Home

Data supplement 3

Contents

1. STANDARD OPERATING PROCEDURE FOR LAND USE REGRESSION LUR ALGORITHMS TAPHE LUR STUDY ICMR CAR PROJECT DEPARTMENT OF ENVIRONMENTAL HEALTH ENGINEERING ICMR CENTER FOR ADVANCED RESEARCH ON ENVIRONMENTAL HEALTH AIR POLLUTION SRI RAMACHANDRA UNIVERSITY CHENNAI TN SOP ID 2 9 TAPHE EXPOSURE LUR Date of issue 15 February 2011 Date of last review January 2015 Prepared amp Reviewed by Approved by Mr Santu Ghosh Dr Kalpana Balakrishnan Collect and pre process data for selection of monitoring sites to ensure that monitoring sites and predictor data sets are in the same projected coordinate system Convert the GIS predictor data sets into rasters grids with a common specification e g uniform cell size and extent Define the list of predictor variables including zones of influence buffer neighbourhood size and direction of effect Specify the zones of influence to reflect the scale of environmental processes appropriate for each variable For example for effects of emissions from road traffic that are typically highly localised use narrow zones of influence e g within a radius of 20m to 500m for effects of land use that are often more extensive and more complex affecting both dispersion patterns as well as emissions use larger zones of influence up to several km while noting that for any variable the minimum buffer size will depend on the resolution of that GIS data set Prior to creating the
2. CYP1A1 gene polymorphism CYP1A1 gene which is mapped on chromosome 15422 24 Fig 5 2 encodes CYP1A1 which exhibits aryl hydrocarbon hydroxylase activity CYP1A1 gene spans 10kb and consists of 7 exons The CYP1A1 gene is polymorphic the T3801C substitution in the 3 untranslated region UTR is referred to as m1 allele The m1 variant has been associated with elevated enzyme activity Chromosome 15 12 1 03 DI d GI SI WX XJ TO 5 h3 h P2 a HS Soo l DHoAAARLRONON SSS OT ROON gt Co ON CO SO TU oU ch m Co UTR s eae m1 T 3801C Fig 5 2 Genomic location and structure CYP1A1 gene Genotyping CYP1A1 3 UTR by PCR RFLP PCR is performed to amplify the 3 UTR of CYP1A1 gene using specific primers Table 5 1 Since the T to C transition in the 3 UTR creates a recognition site for the Msp1 enzyme the genotypes are determined by PCR RFLP Table 5 1 Primer sequences for amplification of CYP1A1 3 UTR Primer Primer Sequence Amplicon Size bp Forward 5 TAGGAGTCTTGTCTCATGGCCT 3 340bp Reverse 5 CAGTGAAGAGGTGTAGCCGCT 3 A 20ul reaction is set up using 50 100ng of genomic DNA 1X PCR buffer 1 5mM MgCIl2 10 mM Tris pH 9 0 50 mMKCI and 0 196 Triton X 100 200uM dNTPs 50pM of each primer and 1 U of Taq DNA polymerase Table 5 2 The
3. b I usually get shortness of breath but always get well c My breathing is never completely satisfactory Self explanatory Give Select the most appropriate choice Codes a 0 b 1 c 2 If the answer is b or c specify the number of years for which present else enter 99 44 Reaction to exposure to dust animals 24 When you are exposed to dusty areas or pets like dog cat or horse or feathers or quilts or pillows etc do you a Feel tightness in chest b Feel shortness of breath Self explanatory Give answer in Yes or No separately for each of a and b in case of doubt give answer as No Codes Yes 1 No 0 If Yes specify the number of years for which present If No enter 99 History of Asthma 25 26 27 Have you ever suffered from asthma Self expalanatroy Ask if the diagnosis was made by a doctor Give answer in Yes or No In case of doubt give answer as No Codes Yes 1 No 0 If Yes specify the number of years for which present If No enter 99 Have you ever had an attack of asthma during the last 12 months An attack of asthma means rapid worsening in breathlessness requiring increase in the dose of medicines or requiring hospitalization Give answer in Yes or No In case of doubt give answer as No Codes Yes 1 No 0 If Yes specify the number of years for w
4. Explain the weighing and measuring procedures to the mother and to a limited extent the child to help minimize possible resistance fears or discomfort they may feel You must determine whether the child or mother is under so much stress that the weighing and measuring must stop Remember young children are often uncooperative they tend to cry scream kick and sometimes bite If a child is under severe stress and is crying excessively try to calm the child or return the child to the mother before proceeding with the measuring Do not weigh or measure a child if a The mother refuses b The child is too sick or distressed c If the child has a physical deformity that will give an incorrect measurement measure the child and make a note of the deformity on the survey Safety rules Keep objects out of your hands and pens out of your mouth hair or breast pocket when you weigh and measure so that neither the child nor you will get hurt due to carelessness When you are not using a pen place it in your equipment pack or on the questionnaire Make sure you do not have long fingernails Remove jewelry such as rings or watches before you weigh and measure Section C Using Child health calendars Emphasize that you would like the child s caregiver to focus on the previous 14 days 2 wks 27 Section 1 Ask Q1 If the caregiver answers NO or Don t Know proceed to the next symptom Q2 1 2 4 If the caregive
5. Follow the procedures given below to prepare XAD resins for filter coating storage and transportation 1 iii iv Clean all glassware using Alc KOH solution and ultra pure water For glassware not contaminated with XAD it is not necessary to clean with Alc KOH Clean aluminum foil by baking at 400 C for at least 30 min or by using a 1 1 1 mixture of hexane methanol and dichloromethane magic mix Select a clean and dry space in a fume hood for filter coating process Grind 5 g of XAD 4 resin in a ball mill grinder at 520rpm for 20 min Transfer the ground resin into a clean 500ml beaker to this add 250mL of methanol followed by 250ml ultrapure water and sonicate the mixture for 1hr and allow the mixture to settle for 10min to settle Bake the Alundum thimble at 800 C for 10min and allow to cool in desiccators this step can be completed while the resin mixture is kept for sonication Place the baked alundum thimble in a clean 500mL beaker and pour the sonicated resin mixture into the alundum thimble for purification of grinded resins vi vii viii ix xi xii xiii xiv XV xvi xvii xviii xix XX xxi Collect the resin from the alundum thimbles and discard the filtrate i e solvent Wash the resins in thimbles by pouring 500ml of methanol followed by 1 1 methanol DCM mixture to purify the resins Dry the resins by placing the thimbles in hot air oven at
6. 26 68 26 73 26 87 26 8 26 72 1 35 1 8 24 0 26 03 26 08 25 70 25 91 25 98 25 83 26 0 25 92 1 39 1 9 25 0 24 78 24 84 24 91 24 87 24 89 24 91 24 9 24 87 1 45 1 95 26 0 24 29 24 31 24 25 24 33 24 38 24 32 24 2 24 31 1 48 2 0 28 0 23 22 23 23 23 23 23 27 23 25 23 26 23 27 23 24 1 55 Soap bubble meter Filter cassette BGI Cyclone separator Calibration chamber Tygon tube Rotometer Soap solution SKC air meter 69 Figure 2 Set up of rotameter calibration apparatus 0 046 0 282 R 0 997 Chart Title 0 0 5 0 10 0 15 0 20 0 25 0 30 0 35 0 Series1 Linear Series1 Rotameter Figure 3 Linear graph showing calibration of rotameter with soap bubble meter 5 1 3 AIR SAMPLER CALIBRATION USING SOAP BUBBLE METER Thoroughly wash the standard glass burette in and out with water Fix the washed burette in the burette stand Keep diluted soap solution in the beaker and place under the burette Clean the BGI cyclone separator and assemble the unit for calibration as shown in Fig 4 Use Data Form EXP 2 for instructions to clean and assemble cyclones Attach calibration chamber inlet with a suitable section of inch tygon flexible rubber tubing and connect the other end of the tubing to soap bubble meter fixed in the stand see Fig 4 Connect the calibration chamber o
7. k Measure the time taken for the bubble to travel 500 or 1000 ml by using stop watch l The flow rate Q L min is determined by dividing the volume traversed by the bubble V ml in the burette divided by the time taken T sec for the bubble to reach 500 or 1000 ml mark in the burette m Compute flow rate of air samplers using the formula V ml 60sec 1L Where Q Flow rate L min V the volume traversed by the bubble ml T time taken for the bubble to travel across the specific volume sec 67 Ina spreadsheet record the values and compute the flow rate a sample spreadsheet is shown in Table 1 Repeat steps j to o to set desired flow rates ranging between of 1 25 to 2 0 L min Plot data in a spreadsheet for rotameter readings vs soap bubble flow rate readings Flow rates for various rotameter readings is extrapolated from equation e g Flow rate L min 0 046 rotameter value 0 282 Fig 3 68 Table 1 Sample rotameter calibration spreadsheet Flow s Flow vate meter Time taken for the soap bubble to travel 500 or 1000mL in vate L min ie the graduated cylinder seconds L m 1 2 3 4 5 6 7 Avg 1 0 13 0 41 86 41 17 40 65 40 63 40 85 41 86 41 23 41 17 0 87 1 25 15 0 37 70 37 19 37 27 37 18 37 26 37 17 37 21 37 30 0 97 1 5 19 0 30 52 30 65 30 88 30 89 30 97 30 94 30 93 30 81 1 17 1 75 23 0 26 60 26 68 26 75
8. So 09 10 11 would be the EDD 3 Corrected EDD Ifa first trimester ultrasound scan is available write down the corrected EDD from the records in lt dd mm yyyy gt format see section E 4 Blood Group and RH factor Encircle the blood group of the participant noting it from the ANC record Section E Ultrasound Scan Results Current Pregnancy 15 Collect this information from the government ANC records and or reports of the private scan centers Record the Date of the scan against each trimester and note down the measurements in millimeters under each column Note GA Gestational age CRL Crown Rump Length BPD Bi parietal Diameter HC Head circumference AC Abdominal circumference FL Femur length EFW Estimated fetal Weight If the scan report is recorded from a private scan facility the impression statement is usually provided at the end of the report This should be noted down in the ultra sound impression statement Section F Pregnancy complications Current Pregnancy In this section the systemic illnesses and other health conditions which are mentioned in the ANC records should be marked in the appropriate column against each trimester Use the Others specify field if the condition which is not listed down in the section is mentioned in the ANC record Section G Periodic Clinical examination and Investigations Current Pregnancy In this section the results of periodic clinical examinat
9. Write down the full name of the respondent 6 Name of husband Write down the full name of the respondent s husband this is additional identifying information would be useful for locating the household during the first field visit if the household address information is inaccurate 7 Where do you live currently Write down the name of the village area Do not label it as urban or rural This assignment is done at the laboratory while assigning the unique ID 8 Where do you intend to go for delivery Provide the respondent with the enlisted options and encircle her response 9 Specify the locality of the place of delivery mentioned above Write down the name of village or area that the respondent intends to go for the delivery of the child 10 Is that place within the study zone Check against the villages and zones included within our study area MC Data Form 1a Encircle either Yes or No a If the response is NO she is not eligible for inclusion Explain to her that she is ineligible as the team will find it difficult to follow her during the course of the pregnancy and thank her for her time 11 Participant s occupation Write down the occupation of the respondent 12 Is that a dusty occupation Common dusty occupations are listed in the Annexure MC Data Form 1a If in doubt confirm from the respondent if she is exposed to dust frequently in her workplace a Encircle either Yes or No b If the response is Ye
10. concentrations to the concentrations obtained from a GC MS vi Calculate the original theoretical concentration of each PAH in the filter extract as follows Theo i Rspike i x V inj V fext where Theo i Calculated original theoretical concentration of component i in the filter extract RSpike i Concentration of component i in spike solution V inj volume of spike solution injected on the filter prior to extraction and V fext final volume of filter extract vii Calculate the recovery efficiency for each as follows 96 Recovery i C i Theo i x 100 where 96 Recovery i recovery percentage of standard component i C i concentration of deuterated PAH component i obtained from the GC MS and Theo i calculated original theoretical concentration of standard PAH component i in the filter extract If the calculated efficiency is less than 50 or higher than 150 a remark or flag recovery low or recovery high must be noted on the analysis report ThePAH mass can be calculated as follows PAH i C i V fext 9o Recovery i where PAH i measured mass in ng of component i on filter C i concentration in ng mL or ppb w v of PAH i obtained from GC MS analysis V fext Final filter sample s extraction volume in mL prior to GC MS analysis and Recovery i recovery percentage of PAH i gt For PAHs that have rec
