everitt B S 1992 Cluster analysis Oxford Univ Press New York Excoffier L Smouse P E and Quattro J M 1992 Analysis of molecular variance inferred from metric distances among DNA haplotypes application to human mitochondrial DNA restriction data Geneti
103. cus in the jth population 1 2 m and m is the number of loci The genetic distance estimators proposed by Nei 1972 1978 and Rogers 1972 are affected by within population heterozygosity Swofford et al 1996 Cavalli Sforza and Edwards 1967 proposed an estimator that overcomes this problem The arc distance estimator of Cavalli Sforza and Edwards 1s D A Bor ve mn 220 gt PinPiu y where Piui is the frequency of allele A for locus in the ith population Piu 1s the frequency of allele A for locus in the jth population 1 2 m and m is the number of loci Populations are conceptualised as existing as points in an m dimensional Euclidean space which are specified by m allele frequencies i e m equals the total number of alleles in both populations The distance is the angle between these points chord D Peo J 4 OMe ts Ol j l deroa XX2 2 1 a N Pap aa J j l 1 where x and y are the frequencies of the ith allele in populations X and Y e If no alleles are shared between populations i and j then D 1 regardless of the variability within either population Swofford et al 1996 a property lacking in the estimators of Nei 1972 1978 and Rogers 1972 e The angular transformation of allele frequencies seeks to eliminate the adverse effects of different allele frequency ranges Ner s genetic distance estimators are based on the follo
104. d and not a lot of other DNA from the less suitable parent 1 2 A Summary of Marker Techniques Table 1 2 1 List of marker techniques Marker technique PCR based Polymorphism abundance RFLP No Low Medium RAPD Yes Medium High SSR Yes High ISSR Yes High AFLP Yes High IRAP REMAP Yes High Additional marker systems Morphological No Low Protein isozyme No Low STS EST Yes High SNP Yes Extremely High SCARS CAPS Yes High Microarray Yes High 1 3 Ideal genetic markers highly dependent on application and species involved e No detrimental effect on phenotype Co dominant in expression Single copy Economic to use Highly polymorphic Easily assayed Multi functional Highly available un restricted use Can be multiplexed Ability to be automated linked marker is usually good enough Dominance Co dominant Dominant Co dominant Dominant Dominant Co dominant Dominant Recessive Co dominant Co dominant Co dominant Dominant Co dominant Co dominant Genome specific in nature especially when working with polyploids A perfect marker for the gene of interest though for practical plant breeding a tightly Page 1 4 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 1 4 Marker application suitability RFLP SSR ISSR AFLP Comparative maps Framework maps bin mapping Genetic maps Breeding Varietal line identification multiplexing of probes necessary Marker a
105. d E W Jones 1999 Essential Genetics Jones and Bartlett Publishers Sudbury Massachusetts Kahl G 2001 The Dictionary of Gene Technology Wiley VCH Weinheim Meinkoth J and G Wahl 1984 Hybridization of nucleic acids immobilized on solid supports Anal Biochem 138 267 284 Sambrook J E F Fritsch and T Maniatis 1989 Molecular cloning a laboratory manual Cold Spring Harbor Laboratory Press Cold Spring Harbor N Y Southern E M 1975 Detection of specific sequences among DNA fragments separated by gel electrophoresis J Mol Biol 98 503 6 5 Reagents needed Use only sterile distilled water for all solutions 0 25M HCl Concentrated HCl 37 w v is 10 M or 40x NaCl Sodium citrate Sx TBE per liter TRIS base 54 g Boric acid 27 5 g EDTA 0 5 M 20 ml EDTA 0 2M LiCl 4M Ethidium bromide EthBr Antibody stock solution 750 U ml Anti Digoxigenin alkaline phosphate provided in the Dig Kit Roche Ammonium acetate 1M Page 6 12 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 70 Ethanol TE buffer 10 mM Tris ImM EDTA pH 8 0 CSPD solution in buffer II alkaline buffer provided in the Dig Kit Roche 0 2 N NaOH Maleic acid Tween 20 Alkaline phosphatase AP provided in the Dig Kit Roche NBT X phosphate provided in the Dig Kit Roche AMPPD resp CSPD provided in the Dig Kit Roche Hexanucleotide mixture provid
106. d from the DNA and sample volume reduced to 1 5 ul There are several methods that can be used to accomplish this The one you might be most familiar with is alcohol precipitation For TILLING we use a different method size exclusion chromatography using Sephadex G50 medium beads This is much faster than alcohol precipitation and provides consistent and high recovery of DNA 96 well plates containing hydrated Sephadex can be prepared up to one week in advance Page 12 3 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Each team will practice preparing a Sephadex plate during the 90 C incubation in Step 12 1 3 1 Pour dry G50 medium powder into a 96 hole metal plate and distribute evenly using plastic scraper Fit a 96 well membrane plate on top then invert and tap to fill wells with powder Use a multichannel pipette to add 300 ul water to the top of each well to hydrate then cover and let sit at least 1 hr at room temperature Plates are usually made in advance and stored at 4 C in a moist environment for up to one week 12 1 3 Agarose gel analysis of enzymatic mismatch cleavage and sample purification Agarose gel analysis DNA samples are electrophoresed through an agarose gel to verify that a PCR was successful in Step 12 1 1 and b digestion of mutant DNA by CELI has occurred in Step 12 1 2 Load samples in the following order 7 8 9 110 it 5 60 7 8 strip 2 section eee ee
107. e 9 7 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 9 2 Required enzymes and primer sequences for AFLP assays 9 2 1 Restriction enzymes Msel Tr9 1 PstI 9 3 Preparation of adapters Tru9I adapter oligos have 16 and 14 nucleotides 5 GACGATGAGTCCTGAG 3 3 TACTCAGGACTCAT S Take 15ul of each to get the final concentration of 50pmol ul in 30ul water Pst1 adapter oligos have 21 and 14 nucleotides 5 CTCGTAGACTGCGTACATGCA 3 3 CATCTGACGCATGT S Take 15ul of each to get the final concentration of 50pmol ul in 30ul water 9 4 Reagents needed Use only sterile distilled water for all solutions 5x RL buffer 50 mM TrisAc pH7 5 50 mM MgAc 250 mM KAc 25 mM DTT 250 ng ul BSA Rare cutting enzyme PstI SU ul Frequent cutting enzyme Tru9 SU ul PstI adaptor 5 pmole ul or EcoRI adaptor 5 pmole ul Tru9I adaptor 50 pmole ul rATP 10 mM T4 DNA ligase 10 x PCR buffer Pstl or EcoRI non selective primer 50 ng ul Tru9 non selective primer 50 ng ul Taq DNA polymerase 5U wul Page 9 8 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Agarose To 1E buffer Pstl or EcoRI selective primer Tru9I selective primer dNTPs 10 mM Formamide ROX Standard 9 5 Sequence information of adapters and primers used for AFLP Tru91 primer Eco P0 Tru91 P0 Tru91 PC Tru91 CAC Tru91 ACC
108. e UV light of the transilluminator Page 10 3 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION REMAP amp IRAP 10 2 References Hirochika H K Sugimoto Y Otsuki H Tsugawa and M Kanda 1996 Retrotransposons of rice involved in mutations induced by tissue culture Proc Natl Acad Sci USA 93 7783 7788 Kalendar R T Grob A Regina A Suoniemi and A Schulman 1999 IRAP and REMAP two new retrotransposon based DNA fingerprinting techniques Theor Appl Genet 98 704 711 10 3 Reagents needed Use only sterile distilled water for all solutions Tag buffer dNTPs Primers Taq DNA polymerase 5U ul DNA 10 20 ng ul 10 x loading buffer Glycerol 80 600 ul Xylene cyanol 2 5 mg Bromophenol blue 2 5 mg Water 400 ul 5 x loading buffer Glycerol 80 300 ul Xylene cyanol 1 3 mg Bromophenol blue 1 3 mg Water 400 ul Ethidium bromide Agarose Acrylamide Bis acrylamide TBE Page 10 4 FAO TAEA INTERREGIONAL TRAINING COURSE ON MUTANT SINGLE NUCLEOTIDE GERMPLASM CHARACTERISATION POLYMORPHISMS 11 SINGLE NUCLEOTIDE POLYMORPHISMS SNPS SNP definition Any polymorphism between two genomes that is based on a single nucleotide exchange small deletion or insertion Kahl 2001 Small nucleotide polymorphism SNP is a relatively new marker technology originally developed in human SNPs are the most abundant polymorphic marker with 2 3 poly
109. e a 9 3 oE E D EE E E E E A E A E E E 9 3 91 5 SClIECH VE Preamp Ned A ON esiciccosticncenttdcerstarst ued cessed a a a 9 4 9 1 6 PCR mix for selective amplification products to be visualized On PAGE 9 5 9 1 7 PCR profile for Selective amplification products to be visualised on PAGE 0008 9 5 9 1 8 Polyacrylamide Gel Electrophoresis PAGE oo ccseeseesessesseseesssseseeneneeseeseneneeseeseneeaeacens 9 5 Ore SiVEr staining O PAG sraa a ianbee Merete erceaedivaenth 9 6 9 1 10 PCR mix for selective amplification products to be visualized on an automated DNA S oc nee ee ete ere ere er are eran Peper A tetera tt eer ee 9 6 9 1 11 PCR profile for selective amplification products to be visualized on an automated DAA TA Ac e ieee erate peer eee eee ree nr ren er ne er cree opr ee T ere rere creer rere er ere 9 6 9 1 12 Electrophoresis using an automated DNA analySelL eeesseesssssseesseessesesesseneteieaeeteneneaeacens 9 6 9 1 13 Production of single primer linear PCR products cssssesesessssesssesssesssesesessessseseseeeseseees 9 7 9 1 14 PCR amplification to produce single stranded DNA ccssssssesssesescsesesesesesssesesseeseseseseees 9 7 9 2 Required enzymes and primer sequences for AFLP aSSAYS sssssessssseseeseseeseteseeneseseeteseseeneaeenenees 9 8 JA Mag RES ULC CLOT OT Za NOS waicach itachi lobia erst lots tates rang kau aieumalucualeeNinas aide otis Nirwalsoests 9 8 9 5Prepatavion Or adapter S annann
110. e can choose the region of a gene with the highest number of possible deleterious changes For projects where there are a large number of targets or where the cost of screening could become prohibitive choosing a best screening region is a good approach This is the approach that STP takes for its public services For this section of the course students will use computational tools to choose a target region for TILLING design primers and place an order with STP There are three important components necessary for the optimal TILLING order 1 a good gene model intron exon positions 2 a good protein sequence homology model and 3 a good PCR primer pair These choices are facilitated by the CODDLE Input Utility http www proweb org input which accepts genomic cDNA and or protein sequences from your own files or via links from public databases Codons Optimized to Discover Deleterious LEsions Page 12 8 3 A FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Open the Test Genes page http tilling fhcrc org tllingdemo CODDLEtestgenes in a new browser window Select a gene by clicking on the gene name Here you will find both genomic and protein sequence information Select and copy the genomic DNA sequence Open CODDLE Input Utility http www proweb org input in a new browser window In the CODDLE input page enter the gene name and paste in the genomic sequence information
111. e excel sheet Did you get the same results Page 3 6 FAO TAEA INTERREGIONAL TRAINING COURSE ON MUTANT RESTRICTION ENZYME GERMPLASM CHARACTERISATION DIGEST 4 RESTRICTION ENZYME DIGEST Restriction enzymes are produced by various bacterial strains In these bacterial strains they are responsible for limiting attack from certain bacteriophages They act by cutting restricting the phage DNA at a sequence specific point thereby destroying phage activity Sequence specific cutting is a fundamental tool in molecular biology DNA fragments can be ligated back together recombined by T4 DNA ligase In addition to cloning and molecular marker applications restriction digestion is being used for new techniques such as for creation of restriction phased libraries for Next Generation Sequencing NGS Many restriction enzymes have been cloned and are available in a commercially pure form They are named after their bacterial origin e g EcoRI from E coli The known restriction enzymes recognize four or six bases eight in the case of very rare cutters like NotI and Sfil Recognition sequences are almost always palindromic where the first half of the sequence is reverse complementary to the second e g the Xbal site is SY T C T A G A 7 7 A G A T C T P The position of the actual cut is enzyme dependent and symmetrical on the opposite strand SY TIC T A G A 3 7 A G A T CYT F leaving cohesive termini sticky ends a
112. e for high throughput No gel system Can be automated Disadvantages Sequence information required Substantially decreased levels of polymorphism Very high development costs Requires sequence information Can be technically challenging Very labour intensive Very high development and start up costs Portability unknown Page 1 11 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Page 1 12 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 2 LOW COST DNA EXTRACTION WITHOUT TOXIC ORGANIC PHASE SEPARATION One of the most common activities of molecular biology is the extraction of genomic DNA from cells Traditional methods utilized lysis followed by organic phase separation to remove unwanted molecules such as proteins Commercialized kits from companies such as Qiagen have circumvented unwanted toxic organic phase separation by using methods that employ DNA binding to silica with the use of chaotropic salts This approach has proven superior in terms of speed and quality of product and has become the industry standard The main issue with these commercial kits is that costs can become prohibitively expensive for large scale applications The protocol below describes a home made silica DNA binding protocol that costs about 1 10th that of a commercial kit and produces DNA quality suitable for TILLING and other high throughput molecular applications 2 1 Materials
113. e gel surface along its length Gently fill the reservoir to the fill line insert the electrode cover close the top and then click on Collect image From the time the comb touches the slot until the time the current is applied should be no more than about 20 min or so to prevent diffusion After 10 min open the LI COR be sure that you hear the pling signal and the high voltage light goes off remove the comb and gently rinse the slot with buffer Replace the upper electrode close the door and resume the run for 3hrs 45min Page 12 7 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 12 1 6 Data Analysis This component of the TILLING exercise is intended to be performed by students on computers with internet access Programs and training files along with the protocol below can be downloaded here http tilling thcrc org tillingdemo computational_tools shtml By following the instructions on the webpage you can easily access all the links described in the protocol below 12 2 Computation tools 12 2 1 Selecting the best region to screen and designing primers The current PCR target size for TILLING is between 725 and 1600 bp with the optimum being around 1 5 kbp The average gene size in Arabidopsis is 3 4 kb and thus a single PCR amplicon will not cover a whole gene For genes larger than 1 6 kb one can either screen the entire gene with overlapping primer pairs TILLING by tiling or on
114. east OS utmost importance of the choice of a genetic distance estimator i e t should not be chosen uniquely given the availability of a computer programme a naive measure of genetic similarity or measure of genetic distance is the Hamming distance where d proportion of sites at which two sequences differ Sorghum TGTATCGCTC Sugarcane TGTGTCGCTC Single substitution Multiple substitution Sequence difference 1 change 1 difference 2 changes 1 difference Expected difference 4 Sorghum TGTATCGCTC Q 2 S Rice AGTCTCGTTC A S Sugarcane TGTGTCGCTC Rice AGTCTCGTTC Observed difference Time The Hamming Distance is a poor measure of the actual number of evolutionary changes as a site can undergo repeated substitutions It might be appropriate for short periods and or parental inferences In order to define a genetic distance estimator we have to assay the genetic similarities of the entities we are studying Let these entities be dominant markers present absent characters the genetic similarity between the ith and jth entity is sij As such genetic similarity coefficients are symmetric sij sji positive and bound by 1 0 lt sij lt 1 Two individuals are completely identical when sij 1 and completely different when sij 0 Genotypic scores and counts for a binary variable dominant marker entity i entity count condition present 1 present 1 a N71 positive match present 1
115. ecies and heritability of variation is required for proper application To highlight this we offer two different examples of application of markers one correct the other incorrect If you are uncertain if molecular markers are right for you please feel free to contact the Plant Breeding and Genetics Laboratory for further advice 1 1 1 An example of how not to use molecular markers A research group is starting a new project to use induced mutations to breed for improved disease resistance in barley They have never used induced mutations before and would like to use molecular markers to track disease resistance because it is very time consuming and expensive for them to test their material phenotypically at every generation The group produces a large M1 population that was treated with gamma rays They self fertilize the barley and grow the M2 in the next generation They apply pathogen to the plants and score resistance Of 10 000 plants they find 50 with some increase in resistance to the pathogen These 50 plants come from 20 different M1 parents They collect tissue from these 50 plants along with 10 mutagenized plants that are susceptible and 10 plants that were not mutagenized They extract DNA and perform an AFLP marker analysis They hope to find bands that are common in the resistant plants but not in the control Their data is not conclusive so they decide to look at even more plants Page 1 2 FAO ITAEA INTERREGIONAL TRAINI
116. ed in the Dig Kit Roche dNTP mixture containing Dig 11 dUTP provided in the Dig Kit Roche Klenow enzyme DNA polymerase provided in the Dig Kit Roche Bromophenol blue dye solution 45 ul NBT solution 35 ul BCIP solution 10 ml buffer III NBT solution 75 mg ml BRL 95540 Dissolved in dimethylformamide TOXIC BCIP solution 50 mg ml BRL 95541 Dissolved in dimethylformamide TOXIC Denaturing solution 0 4 M NaOH IM NaCl Loading buffer x10 per ml Glycerol 80 600 ul Xylene cyanol 2 5 mg Bromophenol blue 2 5 mg H2O 400 ul Hybridization pre hybridization solutions 100 ml 50 v v Formamide 50 ml 5 w v Blocking reagent 5g 5x SSC pH 7 0 25 ml 20xSSC 0 1 N Lauroyl sarcosine 1 ml of 10 stock 0 02 w v SDS 0 2 ml of 10 stock Buffer I Maleic acid buffer MAB 0 1 M Maleic acid 11 61 g l 0 15 M NaCl 8 76 g l pH 7 5 Autoclave Buffer II Maleic acid 1 w v Blocking reagent provided in the Dig Kit Roche NOTE It is advisable to prepare a 10 x concentrated stock solution of blocking reagent Therefore weigh 10 g of blocking reagent into an autoclavable flask fill it up to ca 90 ml Page 6 13 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION with buffer I and heat it in an 80 C water bath to dissolve the blocking reagent needs about 1 hour The last particles can be dissolved by briefly boiling in a microwave Autoclave the solution