11. quality check amp data entry and v data analysis Fig 1 Each of these activities is described in detail in the following sections Tool box meeting Laboratory activities Sampler calibration Filter conditioning amp weighing Field preparation Field activities Sampler placement Repeat steps for next sampling cycle Review QC filter weights and field data sheets Sampler retrieval Quality check QA QC amp data entry Figure 1 Steps involved in collection and determination of PM mass concentration 64 4 Tool box meeting A 10 15min tool box meeting is conducted every day to plan field activities and logistics Based on sampling requirement select the areas i e rural and or urban for sampling and assign field teams Set monitoring targets i e number of households for each team and organize field equipments and samplers accordingly Document sampling date location number of field teams and logistics information in the tool box meeting data sheet everyday Use Data Form TB Information Sheet 5 Laboratory activities Several steps are grouped under laboratory activities that involves filter conditioning and weighing sampler calibration before and after sampling and preparation of sampler units for field sampling Divide the work load among field team members to complete each step prior to going to field Typically filter conditioning and weighing should be handled
12. the bag Hold the sampler body over a clean glass Petri dish Hold the sampler body using fingers with one end pointing up Remove the top end cap of the sampler body use clean flat forceps as a wedge if necessary and place the end cap in the beaker for used end caps Still holding the body above the Petri dish tilts it to allow the filter and the two stainless screens to fall onto the dish Use forceps if necessary to get the filter and screens out of the body being careful not to damage the screens Separate the exposed filters from the screens using clean forceps Place the filters into the shipping vials if the filter does not insert easily fold the filter using the two forceps together as shown in Fig 4 Use separate shipping vials for NO2 NOx and 502 filters i e one filter in one vial For filters place both the filters from the same sampler in a single shipping vial Label the vials appropriately following the same labeling scheme as the samplers After finishing transfer of both filter in separate vials clean the forceps both and the petridish with moist Kimwipes or wet cleaning tissue making sure that they are all wiped completely dry after cleaning Repeat the process for each sampling badge Store the shipping vials for each sampler in a cool place but not refrigerated in the dark until the time of filter extraction The vials containing exposed filters are packed properly and shipped to R
13. viii ix xi xii xiii xiv Charge the UCB particle monitors and ensure that the battery voltage is at least 7 0 volts for it to operate for 24 hours To charge the UCBs connect it to a computer using the 9 pin UCB serial cable Open the UCB device manager wizard interface to check battery temperature sensor reading and the photoelectric sensor signal Select configure this device and synchronize the monitor clock with the computer clock and set the date and time for sampling Set the logging interval to 1 min and sample interval to 1 sec this is the most frequent logging possible Set the filter depth to 2 and select launch program to set the monitor ready for sampling Launch the pre sampling zeroing period by placing the UCB in a zip lock bag and away from dusty environment Make sure the bag does not have any holes and is stored in a place with no disturbance Note down the start time and after 30 min note the end time of the pre sampling zeroing period in a data log sheet Leave the UCB in the zip lock bag until it is ready for installation in the field site Note before launching UCB in the field time in wristwatches of field personnel should be synchronized with computer and UCB software manager times Remove the UCB from the bag and place it in appropriate indoor locations preferably hooked to air sampler bag as shown in Fig 7 Record the sampling start time in the data sheet After 24h sampling is complete
14. 123 denda incer rera Error Bookmark not defined 9 Reference se esesisencu atts nutnasiien vavsnansversideaverenintvceitandatuannd Error Bookmark not defined 4 STANDARD OPERATING PROCEDURE FOR SAMPLING AND ANALYSIS OF TRACE METALS IN HOUSEHOLD MICRO ENVIRONMENTS ener 127 T PuEPpDOSE Da sa Fc ME via ORE 128 2 Scope and Applicability esses eeenenetn rnnt te tnn enata tnnt tans 128 3 Summary OF Method eie ctim ic cue Eu CRANE Du FA ra RN a E 128 4 Materials TEQUIFEQ eus nndis doa ndis etude 129 4 4 Calculat a a EEPE A E EE E 136 42 5 ADA TIE YC TCT ON Meade Ed dicor bus 136 STANDARD OPERATING PROCEDURE FOR SAMPLING AND ANALYSIS OF POLYCYCLIC AROMATIC HYDROCARBONS PAHs IN HOUSEHOLD MICRO caus o ERES Usu ra uU suse un GERA Er EO E Ea Fd a RUE 138 De OSC TA 139 2 Scope 139 3 5ummary etam ibi rod rie ni Lais thr ere D ny errr IRR 139 4 Toolbox meeting nk SU xa Cat dn CE d CLR dE NUS 140 5 Laboratory activities iuiaecice css iesinicassc iani cri FOL RS abc Ra ORDRE rad d 140 6 Sampl
15. 24 h in a conditioned environment prior to taking weights l Repeat the above filter conditioning steps before and after field sampling m Record details in Data Form EXP 3 against each filter ID 73 Figure 5 Filter conditioning in desiccator 5 2 3 FILTER WEIGHING The same person should handle pre and post weights of filters to avoid inter person observation bias Filter weights should be taken only after completing filter conditioning steps and the room conditions are stabilized within the standard operating range Follow the steps to complete filter weighing using a microbalance o a Turn on the power connections to the micro balance Turn on the power of the micro balance and allow it to stabilize for 15 30 min Slide open the top cover of the micro balance Repeat this process 2 3 times Press tare button on the micro balance Press CAL button to initiate auto internal calibration Zero digit with 3 decimals will appear automatically after the internal calibration is completed 2 3 min if not press tare again Carefully pick up the conditioned filters from the desiccators and remove the electrostatic energy ofthe filter by swaying it 1cm above the electrostatic neutralizer four to eight times Take care not to bring filters in contact with the electrostatic neutralizer While weighing avoid putting unnecessary weights or pressure on the table as this may skew the balance Place the filter
16. 4 Are you employed Employment includes self employment like tailoring from the house hand works sales of household things etc Mark the appropriate answer 5 Have you ever been employed If the answer for previous question was No ask the participant about previous employment and mark the appropriate answer 6 Which is your work place Mark the appropriate answer 7 How frequently do you commute Mark the appropriate answer 8 On an average how much distance do you travel Ask the participant on an average how many kilometer she he travels If the participant does not know the exact distance ask them for the place and calculate the average distance 9 On an average what is the duration of your travel Ask the participant to recall the approximate duration of travel in hours 10 What is your mode of travel Here the participant can choose multiple answers and mark the appropriate 11 When you commute by a two wheeler do you use any protective device Mark the appropriate answer 12 If Q E 11 is yes specify the type 84 Mark the appropriate answer 13 Do you take any diversions short routes while traveling Mark the appropriate answer 14 If Q E 13 is yes specify the reason Mark the appropriate answer Note ignore Q 15 18 ifunemployed 15 How wide is the road street adjacent to your work place Ask the participant to report on the approximate width of the road in feet adjacent to their work place If they
17. FIRMLY ON HEAD LEFT HAND ON KNEES KNEES Io TOGETHER INST BOARD QUESTIONNAIRE AND PENCIL ON CLIPBOARD ON FLOOR OR GROUND BOOY FLAT AGAINST BOARD Fig 6 Child height measurement using stadiometer Weight measurement Explaining the Weighing Procedure to the Mother e Show the scale to the mother and explain to her that you are going to weigh her child on the scale Older children may be weighed by standing by themselves on the scale e Tell her that infants and young children who will not stand on the scale alone will be weighed while being held by the mother e Ask the mother to dress the child in just light indoor clothing The children should not wear thick clothing or anything heavy Preparing the Scale e Make sure that the scale is on a smooth surface and make sure that it is flat horizontal and stable Weighing Older Children Who Can Stand on the Scale by Themselves e Turn the scale ON by stepping on the scale The display should show 188 8 first and then 0 0 The 0 0 reading indicates that the scale is ready 24 e Ask the child to step onto the center of the scale and stand quietly Wait until the numbers on the display no longer change Make sure that the solar cells are not covered by a skirt or feet e The child s weight will appear in the display within two seconds Record the child s weight to the nearest 0 1 kg in the questionnaire Weighing Younger Children e Ask the mother t
18. Information should be communicated to the field team so that missing or erroneous data may be collected during subsequent visits to same household recruitment location Once the form is complete the study instruments should be stored in an access restricted data storage room after removing the identifier information as the unique ID is the variable which relates with all study instruments 61 Scientists should hand over questionnaires field forms to the data entry operators A log of what was handed to the data entry team must be independently maintained and verified against what is handed back after data entry Data is entered into the MS Access database Microsoft Corp Inc designed to accommodate the data analyses requirements for the TAPHE study The relational database architecture allows various tables in the database to be connected through the unique ID The second level data quality check is done at this stage on a half yearly basis wherein simple frequencies are taken to find out artifacts These artifacts are then checked with the data forms for data entry errors The database is then ready for statistical analysis For PFT data attention to equipment quality control and calibration is an important part of good laboratory practice At a minimum the requirements are as follows 1 Alog of calibration results should be maintained 2 Documentation of repairs and or other alterations which return the equipment to acceptable opera
19. NOT give out medicine or medical advice to the families Instead enumerators should advice the family and child s primary caretaker to seek medical attention for the sick child Enumerators should suggest the family seek medical advice whenever encountering a sick child 11 Did any other family member suffer from respiratory infection prior to current episode of the child Ask the question to the mother and encircle the appropriate response Section D Treatment history for sick child 1 Did you seek medical advice This should be asked if any of the symptoms in the child health calendar is present Encircle the appropriate response 2 What type of medical advice did you seek If Yes was the answer for the previous question this question should be asked and answer should be appropriately encircled Section E Breast feeding Vaccination Weaning details 1 Breast feeding Ask the mother whether she is still breast feeding the child If the answer is Yes skip Q 1a and go to question no 2 If No was the answer ask her how many months she did so and fill response 2 Bottle fed Ask the mother whether she is giving any bottle feed to the child and encircle the appropriate response 3 Weaning food introduced If Yes was the answer then further ask when was it introduce If No go to vaccination question 4 Vaccinated Ask the mother whether child is appropriately vaccinated for the age a
20. Steps involved in collection and determination of indoor PAHs 4 Tool box meeting A 10 15min tool box meeting is conducted every day to plan field activities and logistics Based on sampling requirement select the areas i e rural and or urban for sampling and assign field teams Contact participants and get their consent to place samplers in kitchen during cooking duration Enter details about sampling date location number of field teams and logistics information in the tool box meeting data sheet everyday see data form TB 1 for tool box meeting info sheet 5 Laboratory activities Several steps are grouped under laboratory activities that include resin preparation filter coating sampler calibration extraction after field sampling and analysis Each of these steps is explained in detail in the subsequent sections 5 1 MATERIALS REQUIRED i XAD 4 resin ii 37 tissue quartz filters Pall filters ii 37mm 3piece filter cassettes iv 37mm cellulose support pads v A Alundum thimble Height 830mm O D 25mm Dense Beakers 500ml 150ml 100ml 50ml vii Measuring cylinders 500ml 100ml viii Glass bowl 150ml ix Pear shaped flasks 50ml x 47mm FHUP filters Millipore 0 5p pore size xi Micro syringes 10 50 100 250ul xii Standard measuring flasks 25 10 5ml xiii Bent forceps xiv Nitrile gloves xv Glass rod xvi Plastic Tray xvii Soap solution xviii Aluminum foil 5 2 CHEMICALS AND REAGENTS RE
21. a fresh and pre weighed filter paper in the laboratory while doing filter weighing and close it Process it and analyze as like a field sample to ascertain any contamination in the laboratory e Field Blank FB Keep open a fresh and pre weighed filter paper in the field Process it and analyze as like a field sample e Material Blank MB Take a fresh MCE filter Digest and analyze it as like the sample to check for any traces in the filter paper e Solvent Blank SB Digest the acid directly without filter paper and analyze as per the sample to check the traces in acid e Sample Recovery Spike a known concentration of ICP mixed standard in the filter paper and analyze it to check the instrument recovery References 1 NIOSH 7301 March 2003 Manual of analytical methods NMAM 4 ed trace elements by ICP aqua regia ashing 2 T Murphy National Bureau of Standards Special Publication 422 Accuracy in Trace Analysis Sampling Sample Handling and Analysis Proceedings of the 7th IMR Symposium 3 P E Rasmussen R Dugandzic N Hassan J Murimboh and D C Gregoire Challeges in quantifying airborne metal concentrations in residential environments Canadian Journal of Analytical Sciences and Spectroscopy Vol 56 No 9 2006 4 ICP analysis of metal metalloid particulates from solder operations Division of Physical Measurement and Inorganic Analyses OSHA Technical Centre Salt lake City Utah STANDARD OPERATING PROCED