117. eding in developed countries and biotechnology companies While incredibly powerful these techniques are still cost limiting and carry a heavy bioinformatics load making use difficult in developing countries This will likely change in the future as sequencing technologies and analysis tools increase in power and decrease in cost Until then we provide in this manual a series of low cost marker systems that are applicable in many laboratories with infrastructure for basic molecular biology Molecular markers are being used extensively to investigate the genetic basis of agronomic traits and to facilitate the transfer and accumulation of desirable traits between breeding lines They are used both to tag target genes and to monitor the genetic background A number of techniques have been particularly useful for genetic analysis For example collections of RFLP probes have been very versatile and important for the generation of genetic maps construction of physical maps the establishment of syntenic relationships between genomes and marker assisted breeding Numerous examples of specific genes that have been identified as tightly linked to RFLP markers are available for the improvement of specific agronomic traits in almost all major crops Specific examples include viral fungal and bacterial resistance genes in maize wheat barley rice tomatoes and potatoes Additional examples include insect resistance genes in maize wheat and rice as well as dro
118. el image Move the box to lane 2 and hit the m key CAUTION Do not change the size of the box You must measure the same volume of box for 11 12 each lane If you accidentally change the size of the box while measuring lanes start over Continue to move the box and hit the m key until all the lanes in a gel tier are measured including the standards Evaluate the table Does every sample have the same area value If not you have changed the size of the box and you need to start over Does the number of samples equal the number of lanes on the gel If not you either missed a lane or counted a lane more than once If so you need to start over Page 3 4 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION DNA QUANTIFICATION 13 When you are satisfied that the table is correct Select the entire contents of the table control A copy and paste into the raw data section of the excel worksheet 14 Copy the density area from the last 6 samples representing the standards of known concentration in the test image Paste these data into the density column just below the raw data The excel table for the test gel image is found on URL CAUTION If you used less than the normal complement of standards or put the standards in a different order than is represented in the ng ul column you will need to modify this section appropriately 15 Select the density and ng ul columns including the title
119. ely with self made low cost buffers and show a comparable concentration and yield as the other extractions Page 2 7 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION L 1 1 2 2 3 3 4 4 5A 5B 6A 6B 7A 7B 8A 8B 3 3 4 4 SA 5B 6A 6B 7A 7B 8A 8B i 4 E i t E ee ee weno oy an ou ge eg FF FF Fg am omp a Figure 2 TILLING PCR products amplified from genomic DNA extractions of barley obtained by silica based low cost DNA isolation method using different combinations of self made buffers and buffers provided by Qiagen DNeasy kit An aliquot of SuL of each PCR reaction was separated on a 1 5 agarose gel top half Target gene nb2 rdg2a 1500bp PCR product bottom half Target gene nbs3 rdg2a 1491bp PCR product 1 8 Barley genomic DNA preparation see Table 1 using QIAshredder columns for the preparation of barley leaf lysates Lysis procedure following the kit instructions preparation of leaf lysates using the kit instruction but without using QIAshredder columns A B technical replicates L size standard 1 kB Plus DNA ladder Invitrogen 2 5 Conclusions The DNA extractions from barley using the silica based low cost method provided high quality genomic DNA and sufficient yield suitable for standard PCR application such as molecular markers and TILLING Page 2 8 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION DNA QUANTI
120. emove lines 12 Set the molecular weight migration Click the show calibration information box Vertical lines will appear 13 Place the mouse over one of the numbers in blue and drag that number to the desired location on the gel The 700 should align with the highest band in the ladder lanes The 200 should align with the 200 bp marker Now set the 0 and 100 migration by dragging the red numbers to the bottom of the signal on the gel image 100 and to the top of the full length product 0 When complete click the calibration information box again to make lines disappear Select mutations Select the record signals mode box Using the 700 800 box switch between channels to find mutations You will be prompted to enter the size of the full length product 0 migration Enter the number at 0 and click ok Enter your initials in the created by box The signal grouping should be set to all lanes Click the mouse over the mutation to select the mutation When selecting mutations note that mutations in the 700 channel are marked red and those in the 800 are marked with a blue box If you are unsure of a mutation note that the size of the band is given at the bottom of the window when your mouse is over the mutation For any one lane the sizes of bands p iN p lt N Page 12 11 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION in the blue and red boxes should
121. enaturing condition at 12 V cm for 10 13 hours NOTE This is normally done overnight NOTE Non denaturing gels are run at low voltages and 1 x TBE to prevent denaturation of small fragments of DNA by the heat generated in the gel during electrophoresis 2 Run agarose gel at 120V for at least 2 hours NOTE Do not run the bands off of the bottom of the gel 8 1 5 Silver staining Follow Section 6 1 6 of SRR Protocol silver staining 8 2 Primers available at Plant Breeding amp Genetics Laboratory FAO TAEA Page 8 3 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Y C T R A G 8 3 References Davila J A Y Loarce and E Ferrer 1999 Molecular characterization and genetic mapping of random amplified microsatellite polymorphism in barley Theor Appl Genet 98 265 273 Provan J W T B Thomas B P Forster and W Powell 1999 Copia SSR a simple marker technique which can be used on total genomic DNA Genome 42 363 366 Yang W A C De Olivera I Godwin K Schertz and J L Bennetzen 1996 Comparison of DNA marker technologies in characterizing plant genome diversity variability in Chinese sorghums Crop Sci 36 1669 1676 Zietkiewicz E A Rafalski and D Labuda 1994 Genome fingerprinting by simple sequence repeat SSR anchored Polymerase Chain Reaction Amplification Genomics 20 176 183 8 4 Reagents needed Use only sterile distilled water for all solu
122. entification of the haptene molecule at the hybridization sites is facilitated by an immunological detection reaction In the case of the Digoxigenin system DIG system Roche the haptene is digoxigenin a steroid exclusively occurring in the plant Digitalis purpurea The molecule is linked to desox yuracilphosphate by an 11 atoms linear spacer Dig 11 dUTP Figure 5 5 The DNA DNA hybridization sites are detected by using antibodies against digoxigenin which are conjugated to alkaline phosphatase AP as a reporter enzyme By adding the colourimetric substrate NBT X phosphate or alternatively the chemiluminescence substrate AMPPD CSPD the presence of the enzyme is visualized Figure 5 6 The main advantage of the non radioactive system is the avoidance of radioisotopes and the associated hazards as well as saving high costs for maintaining an isotope laboratory e g for disposal of the radioactive waste Furthermore DIG labelled probes are much more stable They can be stored at 20 C for more than 12 months and the hybridization solution can be re used several times At the same time the sensitivity of the DIG system is comparable to that of P labelled probes OH T Jl i OH A 7 I II ni oA gt P 0 P 0 P 0 O Cr oe Co x4 Lit OH Figure 6 5 Structure of the Dig 11 dUTP molecule source DIG DNA Labelling and Detection Kit Page 6 6 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTER
123. equal the full length product Do not be alarmed if the sizes are up to 100 base pairs off To delete a box hold down the option key and click the box re 16 Once you have selected all of the mutations select the show signals box to remove the boxes Look at the gel again to be sure you have selected real mutations Select the box again to make the boxes reappear 0go onog 17 To zoom in to a region of the gel select the zoom in mode box and click on the region you wish to enlarge To zoom out select the zoom out mode box To fit the image back to the original window select the zoom to window box 18 When you have finished analysing the gel click the log box to see a report Inspect the signals sorted by lane table True mutations should have paired signals in the 700 and 800 channel that add up to the full length product size 19 Compare your data with what was found by STP At STP data from GelBuddy is directly posted to the program Squint in the STP database using the GelBuddy autopost function You can view squint files for this exercise here http tilling fhcrc org cgi bin displayWorkshop pl form newSquint Under squinting click new modify view In the LI COR run name field enter the run name The run name does not include 7 jpg or 8 jpg For instance for the first set of images on the images page you would type 42600mla eb as the run name Select list current squint file
124. es Paste again in NOTEPAD Put the cursor in front of the first data in each row and hit backspace the space between the comma after the sample name and the first score 1s deleted Save Use a simple file name one word e Save the txt file in the same folder as the Programme Populations exe 4 Step 4 Running the programme Open program and choose sequentially by entering the corresponding numbers and hitting Enter e Compute individuals distance tree when data has only one population No 1 e Type the exact name of txt file from last saving in the space provided The txt extension must be included in the name The name is also case sensitive Phylogenetic tree of individuals with bootstraps on locus No 3 Nei s standard genetic distance Ds 1972 No 2 UPGMA No 1 10000 Enter desired name for output file with tre extension Wait for the programme to finish running The output file with the tre extension is now deposited in the same folder as the programme Populations exe e Double click on the output file with the tre extension in order to see the resulting dendrogram 16 6 References Cavalli Sforza L L Edwards A W F 1967 Phylogenetic analysis models and estimation procedures Am J Hum Genet 18 233 257 Chakraborty R and Danker Hopfe H 1991 Analysis of population structure A comparative study of different estimators of Wright s fixation
125. es Incubate on ice for 5 min Centrifuge 13 200 rpm 5 min RT pellet the leaf material Page 2 4 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION DNA BINDING e prepare 700 uL silica binding solution see above e transfer 800 uL of the supernatant to the tubes containing silica binding solution Do not transfer leaf material e Completely resuspend the silica powder by vortexing and inversion of tubes approx 20 sec e incubate 15 min at RT on a shaker at 400 rpm and or invert tubes from time to time e Centrifuge 13 200 rpm 3 min RT pellet the silica e Remove the supernatant with pipette WASHING 2 times washing e Add 500 mL wash buffer Prepared fresh see above e Completely resuspend the silica powder by vortexing and inversion of tubes approx 20 sec e Centrifuge 13 200 rpm 3 min RT pellet the silica e Repeat the washing step optional a third washing step e Remove the supernatant with pipette as complete as possible e optional short spin and remove residual liquid e After last washing step dry the silica in the hood up to hour at RT make sure there is no wash buffer left RESUSPENSION e Add 200uL TE buffer or 10mM Tris buffer e Completely resuspend the silica powder by vortexing and inversion of tubes approx 20 sec e Incubate 20 min RT with gentle agitation on a shaker at 400 rpm and or invert tubes from time to time e Centrifuge for t
126. euseces 4 5 FINDING CANDIDATE GENES AND PRIMER DESIGN FOR MOLECULAR TESTING AN EXAMPLE FROM THE ANNOTATED SORGHUM BICOLOR GENOME 00066 5 1 S Le OVE VS W anai a A 5 1 C PEELE e E R E E er rere 6 1 O BPN oe 0 1 0 6X0 Lr o E oa E eA 6 2 old Agarose Gel CleCtrO PMO ESS ainiaan aa A A 6 2 6 1 2 Southern blotting and Nybridizatioissroncosrcn nen ene ee 6 4 6 1 3 Labelling the probe and dot blot QuantificatiOn csssscsssesesesssesesesssesessssesssesesesesseeeeseees 6 7 OZ TA VIVO SACOM coer ees cseniree tease ence este te ae enero ears ee aed nese eee sees 6 9 GAR WW AS I TC BOO is oascs cata sctg cea deceeoees seosndniy se arasiesescalear seaeteenca cena easier adel tauentmaeieveem ene aiaeas 6 9 O22 CVC CIO Maaa a a Er E a a 6 10 6 3 Membrane rehybridisation method s ss ssssssssssrsssrsnsnsnrnssnennnennnennnsnnnnnnnnnnennnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnnea ne 6 12 GA RELCPONCES nsee a a a Meee a ine 6 12 Sree E E E 21 6 REEE errr E TE E E E PE E N P E E E 6 12 Mle oe E o A AE T AA IA A AE E E A aaeeeeene 7 1 We PrOtoCOl saan a OO 7 2 P REEPERTEICION II unir a eeu aaa nade 7 2 PAO PCRa mnp CIO a vache eee eta emneede 7 3 7 1 3 Separation of the amplification products in agarose gel sssscssseesesesssesessesesseeseseeeseseeeeeees 7 3 7 1 4 Denaturing gel electrophoresis ecesssseesecesssseseesssssesessesenesesesseseneseseeseneeaeasenensseaeaseneneeaeaseneeaees 7 4 7 1 5 Assembling the glass plate SA
127. evalence of retrotransposon like elements in plant genomes can be exploited for DNA fingerprinting Two DNA techniques based on retrotransposon like elements are introduced here IRAP and REMAP Kalendar et al 1999 The IRAP Inter Retrotransposon Amplified Polymorphism markers are generated by the proximity of two retrotransposons using outward facing primers annealing to their long terminal repeats LTRs In REMAP REtrotransposon Microsatellite Amplified Polymorphism the DNA sequences between the LTRs and adjacent microsatellites SSRs are amplified using appropriate primers The principle of IRAP und REMAP is shown in Figure 9 1 below Figure 10 1 Principle of the IRAP und REMAP strategy IRAP PCR primers facing outward from the 5 black arrows and 3 grey arrows ends of LTRs will amplify intervening DNA from the retrotransposon in any of the three possible orientations tail to tail head to head head to tail REMAP LTR primers are used together with a primer consisting of simple sequence repeats blank boxes Kalendar et al 1999 d lt alendar etalk 19995 10 1 Protocol REMAP and IRAP markers are species specific In the FAO IAEA course the following primers for rice and barley were available and used in conjunction with rice and barley DNA Table 10 1 LTR primers from the rice retrotransposon Tos17 Hirochika et al 1996 CAHrechike et aL 1996 sequence and PCR annealing temperatures T Primer Sequence Ta
128. ffer Dot Blot Quantification of labelling efficiency NOTE Wear gloves and lab coat at all times for safety and to prevent contamination It is absolutely necessary to estimate the yield of DIG labelled probe If the probe concentration in the hybridization solution is too high large background signals will appear on the blot after detection Therefore the kit contains a DIG labelled control DNA of known concentration A dot blot with a dilution series of your probe and the provided control DNA makes the test If the amount of template DNA was about 1 000 ng you can expect between 260 ng after hour incubation with Klenow enzyme up to 780 ng after 20 hours of newly synthesized DIG DNA 8 1 Cut a piece of nylon membrane and label 1 cm squares with a soft pencil NOTE Do not use an ink or ballpoint pen 8 2 Apply 1 ul of the probe dilution series 1 10 1 100 1 1 000 and of the control DNA dilution series to each square on the membrane To prepare the dilution series of the control DNA follow the scheme proposed in the kit manual see below 8 3 Fix the DNA to the membrane by cross linking with UV light or baking dependent on the type of nylon membrane used 8 4 After the spots are dry continue with the detection procedure The colourimetric assay is the method of choice because you can easily follow the development of the colour on the membrane 8 5 Stop the reaction as long you can see differences between the concentrations
129. followed quickly and carefully so make sure you have everything set up and ready 6 Remove gel from the silver stain solution and rest it on a tray containing water do not put it in the water yet Dispose of spent stain according to the regulations of your organization Rinse the box that contained the silver stain with water 7 Set a timer for 10 seconds Start the timer and quickly lower the gel into the water Agitate several times to remove all excess silver stain When 10 seconds is up quickly drain the gel and place it in the developing solution 8 Agitate the gel in developer solution and use a piece of white paper placed behind the gel to check progress of the band development Keep an eye on the gel as it develops Stop the reaction when bands start to appear near the bottom of the gel i e 70 bp marker on the 1 kb ladder by taking the gel out of the developer solution 9 Put the gel into a tray containing 2 litres of stop solution 10 glacial acetic acid for 5 minutes NOTE The stop solution could be what was saved from earlier first step fixative if there is no need for re use If re use is desired it 1s best to have separate fixative and stop solutions as the latter contains AgNO3 and therefore not suitable for use again as fixative 10 Rinse gel in water for 5 minutes and leave it to dry standing vertically 11 Gels can be recorded or documented using Kodak duplicating film 11 1 Place the glass plate upside down on
130. g taxonomic phenograms i e trees that reflect the phenotypic similarities between species but it can also be used to construct phylogenetic trees if the rates of evolution are approximately constant among the different lineages The latter Neighbor joining Saitou and Nei 1987 is a method that is related to the cluster method but does not require data whose lineages have diverged by equal amounts Common genetic distances include e Nei s genetic distance Nei 1972 e Cavalli Sforza chord measure Cavalli Sforza and Edwards 1967 l e Reynolds Weir and Cockerham s genetic distance 1983 These types of analyses are well handled by the set of program PHYLIP and also by POPULATIONS although any software that can produce a distance matrix will be useful for producing a tree Testing of the branches and tree structure however is a delicate task and is mostly the domain of phylogenetics instead of population genetics although the two fields overlap 16 5 Web resources and software non exhaustive FSTAT http www2 unil ch popgen softwares fstat htm Pros General purpose diploid analysis software with not so difficult data file Nice interface very good help files and handles most of the necessary analyses Output files are also good almost ready to use Page 16 13 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 170 2 OW CO Rel DNI ON Y CON Cons doesn t perform nested Fst analy
131. g ul you may want to dilute the rest of the samples prior to the agarose gel assay This will save a gel run and the time required to estimate DNA concentrations A Add 3 ul of DNA sample plus 2 ul DNA load dye 30 glycerol plus bromophenol blue Do not add xylene cylanol as it migrates near the genomic fragment and can interfere with quantification Use the same volumes for the DNA concentrations standards B Load the gel When using a 28 tooth comb lanes 1 14 should contain genomic DNA samples and lanes 15 28 the concentration standard Lane 15 should contain the 3 ng ul standard lane 16 the 4 5 ng ul standard and so on with lane 28 containing the 115 ng ul standard 3 1 4 Running the gel A Run gel at 5 6 V cm 160V on a large Owl A2 rig should be about the same for our rigs for 30 60 min The DNA sample should be completely out of the well and into the gel about 0 2 cm Do not run the gel too long as the genomic DNA band will become diffuse and hard to quantify NOTE Degraded samples those producing smeary bands with standard agarose gels should be run on a 3 MetaPhor agarose gel 10 5g MetaPhor Cambrex in 350ml 0 5x TBE The preparation of the MetaPhor gel is more specific in that it must be allowed to hydrate in the 0 5x TBE for 15 min prior to melting After melting and pouring allow to set at room temperature then put in the cold room 4 C for 15 30 min This final step is critical for proper setting of t
132. gh the stack down with a 500 g weight Leave overnight for transfer and sleep well Remove the paper towels and the 3MM paper from the gel Peel the membrane off and soak it for 5 minutes in 2XSSC to remove any pieces of agarose sticking to the filter Dry the membrane on 3 MM paper for 30 minutes Then fix the DNA by baking the filter refer to manual of the nylon membrane which is used e g the positively charged nylon membrane from Roche is baked for 30 minutes at 120 C Proceed with hybridization of probe weight a yn paper towels nitrocellulose filter Whatman 3MM paper or nylon i ao D transfer buffer gt S Figure 6 4 piina apparatus for transfer of DNA Sambrook etal 1989 Sareek erne DNA DNA hybridisation using the DIG system NOTE The hybridization protocol used in the FAO IAEA course was that obtained in the Random Prime Labelling and Detection System RPN 3040 3041 commercially available from Amersham LIFE SCIENCE This is a very good labelling and detection kit that comes Page 6 5 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION with a step by step procedure However if you cannot obtain the Amersham kit try the following protocol which also works well Most of the non radioactive labelling and detection systems for nucleic acids are based on the incorporation of a nucleotide which is linked to a haptene molecule into the hybridization probe The id
133. h variable is sij the weight for the Ath variable measured on the ith and jth entity is wij i 1 2 n j 1 2 n n is the number of entities k 1 2 m and m is the number of variables DNA fragments or bands The variable weight is either O or 1 and is used to include or exclude negative matches for binary or categorical variables genetic markers when k is unknown for one or both entities In our example if we exclude 0 0 matches Outcome Entity Entityj Six Wijk if positive match 1 1 1 1 if mismatch i j 1 0 0 l if mismatch i j O 1 0 l if negative match 0 0 1 0 so Ox 1 0x 1 1 x0 140 0 2 0 s3 Ox 1 1x0 0x 1 1 041 0 2 0 93 1 x 0 0x 1 0x 1 0 141 0 2 0 Now if we include 0 0 matches Outcome Entity Entityj Six Wijk if positive match 1 1 i 1 if mismatch i j 1 0 0 l if mismatch i j O 1 0 1 if negative match 0 0 l 1 so Ox1 0Ox1 0xD i4 14 1 1 3 s3 Ox1 0x1l 0xi 14 1 D 1 93 1x1 0x1l 0xl 14 14 D 1 The genetic similarities among the lines considering the one locus only are 0 00 however if negative matches are included then the genetic similarities are 0 33 Obviously this is a demonstration by the absurd we have a population of 3 entities genotyping is based on 1 co dominant locus there are only 3 alleles in our population allele frequency of all the alleles is identical in our population and we are sure that there is no null Page 15 6 F
134. has been added to sampke 7 so that hetereoduplexes will be formed 12 4 Additional info 12 4 1 List of consumables and equipment Note that not all equipment is necessary for a successful TILLING operation and not all equipment may be available For instance the comb loading robot is no longer being sold by MWG and neither are the thermal cyclers Manual comb loading is relatively easy and most thermal cyclers should work for TILLING so lower cost options are available Lab Supplies Product Company Catalog Number LI COR 4300 S DNA analyzer LI COR 4300 02 Apricot pipettor Perkin Elmer PP 550 Combloader MWG Combload Centrifuge 5804 Cel I Brinkman 2262250 1 Thermocycler Primus 96 MWG 4000 000005 Centrifuge 5810 Genomic Brinkman 2262500 4 Nanopure Water Treatment VWR Barnstead 13500 866 Centrifuge 5417C PCR bench Brinkman 2262170 0 Page 12 13 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Equalizer electric pipettes Heat plate sealer pH meter Heat blocks Pipettes LTS multi channel 20 1000u1 APC surge protector Multi heat block Pipettes LTS single channel 20 1000u1 Stir plate Consumables Product Membrane combs MWG 96 well plates QT tip 250ul clear sterile filter tip QT tip 500ul clear sterile non filter tip Acrylamide Buffer reservoirs Sephadex G 50 EDTA Ficol Tris Boric acid Milipore plates Formamide Sealing tape PCR Sealing tape non PCR IRD
135. he EcoRI and Tru91 primers used in pre amplification are non selective in that they recognise all EcoRI and Tru91 priming sites 9 1 3 PCR pre amplification This step amplifies all of the DNA fragments carrying PstI and Trul terminal adaptors and provides sufficient template for subsequent selective amplification Place the tube in the PCR machine and amplify using the following programme repeat steps 1 3 for 11 cycles repeat steps 5 7 for 22 cycles 9 1 4 Check step It is important to check that everything has worked in the previous steps before proceeding 1 Take a5 ul aliquot of the PCR amplified product from 7 1 3 above and place in a fresh 0 5 ml tube and add 2 ul 5x loading buffer Vortex briefly Centrifuge briefly 14 000 rpm for 5 seconds Load the sample into a 1 2 agarose gel Run gel at 50V for 30 minutes ao ai Page 9 3 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 6 Visualise DNA by UV illumination Figure 8 2 Caution wear gloves and UV protective glasses and shields over your face when you are exposed to the UV light of the transilluminator NOTE If previous steps have worked you should see a clear DNA band Figure 8 2 Figure 9 2 7 Dilution of pre amplified DNA e For silver staining dilute 5ul of pre amplified DNA sample 1 50 with water 50 ul sample 245 ul water e For fluorescent labelling dilute pre amplified DNA to 1 10 with TE 10 ul
136. he gel Page 3 2 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION DNA QUANTIFICATION 3 1 5 Photographing the gel It is important to get a proper exposure of the gel that shows a difference in ethidium staining in the concentration ranges you are assaying For example if all of your samples are at 20 ng ul you should be able to observe a noticeable difference in the 34 2 ng ul 22 8 ng ul and 15 2 ng ul concentration standards Make sure this is clear on the gel printout A Adjust the image so as to take the longest possible exposure that does not saturate the image of any of the samples being assayed It is all right to saturate the image of a reference sample that has higher DNA than any of the samples being assayed Save this image in TIFF format Print this image B It may not be possible to set the exposure such that all bands can be visualized without saturating the higher concentration samples In such a case a second exposure is required for the notebook but not for the scoring protocol on the gel documentation system as the computer can score samples that may be difficult to see by eye Adjust the exposure of the gel so as to allow for the visualization of the lowest DNA samples This will cause the saturation of the images of the highest DNA samples Save this image as a TIFF file Print this image 3 2 Quantification of DNA using image analysis software DNA concentrations can be
137. heory has been proposed by M Nei in the 1970 s In general it 1s computed as follows although there are some variations to account for sample size or levels of inbreeding l He 1 p l where p represents again the frequency of each allele The p term represents the probability of sampling twice the same allele or probability of homozygosity Then one minus this probability computed for all present alleles gives us the probability of sampling two different alleles at a locus It will be seen next that this measure is calculated with respect to an ideal or reference population that may or may not have similar values as the observed heterozygosity These deviations are considered next Page 16 9 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 170 2 0 07 4 u CO Rel DNI ON Y CON Shannon Index Diversity The equivalent to the gene diversity but this time cast in information theory is the Shannon index borrowed from community ecology Bands can be counted as we count species in lake and a global value can be calculated for a population as H pnp i Sometimes we see this index estimated for co dominant data One drawback of this measure is that is not bounded so values vary from population to population and comparisons are difficult not as for He whose values are between O and 1 Inbreeding Inbreeding is both the process of reproduction between related individuals and the result of th
138. her transparent sheet to produce a uniform layer of liquid Incubate for 5 minutes 3 Place the membrane on 3 MM paper until the liquid is evaporated from the surface do not let the membrane dry Seal the damp membrane in clingfilm and incubate for 15 minutes at 37 C 5 Expose an X ray film to the glowing membrane in the dark The exposure times needed for genomic Southern blots are between 30 minutes and 14 hours Page 6 11 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 6 3 Membrane rehybridisation method 1 For repeated hybridization of a membrane previously detected by chemiluminescence wash it in sterile H2O for 5 minutes 2 Follow this by a 2 x 15 minutes incubation in 0 2 N NaOH 0 1 SDS at 37 C in order to remove the bound Dig labelled probe After final washing in 2XSSC the filter is ready for new pre hybridization 6 4 References Devos K M M D Atkinson C N Chinoy H A Francis R L Harcourt R M D Koebner C J Liu P Masojc D X Xie and M D Gale 1993 Chromosomal rearrangements in the rye genome relative to that of wheat Theor Appl Genet 85 673 680 Devos K M and M D Gale 2000 Genome Relationships the grass model in current research Plant Cell 12 637 646 Feinberg A P and B Vogelstein 1983 A technique for radiolabelling DNA restriction endonuclease fragments to a high specific activity Anal Biochem 132 6 13 Hartl D L an
139. ia Telephone 43 1 2600 21621 or by email K Allaf iaea org Page ii LIST OF ACRONYMS AFLP CAPS CJE EST IPCR IRAP ISSR PCR RAPD REMAP RFLP SCAR SNP SSCP SSR STS TILLING NGS Amplified Fragment Length Polymorphism Cleaved Amplified Polymorphic Sequences Celery Juice Extract Expressed Sequence Tag Inverse Polymerase Chain Reaction Inter Retrotransposon Amplified Polymorphism Inter Simple Sequence Repeat amplification Polymerase Chain Reaction Random Amplified Polymorphic DNA Retrotransposon Microsatellite Amplified Polymorphism Restriction Fragment Length Polymorphism Sequence Characterized Amplified Region Single Nucleotide Polymorphism Single Stranded Conformation Polymorphism Simple Sequence Repeat Sequence Tagged Site Targeting Induced Local Lesions IN Genomes Next Generation Sequencing Page iii TABLE OF CONTENTS FORE V ORD es cccirrosetom quests E A sees E ERON I ED TOPFACRON KE e specs I O E A E AN TI TABER OF CONTENT ea IV 1 INTRODUCTION TO MOLECULAR MARKERS ssssssssssssssssssssesrerrererereerrrrrereee l 1 1 1 Use of molecular markers A cautionary tale s sssssssessssssrrsnsressnessrrssrnensnensnrennnennnennnnnnnnnnnnnnnnnennnennnes 1 2 1 1 1 An example of how not to use molecular markers ccssssssesseseesesseesssesesesessseeseeseeseeeeeeesees 1 2 1 1 2 An example of efficient application Of markers s ss ssressrssrrssrrnsnenrnnrnnsnennnronnnsnresnrnnnnsnrnsnrenns 1
140. ide clamps over the gel plate assembly one clamp at a time This can be done while holding the IPC vertically Start each clamp there is right and left clamp near the bottom Page 7 4 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION end first then slide the clamp on to the IPC assembly until it snaps into a place along the entire length NOTE The clamps must fit reasonably tightly to prevent the spacer from leaking Make sure the clamps are all the way on with the spacer and outer glass plate flush at the bottom 7 1 6 Casting gel 1 Prepare 100 ml of gel solution per plate by adding together Acrylamide bis solution 19 1 40 TBE 10X 10 ml Urea 8 M Make up to 100 ml with distilled water Caution acrylamide is toxic NOTE An alternative option is to use a pre mixed solution SequaGel XR National Diagnostics Inc which gives sharper bands 2 Filter the solution and keep at 4 C and take as required when ready to cast a gel 3 Add 28 ul TEMED Caution TEMED is corrosive and 800 ul 10 fresh ammonium persulphate solution Caution ammonium persulphate APS is harmful to 100 ml of the gel mix 4 Gently draw up acrylamide solution into a 100ml syringe avoiding air bubbles 5 Adjust angle of plates so gel solution flows slowly down one side Keep the acrylamide solution flow consistent by varying the flow rate by tilting the gel assembly This reduces the formation of bu
141. ient can be used Thus we can ask ourselves about of Page 16 11 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 170 2 0 07 4 u CO Rel DNI ON Y CON e the correlations of gametes within individuals relative to the subpopulation or F s e the correlations of gametes within individuals relative to the total population or F rr e the correlations of gametes within subpopulations relative to the total population or Fsr If any of these correlations is gt gt 0 it means that the probability of finding two identical alleles is stronger in the subunit individual or subpopulation than in the reference population subpopulations and total population Note that in principle all this values are between zero and one closeness to one meaning fixation of alleles at the particular scale Note also that capital letters have been used to distinguish these parameters from single population parameters They are related by the expression 1 Frr 1 Fis 1 Fsg 1 F 1 Fis Where Fsr and F have been introduced between Frys and Fsr to denote that population structure can be more complex and include regions watersheds etc The two most common used statistics are Fis and Fst but Fir has been overshadowed by the rest Note also that for Nei s G statistics there are equivalent Gis Git but are less and less used Fy is commonly regarded as the population structure parameter that if significantly
142. in 2013 and methods for rapid bench top purification of single strand specific nucleases used in mutation discovery assays new in 2014 Of note in this 2014 edition is the successful implementation of low cost and non toxic DNA extraction methods developed by the PBGL and first delivered to the Member States in the 2013 edition of this manual Because these methods have been successfully used at 4 training courses in 2013 and used in 20 different crops the more traditional and toxic method of DNA extraction using organic phase separation has been deleted from this manual Particular thanks for work on this recent edition go to PBGL staff Owen Huynh Joanna Jankowicz Cieslak and Bradley Till We strive to improve the manual with each edition We very much appreciate feedback suggestions and comments which could further improve and enrich the contents of this Page i manual Correspondence should be addressed directly to Mr PJL Lagoda Head of Plant Breeding and Genetics Section Joint FAO IAEA Division of Nuclear Techniques in Food and Agriculture P O Box 100 Vienna Austria Telephone 43 1 2600 21626 email P Lagoda iaea org A hard copy with attached CD ROM will be distributed free of charge to interested scientists from FAO and IAEA Member States Requests for the manual should be sent to Ms K Allaf Plant Breeding and Genetics Section Joint FAO IAEA Division of Nuclear Application in Agriculture P O Box 100 Vienna Austr