22. anti clockwise to increase the flow k Takethe beaker to the mouth ofthe burette so that a single soap film layer is created in the burette Do not keep the beaker near the mouth for longer duration to avoid multiple film layers Calculate the flow rate using the formula Flow rate L min V 60 1000 S Where V Volume crossed by soap solution ml S time taken for soap solution s 8 Field Activities Field activities comprises of air sampler placement retrieval and questionnaire administration to collect information sources of VOC and smoking see data form AIR TOXICS 1 for questionnaire Carry relevant data forms equipment s and questionnaires before arriving at field sites Identify areas where a minimum of three households have 112 given consent for placing the samplers and arrange the logistics accordingly to these areas in the tool box meeting 8 1 Indoor VOCs sampling Transport conditioned tubes to field stored in self sealed bags in a cooler b Atthe sampling site remove the tube from the bags and unplug caps and attach outlet of the tube to the pump and keep inlet open to the air use the side with marking as the inlet c Placethe pump inside a bag with sampling tube hanging outside of it d Setthe pump at 1m distance from the combustion source and at an height of 1 5m from the center of the kitchen floor e Donot place the pumps near to walls or behind doors f Set the pump run time to 100min
23. by an experienced personnel to maintain consistency in operations and minimize bias introduced due to inter person variation Each of these steps are explained in detail in the following sections 5 1 Sampler calibration Data Form EXP 1 and EXP 2 Calibrate all air samplers before and after of each field sampling day and enter the calibration data along with information on date sampler ID and flow rate in calibration sheets Use Data Form EXP 1 for calibration data sheets Calibration can be performed using either primary ie soap bubble meter and or secondary ie rotameter calibration devices Given that the soap bubble meter is fragile and sensitive to shock it would be difficult to use this device in the field Since rotameters are simple and easy to carry they are preferred over soap bubble meters for use in the field However rotameters has to be calibrated in the laboratory using the soap bubble meter prior to using it for calibrating air samplers In the following sections calibration of rotameter and air samplers using both primary ie soap bubble meter and secondary i e rotameter devices are described 65 5 1 1 MATERIALS REQUIRED og Air sampler SKC 224 PCXR8 SKC pump charger 1000ml inverted standard glass burette frictionless Burette stand with clamp BGI triplex cyclone with calibration chamber Rotameter Matheson TriGas Beaker 100ml Soap solution diluted Standard calibrated Sto
24. by combining three different entities They are 1 the type of cohort 2 location of cohort and 3 serial number of the cohort participant enrolled in a particular village city The first character is a text which is either M or A denote the type of cohort M for mother child and A for adult cohorts The next 8 digits represent the location of the cohort of which the first two characters are texts which denote either R for rural and U for urban and K for Kancheepuram district or T for Thiruvellore district or C for Chennai district The next six digits of the location component are written in Arabic numeral which identify the village zone and the household The last digit of the unique 11 ID represents the serial number of the participant of that particular location For e g M R K 001 001 1 means it is a mother child cohort from the rural area of Kancheepuram district with a village ID 001 and household ID 001 and she is the first person recruited from the household 6 Collection of maternal antenatal health data Data Form MC 3 This is performed by administering the ANC questionnaire Data Form MC 3 to the participant at the household This questionnaire has two sections for collection of 1 basic data pertaining to personal marital medical and obstetric history of the participant and 2 available antenatal care data from the ANC card available either with the participant or the PHC UHP
25. e 2 15 100 9 Data quality and data management study instruments used in TAPHE study are developed by CAR research team based on the experience in previous air quality and health related projects through consultation with various independent and project review committee experts and through relevant modifications in standardized instruments used in other national and international studies These instruments have been piloted and validated before routine administration in the field 32 The question structure is therefore critical in maintaining consistency across responses elicited from the participants by the field staff Do not modify or change the question even if you feel the responses can be better elicited by changing the format of the question Do not change the sequence of questions while administration Ask every question Some questions are needed for internal consistency checks and may seem redundant Do not use any personal discretion while administering the questionnaire Use AS IS Data quality Two levels of data quality check are done one immediately after the data collection and the second after the data entry At the first level the collected information should be verified by the scientists on a weekly basis and if any data collection errors are suspected these fields should be appropriately tagged Information should be communicated to the field team so that missing or erroneous data may be collected duri
26. for sampler placement and mobilize logistics accordingly Identify the location for sampler installation look for sampler siting criteria below at least one day before installation Bring 2 to 3 personnel to assist in shifting the sampler from transport vehicle to installation site Obtain consent from household personnel before deploying the sampler in their terrace or roof Follow the instructions to install and set up the operation of the sampler in the field a b Install the sampler 2 15m above ground and 2m away from any structures Ensure the sampler is at least gt 20 m away from trees and there is unrestricted airflow 270 degrees around the sampler inlet C d e Assemble the stand see section 2 8 and secure the sampler to the stand Connect to a power source Turn the sampler ON and ensure it is stop mode If the sampler is not in the stop mode press the lt RUN STOP gt key in the main screen to enter the stop mode Install two pre weighed 47mm Teflon filters coarse and fine into filter exchange mechanism and lock them as shown in Figure 4 and 5 See TAPHE EXP PM SOP for filter conditioning and weighing instructions Press F5 Setup to access the setup screen Confirm that the correct time date and set flow rates are displayed on the setup screen Set flow rate to sampler default values i e main inlet 16 7 L min split into coarse 1 67L min and fine 15 0 L min Set sampling duration to 72
27. is written there without truncating and with the correct unit of measurements Usually birth weights are recorded in kilograms with two or three decimal points If it is written in grams please write down as such don t convert it to kilograms The scientist at the lab would do the conversion Birth length amp APGAR Score 5 mints Item nos 5 amp 6 Note down from the discharge summary If the information is not available please write down as 99 Don t leave the field blank Birth defect If it is mentioned in the discharge summary mark that as Yes in the questionnaire and write down the name of the birth defect as mentioned there Was cord blood sample taken for genetic analysis This is being collected in a small subset of our study participants Hence if it is collected encircle option Yes This information has to be elicited from the participant and has to be verified with our records Was the baby kept in NICU If the baby was kept in Neonatal Intensive Care Unit immediately after delivery it has to be recorded Usually it is recorded in the baby s discharge summary sheet Please note keeping the baby in phototherapy unit is not considered as NICU admission If yes How long the baby was kept in NICU Please note down the number of days of admission into the NICU What was the first feed given to the baby This information is also usually found in the discharge summary If not please ask the mother and encircle th
28. mouth Obstructed mouthpiece due to tongue or teeth in front of the mouthpiece or mouthpiece deformation due to biting End of test criteria Continuous maximal expiratory blow for 26 sec in duration A plateau in the volume time curve i e no change in volume 0 025L for a 1 second period The patient need not continue to exhale 7 5 9 TERMINATION OF TEST Conclude the session after arriving at any of the following circumstances After successfully recording 3 technically correct tracings Even after repeated 6 8 trials the participant is not able to understand and or perform the test properly At any point of time if the participant becomes inconvincibly un cooperative and or hesitant Interferences If erroneous results are obtained check the following Is the filter attached correctly Hasthe pneumotach been calibrated lately 15 pneumotach screen free of debris there any restrictions to the air flow through pneumotach Read Print 60 e Select Read Interpret The screen will show the format which ever report design is currently selected e Select Patient and Test Series e To show the report of a particular test group select Read Interpret File Select Patient and Test Series e Select the desired group and click on OK e To printa report make sure to indicate the settings desired in File Print setup from the Read Interpret Print results screen 8 Data
29. onto the center part of the weighing pan Wait until the displayed digits stabilize and the unit mg appears Note down the weight in the filter weight log book Remove the filter paper from the balance with forceps and place it back in the same petridish and cover the lid 74 Checkthe balance display again without the filter The display should go back to zero and a reading of 0 001mg is acceptable Record three weights for each filter Accept if the variations of two measurements are within 5 ug otherwise measure the filter a third time and accept the closest two of the three measurements Once weights are taken place the filter inside the filter cassette see Figure 6 Ensure that the support pad is loaded in the filter cassette before placing the filters For every 10 to 15 filters weigh a randomly selected filter to ensure the weights have not deviated by 0 005 mg If it has deviated above this range then check the room condition re calibrate the balance and re do the weighing of the previous 10 15 filters Pre and post weights of the filters should be weighed in the same balance and by the same person Make sure the filter log weights book is completely filled with all information like filter batch number and type filter ID date of pre and post weights room condition blank weights and any other info as necessary Switch off the weighing balance by pressing ON OFF button and finally switch off the
30. personnel and document any repair undertaken e out chain of custody forms every time filters are received or handed over to the field team f Ensure precision and accuracy of the balance is checked periodically following quality control procedures see QC section and document 5 3 2 UALITY CONTROL Follow the steps described below to comply with QC aspects for filter weights Internal calibration The micro balance comes with a built in internal calibration option Perform internal calibration check during each filter weighing session Calibration should be done with empty pan only Allow the balance to stabilize for 15 min and press CAL button Balance displays 0 0000mg and is now ready for taking sample filter weights 76 Calibration using certified mass standard Record the mass of standard weights provided by the balance manufacturer every day for five days in triplicate and record the weights in the log book If the mean weights of the standards differ from the certified value by more than 20 ug primary standards should be verified Check the weights of certified standard weights periodically to check if the response of the microbalance has shifted over time Laboratory blank Use a lab blank during filter weighing session and store in desiccator in the filter room A weight difference of lt 15ug between different days is acceptable If the weight deviates then check the room condition auto calibrate the balance
31. quality and data management All study instruments used in TAPHE study are developed by CAR research team based on the experience in previous air quality and health related projects through consultation with various independent and project review committee experts and through relevant modifications in standardized instruments used in other national and international studies These instruments have been piloted and validated before routine administration in the field The question structure is therefore critical in maintaining consistency across responses elicited from the participants by the field staff Do not modify or change the question even if you feel the responses can be better elicited by changing the format of the question Do not change the sequence of questions while administration Ask every question Some questions are needed for internal consistency checks and may seem redundant Do not use any personal discretion while administering the questionnaire Use AS IS The printed hard copies PFT reports should be sent to chest physician for interpretation and approval The hard copies are then filed in a secured storage area Two levels of data quality check are done one immediately after the data collection and the second after the data entry At the first level the collected information should be verified by the scientists on a weekly basis and if any data collection errors are suspected these fields should be appropriately tagged