143. ing applications design primers following protocol in chapter section 13 2 1 Page 5 2 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 6 RFLP RFLP definition The variation s in the length of DNA fragments produced by a specific restriction endonuclease from genomic DNAs of two or more individuals of a species Kahl 2001 Restriction fragment length polymorphism RFLP technology was first developed in the 1980s for use in human genetic applications and was later applied to plants By digesting total DNA with specific restriction enzymes an unlimited number of RFLPs can be generated RFLPs are relatively small in size and are co dominant in nature If two individuals differ by as little as a single nucleotide in the restriction site the restriction enzyme will cut the DNA of one but not the other Restriction fragments of different lengths are thus generated All RFLP markers are analysed using a common technique However the analysis requires a relatively complex technique that is time consuming and expensive The hybridization results can be visualized by autoradiography if the probes are radioactively labelled or using chemiluminesence if non radioactive enzyme linked methods are used for probe labelling and detection Any of the visualization techniques will give the same results The visualization techniques used will depend on the laboratory conditions Restriction Fragment Length Polymorphis
144. inverse of the PIC polymorphism information content of a certain marker compute a weighted Jaccard s distance WJ to take into account the frequency of each marker in the calculation of the distance For example p J is a Hermitian matrix For all non zero x R or equivalently PIC 1 P E E Pit Pj i l i 1 j itl 4 Pi frequency of allele 1 from to n This formula produces an indicator of how many alleles a certain marker has and how much these alleles divide evenly For example if a marker has few alleles or if the marker has many alleles but only one of them is frequent the PIC will be low Obviously L GEI E Page 15 4 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION EVO Mua LUD ONE Beast OS The Nei amp Li genetic distance estimator was developed for the analysis of restriction site polymorphisms and is the estimator proposed by Dice 1945 in the pre molecular era Dj 2N N Nj where Ni is the number of restriction sites or restriction fragments shared by i and j n7 Ni is the number of restriction fragments in i n7 ngo and N is the number of restriction fragments in j n1 No This estimator excludes negative matches The simple matching coefficient and Jaccard s coefficient differ in how negative matches 0 0 matches or d counts are handled The problem of whether to include or exclude negative matches only arises for present absent characters bina
145. ion than that existing in a single population Or are all populations the same To answering these questions Nei developed in 1972 a synthetic parameter called Gy This parameter takes the value of zero if all sub populations contain the same information as the total population and greater than zero and up to one rarely achieved if any of the sub populations contains levels of diversity that are not distributed at random among the sup populations Its computation is rather straight forward and follows the equation Gs H H H H H Where H is the total population diversity computed from the average allele frequencies from all subpopulations and H is the average within population diversity computed for each single population It is clear that if both values are the same Gs approaches zero If not if H is much larger than H we would say that the distribution of genetic diversity is not random or is structured 16 3 2 Sewall Wright s F statistics If instead of thinking of diversity but inbreeding or better correlation of alleles within Individuals Subpopulations and the Total population a set of relationships can be deduced for the different levels at which genes occur individuals subpopulations and the total population of course Thus the inbreeding coefficient that we saw earlier for a single population can be scaled to different levels of population organization and different inbreeding coeffic
146. ions mixtures of inbred genotypes or inbred lines How genetically heterogeneous accessions are sampled depends on the goal of the study and economic resources Another goal of a DNA fingerprinting study might be to assess the minimum set of accessions that comprise an ideal or so called core set The purpose of a core set in theory is to produce maximum information from a minimum sample of genetic materials The practical aims might be to eliminate redundant accessions and streamline the maintenance of genetic diversity in a seed or gene bank Similar concepts can be applied to surveys of genetic diversity e g the optimum set of genetic materials for assessing the utility of a sample of genetic markers or more broadly for classifying new genetic materials or genetic materials of unknown ancestry or origin What is the best sampling strategy The mating biology and breeding system of the species dictate the sampling strategy The gene pools of many plant species e g maize Zea mays L and sunflower Helianthus annuus L are comprised of partially or fully inbred genetic stocks in addition to heterogeneous segregating populations natural or experimental The gene pools of humans most animal species and many plant species more or less domesticated and or wild types are comprised of heterogeneous segregating populations The optimum genetic and statistical sampling strategies may be difficult to specify are nearly alwa
147. is http naaic org http probe nalusda gov 8300 cgi bin browse beangenes http probe nalusda gov 8300 cgi bin browse chlamydb http probe nalusda gov 8300 cgi bin browse coolgenes http probe nalusda gov 8300 cgi bin browse cottondb http probe nalusda gov 8300 cgi bin browse graingenes http www agron missouri edu http j1105 jic bbsrc ac uk 8000 cgi bin ace search millet http probe nalusda gov 8300 cgi bin browse pathogenes http genome cornell edu rice http www staff or jp http genome cornell edu solgenes welcome html http probe nalusda gov 8300 cgi bin browse sorghumdb http 129 186 26 94 http dendrome ucdavis edu index html http www ncegr org Page 17 7 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION APPENDICES 17 4 Acronyms of chemicals and buffers AMPPD BCIP CSPD CTAB ddH O DIG N 2 liquid NBT PCI SDS SSC TBE TE TEMED TRIS 4 Methoxy 4 3 phosphatephenyl spirol 1 2 dioxetan 3 2 adamantan 5 Bromo 4 chloro 3 indolyl phosphate Chemiluminescence substrate a registered trademark of Tropix Inc USA Hexadecyltrimethylammonium bromide Double distilled water Digoxygenin Liquid nitrogen Nitro blue tetrazolium Phenol chloroform isoamylalcohol 25 24 1 Sodium dodecyl sulphate Saline sodium citrate buffer Tris borate EDTA buffer Tris EDTA buffer N N N N tetramethylenediamine Tris hydrox ymethyl
148. is type of reproduction The coefficient of inbreeding denoted Fis or fis or simply f is a measure of consanguinity and estimates the probability that within a locus from a given individuals both alleles are the same and more importantly have originated from the same ancestor It is measured as Fis He Ho He 1 H H As evident from the above formula the inbreeding coefficient measures a departure of genotype frequencies from a reference population a so called Hardy Weinberg population When both are the same or Ho He the inbreeding coefficient is 0 and we would say that no significant departures from HW were observed Significant deviations from HW 1 e fis significantly greater than zero can arise for a number of reasons that are not mutually exclusive mainly e Small population size that entails the loss of heterozygotes just by chance genetic drift and increases the probability of mating with related individuals e Non random mating that favours the replication of the same genotypes in the population e Selfing plants and certain snails which is a form of non random mating e Lack of external gene flow without migration alleles will be fixed just by chance in small isolated populations Testing for significant inbreeding is performed with different tests 1 e fisher s exact tests but many programmes rely in permutation tests to find a numerical solution for it For example FSTAT reshuffles alleles wi
149. it of inheritance a non recombining segment of DNA A given location on a chromosome Genotype The combination of the two homologous alleles carried on the two chromosomes of a diploid individual at a given locus Haplotype A particular combination of alleles at different loci on a chromosome Heterozygosity The probability of an individual to have two different alleles at a given locus the probability of being heterozygote Homozygosity The probability of an individual to be homozygote at a given locus Homozygote The fact that an individual has two identical alleles at a given locus Locus A given location on a chromosome a non recombining segment of a chromosome usually interchanged with gene Phenotype The visible physical state of an individual The relation between the genotype and the phenotype can be complex and will usually depend on the degree of dominance and the interaction of different alleles at a single or multiple loci Polymorphism the fact that there exist different alleles at a given locus in a population Population A group of interbreeding individuals living together in time and space It is usually a subdivision of a species Sample A collection of individuals or of genes drawn from a population Page 16 19 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 16 8 Equations k Ji 2n 2Spq P H 2 1 X p 2pq p E reall 3 He 2p4 5 7 l1 1 Qs
150. ith a random example of a dominant marker gel data Whether the bands come from RAPD s ISSR and AFLP s or similar does not affect the way data is coded and more importantly how it is analysed What matters is whether or not we observe a given band Next co dominant markers are dealt with as they are close to the notion of a diploid species where each individual carries n maternally and n paternally inherited gametes for a total ploidy of 2n Of course codominant data can be obtained in tetraploid or hexaploid individuals also as will be demonstrated The exercises will start with microsatellite data from a population sample It is important to note however that all these coding systems can be used also for allozyme data Different coding schemes will be analysed some tricks with using spread sheets and highlights on what can and what cannot be done with each coding system will also be shown After reviewing how data can be coded the next step will involve going through the basic concepts of population diversity population structure and population divergence This last part of this module is the basis of phylogenetic studies although for this manual only phenetic analyses will be shown To conclude this brief introduction to population genetics two non exhaustive lists of references and of web resources of relevance to the study of the subject are provided Finally a list of key concepts and equations are provided to complete
151. ium Values of Measures of Population Subdivision For Stepwise Mutation Processes Genetics 142 1357 1362 Rousset F 1997 Genetic differentiation and estimation of gene flow from F statistics under isolation by distance Genetics 145 1219 1228 Page 16 18 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 170 2 0 07 4 N CONNEC DNI ON Y CON Saitou N and M Nei 1987 The neighbor joining method a new method for reconstructing phylogenetic trees Mol Biol Evol 4 406 425 Slatkin M 1993 Isolation by distance in equilibrium and non equilibrium populations Evolution 47 264 279 Slatkin M 1995 A measure of population subdivision based on microsatellite allele frequency Genetics 139 457 462 Slatkin M and Barton NH 1989 A comparison of three methods for estimating average levels of gene flow Evolution 43 1349 1368 Sokal RR and Rohlf FJ 1981 Biometry 2nd Edition Freeman amp Co Weir BS and Cockerham CC 1984 Estimating F statistics for the analysis of population structure Evolution 38 1358 1370 Weir BS 1996 Genetic data analysis II Sinauer Publ Sunderland MA Whitlock MC and McCauley D 1999 Indirect measures of gene flow and migration Fst lt gt 1 4Nm 1 Heredity 82 117 125 Wright S 1969 Evolution and the genetics of populations Vol 2 The theory of gene frequencies University of Chicago Press 16 7 Some key concepts Alleles All possible forms of a gene Gene A un
152. l get a list of possible primers http www genome wi mit edu cgi bin primer primer3_www cgi http genome www2 stanford edu cgi bin SGD web primer http www nwisc noaa gov protocols oligoT Mcalc html Page 17 4 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION APPENDICES The annealing temperature must be determined empirically and is dependent from the Tm s of the primers A rule of thumb Wallace rule provides a first order approximation for Tm of oligonucleotides that have 20 bases or less Tm 2 C A T 4 C C G The annealing temperature is a few degrees lower than Tm PCR is extremely sensitive Thus contamination of samples and solutions with minimal amounts of foreign DNA or the wrong PCR programme can result in unspecific PCR products Always include controls without template DNA in order to check if there is any contamination in your nucleotides primers etc A typical PCR experiment is given in the table below In the FAO IAEA course PCR was demonstrated by amplifying a 1050 bp sequence of the rice retrotransposon Tos 17 accession number D88394 Forward Primer 1 100 pmol ul Reverse Primer 2 100 pmol ul Reaction volume 50 ul Stock solutions ul Final conc amount 10 x PCR buffer 15 mM MgCl 5 0 ul 1 x PCR buffer 1 5 mM MgCl Primer 1 100 pmol ul 0 5 ul 1 pmol Primer 2 100 pmol ul 0 5 ul 1 pmol dNTP mix 10 mM 1 ul 0 2 mM DNA template 100 ng ul l ul 1
153. limited number of loci Codominant Many detection systems Can be converted to SCARs Robust in usage Good use of probes from other species Detects in related genomes No sequence information required Results obtained quickly Fairly cheap No sequence information required Relatively small DNA quantities required High genomic abundance Good polymorphism Can be automated Fast Highly polymorphic Robust Disadvantages Labour intensive Fairly expensive Large quantity of DNA needed Often very low levels of polymorphism Can be slow often long exposure times Needs considerable degree of skill Highly sensitive to laboratory changes Low reproducibility within and between laboratories Cannot be used across populations nor across species Often see multiple loci Dominant High developmental and start up costs Species specific Sometimes difficult interpretation because of stuttering Page 1 9 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Marker Advantages e Can be automated Only very small DNA Codominant Multiallelic Multiplexing possible Does not require radioactivity Highly polymorphic Robust in usage Can be automated ISSR AFLP Small DNA quantities required e No sequence information required e Can be automated e Can be adapted for different uses e g CDNA AFLP IRAP e Highly polymorphic depends REMAP on the transposon e Robust in us
154. lts the developer must be chilled 2 While the gel is running prepare the fixative 10 acetic acid Add 200 ml glacial acetic acid to 1 8 litres distilled water Caution acetic acid is corrosive gloves should be worn 3 Prepare the silver stain toxic wear gloves Add 2g silver nitrate AgNO3 solution in 2 litres of distilled water Caution silver nitrate is corrosive gloves should be worn Then add 3 ml formaldehyde 37 solution and mix Caution formaldehyde solution is toxic Wear gloves and lab coat and avoid inhalation Silver nitrate is light sensitive so store in an opaque bottle or wrap aluminium foil around the bottle 4 Remove the gel from the rig and separate the plates Place the gel in a tray with the fixative and leave shaking in a fume hood for 20 minutes Page 7 6 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION NOTE Do not pour solutions directly onto the gel as it may come off the plate When running 5 Remove the gel and stand on a rack Pour off fixative and save it as it can be used for up to 10 times Wash the gel three times 2 min in water Remove the gel and stand Pour out the water and replace with silver stain introduce the gel again and leave shaking for 30 minutes For best results cover the tray as light affects the AgNO solution NOTE Silver stain AgNO and formaldehyde solution can be re used up to 10 times NOTE The next few procedures have to be
155. ly aspirated without loss of seeds Day 1 1 Preparation of Fume Hood for procedure 1 1 Label each scintillation vial with the concentration of EMS that is to be used in it 1 2 Warn all personnel that a dangerous procedure is about to be performed in the hood 1 3 Place all materials in hood 1 4 Put 125 ml of 2 N NaOH and 375 ml of H20 in beaker with stir bar slowly rotating Place remaining 875 ml of 2 N NaOH in tub with 2 6 L H20 2 Add 4 ml of H20 to each vial and mark level with a fine tip marker then empty vial of H20 3 Rinse seed into each vial with 4 ml of diH O Add 40 ml of 10 Tween 20 to each vial and agitate at 180 RPM for 15 sec 4 Pipette off Tween H20 and add 4ml DI H20 to each vial Agitate for 5 min at 180 RPM Repeat for 4 total washes 5 Add DI H2O to each vial to 4 ml line made in 2 in order to achieve a total volume of 4 ml 6 Use gloves lab jacket and fear for following steps 7 Add 425 X ml EMS to each vial with barrier tip P 20s X is desired EMS mM Dispose of tips in beaker of 0 5 N NaOH 8 Agitate for 17 hr at 180 RPM at room temperature Day 2 1 Pipette off EMS solution from each vial and dispose in flask of 0 5 N NaOH 2 Fill each vial to shoulder with di H2O from squeeze bottle swirl by hand then pipette off Supernatant and dispose as in 1 Repeat 5 times Add diH20 to vial to achieve 4 ml and agitate 15 sec Pipette off as in 2 and repeat Store at 4 C until sown
156. lyze against Buffer B at 4 C 2 Liters per 10mls of resuspended solution Use e g Spectra por 7 MWCO 10000 tubing NOTE Soak the dialysis tubing in nanopure water for 30 min before use 12 Dialyze for 1 hour against Buffer B at 4 C 13 Repeat for a total of 4 dialysis steps with a minimum of 4 hours dialysys NOTE Longer dialysis is better it is often convenient to perform the third dialysis overnight 14 Remove liquid from dialysis tubing It is convenient to store 75 of the liquid in a single tube at 80 C and the remainder in small aliquot for testing This protein mixture does not require storage in glycerol and remains stable through multiple freeze thaw cycles however limiting freeze thaw cycles to 5 limits the chance of reduced enzyme activity 15 Perform activity test step 3 3 or proceed immediately to enzyme concentration step 3 2 Figure 1 Mixture of different plant species weedy plants from the grassland around the Seibersdorf laboratories used for the isolation of an enzyme extract for mismatch cleavage 13 3 2 Concentration of enzyme extractions Concentration of weed and celery enzyme extracts is done using Amicon Ultra 10K centrifugal filter devices for 0 5mL starting volume in 1 5 mL tubes l Perform with 600uL of protein extract after dialysis 2 Clear extract by centrifugation at 30 min 10 000 x g 4 C to pellet plant material in refrigerated microcentrifuge Page 13 3 FAO
157. m RFLP Ecori EcoRI EcoRI Figure 6 1 The scheme depicts enzyme digestion of DNA into fragments and their subsequent gel separation and the detection of allelic variation in varieties A and B with permission K Devos Page 6 1 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 1H 22HHHH 2H1HHHPI1P2 o o ee e oer e 9 O Figure 6 2 An autoradiograph detecting parent P1 and P2 and homozygous 1 and 2 respectively and heterozygous H Fz segregation with permission M D Gale 6 1 Protocol 6 1 1 Agarose gel electrophoresis Agarose is a galactose based polymer widely used in analytical and preparative electrophoretic separation of linear nucleic acids in the size range above 100 bp DNA applied to an agarose gel which is exposed to an electrical field migrates towards the anode since nucleic acids are negatively charged The smaller the molecules the faster they run through the gel matrix Figures 5 1 5 2 and 5 3 Migration is inversely proportional to the log of the fragment length In order to determine the length of the separated fragments in the gel a molecular weight fragment ladder control is placed in a lane alongside the experimental samples Restricted genomic DNA is usually separated in a 0 8 1 0 gel whereas gels with a higher concentration of agarose 2 3 are needed for separation of small DNA fragments lt 500 bp Method Gel preparation and running
158. marily concentrating on the analysis of genotypic measurements e g DNA marker genotypes phenotypic measurements should not be overlooked and can be combined with genotypic measurements in analyses of genetic patterns Special similarity measures can be used to combine phenotypic and genotypic measurements or a conceptual synthesis of patterns can be produced from separate analyses performed on phenotypic and genotypic variables The choice of variables 1s usually more complicated for phenotypic than genotypic variables because the former are heterogeneous whereas the latter are homogeneous when a single marker system is employed in the conceptual sense however the information supplied by individual genetic markers can vary If DNA fingerprints are to be produced then the types of variables measured are dictated 1 by the types of markers developed for the species 11 whether the DNA markers are dominant or co dominant 111 by the homology of DNA fragments across individuals or populations iv by economic factors v by the reproducibility and robustness of the DNA marker system genotyping errors The ideal genetic marker is highly polymorphic co dominant locus specific robust and highly reproducible How many variables should be measured There are no formal statistical rules for deciding how many genetic markers are needed to accurately classify accessions describe genetic patterns or accurately estimate genetic distances
159. mers that incorporate the SSR regions in their amplification products and by combining 3 and 5 primers Zietkiewicz et al 1994 Other methods of fingerprinting using primers complementary to SSR motifs involve using SSR specific primers in combination with an arbitrary primer Davila et al 1999 Davita et d19995 or in combination with primers that target other abundant DNA sequences such as retrotransposons Provan et al 1999 Prevan eta41999 Products Variety A AC NN p irs Pd s lt NN OV Length variation between Varieties A and B Variety B AONN p NN lt NN COV Variety C AC NN y NN as Ha No product Figure 8 1 The above scheme shows how sequence variation between two SSRs results in variation in PCR products in varieties A B and C The figure shows variation at only one ISSR locus amplification of all compatible ISSR loci among the genomes of a range of varieties will result in complex fingerprinting banding patterns 8 1 Protocol In the example below one of three primers given in the ISSR protocol of Yang et al 1996 is used this produces a relatively simple fingerprint small number of bands In more recent applications two or more primers have been used to produce more complex banding profiles similar to AFLP profiles Page 8 1 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION NOTE Wear gloves and lab coat at all times for safety and to
160. mophenol blue 1 3 mg Distilled water 400 ul Ethidium bromide Agarose Acrylamide Bis acrylamide TEMED Ammonium persulphate Sodium thiosulphate TBE H20 800 ml Tris base 108 g Boric acid 55g EDTA 9 3g ddH20 Adjust volume to 1 litre 100 ethanol Bind silane Page 7 8 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Sodium carbonate Glacial acetic acid Formamide dye mix for 1 ml Formamide deionized 950ul dd H2O 30ul EDTA 0 5 M 20ul Bromophenol blue 1 mg Xylene cyanol 1 mg Mix and store at 20 C Page 7 9 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Page 7 10 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 8 ISSR ISSR amplification definition A variant of the polymerase chain reaction that uses simple sequence repeat primers e g AC to amplify regions between their target sequences Kahl 2001 Inter SSR ISSR amplification is an example one of many of a PCR based fingerprinting technique The technique exploits the abundant and random distribution of SSRs in plant genomes by amplifying DNA sequences between closely linked SSRs Figure 6 1 The method used in the FAO IAEA course used 3 anchored primers to amplify regions between two SSRs with compatible priming sites Yang et al 1996 More complex banding patterns can be achieved using 5 anchored pri
161. morphic sites every kilobase Cooper et al 1985 Originally discovered in humans SNPs have now been developed for genotyping in plants SNP technology is heavily dependent upon sequence data Several methods are available for SNP detection including automated fluorescent sequencing denaturing high performance liquid chromatography DHPLC Underhill et al 1996 DNA microarrays Hacia and Collins 1999 single strand conformational polymorphism capillary electrophoresis SSCP CE Ren 2001 Figure 1 microplate array diagonal gel electrophoresis MADGE Day et al 1998 and matrix assisted laser desorption ionisation time of flight MALDI TOF Griffin and Smith 2000 SNP detection by SSCP single strand conformation polymorphism Var A RCTEE Var B PCR ACCTGG ACTTGG TGGACC TGAACC Denature SSCP l A ACCTGG ACTTGG TGAACC Figure 11 1 The scheme above shows how SNP variation can be detected between varieties A and B with permission K Devos Page 11 1 FAO TAEA INTERREGIONAL TRAINING COURSE ON MUTANT SINGLE NUCLEOTIDE GERMPLASM CHARACTERISATION POLYMORPHISMS 11 1 References Cooper D N B A Smith H J Cooke S Niemann and J Schmidtke 1985 An estimate of unique DNA sequence heterozygosity in the human genome Hum Genet 69 3 201 205 Day I N E Spanakis D Palamand G P Weavind and S D O Dell 1998 Microplate arrays diagonal gel electrophoresis DADGE and melt MADGE tool f
162. n automated DNA analyser The single stranded AFLPs are separated through electrophoresis on a capillary type automated DNA analyser ABI Prism 3100 is used in the Plant Breeding and Genetics Laboratory 1 Put on gloves and in a sequencer plate add for each sample PCR amplified product from 7 1 3 1 1 0ul 13 0 ul ROX standard 0 25 ul Page 9 6 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 2 Denature for 5 minutes at 95 C 100 C and snap cool on ice 3 Centrifuge briefly 14 000 rpm for 5 seconds and check for air bubbles 4 Load plate on the DNA analyser according to User s manual and select the option for AFLP fragment separation 9 1 13 Production of single primer linear PCR products NOTE This procedure is used to avoid doubled stranded DNA fragments and results in a greater clarity of band separation 1 Put on gloves and add in a PCR tube LOX PCR bute Selective amplification DNA produced in 2 ul Step 6 PstI selective primer 50 ng ul 1 5 ul dNTPs 2 mM 2 5 ul Taq DNA polymerase 5U ul 0 1 ul Add sterile distilled water to make up to 2 Mix gently by tapping the tube 3 Centrifuge briefly 14 000 rpm for 5 seconds 9 1 14 PCR amplification to produce single stranded DNA Put on gloves and place tube from 10 2 3 into a PCR machine and amplify using the following programme 30 seconds Cycling repeat steps 1 3 for 22 cycles Pag
163. n the formula of Meinkoth and Wahl 1984 Tm 81 5 C 16 6 log M 0 41 G 500 n 0 61 formamide where M is the concentration mol I of monovalent cations in the hybridization solution washing solution G C the proportion of guanine and cytosine in the probe and n the length of the probe in base pairs The melting temperature Tm together with the selected hybridization and washing temperature T determine the conditions for annealing between probe and target DNA This is called the stringency stringency 100 Mf Tin Ta where Mf is the mismatch factor 1 for probes longer than 150 bp Under hybridisation washing conditions with a stringency of 100 all DNA DNA hybrids with less than 100 homology are resolved In general one can say the lower the salt concentration in the washing solution and the higher the hybridization or washing temperature the higher the stringency 1 The hybridization bag is opened 2 The membrane is transferred to a plastic dish It is very important that the plastic dish has been thoroughly cleaned Use 500ml of each solution per 100cm membrane 1 wash 2 x SSC 0 1 SDS w v 2 x 15 minutes at room temp 2 wash new dish 0 1XSSC 0 1 SDS w v 2 x 15 minutes at 68 C NOTE These conditions are highly stringent The SSC concentration in the second stringent wash should be increased when a probe of lower G C content e g some repetitive seque
164. nces 1s used or when you are working with heterologous probes 3 The membrane is heat sealed in a new plastic bag for subsequent detection 6 2 2 Detection NOTE Wear gloves and lab coat at all times for safety and to prevent contamination 1 Wash the membrane briefly with maleic acid buffer buffer I to remove any residues of SDS NOTE To avoid unspecific binding of the antibodies incubate the membrane for at least 60 minutes in maleic acid 1 w v blocking reagent buffer ID 1 ml cm on a shaker before adding antibody solution Page 6 10 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 2 Dilute the antibody stock solution 750 U ml with buffer II to 75 mU ml 1 10 000 0 2 ml cm Centrifuge the antibody stock solution before adding to the membrane in order to separate any precipitates which can lead to background spots on the filter oS 4 Discard buffer II and add the diluted antibody solution to the membrane 5 Remove bubbles before sealing the bag 6 Incubate for 30 minutes no longer at room temperature on a shaker 7 Open the bag remove buffer and transfer membrane to a thoroughly cleaned dish with 5 ml cm wash buffer buffer I plus 0 3 v v Tween 20 8 Wash 3 x 15 minutes with gentle agitation at room temperature 9 Transfer membrane to a clean dish with alkaline buffer buffer III to activate the reporter enzyme alkaline phosphatase NOTE The
165. nd should work for most organisms Requirements include the ability to induce mutations propagate and or store mutant organisms and PCR amplify gene specific targets What about polyploids or duplicated gene targets STP has successfully screened polyploid species Additionally Slade et al have published TILLING data for polyploid wheat SLADE et al 2005 For polyploids and duplicated gene targets a good approach is to pre test unlabeled primers before purchasing IRD labeled primers This is the approach taken for the Maize TILLING Project http genome purdue edu maizetilling Following PCR and agarose gel analysis products are sequenced Primer pairs are selected for TILLING if they produce at least 7 ng ul of product and sequence analysis indicates the amplification of a single target What if there is no genomic sequence available for my organism Short of cloning genes you can design primers to EST data or whatever is available and pre screen the primers Sequencing the PCR products will provide genomic sequence information It is important to select primers that yield products within the appropriate size range for your assay Also you may wish to avoid TILLING large amounts of intron as mutations in introns are likely to be non functional You may be able to use genomic sequence from a related organism to guess at the position of introns in your organism I do not have access to a LI COR can I still TILL The choice of re
166. ne identification F identification Novel phenotypes Breeding Genetic maps Quality trait mapping Varietal line identification multiplexing of proteins or necessary F identification Breeding Seed testing Fingerprinting Varietal identification Genetic maps F identification Gene tagging and identification Bulk segregant analysis Diversity studies Marker assisted selection isozymes Page 1 6 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Novel allele detection High resolution mapping Map based cloning SNP Genetic maps F identification Breeding Gene tagging Alien gene introduction Bulk segregant analysis Diversity studies Novel allele detections Marker assisted selection High resolution mapping SCARS CAPS Framework mapping Can be converted to allele specific probes F identification Gene tagging Bulk segregant analysis Diversity studies Marker assisted selection Map based cloning Microarray Fingerprinting Sequencing Transcription Varietal identification Genetic maps F identification Gene tagging and identification Bulk segregant analysis Diversity studies Marker assisted selection High resolution mapping Page 1 7 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 1 5 Implementation Table 1 5 1 Relative costs of marker techniques Marker techniques Development costs Running costs perPortability data point Lab
167. ning autoradiography if primers are radioactively labelled or via automation if primers are fluorescently labelled Figures 6 1 and 6 2 SSR analysis is amenable to automation and multiplexing Figure 6 2 and allows genotyping to be performed on large numbers of lines and multiple loci to be analysed simultaneously SSRs can be identified by searching among DNA databases e g EMBL and Genebank or alternatively small insert 200 600bp genomic DNA libraries can be produced and enriched for particular repeats Powell et al 1996 From the sequence data primer pairs of about 20 bp each can be designed software programmes are available for this Microsatellites SSR Var A Var B CACACACACACACACA CACACACACACACACACACACA mmm ae TGTGTGTGTGTGTGT GTGTGTGTGTGTGTGTGTGTGT PCR amplification Var A Var B Figure 7 1 The schematic above shows how SSR variation short A and long B can be detected using gel electrophoresis after PCR with forward blue and reverse primers green with permission K Devos Page 7 1 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Figure 7 2 A computer image showing an example of SSR multiplexing with different colours with permission J Kirby and P Stephenson 7 1 Protocol 7 1 1 PCR reaction mix Microsatellite primers are specific for each individual genome or species It is essential to know that the primer pairs chosen will work for your
168. not in NCBI What you ll get is an 800 000 bp scaffold that contains the gene sequence Unfortunately it contains many predicted proteins but the annotation isn t there Which means that it is very hard to find the protein you re looking for unless you blast all the hypothetical peptides This isn t very convenient To retrieve genomic cDNA and protein sequences goto the genome website http www phytozome net sorghum Click Browse Genome and then enter Sb0019s003010 1 into the landmark or region window and click search You ll get the gene model back with blast hits to other plant proteins Move the mouse over this pile up and you ll get individual annotations from the different species this is good to do to double check you have the correct gene 4 Download sequences for downstream analysis and primer design Page 5 1 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION PRIMER DESIGN In many cases such as TILLING Ecotilling it is best to be searching for potentially functional variation So it will be more efficient to screen exonic regions In this example notice the exonic regions are mostly on the left side It is not very intuitive how to get bot the genomic and transcript sequence from this graphical output Put your mouse over the transcript and right click A new window will appear from phytozome and you can get the sequences you need from the sequencing tab FOR TILLING and Ecotill
169. nslate from a rather simple data file to several other programmes as shown in Figures 13 4 and 13 5 Page 16 6 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 170 2 0 07 4 u CO Rel DNI ON Y CON EXCEL e GENEPOP lt gt FSTAT e ARLEQUIN format CONVERT e POPGENE utility e MICROSAT format GENEPOP e PHYLIP allele frequency formatted infile format file e STUCTURE e Table of allele frequencies Figure 16 3 Flow chart showing the different data translation paths possible with the CONVERT utility software Not all possibilities are here but at least these programmes are glued together Note however that these programs are almost exclusive for diploid codominant data but some tricks can be done as explained in section 13 1 6 FSTAT is marked with an asterisk as is the one that we are going to use for most of the analyses as explained in the next section 16 1 8 The FSTAT data file As we will use this programme mostly throughout the exercises let us explain briefly the data structure need For running FSTAT it is first necessary to create an input file named FILENAME DAT where FILENAME is anything between 1 and 256 characters containing the genotypic data coded numerically either with a 1 a 2 or a 3 digit number per allele The file must have the following format The first line contains 4 numbers 1 the number of populations here called samples lt 200 2 the numbe
170. nt of enzyme falls below the target range PCR product and background bands will become increasingly dark to the point where the image becomes difficult to interpret Synthesis of TILLING PCR products for mismatch cleavage tests barley TILLING primer 13 GENES PRIMER Mlo9 1476 bp PCR product 13 HV_Mlo9 F2 CATTTGTCGCAAAACAGCAAGTTCGAC HV_Mlo9 R2 TTGTCTCATCCCTGGCTGAAGGAAAAA TEMPLATE 1 l mixture of Golden Promise and HOR 1606 gDNA mixture gives mismatch cleavage TILLING PCR REACTIONS TaKaRa ExTag enzyme total volume 25uL 10x ExTaq buffer TaKaRa 2 5 uL dNTP mix 2 5 mM 2 0 uL Primer forward 10 uM 0 3 uL Primer reverse 10 uM 0 3 uL TaKaRa Taq 5U ul 0 1 uL Barley genomic DNA 5 ng uL 5 0 uL H20 to 25 uL 14 8 uL TILLING PCR cycling program for TILLING PCRTM70 95 C for 2 min loop for 8 cycles 94 C for 20 s 73 C for 30 s reduce temperature 1 C per cycle ramp to 72 C at 0 5 C s 72 C for 1 min loop 2 for 45 cycles 94 C for 20 s 65 C for 30 s ramp to 72 C at 0 5 C s 72 C for 1 min 72 C for 5 min 99 C for 10 min Page 14 5 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION LOL OFS OM DDG y TO y CONN loop 3 for 70 cycles 70 C for 20 s reduce temperature 0 3 C per cycle hold at 8 C e CELI digestions mix 10uL of PCR product with 10uL digestion mix to a volume of 20uL see Table 3 for set up of digestion mixes e Incubate