32. quartz wool pack 25mg of Carbopack Cap the packed media using quartz wool followed by stainless steel 60 80 mesh Finally place the retaining spring as a spill protector at the end Condition the packed stainless tubes in the thermal desorption unit at 200 C with continuous helium gas purge at a flow rate of 20ml min for 5 min to ensure removal of air pockets and also to desorb any bound compounds from the sorbent media Close the tube on both sides tightly using teflon caps Store packed tubes in a clean self sealing cover until field sampling Use the tubes for sampling within 24 hours of conditioning in the lab 111 7 Air sampler calibration Thoroughly wash the standard glass burette in and out with water b Fixthe washed burette in the burette stand c Keep diluted soap solution in the beaker and place it under the burette d Attach low flow holder to the sampler e Adjustthe inner screw of the sampler in anti clockwise direction until maximum to convert it to low flow f Plug outlet ofthe stainless tube used for calibration purpose only into low flow holder and connect the tube inlet to the soap bubble meter g Make sure the entire assembly is placed vertically h Wetthe inner side of the burette wall with soap solution i Turnthe air sampler on and set the flow rate to 0 1L min by using the knobs as shown in manual ofthe air sampler j Adjust the screw on the low flow holder clock wise to decrease the flow and
33. regression model review the explanatory variables and their anticipated direction of effect on pollutant concentrations such as positive associations of pollution levels with variables that represent emission sources e g traffic density negative associations with variables representing distance from or absence of emission sources e g areas of semi natural vegetation or the effectiveness of dispersion mixing processes e g altitude windspeed Use GIS to extract predictor variables for the zones of influence around each monitoring site such as using focal functions to sum each predictor variable for the appropriate neighborhood of cells e g ArcINFO focalsum with circle option ArcGIS focal statistics with sum and circle option This will create a new raster for each predictor variable listed in step 2 allow extraction of the values from each raster to the monitoring sites e g ArcGIS Extract Value to Points Export the monitoring data and extracted predictor variables from GIS and import into the statistical package Develop the LUR model using linear regression applying logical criteria to ensure that the resulting model is interpretable and robustby choosing appropriate explanatory variables and zones of influence to reflect the processes involved and the rigorous application of constraints on the regression model such as the 10 11 12 sign for each coefficient in the model conforming to the expected direction
34. report in meters convert into feet 16 Specify the type of location of your work place If participant is not able to classify assist the participant by giving examples such as an area having only households being residential area with multiple shops and services being commercial and area having one or more industries being industrial 17 What kind of vehicles ply most of the time on the road outside your work place Multiple answers allowed based on the highest type of vehicle the category will be determined later Ask the participant by listing the vehicle type and number and mark appropriate answer 18 How would you rate the vehicular traffic outside your work place Ask the participant about the opinion of the vehicular traffic outside their workplace using their own judgment and mark the appropriate Outdoor air Pollution Sources Industrial Air pollution 1 Are there any dust fumes vapor generating industry in your area causing pollution Interviewer has to use own judgment to locate any dust fumes vapor generating industry in the vicinity of the household and mark the appropriate answer If answer is 2 or 99 Skip the following questions and directly go to the next section 2 Specify type of industry Causing pollution 85 Ask the participant if any of mentioned industries are located in their neighbourhood If it is different from the mentioned types note down the same If they don t know th
35. request her him to provide a reason and encircle the appropriate answer from the list provided in the questionnaire For participants who are eligible and willing proceed to secrure informed consent 39 5 Obtaining informed consent from eligible participants at the household Data Form AC 2 5 1 Steps for securing informed consent 1 Provide a consent form Data Form AC 2 to the participant and request her him to get their doubts clarified if any once they read it 2 If he she cannot read read it for her him and make her him understand the content of the consent form in the presence of another household member who can read Tamil 3 Getthe signature of the participant with full name and date after the participant has understood her his role in the study and voluntarily consents to be a participant in the study 4 Obtain a witness signature from the participant s relative or another field staff member with full name and date 5 Complete the interviewer s statement and sign it with name and date 6 Give the participant a copy of the signed consent form 5 2 Assigning a participant ID All enrolled participants are assigned with a TAPHE unique identifying number to link all data fields pertaining to the participant and or household The assignment of unique ID is done in the laboratory after securing the informed consent Unique ID This is assigned at the lab This is a 10 character alpha numeric cod
36. same coating steps until all 75 filters are coated xxii xxiii xxiv xxvi xxvii xxviii To coat the filters for the second time use the second slurry and sonicate it for 5min before beginning to coat Starting with filter number 75 i e in reverse order coat all filters by dipping in resin slurry 10 times Coat all the filters in the same way and keep track of the order in which filters were coated After completing the second coating step allow the filters to dry in the hood Rinse the coated filters by dipping each filter 10 times in 100ml n hexane solution to remove excess resin from the filters Repeat this step in reverse order with a fresh n hexane solvent Allow the coated filters to dry in the fume hood Store the coated filters in clean amber glass jars at room temperature Label the jar with the date of coating Place the coated filter with rough side up on top of support pad in a three piece 37mm filter cassettes and transport it to field for sampling 6 Sampling procedure and storage iii iv vi vii viii Set the SKC air samplers to a flow rate of 2 0 L min and calibrate using soap bubble meter see TAPHE EXPOSURE PM for air sampler calibration procedure Attach three filter cassettes sampling train separated by leuer adapters to SKC air sampler pumps Set the sampling time in the pump to 100 min to cover the cooking duration Place the pumps at the distance of 1 m fr
37. standardized PCR conditions Steps Temperature Time Initial Denaturation 95 5 min Denaturation 95 60 sec Annealing 579C 45 sec Extension 72 60 sec Repeated for 30 cycles Final extension 729C 10 min Hold at 4 C 4 Analysis of PCR amplicons The PCR ampliconsare electrophoresed in 296 agarose with 1X TAE buffer at 4V cm The PCR ampliconsare identified at 340bp with the help of 100 bp molecular weight marker PCR RFLP Purification of PCR ampliconsis performed by re precipitation with ethanol The purified PCR product is subjected to restriction digestion with Msp1 enzyme A 20 ul reaction is set up with 10 ul of the PCR amplicon 10X buffer 2U of Msp1 enzyme 10U ul B Genei The reaction mix is incubated at 37 for 1 hour Analysis of restricted products by Agarose gel electrophoresis PCR RFLP enabled identification of the genotypes based on the restriction pattern and a summary of the sizes of the digested products is depicted in figure 5 3 The samples are subjected to electrophoresis on 396 agarose gel at 4 Volts cm and the gel is documented to identify the genotypes based on the band pattern Figure 5 4 Sequencing of representative samples is done to confirm the PCR RFLP results 5 samples for each genotype Fig 5 3 Diagrammatic representation of the Msp1 restriction site created by the T to C substitution in the 3 UTR of CYP1A1gene and the size of the
38. than 10 years tell the respondent that she he is not eligible for the study 38 8 Pregnancy status If the respondent is a woman and she is currently pregnant or not sure about her pregnancy status tell her that she is not eligible for the study 9 Questions from 9 to 11 If the respondent had experienced any ofthe events mentioned in these questions tell the respondent that she he is not eligible for the study 10 Taking treatment for pulmonary tuberculosis If the respondent is taking treatment for pulmonary tuberculosis tell the respondent that she he is not eligible for the study 11 Smoking status If the respondent is current or past smoker of cigarette or beedi tell the respondent that she he is not eligible for the study 12 Dusty occupation Ask the respondent whether she he is engaged in a dusty occupation If the answer is yes tell the respondent that she he is not eligible for the study For respondents who are not eligible thank them for their time and answer any questions they may have regarding their eligibility If the respondent is eligible based on responses to questions from 6 to 15 ask her him if she he is interested in being a study participant and sign an informed consent If she he is eligible and willing to participate encircle the option INCLUDE if not eligible encircle EXCLUDE and if eligible but not willing encircle NOT WILLING If she he is not willing
39. the ATS pulmonary function laboratory management manual 7 e Assemble the components according to the manufacturer s instructions i e tubing connectors flow sensors valves and adapters e Turn on the system to ensure adequate warm up refer to manufacturer s guidelines Allow time for equilibration to room temperature for portable systems for field level investigations e Perform a validation check calibration e Perform spirometry only at temperatures recommended by the equipment manufacturers e Document the environmental data from an accurate source representative of the laboratory prior to calibration 7 5 2 INFECTION CONTROL The aim of infection control is to provide a better understanding of infections and their modes of transmission to the staff and the participants It is also important in maintaining a safe working environment for staff and participants to help prevent disease transmission during pulmonary function testing ATS ERS guidelines define direct and indirect contact with respect to pulmonary function testing and transmission of pathogens as follows Direct contact From person to person There is potential for transmission of upper respiratory tract disease enteric infections and blood borne infections through direct contact Although hepatitis and HIV transmission are unlikely via saliva disease transmission is a possibility when there are open sores on the oral mucosa bleeding gums or haemoptysis The m
40. trees and plants Ask the participant and mark the appropriate response L Details about kitchen Draw a detailed sketch of the living and kitchen area only Using the symbols above mark the location of doors windows and the equipment 2 Type of the kitchen enter the code Write an appropriate code using above diagram Measure in kitchen in meters 3 Length 4 Width 5 Height 1 6 Height 2 Ventilation in kitchen If kitchen type is 2 or 5 then no need to enter this section 7 Entrance with door s Mark the appropriate answer 8 Number of door s If previous answer is YES then write the appropriate 9 Window s with door s Mark the appropriate answer 92 10 Number of door s If previous answer is YES then write the appropriate 11 Eve ventilators Mark the appropriate answer 12 Perforated ventilation jolly Mark the appropriate answer 13 Doors Measure the length and width of door 14 Windows Measure the length and width of window 15 Eves Measure the length width and height of Eve s Observe in kitchen 16 Number of walls Write the number of walls present in kitchen 17 Wall material Mark the appropriate answer 18 Roof material Mark the appropriate answer 19 Floor material Mark the appropriate answer 20 Whether the door is open while placing the sampler Mark the appropriate answer 21 Whether the window is open while placing the sampler Mark the app
41. 276 000 0 050 0 1000 35 0 70 0 70 278 000 226 000 0 050 0 1000 40 0 70 0 70 9 Calculations and reporting Calibration calculations i After analysis of the standards integrate the characteristic ion s peak area for each calibration compound and internal standard at the expected retention time ii Plot the response area ratio Rsp on y axis versus the amount of the analyte in ppb on x axis to generate calibration curves for each of the 17 PAH compound Where Rsp A i A is A i area of compound i and A is area of internal standard And Amt i C i C is C i concentration of compound i in the calibration standard C is concentration of compound in the IS An example for a calibration curve i Linear least squares fit calculation ii Obtain the linear least squares fit from the calibration curves iii For each PAH i the linear least squares fit can be expressed in the following form Rsp i m i x Amt i b i where m i slope of linear equation for PAH i b i intercept at the y axis iv PAH concentration calculation Calculate the concentration of each PAH compound in ng uL Cs ng uL amt i in ppb 1000 Calculate the concentration of each PAH compound in ng m3 C ng m3 Cs Ve Vs Ve final volume of extract in uL Vs volume of air sample in m3 v Recovery efficiency calculation The recovery efficiency can be calculated by comparing the original spiking PAH
42. 3 weeks ago and ended 2 days ago D Started 12 days ago and lasted for 3 days Symptom went away for 5 days but returned 4 days ago and child still has symptom E Started 4 days ago and the child still has the symptom An X was mistakenly recorded on day 5 and is crossed out using a single diagonal line across the box Repeat steps 1 4 for each symptom on the calendar Collect all the information on a symptom before proceeding to the next symptom IF CHILD HAS HAD CONSTANT COUGH YES IN Q 2 Q 8 Measure breathing rates ONLY for children who CURRENTLY have a cough or difficulty breathing If the child has clothing that covers his or her chest and stomach ask the caregiver to remove the clothing or pull up the clothing so that you can see the child torso to measure breathing If the child is crying or visibly upset DO NOT record the breathing measurement Only record a breathing measurement when the child is 29 calm and in a resting state If the child does not calm down for the measurement mark 99 in the answer space If the child calms down later in the interview then return to the question and measure the breathing rate and cross out the 99 To measure the breathing rate first reset your stopwatch timer Make sure you have a clear view of the child s chest Start the timer and count the rises of the chest for 30 seconds If you observe FEWER than 30 breaths over 30 seconds record the measurement in the answe
43. 50 C for up to 2 h or until the resin in completely dry Weigh the thimble and if the balance does not stabilize dry the thimbles in the oven to expel excess solvent from the resin Transfer the dried resins into a clean flask and store it in a dark place at room temperature Place the tissue quartz filters in crucibles and bake it at 700 800 C for 4h in a muffle furnace Transfer the baked filters into a clean amber glass container and close the lid tightly to avoid any contact with ambient air Weigh 1 8g purified resin into a clean 500ml beaker to coat 75 filters Add 275ml n hexane into the resin beaker and sonicate the mixture for 30min in a fume hood Allow the slurry to settle for 10 seconds and decant about 7596 of the slurry into a clean 250ml beaker optimized slurry Sonicate the optimized slurry for approx 5min and then divide the slurry equally into two clean 200ml glass beakers by transferring 30mL aliquots alternatively into each beaker until the slurry is divided equally Cover the two beakers containing the slurry and label them Take the first slurry beaker and sonicate it for 1 2min before starting to coat the filters Arrange the baked filters on a clean aluminum foil in rows of 10 Start coating with the first filter from the first row by dipping the filter the ten times into the beaker containing the resin slurry Place the first coated filter with rough side facing up and move onto the next filter Follow the
44. 52 000 0 050 178 000 176 000 0 050 Segment 5 Chrome Filter Not used Q2 Gas pressure 1 0 Time 0 1000 0 1000 0 1000 0 1000 0 1000 CE 15 15 15 15 15 Q1 PW 0 70 0 70 0 70 0 70 0 70 Q2 Gas pressure 1 0 Time 0 1000 0 1000 CE 30 15 Q1PW 0 70 0 70 Q2 Gas pressure 1 0 Time 0 1000 0 1000 CE 15 30 Q1PW 0 70 0 70 Q2 Gas pressure 1 0 Q3 PW 0 70 0 70 0 70 0 70 0 70 Q3 PW 0 70 0 70 Q3 PW 0 70 0 70 Scan Events 1 c SRM Micro scans 1 Parent Center 202 000 200 000 202 000 201 000 Segment 6 Chrome Filter Not used Scan Events 1 c SRM Micro scans 1 Parent Center 228 000 202 000 228 000 226 000 Segment 7 Chrome Filter Not used Scan Events 1 c SRM Micro scans 1 Parent Center 252 121 226 000 252 121 250 000 Segment 8 Chrome Filter Not used Scan Events 1 c SRM Micro scans 1 Parent Center 276 000 250 000 Width 0 050 0 050 Width 0 050 0 050 Width 0 050 0 050 Width 0 050 Time CE Q1 PW 0 1000 15 0 70 0 1000 15 0 70 Q2 Gas pressure 1 0 Time CE Q1 PW 0 1000 15 0 70 0 1000 15 0 70 Q2 Gas pressure 1 0 Time CE Q1 PW 0 1000 30 0 70 0 1000 30 0 70 Q2 Gas pressure 1 0 Time CE Q1 PW 0 1000 40 0 70 Q3 PW 0 70 0 70 Q3 PW 0 70 0 70 Q3 PW 0 70 0 70 Q3 PW 0 70 276 000 274 000 0 050 0 1000 35 0 70 0 70 278 000
45. 96 010b 1999 Compendium of Methods for the Determination of Toxic Organic Compounds in Ambient Air Second Edition Compendium Method TO 17 Determination of Volatile Organic Compounds in Ambient Air Using Active Sampling onto Sorbent Tubes 2 EPA 600 B 07 001 2007 Guidance for Preparing Standard Operating Procedures SOPs EPA QA G 6 115 STANDARD OPERATING PROCEDURE FOR SAMPLING AND ANALYSIS OF GASEOUS CONTAMINANTS NOx NOz SO and IN HOUSEHOLD AND AMBIENT ENVIRONMENTS TAPHE EXPOSURE STUDY ICMR CAR PROJECT DEPARTMENT OF ENVIRONMENTAL HEALTH ENGINEERING ICMR CENTER FOR ADVANCED RESEARCH ON ENVIRONMENTAL HEALTH AIR POLLUTION SRI RAMACHANDRA UNIVERSITY CHENNAI TAMIL NADU SOP ID 2 6 TAPHE EXPOSURE GASES Date of issue 15 February 2011 Date of last review 5 January 2015 Prepared by Reviewed by Approved by Dr Naveen Puttaswamy Dr Sankar Sambandam Dr Kalpana Balakrishnan Mr Rengaraj Siva Ms Gayathri Natarajan Mr Sathish Madhavan Dr Krishnendu Mukhopadhyay 116 1 Purpose This document provides instructions for preparing and sampling of NOx NOz SO and by passive samplers developed and supplied by Ogawa amp Co FL and USA www ogawausa com protocols Liu et al 1994 2 Scope and Applicability The passive samplers collect individual gaseous contaminants i e NOx NO2 502 and O3 on specific pre coated filters in both indoor and ambient environments These passive monitors do not req
46. ATORY SYMPTOMS AND ASSESSMENT OF LUNG FUNCTION IN ADULT MEN AND WOMEN TAPHE Adult Respiratory Health Study ICMR CAR PROJECT DEPARTMENT OF ENVIRONMENTAL HEALTH ENGINEERING ICMR CENTER FOR ADVANCED RESEARCH ON ENVIRONMENTAL HEALTH AIR POLLUTION SRI RAMACHANDRA UNIVERSITY CHENNAI TN SOP ID 2 2 TAPHE Adult Respiratory Health Date of issue 15 April 2010 Date of last review 19 November 2014 Prepared by Reviewed by Approved by Mrs Saraswathy Mr Rajkumar Paramasivan Dr Ashutosh Aggarwal Manivannan Dr Gurusamy Thangavel Dr Kalpana Balakrishnan Mr Durairaj Natesan Dr Priscilla Johnson 35 1 Purpose and scope This document provides instructions to research personnel involved in the ICMR CAR project for collecting health data pertinent to the Tamil Nadu Air Pollution and Health Effects Adult Respiratory Health Study TAPHE Adult Respiratory Health Study It includes details for i screening women and men at the household to assess eligibility for enrollment in the adult cohort ii seeking informed consent iii collecting data on chronic respiratory symptoms and iv assessing lung function in eligible women and men 2 Summary of the method The SOP covers 5 sequential steps Figure 1 that includes i assigning field tasks for health teams at tool box meetings using the Tool Box Information Sheet ii screening women and men at the household using Data Form AC 1 iii assessment of eligibility iv securing written i
47. Contents STANDARD OPERATING PROCEDURES FOR SCREENING RECRUITMENT OF PREGNANT MOTHERS AND COLLECTION OF MATERNAL HEALTH BIRTH OUTCOME AND CHILD HEALTH ARI DATA eere 6 1 Purpose and AM 7 2 Summary of the method ii tccsssticassstutarcccacsantustnescneciusniediivenssnieuntaceeaaiadandatieastadenucantanntecatuanen 7 3 Fool BOX iissa nU EOD DUEB UR RE 8 4 Screening for eligibility at primary health care centres PHC urban health posts UHP Data Form 1 cana ccr aci 8 5 Obtaining informed consent from eligible mothers at the household Data Form MG 2 e 11 6 Collection of maternal antenatal health data Data Form MC 3 12 7 Collection of Birth Outcome Data Data form MC 4 ses 17 8 Collection of ARI Data Data Form MC 5 nnt tn nnn 19 9 Data quality and data management esses seen enatntna nte tn nnn 32 TC 34 STANDARD OPERATING PROCEDURES FOR ASSESSING CHRONIC RESPIRATORY SYMPTOMS AND ASSESSMENT OF LUNG FUNCTION IN ADULT MEN AND WOMEN c inr van DURO LA cana UAE LAN LR GR 35 1 Purpose SCOPE T 36 2 Summary of the mel
48. GEN DNA isolation kit About 20ul of QIAGEN protease is taken into a 1 5ml microcentrifuge tube Peripheral blood samples are added into the tube and mixed well Then 200ul of AL buffer is added to the sample and vortexed for 15 seconds and incubated at 56 C for 10 minutes Then 200ul of absolute alcohol is added and the entire contents are transferred into the QIAamp spin column spun at 8000rpm for 1 minute The column is then changed to a clean collection tube 500ul of AW1 buffer is added and spun at 8000rpm for 1 minute The column is again changed to a new collection tube and 500ul of AW2 buffer is added spun at 8000rpm for 3 minutes Finally the DNA is eluted into a sterile microfuge tube by adding 200ul of AE buffer and spun at 8000rpm for 1 minute Fig 5 1 Genomic DNA Isolates from Blood samples 3 Single Nucleotide Polymorphism analysis Polymorphisms in Xenobiotic metabolism genes The human body has endogenous free radical scavenging systems including phase I enzymes of cytochrome P 450 CYP450 family and phase II enzymes of glutathione S transferase GST family which play a central role in the detoxification of toxic and carcinogenic electrophiles Phase I metabolism Phase I metabolism is composed mainly of the CYP450 supergene family of enzymes and is generally the first enzymatic defense against foreign compounds In a typical phase I reaction CYPP450 uses oxygen and NADH as a cofactor to add a reactive group such a
49. PHE adult respiratory study uses the questions to only estimate the prevalence of chronic respiratory symptoms in relation air pollution exposures The study does aim to estimate the prevalence of the disease conditions The questionnaire has been validated on individuals of both gender aged above 15 years irrespective of whether they are from rural or urban locations through direct administration to the participant Occasionally other members of the household provide information on the age date of birth of the participant It is available in Tamil Since the eligibility criteria for TAPHE Adult Respiratory Health Study excludes smokers the detailed section on smoking has been excluded from the original INSEARCH questionnaire Therefore the modified questionnaire consists of four components 1 demographic and identification details 2 respiratory symptoms 3 atopy and family history and 4 Environmental tobacco smoke exposure 6 1 Instructions for filling up the Data Form AC INSEARCH 3 General Information 1 Unique ID The unique ten digits ID given to each participant should be entered 2 Date Of Survey Record the date of interview in lt dd mm yyyy gt format 3 Name Of The Interviewer Enter the full name of the interviewer 4 Address 41 Note the complete postal address of the respondent Phone Number Note the contact mobile telephone number Name Note the full name of the respondent Date Of Birth R
50. PUFDOSQu io cas a V A EC RU 109 2 Scope and Applicablility cies ranis d ipi eT 109 Fe sumtidry OF MENGE ea ona decina ditior dan eouekdaia tirocinio anaana aada eiaa 109 BOX THOCLUIDSB dor race bl fa Grief A CE n RC M vinee ds 110 5 Laboratory activities caesis innisaciitienr sy nin a acd Sica cA E Y EER Ra SEd an Rd LUE LUE 110 6 Sorbent tube conditioning and preparation eene 111 7 Air sampler calibration nei cuan adn ka cu nna C a n FAS a E LR d anann 112 8 Field ACUVIUGS Tu RE DLE Ra re ui i dao 112 9 Analysis of VOUS aedilis ie Falc NP LOMA Hed fate 114 I0 RE BG PO INCE sae uiros ida viewer a aa eset dete daaraan doe Loi e xu 1143 STANDARD OPERATING PROCEDURE FOR SAMPLING AND ANALYSIS OF GASEOUS CONTAMINANTS NOx NOz2 SO and IN HOUSEHOLD AND AMBIENT ENVIRONMENTS ini Ecc doc Po 116 o PAAA eE EAEE de dunno dd in eb a A tod A nd E c diese 117 2 Scope and non cre dn c cs d C BE 117 3 Summary OF Methods orate icis c RR ln n Ex C A I n anann 117 4 Equipment and supplies S CA CR 118 6 Sampling siacucususcaeiesvndi Sueded 122 7 Disassembly of the sampler
51. Press F4 Run Stop gt to enter the Stop Mode before exchanging filter cassettes or retrieving data on the sampling run iii Remove sampled filters from the filter exchange mechanism and transport to the lab stored in filter cassettes iv See TAPHE EXP PM SOP for filter conditioning and weighing instructions v NOTE Always use antistatic filter transport container when moving the filter and carrier to and from the sampling site 7 Field QC procedure A field calibration check must be performed at least once per month to track samplers flow stability Follow the flow calibration steps given in section 2 9 Enter the flow check information in sampler log book and calculate the 96 deviation from the standard flow rate If the deviation is more than 1096 of the manufacturer set default flow rate then seek technical service help from the manufacturer to check the sampler calibration and to set it to default value In addition use one field blank 105 per sampling cycle to determine contamination of filters while handling and or transportation 8 Calculations The PM25 concentration is calculated as For Fine PM Mr C Vr For coarse PM C Cr Vt Vt For PM 10 Cr Cp Cc Where C Mass ug m3 of fine particle fraction C Mass conc ug m of Coarse particle fraction C Mass conc ug m3 of PM 10 Mr Mass ug collected of fine particle fraction filter Mc Mass ug collected of coarse particle fraction