171. ntary to the adaptors are used to amplify the restriction fragments The PCR amplified fragments can then be separated by gel electrophoresis and banding patterns visualized Figure 7 1 A range of enzymes and primers are available to manipulate the complexity of AFLP fingerprints to suit application Care is needed in selection of primers with selective bases Psi Msel Msa Msel Msel_ Digest DNA with Frequent cutter Msel Rare cutter Psa G PCR amplify using Psti Msel primers with no selective bases with 1 2 or 3 selective bases Separate products in a denaturing polyacrylamide gel 11 Tolerant lines 11 Sensitive lines ne eee ne TP SP TB SB Figure 9 1 In the figure above AFLP profiles have been used in bulk segregant analysis to detect a band associated with tolerance to aluminium in rye the arrow shows the presence or absence of a band in the tolerant TP and susceptible SP parents tolerant TB and susceptible SB bulks and 11 tolerant and 11 susceptible individuals scheme and data with permission K Devos and Miftahudin respectively Page 9 1 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 9 1 Protocol AFLP involves four major steps I Cutting genomic DNA with restriction enzymes II Ligating double strand adaptors to the restriction fragments Iii Amplifying pre and selective amplification restriction fragments using primers IV Gel analy
172. ntify mutations The same methods can be used to identify naturally occurring polymorphisms in populations called Ecotilling COMAI et al 2004 For this training course we will be using primers for the Arabidopsis OXI1 gene and eight genomic DNA samples each containing a unique single nucleotide point mutation The protocol has been scaled down from the standard high throughput TILLING protocol for the discovery of mutations in a large number of pooled samples TILL et al 2003 TILL et al 2006 Primers and genomic DNA samples are described in a publication on the use of single strand specific nucleases for mismatch cleavage TILL et al 2004a The standard high throughput TILLING protocol will be followed using fluorescently labelled primers and a LI COR DNA analyser Additionally students will analyse mutations using lower cost and lower throughput agarose gels for examples see GALEANO et al 2009 GARVIN and GHARRETT 2007 SATO et al 2006 The goal of this section of the training course is to familiarize you with the bench and computational techniques that have been developed for TILLING The hope is that students will leave with a firm understanding of TILLING and the ability to critically evaluate the usefulness of TILLING in his or her research program 12 1 Protocol Each group will receive a box containing samples buffers and solutions for this section of the course All materials are provided in the box except Ex Taq polymerase
173. o So re samen flanked by primers l HE primer b 5 2nd cycle major PCR product accumulates exponentially MALIL M a primer a sequence complementary to primer Single stranded DNA i major PCR products 3rd cycle primer extension products ues sample DNA Figure A 2 2 Schematic diagram of PCR By using primer pairs a and b short black lines annealed to complementary strands of DNA long black lines two new strands shaded lines are synthesized by primer extension If the process is repeated both the sample DNA and the newly synthesized strands can serve as templates leading to an exponential increase of product which has its ends defined by the position of the primers McPherson et al 1991 4ePhersen etat 1994 Successful performance of a PCR experiment is dependent on a number of different factors some of them have to be determined empirically The selection of the primers is a very important step They should be long enough to be specific not anneal against themselves by folding avoid palindromic sequences nor should the forward primer anneal with the reverse primer Furthermore the G C content of the primers should be similar and they should have similar melting temperatures Tm Several computer programs are available on the Internet to help to find the best primer pairs for a given sequence Try the addresses below submit the DNA sequence and some required parameters and you wil
174. oad the wells of the gel to the top It typically takes 30 to 40 ul to fill each well NOTE Do not over load the wells as that would definitely lead to DNA contamination NOTE The DNA is mixed with loading buffer and dye order to facilitate the solution sinking into the gel wells As a single band 10 ng DNA can still be visualized with EthBr 8 Run samples into gel at 100mA for 5 10 minutes then reduce the amperage and run at 25 mA constant current until the bromophenol blue dye marker has migrated almost to the end of the gel Typically a long gel will be done after 14 16 hours NOTE The following step is used only if the EthBr was not added as in step S 3 Stain each gel in 1 ug ml EthBr 50 ul of 10 mg ml EthBr in 500 ml dH2O for 20 minutes shaking gently 9 Rinse gel in ddH20 for 20 minutes slide gel onto a UV transilluminator and photograph For Fotodyne PCM 10 camera with 20 x 26 cm hood and Type 667 Polaroid film use an f8 10 second exposure Caution Wear gloves and lab coat and UV protective full face shield or glasses when you are exposed to the UV light of the transilluminator Page 6 3 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Slots for Bands visible after samples suitable treatment Electrode Buffer solution j Direction of movement Figure 6 3 Apparatus for gel electrophoresis Hartl and Jones 1999 6 1 2 Southern blotting and hybridization Southern blo
175. oop 2 for 45 cycles 94 C for 20 s 65 C for 30 s ramp to 72 C at 0 5 C s 72 C for 1 min 72 C for 5 min 99 C for 10 min loop 3 for 70 cycles 70 C for 20 s reduce temperature 0 3 C per cycle hold at 8 C Mix 10uL of PCR product with 10uL weed digestion mix to a volume of 20uL Incubate at 45 C for 15 min Add 2 5uL of 0 5M EDTA pH 8 0 to stop reaction Load a 10uL aliquot on an agarose gel Ca ee Page 13 4 FAO TAEA INTERREGIONAL TRAINING COURSE ON MUTANT LOW COST MUTATION GERMPLASM CHARACTERISATION DISCOVERY 13 4 Example results Concentrations of protein extracts Table 1 Calculations of concentration factors after centrifugation with Amicon Ultra 10K Starting volume 500 uL Before centrifugation considered as 1x concentrated Recovered Concentration factor volume calculated from 500 uL starting volume 42 uL 33 uL Mismatch digestions using celery and weed enzyme extracts Table 2 Set up of mismatch digestions using celery and weed enzyme before and after centrifugation with Amicon Ultra 10K The enzyme concentration in the extracts were calculated using the calculated concentration factors from Table 1 1 2 after 3 after 4 after BEFORE Celery enzyme 7 6 uL 45 6 uL 91 2 uL concentration in 1x 2 2Xx 13 0x 26 1x relation to extract before centrifugation 3 5uL before 1x Weed enzyme 5 95 uL 35 7 uL 71 4 uL concentration in 1x 1 7x 10 2x 20 4x
176. or molecular genetic epidemiology Trends in Biotech 16 287 290 Griffin T J and L M Smith 2000 Single nucleotide polymorphism analysis by MALDI TOF mass spectrometry Trends in Biotech 18 77 84 Hacia J G and F S Collins 1999 Mutational analysis using oligonucleotide microarrays J Med Genet 36 730 736 Kahl G 2001 The Dictionary of Gene Technology Wiley VCH Weinheim Ren J 2001 High throughput single strand conformation polymorphism analysis by capillary electrophoresis J Chromatography B Biomed Science Appl 741 115 128 Underhill P A L Jin R Zemans P J Oefner and L L Cavalli Sforza 1996 A pre Columbian Y chromosome specific transition and its implications for human evolutionary history Proc Natl Acad Sci USA 93 196 200 Page 11 2 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 12 TILLING TILLING Targeting Induced Local Lesions IN Genomes is a general strategy for the discovery of induced point mutations COLBERT et al 2001 MCCALLUM et al 2000 The procedure consists of setting up and running PCR using gene specific primers denaturing and annealing PCR products to create heteroduplexes between mutant and wild type strands digesting heteroduplexes with a single strand specific nuclease purifying the products and reducing sample volume loading sample onto a membrane comb running the samples on a gel and processing and examining the gel images to ide
177. ow this the changes and predicted effect of the changes can be seen at the sequence level For a complete description of the symbols used and more detailed information on CODDLE please visit the CODDLE glossary Page 12 9 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 10 When you are satisfied with the CODDLE output click Create primers for this window 11 Evaluate the information in the Primer3 window Note that the optimum Tm for primers is 70 C Click pick primers 12 In the output page click display this pair of primers for your favorite set of primers 13 You will now be directed to a page summarizing your primer choices Note that the percentage of each type of change is listed 14 When satisfied click order TILLING of this region 15 You are now directed to an STP order page Enter the following email address test fhcrc org and select Arabidopsis as the organism 16 Click place order Your order will now be searched in the STP database If the target has been previously screened you will be provided with information on found mutations If it is a new target it will be blasted against the Arabidopsis genome to ensure that the primers are designed to the correct organism Once ready click store to store the order in the database 17 NOTES The CODDLE input utility CODDLE and Primer3 are all general tools that are available on the World Wide Web Yo
178. own cluster C Define one leaf for each sequence and place at height zero Iteration e Determine the two clusters 2 7 for which d is minimal e Define a new cluster C C U C e Define a new node k with daughter nodes z and j and place it at height d 2 e Add k to the current clusters and remove i and 7 Termination e When only two clusters 2 7 remain place the root at height d 2 Following the first clustering A and B are considered as a single composite OTU A B and we now calculate the new distance matrix as follows dist A B C distAC distBC 2 dist A B D distAD distBD 2 dist A B E distAE distBE 2 dist A B F distAF distBF 2 and so on Page 15 11 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION EVO Mua LUD ONE Beast OS Example Suppose we have the following distance matrix giving the pair wise evolutionary distances of 6 OTUs A B C DE B 2 C l4 l4 D 6 6 6 E 6 6 6 4 F 8 8 8 8 8 re B First cycle We now cluster the pair of OTUs with the smallest distance being A and B that are separated by a distance of 2 The branching point is positioned at a distance of 2 2 1 substitution We thus construct a sub tree as follows Following the first clustering A and B are considered as a single composite OTU A B and we now calculate the new distance matrix as follows dist A B C distAC distBC 2 4 dist A B D dist
179. prevent it from popping open In Step 5 of the Fast DNA protocol elute binding matrix with 200 ml DES Spin at 14000 x g for 5 min Then pipette off 180 ml of supernatant taking extreme care not to draw up particles of Binding Matrix and transfer supernatant to a sterile screw top tube Add 20 ml of 10x TE 3 2 m g ml RNAse A 12 8 References BURDON M G and J H LEES 1985 Double strand cleavage at a two base deletion mismatch in a DNA heteroduplex by nuclease S1 Biosci Rep 5 627 632 CHAUDHRY M A and M WEINFELD 1995 Induction of double strand breaks by S1 nuclease mung bean nuclease and nuclease P1 in DNA containing abasic sites and nicks Nucleic Acids Res 23 3805 3809 COLBERT T B J TILL R TOMPA S REYNOLDS M N STEINE et al 2001 High throughput screening for induced point mutations Plant Physiol 126 480 484 CoMAI L K YOUNG B J TILL S H REYNOLDS E A GREENE et al 2004 Efficient discovery of DNA polymorphisms in natural populations by Ecotilling Plant J 37 718 786 GALEANO C H M GOMEZ L M RODRIGUEZ and M W BLAIR 2009 CEL I Nuclease Digestion for SNP Discovery and Marker Development in Common Bean Phaseolus vulgaris L Crop Science 49 381 394 GARVIN M R and A J GHARRETT 2007 DEco TILLING an inexpensive method for single nucleotide polymorphism discovery that reduces ascertainment bias Molecular Ecology Notes 7 735 746 HOWARD J T J WARD J N WATSON and K
180. r of loci lt 100 3 the highest number used to label an allele lt 999 and a 4 data coding type 1 if the code for alleles is a one digit number 1 9 a 2 if code for alleles is a 2 digit number 01 99 or a 3 if code for alleles is a 3 digit number 001 999 These 4 numbers need to be separated by any number of spaces Page 16 7 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 170 2 0 07 4 N CONNEC DNI ON Y CON Next the name of the loci are written one per line and finally the main data with first a number for each population followed by the different genotypes each row for each individual Missing data is encoded as zeros A data file for six populations five loci 4 alleles maximum and 2 digit allele coding would look then as 6 populations samples 6A 2 loc 1 Ne loc 3 loc 4 l 0404 0403 0403 0303 0404 l 0404 0404 0403 0303 0404 l 0404 0404 0403 0403 0404 l 0404 0404 0 3 0404 1 0404 0404 0204 a 0404 0404 0 0403 0404 Missing 0 404 0403 0403 0404 data 0404 0303 0404 0403 040 0404 0403 0404 0403 0404 Column marking 6 0404 0404 0404 0404 0404 6 0404 0404 0404 0402 0404 6 0404 0404 0404 0403 0404 populations 16 2 Genetic diversity Gene or genetic diversity is perhaps the central notion and motivation for conducting research in natural resources and crop improvement If there were no biodiversity we wouldn t have a job and more importantly
181. rgest ML value of the character state presented e Invariants based on functions of characters that have an expected value of O in some trees and non zero expectation in other trees Page 15 1 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION EVO Mua LUD ONE Beast OS 15 2 Inferring phylogeny from pairwise distances construction of a distance tree using clustering with the unweighted pair group method with arithmetic mean UPGMA There are mainly two multivariate methods widely used for pattern analyses of DNA genotypes in biology principal component analysis PCA Flury 1988 and cluster analysis Everitt 1992 PCA and cluster analysis seek to uncover hidden or cryptic patterns among objects e g individuals genetic stocks or populations on which two or more independent variables phenotypic or genotypic characters have been measured e Typical phenotypic variables are morphological traits e g flower petal length and width e Typical genotypic variables are DNA marker genotypes or allele sequences A variety of DNA markers can be employed for genotyping or DNA fingerprinting PCA and cluster analysis seek to project multivariate phenotypic or genotypic measurements in lower dimensional spaces so that the underlying patterns or structures can be described and visually displayed The genetic patterns among a set of OTUs entities genetic materials usually cannot be directly discerned f
182. rking draft compare oppose the a priori structure of genetic diversity to the one obtained using the Dice index one might have to use co dominant markers to assess ploidy heterozygosity This might bring new insights furthering data re analyses using more appropriate algorithms adapted to the plant biology and or marker characteristics to get a better modelisation of diversity The sampling distributions of genetic distance estimators are not known thus parametric methods for estimating sampling variances and constructing confidence intervals have not Page 15 7 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION EVO Mua LUD ONE Beast OS been developed however bootstrapping or other resampling methods can be used to estimate sampling variances Bootstrapping is done by randomly sampling data with replacement to produce individual samples from which the parameters are estimated Suppose n individuals were sampled from a population to estimate allele frequencies Bootstrapping would be done by drawing b bootstrap samples of n individuals with replacement and producing b allele frequency estimates from which mean allele frequencies and sampling variance are estimated When constructing dendrograms bootstrapping generates multiple data sets usually 100 random resampling iterations with replacement are sufficient format of seed number being 4n 1 and adds statistical significance to the branching points in the
183. rom DNA fingerprints raw multivariate data however patterns among the OTUs can nearly always be extracted by PCA or cluster analyses of pairwise genetic distance matrices Originally developed for constructing taxonomic phenograms i e trees that reflect the phenotypic similarities between OTUs UPGMA is the simplest method of tree construction if the rates of evolution are approximately constant among the different lineages For this purpose the number of observed nucleotide or amino acid substitutions can be used 15 3 Distance measures Distance measures are based on topology paths in n dimensional space As an example in a two dimensional space we might consider the following Travel in a grid versus shortest direct distance d min lt x Ly d SQR Ax Ay In the context of plant production and protection the choice of genetic distance estimators depends on what we want to do what we want to see what precision of their estimations is needed and the conditions of their applications in terms of type of markers genetic structure of the cultivars accessions individuals diversity of reference collections breeding programmes etc This defines the dimensions and topologies of the space we are exploring and the paths in this space Let us construct the following set up to illustrate the Page 15 2 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION EVO Mua AN LU OTN B