52. QUIRED i Dichloromethane DCM 99 8 purity ii Methanol 99 9 purity iii Hexane 99 0 purity iv Helium carrier gas for GC MS 99 99 purity v Ultra pure Nitrogen gas 99 99 purity and free of PAHs contamination vi Deionized water vii Standard PAH solution 16 Analyte s 500ug mL 500ppm in acetonitrile acetone toluene 6 3 1 Ultra Scientific Analytical Solutions viii Deuterated PAHs a D10 Phenanthrene Supelco b D10 Fluranthene Supelco ix Alcoholic KOH Note Deuterated PAHs are used for recovery and internal standards The purity of these compounds shall be the highest whenever it is possible 5 3 INSTRUMENTS APPARATUS REQUIRED i Gas Chromatography mass spectroscopy Thermo Scientific GC MS MS ii Turbovap II Biotage iii Ball mill grinder Fritsch Planetary Mono Mill iv Muffle furnace Muffle furnace 900 C 3300W Hot air oven vi Sartorious microbalance Model CPA2P F vii Soniccator PCi 6 5L viii Refrigerator ix vacuum pump X Filtration unit 47 mm diameter xi xii xiii xiv XV xvi xvii xviii xix xxi Air sampler SKC 224 PCXR8 Aluminum cyclones SKC Cat No 225 01 02 Calibration Chamber SKC Cat No 225 01 03 1000ml inverted standard glass burette frictionless soap bubble meter Standard calibrated Stop watch Silica crucibles Ice Box Gel Pack Tongs Tygon tube Luer adapters 5 4 RESIN PREPARATION AND FILTER COATING
53. R CAR HH ID No This is a 10 character alpha numeric code which is unique to each participant of the cohort Please write down this ID from the household questionnaire Cooking activities 1 Use key to fill in a number for each stove Ask participant and mark the response Multiple responses are allowed Primary stove The stove that was used for most meals Secondary stove they stove which they used occasionally 2 What stove s Chulha did you use for cooking during the monitoring period Specify the number Ask the participant and mark the response 3 Which stove are you mostly dependant with specify the number Ask the participant and mark the response 4 What is the type of cooking fuel used over the monitoring period in your home tick the appropriate Ask the participant and mark the response 5 Who cooked during monitoring period Ask the participant and mark the response If the response is more than one member write down in others and specify all who cooked 90 6 Number of times cooked per day during the monitoring period Ask the participant and mark the response 7 Cooking Habit Ask the participant and mark the response 8 How much time spent for cooking minutes Ask the participant and write the response 9 How many people cooked for Ask the participant and write the response 10 Was animal fodder prepared Ask the participant and mark the response Other sources of indoor Air Pollution 1 Did yo
54. Set correction box in which select the subtract background Rejected masses and interference equations the click Ok Display the Select reports windows here select the report of which we select in Acquisition mode then click Ok Display the Report option box we can select the style of report summary detailed text only detailed and destination then click Ok Display the Edit analysis parameters box then click Ok Display the Edit calibration Window here click the New Which is located in the bottom of the table window and click the Load Elements list from the current method then click Ok to appear the elements list in table mention the units and levels for selected elements then click Ok To continue Display method save options then click Ok Give the file name which is not more than 8 letters and click Ok e Creation of Sequence e Click on Sequence in menu bar to display the Edit sample log table e Click Edit sample Log Table to display the Edit Sample Log Table method window Here insert the appropriate method which has been created by Method Creation e Then select the Type Analysis Cal standard Key word Quant blank and sample Vial Positions Data file Sample name Comments and dilute Levels then Click Ok and save the sequence 4 3 3 Maintenance of ICPMS Daily Maintenance a b c
55. TI Laboratory NC USA for further analysis and quantification Along with the vials include duly filled Analysis Submission Form or RTI Chain of Custody Form use data form GAS 1A B amp C Figure 4 Inserting filters into shipping or extraction vials 8 Cleaning Disassemble the sampler into its main components a separate the cylinder body with end caps from the pin clip b separate the end caps and stainless steel screens from the body Each of the individual parts must be thoroughly rinsed in separate groups with Milli Q water or Di ionized water and allow to dry on clean paper towel DO NOT USE HEAT Lay out the parts to dry on Kim wipes or laboratory tissue and cover them with Kim wipes or laboratory tissue to keep out dust Cleaning the Sampler Components 8 1 Routine cleaning a Disassemble the samplers and set aside the cylinder bodies with spacer disks and rings still inside to be cleaned separately b Rinsethe end caps with Milli Q water and then set the parts on Kim wipes to dry It may be necessary to tap the water out of the holes in the end caps in order for them to dry completely c Wipethe cylindrical bodies clean with Kimwipes moistened with Milli Q water Then use a dry Kimwipes to wipe off excess water d Placethe stainless screens in a beaker and then rinse them several times with Milli Q water Fill the beaker again with Milli Q and place it in a sonication bath Sonicate the
56. TUDY ICMR CAR PROJECT DEPARTMENT OF ENVIRONMENTAL HEALTH ENGINEERING ICMR CENTER FOR ADVANCED RESEARCH ON ENVIRONMENTAL HEALTH AIR POLLUTION SRI RAMACHANDRA UNIVERSITY CHENNAI TAMIL NADU SOP ID 2 10 TAPHE BIOREPOSITORY Date of issue 15 February 2011 Date of last review January 2015 Prepared by Reviewed by Approved by Mr Srinivasan Dr Vettriselvi Dr Kalpana Balakrishnan Nargunanathan Venkatesan 1 Bio repository creation The bio repository for storing the isolated high molecular weight genomic DNA is currently being maintained in a dedicated 80 C deep freezer The freezer temperature is monitored daily in morning and evening with the temperature recorded in a temperature log form In case of a temperature fluctuation or breakdown of the deep freezer technicians and research scholars of the department are instructed to shift the samples to a backup system available in the genetics department The following steps are performed with the bio repository samples 1 Isolation of high molecular weight genomic DNA from the blood samples 2 Qualitative and quantitative analysis of the DNA samples using standardized procedures 3 Assessment of Purity 260 280 OD ofthe DNA samples 4 Aliquoting DNA samples 5 Genotyping analysis 2 DNA extraction The blood samples are collected in EDTA vacutainers and transferred to microcentrifuge tubes for processing DNA is isolated using the manufacturer s protocol provided with QIA
57. URE FOR SAMPLING AND ANALYSIS OF POLYCYCLIC AROMATIC HYDROCARBONS PAHs IN HOUSEHOLD MICRO ENVIRONMENTS TAPHE EXPOSURE STUDY ICMR CAR PROJECT DEPARTMENT OF ENVIRONMENTAL HEALTH ENGINEERING ICMR CENTER FOR ADVANCED RESEARCH ON ENVIRONMENTAL HEALTH AIR POLLUTION SRI RAMACHANDRA UNIVERSITY CHENNAI TN SOP ID 2 8 TAPHE EXPOSURE PAHs Date of issue 15 February 2011 Date of last review 3 January 2015 Prepared by Reviewed by Approved by Dr Naveen Puttaswamy Dr Krishnendu Dr Kalpana Balakrishnan Mr Sudhakara Rao Saidam Mukhopadhyay Dr Sankar Sambanam 1 Purpose This document provides instructions for sampling extraction and analysis of PAHs collected on XAD 4 coated quartz filters following a modified protocol originally developed by Gundel et al 1995 and Hammond 2002 2 Scope and Applicability This document outlines procedures for XAD 4 resin preperation filter coating with XAD 4 resins field sampling extraction and analysis This SOP is applicable for sampling gaseous and particulate phase PAHs in household micro environments during cooking activity 3 Summary of method This SOP describes procedures for collecting airborne PAHs on XAD resin coated quartz filters emitted during cooking activity in household microenvironments Tool box meeting Laboratory activities Resin preparation Filter coating Sampler calibration Field activities Repeat steps for next sampling cycle Figure 1
58. While the first section is administered once the second section is repeated every trimester to retrieve data from routine antenatal visits Follow general instructions provided below for administering the ANC questionnaire Note Ensure proper privacy to the participant by asking her if she is comfortable responding to the questions at this time The cover page information should be stored securely and separated from the rest of the questionnaire after the first administration as this contains sensitive participant identifying information Remove the cover page before tagging the rest of the questionnaire pages for data entry 6 1 Data Form MC 2 Cover Page Interview Details 1 Name ofthe interviewer Enter the full name of the interviewer 2 Date of interview Record the date of interview in lt dd mm yyyy gt format 6 2 General Information 1 ICMR CAR Member ID No This is a 10 character alpha numeric code which is unique to each participant of the cohort Please write down this ID as explained above 2 ICMR CAR HHID 12 wt o OP Scan no Write down the PICME number as OP no if the participant is recruited from PHC UHP If recruitment is done at private facility write their record no Pregnancy ID Name ofthe participant Write down the full name of the respondent Name of the Husband Write down the full name of the respondent s husband Date of birth of the participant Record in lt dd mm yyyy gt for
59. a or vomiting Severe respiratory distress Physical limitations Cognitive impairment or dementia The above mentioned contraindications should be ruled out with the help of a validated check list before performing the test Data Form AC 4 PFT assessments should not be performed on participants reporting or more of the conditions listed 7 4 Spirometer Calibration Calibration To ensure that the spirometer is in good working condition and the data generated during testing is accurate the spirometer is calibrated once a day prior to performing the tests Calibration syringe General instructions The calibration syringe should be stored at the same temperature and humidity as the testing site away from direct sunlight and heat sources This is best achieved by storing the syringe close to the spirometer A calibration syringe should be used to check the volume calibration of spirometers and must have an accuracy of 15mL or 0 5 of the full scale whichever is greater For most spirometers the syringe volume required is 3L A calibration syringe should be validated yearly to ensure accuracy For specific details refer to the manufacturer s recommendations A calibration syringe should be checked monthly for leaks by attempting to empty it with the outlet occluded This should be performed at more than one volume 51 e Perform inspection of adjustable or variable stops if they exist especially if th
60. and re weigh the filters Field Blanks treat field blank filters similar to field sample except for the sampling procedure Include a field blank for every ten field samples Once at the field site open the field blank filters from the cassettes and expose for few seconds and close immediately Field blanks are transported back to the laboratory along with field filters and weights are taken A difference in filter weight of lt 30 ug is acceptable If it deviates above this range then field sampling for that particular batch of ten filters needs to be repeated 6 Field activities Field activities comprises of administration of the general household questionnaire air sampler placement retrieval and post monitoring questionnaire administration to collect time activity information Carry relevant data forms equipments and questionnaires before arriving at field sites Identify areas where a minimum of five households have given consent for placing the area samplers and arrange the logistics accordingly to these areas in the tool box meeting Synergize the efforts if any air toxics are planned in the same areas or households This section describes instructions for air sampler placement retrieval and questionnaire administration 77 6 1 Material Checklist Use Data Form EXP 5 OB a Th w p o Calibrated air samplers with backup batteries BGI cyclone separators Rotameter calibrated Loaded filter
61. and start sampling 10min prior to cooking activity g Once sampling is completed remove the tubes from the pumps and close both ends of the sorbent tubes with caps and wrap the tubes with Teflon tapes tightly h Also wrap individual tubes in aluminum foils and place all sampled tubes in cooler box and transport to laboratory i Store all sampled tubes in a refrigerator at 4 C until further analysis j Enter sampling date location household ID sorbent tube ID etc in the field data form EXP 6 and household details in AIR TOXICS 1 form 8 2 Quality Control QC QC samples should be prepared and analyzed similar to field samples Include one QC sample tube for every ten tubes sampled Laboratory blank LB Place a fresh sampling tube in the laboratory along with field samples to ascertain any contamination in the laboratory 113 Field Blank FB open the field blank tubes for few seconds and close the caps immediately while placing the field samplers Transport field blanks in same containers as field samples 9 Analysis of VOCs Automated thermal desorption setup allows for optimal desorption of bound VOCs and it minimizes sample loss contamination while handling a Removethe caps on both ends and place the stainless sorbent tube in the thermal desorption chamber b Program the system with settings as shown in Table 1 to initiate automatic desorption and quantification c Quantify individual VOCs