184. roughout 10 1 1 Prepare a 50ul reaction mix 1 Take a sterile PCR tube and add 0 5 yl DNA 100 ng ul 1 0 ul Taq DNA polymerase 5 U ul 0 5 ul Add daHO to bring volume to Page 10 2 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 2 Mix by tapping against the tube 3 Centrifuge briefly 14 000 rpm for 5 seconds 10 1 2 PCR amplification The PCR amplification programme used for the Tos17 sequence was Initial denaturation Step 4 Ramp 0 5 C per second to 2 C Step 5 Step 6 Cycling repeat steps 2 5 for 29 cycles Final extension See tables above for appropriate annealing temperatures Ta 10 1 3 Separation and visualization of the amplification products Place 15 ul of PCR into a fresh Eppendorf tube Add 3 ul of 5 X loading buffer containing dye Vortex briefly Centrifuge briefly 14 000 rpm for 5 seconds Load sample into a 2 NuSieve agarose gel A NOTE NuSieve agarose provides a good separation gel 6 Run gel for approximately 80 minutes at 80 W power limiting or until dark blue front has run 2 3 down the gel NOTE See Section 1 of RFLP Protocol Agarose gel electrophoresis for details of gel preparation and running 7 Stain gel with ethidium bromide Caution ethidium bromide is toxic wear gloves and avoid inhalation 8 Visualise bands under UV light Caution wear UV protective glasses and shield your face when you are exposed to th
185. rs that amplify a 200 bp target region Perform PCR and Sephadex purification as outlined in this protocol Dilute product to 0 5ng ul in TE The instructor will re array samples so that all eight samples from a group are adjacent on the LI COR gel Incubate samples at 90 C for approx 45 min until volume reduced to 1 5 ul 12 1 5 Preparing loading and running LI COR gels All student samples will be run on a single gel The instructor will demonstrate gel preparation Clean and assemble glass plates Prepare the following mixture 20 ml acrylamide gel mix 6 5 15 ul TEMED 150 ul fresh 10 ammonium persulfate Fill a 20 ml syringe with acrylamide solution Dispense along the top avoiding bubbles by rapping just above the liquid edge whenever it appears one might get trapped If any bubbles Page 12 6 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION appear remove them quickly after the gel is poured with a thin wire tool Leaving a little excess at the well insert the top spacer all the way and centered Insert the Plexiglas pressure plate between the glass plate and casting rails Tighten the top screws as soon the spacer is inserted compressing the rubber pads on the pressure plate a little Add acrylamide to the top glass edge where the comb is inserted and on the edges to assure that polymerization is not inhibited within the gel Let the gel set at least 30 min before putting it into the
186. rue for the programmes Fstat and GenePop on the web By the way other programs may need coding as 198 200 or 198 200 etc but in general they are handled automatically by some software see below Spread sheet programmes as OpenOffice Calc or Excel handle text conversions with the CONCAT string function that can be seen in the example below Table 16 1 5 Example of our size type coding where two columns one for each possible allele have been collapsed and concatenated in a single text This one is from a French version of the software and the name of the function changes a bit from language to language For OpenOffice in English the function is CONCATENATE A1 B1 and they are accessible from the fx button string functions Arial Bio g Jo z S ri ag o 0 00 p a 3 000 EEH e M A E F10 Be CONCATENER C10 010 Individual locus 1 allelel locus 1 allele 1 1 198 200 198200 1 2 192 206 192206 1 3 164 04 164704 1 4 20 20 202202 L 5 20d 214 204214 1 6 204 214 204214 L f 192 192 192192 1 8 192 204 192204 L 4 192 192 192192 l 2 L 2 K 2 3 16 1 7 Transforming data types using software As already noted there is not a universal data type but some conversions can be done with available software at least for some applications For many programmes there is no way around and data files must be coded manually A small utility that we will use is the software CONVERT Glaubitz 2003 This software can tra
187. ry or categorical variables e g binary genetic markers with null alleles The question as to whether two individuals are similar when they both lack a character does not always have a simple answer This topic has been hotly debated particularly in taxonomic circles Romesburg 1984 Sneath and Sokal 1973 When one allele is absent null and the other is present and both alleles are observed among the entities sampled Dudley 1993 argued that 0 0 matches should be included because the absence of an allele in two entities measures similarity This may or may not be true Two individuals for example may lack an AFLP band however the mutations that abolished the AFLP band in the two individuals could be different mutation in the restriction sites elimination of sites insertion between restriction sites band too long to amplify deletion between restriction sites smaller band appearing but too small to be scored translocation reshuffling restriction sites in which case the two individuals carry different null alleles and the 0 0 score is incorrect But the probability of these events locus by locus depends on the frequency of these events and the probability of loss of band due to different mutation events decreases with increasing relatedness In fact including 0 0 matches increases homoplasy loci identical by state but not identical by descent Thus when estimated from multiallelic markers genetic similarities may be upwardly bia
188. s subsequently added to the hybridization solution at a concentration of 40 ng ml for probe concentration see results of dot blot test see Section 5 1 2 3 Step 8 8 5 Carefully remove all air bubbles from the bag before you heat seal it 4 Let the hybridization proceed overnight at least 14 hours in the water bath at 42 C with formamide containing hybridization solution or 68 C without formamide with gentle agitation Caution Formamide is harmful Gloves should be worn oS NOTE After hybridization the solution is collected at one corner of the bag by rolling a pipette over it and transferred to a reaction tube for re use 5 The hybridization solution containing the Dig labelled probe is stored at 20 C and can be re used several times NOTE It has to be denatured before each new application 6 2 1 Washing method NOTE Wear gloves and lab coat at all times for safety and to prevent contamination During the washing procedure the remaining probe is diluted and washed from the membrane In a second washing step the probe DNA which binds unspecifically to the DNA on the blot is removed It is useful to know that the stability of DNA DNA hybrids is dependent on certain factors such as the melting temperature Tm at which the probe is annealed to 50 of its exact Page 6 9 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION complement The factors influencing the Tm are included i
189. s very sensitive to unequal evolutionary rates This means that when one of the OTUs has incorporated more mutations over time than the other OTU one may end up with a tree that has the wrong topology e Clustering works only if the data are ultrametric e Ultrametric distances are defined by the satisfaction of the three point condition What is the three point condition For any three taxa dist AC lt max distAB distBC or in words the two greatest distances are equal or UPGMA assumes that the evolutionary rate is the same for all branches If the assumption of rate constancy among lineages does not hold UPGMA may give an erroneous topology This is illustrated in the following example suppose that you have the following relationship Since the divergence of A and B B has accumulated mutations at a much higher rate than A The Three point criterion is violated e g distBD lt max distBA distAD or 10 lt max 5 7 False The reconstruction of the evolutionary history uses the following distance matrix A B C JD JE B 55 C 4 7 D 7 10 7 Page 15 14 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION RBI HUAN IEW DENT Bb AN DS HER Hr F fs i s 9 8 _ J We now cluster the pair of OTUs with the smallest distance being A and A C that are separated a distance of 4 The branching point is positioned at a 2 q distance of 4 2 2 substitutions We thus construct a sub tree as follows
190. sample 90 ul water e Store this dilution and the remaining pre amplification product at 20 C long term NOTE The dilution of sample depend of amplified products S 7 that is used in selective amplification 8 1 3 PCRs and now termed Test DNA 9 1 5 Selective pre amplification In this section specific subsets in the test DNA are amplified using EcoRI and Tru91 primers that are extended with one to three selective nucleotides Silver staining of the amplified fragments that have been electrophoresed on PAGE is commonly used for detection of DNA banding patterns Alternatively fluorescence labelled primers can be used in the selective amplification PCR step and the products visualised on an automated DNA analyser These two options are described below Page 9 4 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 9 1 6 PCR mix for selective amplification products to be visualized on PAGE 1 Put on gloves and in a PCR tube add Test DNA diluted pre amplified DNA from 8 1 4 Step 5 0 ul 1 Taq DNA polymerase 5U pl Up to 25 0 2 Mix by gently tapping against the tube 3 Centrifuge briefly 14 000 rpm for 5 seconds 9 1 7 PCR profile for Selective amplification products to be visualised on PAGE Place tube in the PCR machine and amplify using the following programme 30 seconds 65 C 0 7 Cicycle Cycling repeat steps 1 3 for 13 cycles 30 seconds repeat steps 5 7
191. sed by including negative matches particularly when one or more alleles are rare Negative matches should be excluded for multiallelic co dominant markers with no null alleles otherwise similarities are overestimated In the following an example illustrating this will be detailed Suppose three lines are genotyped for a locus with three codominant alleles and each line is homozygous for a different allele Entity Allele 1 Allele2 Allele3 Genotype l 1 0 0 l 2 0 1 0 2 i 3 0 0 3 c 1 present 0 absent Now Gower 1971 proposed a similarity measure for cases where mixed variable types are measured e g mixtures of binary ordinal categorical and continuous variables This coefficient can be used for example to combine dominant binary and multiallelic co Page 15 5 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION EVO Mua AN IN OTN Beas OS dominant categorical DNA markers or discrete genotypic and continuous phenotypic variables and is one of several similarity measures used in genetic pattern analysis Gower s coefficient and Jaccard s coefficient are the same when the former is estimated from binary variables and negative matches are excluded We can use this to illustrate whether negative matches should be included or not Gower s coefficient is m m Sij Wijk X Sijk i x Wijk k 1 k 1 Where the similarity between the ith and jth entity measured on the kt
192. ses Does not report per population Ho GenePop on the Web http wbiomed curtin edu au genepop Pros Frequently updated includes many tests for the significance of inbreeding available everywhere through the web Cons doesn t perform nested Fst analyses either Output tables are awful and confusing Ho is reported not as a fraction but as the count observed and expected of heterozygote individuals Arlequin Pros so far the most comprehensive software devoted for population genetics Does handle nested Fst or hierarchical AMOVA s Excellent manual that serves as a summary of population genetic methods highly recommended Cons one of the worst data file format ever This has been circumvented by the automatic translation by other software to certain limits Interface apparently simple but results are mixed with original data files becoming confusing after many runs AFLPsurv http www ulb ac be sciences lagev aflp surv html Pros I have yet to see a dominant marker program that convinces me but this is a workable one Includes many genetic distances and calculates genetic diversity Cons Bootstrapping for individuals is restricted as it is population oriented software PHYLIP http evolution genetics washington edu phylip html Pros this is a collection of programs and is somewhat the dean of phylogenetic analyses Has been overshadowed by PAUP but as free software is a good starting point and altho
193. sis of the amplified products OPTIONAL these two steps can be performed in one reaction NOTE Wear gloves and lab coat at all times for safety and to prevent contamination 9 1 1 Restriction of genomic DNA and ligation of adapters to the DNA fragments Two pairs of restriction enzymes Msel Tru9land Pstl EcoRI were used to digest the genomic DNA Msel1 Tru91 is a frequent cutter with a T TAA cutting site whereas PstI and EcoRI are 6 base rare cutters with a CTGCA G PstI is methylation sensitive and G AATTC EcoRI 1 Put on gloves to protect yourself and the reaction mix and add the following to a 0 5 ml Eppendorf tube Restriction ligation reaction mixture 2 Mix by tapping the bottom of the tube 3 Centrifuge briefly 14 000 rpm for 5 seconds 4 Incubate the resulting reaction mixture for a minimum of 3 hours at 37 C 5 Inactivate the restriction endonuclease by incubating the mixture at 70 C for 15 min 6 Place tubes on ice and do brief centrifugation to collect contents Page 9 2 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 9 1 2 Pre amplification Pre amplification is performed with primers having one selective nucleotide The aim of pre amplification is to generate enough template DNA for selective amplification step 1 Set up the PCR reaction on ice 2 Mix by tapping the bottom of the tube 3 Centrifuge briefly 14 000 rpm for 5 seconds NOTE T
194. ssisted selection F identification Diversity studies Novel allele detections Gene tagging Bulk segregant analysis Map based gene cloning This marker system is not suggested due to major issues in the lack of reproducibility Fingerprinting Varietal line identification multiplexing of primers necessary Framework region specific mapping Genetic maps F identification Comparative mapping Breeding Bulk segregant analysis Diversity studies Novel allele detections Marker assisted selection High resolution mapping Seed testing Map based gene cloning Fingerprinting Varietal line identification Genetic maps F identification Gene tagging Breeding Bulk segregant analysis Diversity studies Marker assisted selection High resolution mapping Seed testing Fingerprinting Page 1 5 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT IRAP REMAP Morphological Protein and Isozyme STS EST GERMPLASM CHARACTERISATION Very fast mapping Region specific marker saturation Varietal identification Genetic maps F identification Gene tagging Breeding Bulk segregant analysis Diversity studies Marker assisted selection High resolution mapping Map based gene cloning Fingerprinting Varietal identification F identification Gene tagging Bulk segregant analysis Diversity studies Marker assisted selection High resolution mapping Seed testing Genetic maps Alien gene introduction Varietal li
195. t the 5 end 5 T ar 7 A G A T C 3 The commercially available restriction enzymes are supplied with the appropriate restriction buffers 10 x concentrated The enzymes are adjusted to a specific activity per ul usually 10 U ul 1 Unit is the amount of enzyme needed to cut 1 ug of lambda DNA in one hour at 37 C A typical restriction digestion is performed using between 20ul and 100ul reaction volume per 5 ug and more of plant DNA For purified plasmid DNA 2 U per ug DNA 1s sufficient for plant DNA 4 U per ug should be used Page 4 1 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION DIGEST RESTRICTION ENZYME For example digestion of 5 ug DNA in 40 ul reaction volume Restriction buffer 10x 4 ul DNA 1 ug pl 5 ul Doubled distilled H2O 29 ul Enzyme 10 U ul 2 ul Incubate for at least 1 hour at 37 C The restriction enzyme can be inactivated by heating to 65 C for 10 minutes or by adding 1 0ul 0 5 M EDTA Note however that protein engineering and advanced biochemistry have allowed major improvements from the canonical restriction digestions above For example Thermoscientific have developed a suite of fast enzymes that can digest complete genomes in 15 minutes versus the traditional overnight digestion Such digestions can be accomplished with no star activity Page 4 2 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION PRIMER DESIGN 5 FINDING CA
196. thin loci to create a null distribution of possible fis values from the data and then compares if the observed value is at one or the other extreme of this distribution that is centred approximately at zero If the observed fis is in one of the extremes that contain 2 5 of the simulated data a 5 two sided test we would conclude that the fis is true value greater than zero and not a random result Page 16 10 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 170 2 0 07 4 u CO Rel DNI ON Y CON 16 3 Genetic structure In section 11 2 we saw a series of descriptive genetic diversity parameters that summarizing are A Ae Ho He and fis When we have two or three populations comparisons are feasible but things can be more complicated for more samples Moreover we could begin to loose information even with few populations because the measures of inbreeding for example are performed with population specific data that does not tell us anything about the relative value of diversity or inbreeding of all populations As a definition genetic structure refers to the non random distribution of genetic diversity in space and time 16 3 1 Nei s population genetics parameters G family Casting our question in terms of H s or genetic diversities only we might ask how is the total genetic diversity related to the average sup population diversity In other words has the total population more informat
197. tions Tag buffer dNTPs Sterile distilled water Primer s Tag DNA polymerase 5U ul DNA 10 20 ng ul 10 x loading buffer Glycerol 80 600 ul Xylene cyanol 2 5 mg Bromophenol blue 2 5 mg Water 400 ul 5 x loading buffer Glycerol 80 300 ul Xylene cyanol 2 5 mg Bromophenol blue 2 5 mg Water 400 ul Ethidium bromide Page 8 4 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Agarose Acrylamide Bis acrylamide TEMED Ammonium Persulphate Alconox TBE see 5 3 Ethanol 95 Repelcote Symacote Bind silane Sodium carbonate Glacial acetic acid Sodium thiosulphate Page 8 5 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION Page 8 6 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 9 AFLP Amplified Fragment Length Polymorphism AFLP is basically a fingerprinting technique It is a method by which selection of restricted fragments of a total genomic DNA digest is detected by PCR amplification It is a combination of hybridisation and amplification based Strategies The AFLP technique combines components of RFLP analysis with PCR technology Vos et al 1995 Ves et et 1995 Total genomic DNA is digested with a pair of restriction enzymes normally a frequent and a rare cutter Adaptors of known sequence are then ligated to the DNA fragments Primers compleme