62. arajan Mukhopadhyay Dr Sankar Sambandam 1 Purpose This document provides instructions for collecting and analyzing trace metals in indoor and outdoor air following guidelines as outlined in NIOSH method 7301 2 Scope and Applicability This document outlines procedures for collection digestion and analysis of particulate matter for the determination of trace metal concentrations from indoor and near outdoor environments 3 Summary of Method Airborne metals collected on appropriate filters e g MCE filters are digested by hot acids and the resulting solution is analyzed for trace metals by inductively coupled plasma mass spectrophotometer ICP MS Tool box meeting Filter conditioning weighing and calibration Sampling Acid digestion ICP MS Analysis Figure 1 Steps involved in collection and determination of trace metals in indoor and near outdoor environments 4 Materials required aw Pw 10 11 12 13 14 15 16 17 18 19 20 21 22 23 Mixed cellulose ester MCE filters 0 8 um pore size Two and three piece filter cassettes 37 mm diameter Cellulose backup pads Ultra pure nitric Acid HNO3 Ultra pure hydrochloric Acid HCI Milli Q water CPI International Standard for trace impurities 1000ug mL Argon Hydrogen and Helium Purity 99 99 Standard measuring flask 25ml Glass beakers 100ml SKC active air sampler SKC pump charger Burette stand with clamp 1000ml inv
63. articipant with contact number s if the participant has changed residence after her delivery 6 GPS Coordinates If the address is different from the address provided at the time of recruitment of the mother Mark down the GPS coordinates if the participant has changed residence after her delivery Refer exposure questionnaire SOP for the detail 7 Reason for loss to follow up In case the household is inaccessible unwilling encircle the correct option which is listed for the question 19 Section B Performing Anthropometric measurements The following equipment is needed to perform anthropometric measurements Digital weighing scale 1 SECA mat for length measurement of very infants 2 Stadiometers for measuring height of the children older than 1 year 3 Gullick inch tape for measuring mid upper arm circumference of the children Fig 1 Digital weighing scales Fig 2 SECA Mat length measurement Fig 3 Stadiometer height board Fig 4 Gullick inch tape 20 During each visit to the participant s household the child s age length height weight and mid upper arm circumference MUAC are measured as follows 1 Age Ask the mother or primary care taker about the age of the child and write down the completed age in months 2 Length Height If the child cannot stand independently the length is measured centimeters using SECA MAT Fig 2 If the child can stand independently as the case with older c
64. as No Codes Yes 1 No 0 If Yes specify the number of years for which present If No enter 99 43 Cough and Phlegm 19 20 21 22 23 Have you ever had to get up at night because of cough during the last 12 months Self explanatory Give answer in Yes or No In case of doubt give answer as No Codes Yes 1 No 0 If Yes specify the number of years for which present If No enter 99 Do you usually cough first thing in the morning Self explanatory Give answer in Yes or No In case of doubt give answer as No Codes Yes 1 No 0 If Yes specify the number of years for which present If No enter 99 Do you usually bring out phlegm from your chest first thing in the morning Self explanatory Give answer in Yes or No In case of doubt give answer as No Codes Yes 1 No 0 If Yes specify the number of years for which present If No enter 99 Do you usually bring out phlegm from your chest most of the morning for at least 3 consecutive months during the year Self explanatory Give answer in Yes or No In case of doubt give answer as No Codes Yes 1 No 0 If Yes specify the number of years for which present If No enter 99 Select the most appropriate out of the following a I hardly experience shortness of breath
65. at they cook with kerosene 18 How many days do you cook with LPG in a month 19 Ask participant about the number of days in a month that they cook with LPG 20 Whether any forced ventilation was used Ask the participant and mark the appropriate answer Forced ventilation means a system of ventilation in which air is forced through ventilation ducts under pressure If they have chimneys specify in others 21 Whether Fan is used in Kitchen at the time of cooking Ask the participant and mark the appropriate answer 22 Is Traditional stove present in the outside kitchen Ask the participant and mark the appropriate answer 23 Is Fan present in the Living room Ask the participant and mark the appropriate answer 24 If 21 is yes is the Fan used in the living room at the time of cooking Ask the participant and mark the appropriate answer 25 Perception of Environmental Problems in your locality Read out the options and ask how the study subjects rank it Ranking should be given in numerical form i e 1 2 3 4 89 Encourage the participant to use their own judgment to rank the pollution Smoking habits Ask the participant and mark the response If they are not aware request other household members to help 6 5 Post Monitoring Questionnaire Name of the interviewer Enter the full name of the interviewer Date Record the date of interview in lt dd mm yyyy gt format Start time Record the start time of interview ICM
66. ate answer from the list provided in the questionnaire Once a willing and eligible woman is identified let her know that the research team will come to her household with relevant forms for informed consent 10 5 Obtaining informed consent from eligible mothers at the household Data Form MC 2 5 1 Steps for securing informed consent 1 Provide a consent form MC Data Form 2 to the participant and request her to get her doubts clarified if any once she reads it 2 If she cannot read read it for her and make her understand the content of the consent form in the presence of another household member who can read Tamil 3 Getthe signature of the participant with full name and date after the participant has understood her role in the study and voluntarily consents to be a participant in the study 4 Obtain a witness signature from the participant s relative or another data enumerator with full name and date 5 Complete the interviewer s statement and sign it with name and date 6 Give the participant a copy of the signed consent form 5 2 Assigning a participant ID enrolled participants are assigned with a TAPHE unique identifying number to link all data fields pertaining to the participant and or household The assignment of unique ID is done in the laboratory after securing the informed consent Unique ID This is assigned at the lab This is a 10 character alpha numeric code which is assigned
67. ature C off Right PTV method Mode CT Split Base Temperature On Base Temperature C 280 Split Flow Off Flow Flow ml min 20 Splitless Time min 1 50 Solvent Valve Temperature off Surge Pressure kpa Surge Duration min Constant Purge Stop Purge for min Sub Ambient Backflush Injection Volume Right Carrier Method Mode Initial Value Initial Value ml min Initial Time min Gas Saver Gas saver Flow ml min Gas saver Time min Vacuum Compensation MS Parameters MS Run Time min 26 Segment 1 2 Duration min 2 97 2 93 Scan Events 1 1 Segment 1 Chrome Filter Not used Scan Events 1 c SRM Micro scans 1 Width Parent Center 1000 000 1000 000 1 000 Segment 2 3 00 0 00 off 1 50 off off 2 00 Constant flow on 1 0 1 0 off 20 0 2 0 on Use GC Run Time 3 4 5 6 2 12 1 83 2 12 3 91 1 1 1 1 Q2 Gas pressure 1 0 Time CE Q1 PW 1 000 10 0 70 Yes 7 8 3 99 6 12 1 1 Q3 PW 0 70 Chrome Filter Not used Scan Events 1 c SRM Micro scans 1 Parent Center Width 128 000 102 000 0 050 128 000 127 000 0 050 152 000 150 000 0 050 152 000 151 000 0 050 154 000 153 000 0 050 Segment 3 Chrome Filter Not used Scan Events 1 c SRM Micro scans 1 Parent Center Width 166 000 163 000 0 050 166 000 165 000 0 050 Segment 4 Chrome Filter Not used Scan Events 1 c SRM Micro scans 1 Parent Center Width 178 000 1
68. ave excluding bathroom toilet Ask the participant about the number of rooms reminding them to exclude bathrooms toilets and mark the response 7 How many persons live in this house Including yourself Explain to the participant that this should only include those presently living in this house Guests and married daughters staying elsewhere should not be included Socioeconomic Status 1 Education and Income The name education occupation and income of the members of the family should be noted Help can be taken from other literate members of the family to get the correct information 2 Number of persons employed The interviewer can note from the above list 3 Highest qualified member Give the SN The interviewer can note from the above list 4 Highest earning member Give the SN The interviewer can note from the above list 5 Givethe Ownership status of the present house 83 The person family legally owning a house is called the owner Ask the participant regarding the ownership of the house and mark the appropriate answer Individual Level Information 1 Have you always lived in this house Ask the participant and mark the appropriate answer 2 How long have you been living in this house Here mark the number of years the participant has lived in the current house 3 If Q E 1 is No answer the following question If the participant has lived in more than one house repeat the questions section C Q1 Q6
69. d e f g Check sample waste container level Inspect Argon gas supply and its leaks Inspect torch and aerosols injector tubes Inspect nebulizer for Clogs Inspect sample capillary tube whether it is clean and good condition or not Check Peristaltic tubing before operation At the end of the day flush system for 5 minutes with the plasma on With the maximum of 2 Nitric Acid followed by de ionized water Weekly Maintenance a b d e Make Sure to clean the sample cone and Skimmer cone first rubbing with abrasive polish paper and then sonicate in 2 HNOs Followed by sonicate in Milli Q Water for 2 minutes Make sure to clean the spray chamber Torch End cp and Nebulizer for Soaking in 596 HNO3 Make Sure to prepare tuning solution freshly Make sure to check the sensitivity of the instrument by tuning solution Make sure to check the water level in chiller Quarterly Maintenance a Clean Torch Components and replace any Worn O rings on the Torch assembly b Make Sure to clean the Extraction and Omega lenses carefully c Inspect and clean RF Coil d Clean the nebulizer components and replace any worn O rings on the transducer face and clean drain fitting for leaks 4 4 Calculation Metal Concentration mg kg wet weight basis AXB g sample A concentration of metal in digested solution mg l B Final volume of digested solution in ml 4 5 Quality Control e Laboratory Blank LB Keep open
70. d ask if she would be interested in enrolling herself as a study participant if found eligible c Onceshe provides the initial oral informed consent to be screened administer the screening questionnaire Data Form AC 1 as described below 4 2 Administration of screening questionnaire Data Form AC 1 1 Name ofthe interviewer Enter the full name ofthe interviewer 2 Date Record the date of interview in lt dd mm yyyy gt format 3 Recruiting Household From MC HH Neighbour Write down MC HH if the participant is recruited from the mother child cohort household else write down as neighbor 4 Name ofthe participant Write down the full name of the respondent 5 Name of husband spouse Write down the full name of the respondent s husband or spouse this is additional identifying information useful for locating the household during the first field visit as the household address information is often inaccurate 6 Date of birth or Age ofthe participant Write down the DOB in lt dd mm yyyy gt format if DOB is not known write down the age in completed years If the respondent s age is less than 18 yrs or more than 60 yrs tell the respondent that she he is not eligible for the study 7 Living in the same area Askthe participant how long she he has been living in this area Even if they had shifted house s within 5 kms radius of the current residence it is considered as same area The answer for this question is less
71. d in detail in the following sections 5 1 Materials required Tenax amp Carbopack B amp VOC standard 2000 megamix Sigma Aldrich WwW NIST internal standard comprised of pentafluorobenzene 1 4 difluorobenzene chlorobenzene D5 and 1 4 dichlorobenzene 5 Mixed surrogate standard comprised of dibromofluoromethane toluene d8 and p bromofluorobenzene 6 Methanol 99 596 HPLC grade 7 Stainless sorbent tube 7 5 cm length and 4 mm dia 8 Stainless 60 80 mesh and retaining springs 9 Glass wool 10 Quartz wool 11 Dessicator 12 Aluminum foil 13 Tongs 14 100 ml Borosil beaker 15 500 ml Borosil beaker 110 5 2 Instruments Apparatus required o nM m C PM o np Air sampler SKC 224 PCXR8 Low flow holder Tygon tube Soap bubble meter and soap solution Muffle furnace Stop watch Balance Automated thermal desorption unit in tandem with GC MS system 6 Sorbent tube conditioning and preparation a Clean stainless sorbent tubes in ultra pure water and dry them in oven at 200 for 10 minutes Take clean dried stainless sorbent tube and insert stainless steel 60 80 mesh towards inlet until sits on inner groove Insert a small piece of quartz wool until it sits on the steel mesh Packthe tubes with 50mg of Tenax media and push it with a needle Insert a small piece of quartz wool and press slowly until it reaches the packed Tenax media On top of Tenax media separated by