198. tivity tests showed that mismatch cleavage activity could be detected in celery extracts purified with Amicon Ultra 0 5mL 10k centrifugal filter devices and omitting the dialysis step The whole isolation procedure could be carried out within 1 day using standard laboratory equipment 1 e a cooled microcentrifuge However a stronger background on the agarose gels possibly originating from salt remnants retained in the filter devices is an issue Number of reactions obtained from 18 mL celery juice and using 4 Amicon Ultra filter devices we have recovered a total volume of 155 uL from the 4 filter devices The activity assay shows a clear cleavage pattern with the 5x concentrated enzyme 0 125 uL per reaction This would allow a total of at least 1240 reactions However a lower amount of enzyme between 1x and 5x seems to work either and would increase the number of reactions accordingly 14 4 Contributors Experimental design data interpretation Bernhard Hofinger and Bradley Till Experimental execution Bernhard Hofinger Celery enzyme extraction Bernhard Hofinger Owen Huynh Biguang Huang Bradley Till Manuscript preparation and editing Bernhard Hofinger and Bradley Till Development of TILLING protocol Owen Huynh Bradley Till Page 14 7 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION EVO Mua LUD ONE Beast OS 15 MULTIVARIATE ANALYSIS PHYLOGENETICS AND PRINCIPAL COMPONENT ANALYSIS
199. trifuge or air dry in flow bench Dissolve DNA in TE buffer or sterile double distilled H2O ddH20 a 17 1 3 Solutions 1 5 x CTAB extraction buffer 1 liter CTAB 15 0 g 1 M Tris pH 8 0 75 ml 0 5 M EDTA 30 ml NaCl 61 425 g Page 17 1 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION APPENDICES ddH gt O to 1 litre 10 CTAB 1 litre CTAB 100 g NaCl 0 7M 40 95 g ddH gt O to 1 litre B mercaptoethanol Chloroform isoamylalcohol 24 1 Isopropanol Ethanol 96 and 70 sodium acetate 3 M TE buffer 10 mM Tris HCl 1 mM EDTA pH 8 0 17 2 Polymerase chain reaction protocol The polymerase chain reaction PCR is basically a technique for in vitro amplification of specific DNA sequences by the simultaneous primer extension of complementary DNA strands The principle of primer extension is illustrated in Figure A 2 1 for one DNA strand The primer binds to its complementary sequence of the single stranded target DNA and the polymerase extends the primer in 5 3 direction by using the complementary DNA as a template For a PCR reaction two primers are used one binding to the lower strand forward primer and one binding to the upper strand reverse primer Thus the requirements for the reaction are template DNA oligonucleotide primers DNA polymerase deoxynucleotides to provide both energy and nucleosides for DNA synthesis and a buffer containing
200. tting Localization of particular sequences within genomic DNA is usually accomplished by the transfer technique described by Southern 1975 and subsequent hybridization with a labelled probe Genomic DNA is digested with one or more restriction enzymes and the resulting fragments are separated according to size by electrophoresis through an agarose gel The DNA is then denatured in situ and transferred from the gel to a nylon membrane The relative positions of the DNA fragments are preserved during their transfer to the filter The DNA is hybridized to radioactive or in our case non radioactive labelled DNA probes and the positions of bands complementary to the probe can be visualized by autoradiography or alternative enzyme linked detection systems Capillary transfer In the capillary transfer method Southern 1975 DNA fragments are carried from the gel in a flow of liquid and deposited on the surface of the nylon membrane The liquid is drawn through the gel by capillary action that is established and maintained by a stack of dry and absorbent paper towels see Figure 5 4 Method Transfer of DNA from agarose gel to a nylon membrane NOTE Wear gloves and lab coat at all times for safety and to prevent contamination 1 After taking a photograph of the gel mark the gel for orientation purposes Soak the gel for 5 minutes in 0 25 M HCI for depurination 3 Soak gel 2 x 20 minutes in denaturing solution 0 4 M NaOH 1 M NaCl with constant
201. u may find them useful for non TILLING applications Steps 14 16 have been included to illustrate that placing verifying and confirming orders are tasks that have been automated by STP 18 Additional Exercises Once you have familiarized yourself with CODDLE and primer design try inputting other information in the CODDLE input utility such as the Genbank URL of your favorite sequence step 4 Also try making additional Blocks with the SIFT programme step 8 Finally use the additional options window of the CODDLE output step 9 to design primers to a different region of the gene 12 3 Data analysis The programme GelBuddy has been created to assist the discovery of mutations and polymorphisms ZERR and HENIKOFF 2005 It is available as a free download http www proweb org gelbuddy This program should already be loaded onto the training course computers For this exercise download sample images from here http ulling fherc org tillingdemo ImagestorFAOgelBud Be sure to download both the IRD700 and IRD800 images The protocol below uses the basic Gelbuddy features for analysis of a standard TILLING gel Tools are provided for the analysis of EcoTILLING or two dimensionally pooled gels that are not described More information can be found at the GelBuddy page 1 Download IRD700 and 800 jpeg or tiff images to your desktop For example download both 43ugfp115a_bt 7 and 43ugfp115a_bt 8 2 Open Gel Buddy 3 Import images
202. ubes 13 200 rpm 5 min RT pellet the silica e transfer 180 uL supernatant to new tube avoid transferring silica powder e optional if there is still silica powder in the preps repeat the centrifugation e check for concentration and integrity of DNA e store the genomic DNA at 20 C for long term storage or 4 C for short term storage Page 2 5 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION VALIDATION OF LOW COST DNA PREPARATIONS FOR TILLING APPROACHES Follow the protocol contained in Positive control for mutation discovery using agarose gels version 2 4 available at http mvgs iaea org LaboratoryProtocols aspx to test that your DNA is suitable for TILLING and Ecotilling applications 2 4 Example Data Table 1 Different combinations of self made low cost buffers and buffers from Qiagen DNeasy Plant Mini kit tested with a te tissue Sampe Lysis Dneasy Dneasy Dneasy Dneasy kit kit kit kit Shredde Shredd Shredde Shredde r er r columns r columns columns columns Shredder Shredder Shredder columns columns columns Shredde r columns DNA binding Buffer 6M 6M Buffer 6M 6M buffer AP3 E Guanidi Guanidi AP3 E Guanidi Guanidin ne ne ne e thiocyan thiocyan thiocyan thiocyan ate ate ate DNA wash buffer ng uL 14 13 34 41 12 11 12 20 10 16 io Mais is faz ln 122 las i as ug 2 6 2 4 7 3 1 3 1 5 a 1 9 2 2 2 0 2
203. ugh methods are somewhat outdated the implementation is serious Cons as said somewhat outdated but good for most applications TreeView http taxonomy zoology gla ac uk rod treeview html Pros small and effective program for visualizing trees constructed in the PHYLIP format 1 e out files from NEIGHBOUR for example Cons large trees appear sometimes not so well no possibility of editing trees Page 16 14 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION 170 2 0 07 4 u CO Rel DNI ON Y CON Populations Pros very good collection of genetic distances for codominant markers It can deal with dominant marker data 1f we use the 22 11 coding Produces tree files directly observable with TreeView and accepts GenePop data files Cons often times it crashes unexpectedly possibly because of missing data or repeated individual names within populations RstCalc http helios bto ed ac uk evolgen rst rst html Pros good programme for estimating Rst Cons Data file is not difficult but could be simpler It does not handle nested Rst CONVERT http www agriculture purdue edu fnr html faculty Rhodes Students 20and 20Staff elaubitz software htm Pros little programme that uses a simple excel file that can be translated into other software including GenePop and Arlequin Cons does not support FSTAT so passing through GenePop is necessary Page 16 15 FAO IAEA INTERREGIONA
204. ught and salt tolerance in sorghum These markers often used in conjunction with bulked segregant analysis and detailed genetic maps provide a very efficient method of characterizing and locating natural and induced mutated alleles at genes controlling interesting agricultural traits Markers have also been used to identify the genes underlying quantitative variation for height maturity disease resistance and yield in virtually all major crops In particular the PCR based techniques have been useful in the assessment of biodiversity the study of plant and pathogen populations and their interactions and identification of plant varieties and cultivars Amplified DNA techniques have produced sequence tagged sites that serve as landmarks for genetic and physical mapping It is envisioned that emerging oligonucleotide based technologies derived from the use of hybridization arrays the so called DNA chips and oligonucleotide arrays will become important in future genomic studies However many of these are still under development are proprietary or require the use of expensive equipment and are therefore not yet suitable or cost effective for adequate transfer to developing countries Clearly the initial transfer of technology has only involved a selected group of techniques that are well established and or seem to have a broad application e g RFLP Page 1 1 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION SSR
205. volutionary models and or samples do not come from random samples from natural populations We may have accessions coming from different countries or regions within countries collected simply because they present an interesting trait nice fruits long spikes little cyanide etc This coding 1s required for traditional statistics such as Principal Components Analysis PCA and related multivariate techniques with the advantage that genetic data can be combined with morphological data for grouping purposes Table 4 shows the presence absence coding for the same example gel Important Note You may notice that this coding is not exclusively for diploids In fact tetraploids or hexaploids can be handled this way Simply there can be more than two bands per individual and the notion of heterozygotes diffuses and becomes secondary It is clear that for allozyme data or morphological data known to be co dominant white lilac and purple flowers in Lynanathus for example presence absence are perfectly applicable At this point we would lose the diploid information so estimation of inbreeding the parameter fis that measures the probability that two alleles within an individual are the same cannot be computed This coding however is highly popular for analysing accessions because if you will it is model free and as seen from Table 4 we can include in the same database different kinds of data and potentially in the same analysis fruit
206. w data section Copy and paste the density from the raw data into the density column of the concentration table to the right of the raw data Insert the formula for the second order polynomial into the first cell of the second order polynomial column Copy the formula from the graph then click on the cell type the equal symbol in the formula box and paste the formula Replace x with the density data from the first sample This sample should be in cell J7 so you would replace x with j7 j7 Replace x with j7 When finished press the enter key The value should appear in the cell Click on the cell Pull the right corner so that the box extends over the entire column You should see all the cells in that column fill with the appropriate values Optional Repeat Step 21 and 22 for the third order polynomial For x use j7 j7 j7 For 23 24 25 26 many cases the second order polynomial will be sufficient The main differences will be in estimating high gt 50 ng ul concentration samples Save the gel image in imageJ as a tif image in a new folder labelled with the gel image name In the excel workbook import the tif gel image and place it near the Gel Image field Compare the band intensities on the image with the concentrations estimated from the standard curve Do you agree with the estimations If not consider repeating the measurement Compare your data with the data provided in the sample data tab of th
207. we applied a centrifuge based filter method to concentrate the enzyme extract 13 2 Materials MATERIALS BUFFERS FOR ENZYME Notes EXTRACTIONS hand held mixer or juicer STOCK 100mM PMSF stock in To prepare an aqueous solution of isopropanol 100uM PMSF for buffers A and B add 1 ml 0 1M PMSF per liter of solution immediately before use STOCK 1M Tris HCl pH 7 7 Buffer A 0 1 M Tris HCl pH 7 7 100 uM PMSF Buffer B 0 1 M Tris HCl pH7 7 0 5 M KCI 100 uM PMSF Dialysis tubing with a 10 000 Dalton molecular weight cut off MWCO 10 000 Spectrum Laboratories Inc NH 2SO4 Ammonium sulphate re Sorvall Centrifuge O equivalent centrifuge rotor combination to achieve needed gravitational force OOO MATERIALS FOR CONCENTRATION OF ee ENZYME EXTRACTS Amicon Ultra Centrifugal Filters O 5mL 10K UFC501024 24Pk Refrigerated 4 C Microcentrifuge e g Eppendorf 5415R Page 13 1 FAO TAEA INTERREGIONAL TRAINING COURSE ON MUTANT LOW COST MUTATION GERMPLASM CHARACTERISATION DISCOVERY TILLING PCR re Thermocycler e g Biorad C1000 Thermal cycler PCR tubes Life Science No 781340 TaKaRa Ex Taq Polymerase 5U ul TaKkaRA 10X Ex Taq Reaction Buffer dNTP Mixture 2 5mM of each dNTP Agarose gel equipment 13 3 Methods 13 3 1 Enzyme extraction 1 Collect approximately 200 grams of mixed monocot and dicot weedy plants were collected that were growing on the periphery of our sorghum field
208. which prompts the choice eventually the construction of a mathematical model to analyse the data For example the choice of the euclidean distance leading to Jaccard or Dice indeces is a priori a model to consider when using RAPD markers The Dice index Jaccard euclidean distance is more robust against artefactual bands but takes into account only common present bands Now AFLP is more reproducible than RAPD and absent bands are very significant indeed and an algorithm such as the simple matching algorithm or an algorithm of Sokal and co workers is more appropriate So when confronted with analysing genetic diversity one should start by acknowledging the biological characteristics of the plant and the general taxonomy genera species e g of the individuals accessions in the study assess the a priori structure of the genetic diversity of a collection of individuals phenotyping Then look into the characteristics of the marker system s used dominant vs co dominant PIC reproducibility confidence in reading the pattern power of resolution of the analysis system for example This will prompt a choice of different mathematical models applicable to the problem or even more interestingly exclude some choices In general the choice of the Dice index is at least worth a tentative first order approximation to genetic diversity analyses to sketch a rough outline of genetic diversity of the population studied To confirm refine this wo
209. wing assumptions Infinite Alleles Model all loci have same rate of neutral mutation mutation genetic drift equilibrium stable constant effective population size Ne linear in time Cavali Sforza s genetic distance estimator assumes genetic drift only no mutation accommodates changes in population size is linear ib sum of 1 Ne over time 15 7 Protocol tree reconstruction UPGMA employs a sequential clustering algorithm in which local topological relationships are identified in order of similarity and the phylogenetic tree is built in a stepwise manner We first identify from among all the OTUs the two OTUs that are most similar to each other and then treat these as a new single OTU Such an OTU is referred to as a composite OTU Page 15 10 FAO ITAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION RAVIGIMUAAU ALU LONE Beast OS Subsequently from among the new group of OTUs we identify the pair with the highest similarity and so on until we are left with only two OTUs Definition Distance dag between clusters A B from individual distances da l dag rare 2 da The distance between a simple OTU and a composite OTU is the average of the distances between the simple OTU and the constituent simple OTUs of the composite OTU Then a new distance matrix is recalculated using the newly calculated distances and the whole cycle is being repeated Algorithm Initialisation e Assign each sequence z to its
210. ys constrained by economic factors and depend on the nature of the statistical analysis and scope of inference When analyses are performed on segregating populations a sufficient number of individuals must be sampled within each population to accurately estimate gene Page 15 22 FAO IAEA INTERREGIONAL TRAINING COURSE ON MUTANT GERMPLASM CHARACTERISATION EEV iO Mua AN TIN ONE Beas OS and genotype frequencies Weir 1996 proposed sampling over loci for random model analyses and over individuals for fixed model analyses The line between fixed and random is often blurred Basically if the scope of inference is across a species or across other strata where broad inferences are to be made then random models are used If the scope of inference is a fixed set of populations or inbred lines then fixed models are used If the goal of the study is to survey allelic diversity among a sample of populations chosen for some biological or commercial reason then extensive within population sampling may not be necessary If the goal is to accurately describe genetic patterns among populations measure linkage disequilibrium or gene flow or protect intellectual property e g an open pollinated or synthetic cultivars in crop plants then individuals within populations must be sampled to accurately estimate gene and genotype frequencies and perhaps to find rare alleles and genotypes What types of variables should be measured Although we are pri

Manual - Nuclear Sciences and Applications

Contents

Download Pdf Manuals

Related Search

Related Contents