72. ds in each list to accommodate schedule changes Organize data collection steps based on participant availability as well as vehicle logistics 4 Screening for eligibility at primary health care centres PHC urban health posts UHP Data Form MC 1 4 1 Steps at PHC UHP a Introduce yourself to the PHC UHP staff and request them to direct pregnant women presenting themselves at the antenatal clinic preferably less than 14 weeks of gestation to the SRU recruiting team b Introduce yourself in Tamil to the woman c Brief her about the project provide her with the CAR Information Sheet for Participants and ask if she would be interested in enrolling herself as a study participant if found eligible d Once she provides the initial oral informed consent to be screened administer the screening questionnaire Data Form MC 1 as described below 4 2 General instructions for administering screening questionnaire Data Form MC 1 at PHC 1 Name ofthe interviewer Enter the full name ofthe interviewer 2 Date Record the date of interview in lt dd mm yyyy gt format 3 Recruiting Location Fill details regarding the location of the PHC UHP including village zone name 4 OP outpatient Number Write down the PICME number as OP number for the respondent at the PHC UHP Note for the few participants screened at other hospital facilities use available record locators such as scan or id 5 Name ofthe participant
73. e correct option 18 8 Collection of ARI Data Data Form MC 5 ARI data is collected on children born to mothers who were already enrolled in the M C Cohort based on consents provided for collection of ARI data on their children until 2 years Field personnel need undergo a two day training on the use of child health calendars following protocols recommended by the WHO Integrated Management of Childhood Illness guidelines Each child is visited once a month to inquire from the child s mother or the care taker about the presence and duration of symptoms for the child during the preceding 15 days including the day of the interview with emphasis on symptoms for ARI Anthropometric measurements are also made during each visit Instructions for administration of the ARI questionnaire Data Form MC 5 including anthropometric measurements are provided below Record general information on the child in Section A 8 1 ARI Questionnaire Data Form MC 5 Section A GENERAL INFORMATION 1 Name ofthe interviewer Enter the full name ofthe interviewer 2 Date of interview Record the date of interview in lt dd mm yyyy gt format 3 ICMR CAR Mother ID Write down the 10 character alpha numeric code of the mother who was recruited during her pregnancy 4 ICMR CAR Child ID Write down as 1 5 Address of residence If it is different from the address provided at the time of recruitment of the mother Write down the complete address of the p
74. e syringe has been dropped or damaged e Use of the syringe on a large number of machines distinguishes between instrument problems and problems with the syringe To perform calibration e Pneumotach is connected to the laptop and the Calibration syringe to the inlet port of the pneumotach as shown below Figure 2 Calibration assembly e Click on the icon Calibrate in the Spirometry Software e Verify and change if necessary the environmental conditions room temperature Atmospheric pressure and relative humidity e Enter the name of the person performing calibration e Select the syringe volume 3L Click on Setup MultiFlow syringe e Calibration can be started by clicking Test Start calibration This procedure will begin null ing the Pneumotach During nulling it must be ensured that there is no air flow through the Pneumotach Perform at least 3 trials with varying flow rates for each effort by pushing the syringe handle NSPIRE HEALTH recommends using Low flow Medium flow and High flow e When calibration has been successfully completed a message will come on the screen informing that Pneumotach calibration is adjusted and now within tolerance Click on OK e Aprint of the report of calibration graphic results prior to exiting the calibration screen can also be done if required by Clicking on the Print icon 52 7 5 Spirometry Main Procedure 7 5 1 PREPARING THE SPIROMETER as outlined in
75. e 2 The large rain hood goes on the side of the sampler with two vents One smaller rain hood goes on the other side of the instrument and the other smaller one covers the vent on the back of the instrument The two smaller hoods are interchangeable Figure 2 Gasket and rain hood frame 4 2 Inlet components The inlet components for the sampler include PM 10 inlet the 1 OD sample tube the straight tube and a straight line adaptor Installing the PM 10 inlet a Insert the 174 OD sample tube into the bulkhead of the instrument Ensure that the tube is pushed past the upper and lower O rings which provide some resistance and hits a stop b Hand tighten the dome connector on the bulkhead to ensure a tight grip 100 c Place the 15 Stage inlet over the end of the sample tube Ensure that the tube is pushed past the inlet s two O rings which provide some resistance and hits a stop Figure 3 Figure 3 4 3 Opening the filter exchange mechanism a Openthe filter exchange mechanism by pulling forward on its handle and allowing it to drop into its open position a Remove the filter cassette carrier with the installed cassette Figure 4 Figure 4 4 4 Installing a connecting filter a Snap apart the two halves of a filter cassette and insert a screen so that the serial number is on the underside of the screen b Place a 47 mm diameter filter over the screen 101 Snap together the two hal
76. e Teflon filters using a dichotomous high volume air sampler following US EPA Compendium Method 10 2 1 US EPA 1999 3 Apparatus description The dichotomous high volume air sampler Partisol model2000 D Thermo MA is configured to split a PM10 sample stream into fine PM2 5 and coarse between 2 5 and 10 microns in size fractions using a US EPA designed virtual impactor The sampler is designed with an active volumetric dual flow control system that maintains two constant volumetric flow rates at the levels specified by the user by incorporating two mass flow controllers The sampler uses standard 47mm Teflon filters for PM10 and PM2 5 housed in reusable cassettes to avoid contamination The software records data every 5 minutes that includes temperature ambient temperature ambient pressure and average flow rates Figure 1 Partisol Model 2000 D 99 4 Apparatus set up A brief instruction of apparatus set up is given here Refer Partisol Model 2000 D dichotomous air sampler operating manual for detailed instruction on set up operations and maintenance http www thermoscientific com content tfs en product partisol 2000 d dichotomous ambient particulate sampler html last accessed on 5 1 2015 4 1 Attaching gaskets to rain hoods Attach one gasket to each of the three rain hoods supplied with the unit Peel back the paper facing and apply the sticky side of the gasket to the flanged part of the rain hoods Figur
77. e field Spacer is recommended for proper delivery of the medicine The mouth piece of the spacer should be cleaned using a disinfectant at the field before it is used for the next participant 7 5 5 MEASURING HEIGHT AND WEIGHT Measure and record the participant s height barefoot in centimetres cm with feet together heels against the wall standing as tall and straight as possible and with the head in the horizontal plane eyes level and looking ahead Measure the participant s height by placing a hard board or scale firmly above the head mark the point on the wall and read the lower end of it using a measuring tape 55 Measure and record the participant s weight in kilograms kg standing straight and without footwear Restrict participant touching or leaning on anything and obstructing the display Height measurement Weight measurement p g 7 5 6 ENTERING PARTICIPANT INFORMATION 1 Establish a rapport with the participant by self introduction and by explaining how easy is the test to be performed 2 Enter the following information on to the home window of KoKo PFT software e Click on the icon Enter Edit Patient Information e In the window Enter Edit Patient Information towards the left bottom corner under Patient click on the button New which will open the window Enter Participant Information e Enter relevant details about the participant in the appropriate fields of the wi
78. e in speed argon gas will flow on coolant Auxiliary and nebulizer lines e On the first attempt of lighting allow 2 minutes after turbo pumps have reached full operating speed before continuing with plasma ignition e Once Plasma ignited allow to leave for 10 minutes allow interfere and spray chamber temperature to stabilize e Check that liquid is flowing correctly in the drain tubing and continue the Tuning and analysis ICPMS Software e Double Click on ICP MS TOP icon to display the ICP Ms General Window Click on instrument control in instrument menu bar to display the ICP MS Instrument control Stand by standard window Creation of method Click on the Method in Menu bar to appear Edit entire method Click on Edit entire Method to display the Edit Method Window and then click Display the Method information box and mention the method comments Then click Ok Display the select sample types then again click Ok to display the Interference Equation box then Click Ok Display the Acquisition Mode window here we can select the Appropriate mode of Analysis Spectrum Time resolved Analysis Time Program Spectrum Multi tune Isotope type analysis Multiline then Click Ok Display the Peristaltic pump Program here mention uptake speed rps Uptake time sec Rinse speed rps and Rinse time for sample and standard sec then click Ok Display the
79. e type of industry mark it has 99 3 Identify the nature scale of industry Small scale would include employing 100 people and large gt 100 people Mark the appropriate response 4 What is the approximate distance of industry from your residence meters Request the participant to judge the approximate distance to the industry Vehicular Air Pollution At the location of house observation by the interviewer 1 How wide is the road street adjacent to the participant s residence feet Use your own judgment in assessing the width of road street in feet If you cannot observe measure the width with tape 2 How far the participant s house is from the main road _ meter Use your own judgment main road refers to road that buses and trucks ply 3 Specify the type of location of your household If participant is not able to classify assist the participant by giving examples such as an area having only households being residential area with multiple shops and services being commercial and area having one or more industries being industrial 4 What kind of vehicles do ply most of the time on the road adjacent your house multiple answers allowed based on the highest type of vehicle the category will be determined later Ask the participant by listing the vehicle type and mark the appropriate answer 5 How would you rate the vehicular traffic outside your residence Ask the participant ab
80. e which is assigned by combining three different entities They are 1 the type of cohort 2 location of cohort and 3 serial number of the cohort participant enrolled in a particular village city The first character is a text which is either M or A denote the type of cohort M for mother child and A for adult cohorts The next 8 digits represent the location of the cohort of which the first two characters are texts which denote either R for rural and U for urban and K for Kancheepuram district or T for Thiruvellore district or C for Chennai district The next six digits of the location component is written in Arabic numeral which identify the village zone and the household The last digit of the unique ID represents the serial number of the participant of that particular location For e g M R K 001 001 1 means itis a mother child cohort from the rural area of 40 Kancheepuram district with a village ID 001 and household ID 001 and she is the first person recruited from the household 6 Collection of data on chronic respiratory symptoms Data Form AC INSEARCH 3 This exercise is performed using the INSEARCH Indian study of the epidemiology of respiratory symptoms asthma and chronic bronchitis questionnaire The original questionnaire is directed at diagnosis of asthma chronic bronchitis CB respiratory symptoms and atopy based on a validated set of questions without physical examination However the TA
81. ecord the date of birth of respondent in lt dd mm yyyy gt format If the date is not known record the date based on the age specified by the participant as 15 06 yyyy May also ask other family members in case of difficulty Age In Years If date of birth is known calculate the age in completed years If not ask the respondent his age and record the response Questions like age of marriage age of the first child age at which first child was delivered etc can be asked to get the age of the person For the following questions encircle the numeral of the correct response 9 10 11 12 13 Gender Self explanatory Record male or female Codes Encircle 1 for male and 2 for female What has been your usual residence where you have lived gt 75 of your life Emphasize the term Usual Codes Encircle 1 for rural and 2 for urban For how many years have you received education To calculate the number of years of education sum the number of years spent in school and college if applicable Record 0 if the respondent has never formally been to school What is the occupation of the head of household Select a single option that best describes the occupation of the head ofthe household as told by the participant What is your occupation Select a single option that best describes the occupation of the respondent 42 Breathlessness and Tightness of Chest 14 Have you ever had wheezing or whistli
82. erted standard glass burette Frictionless BGI triplex cyclone SCC 1 062 with calibration chamber Plastic beaker 100ml Soap solution Calculator stop watch Tygon tube Air leak checking instrument Sartorius microbalance Desiccators with desiccants Drierite with indicator 4mesh Anti static ionization strip and cleaning brush Inductive coupled plasma mass spectroscopy Agilent 7500 4 1 Filter conditioning and weighing Use fresh 37mm MCE 0 8um pore size filters for conditioning Follow the procedures outlined in TAPHE PM SOP for conditioning filters and taking weights 4 2 Calibration of active air samplers Set SKC air samplers to a flow rate of 1 5 L min and calibrate following the procedures outlined in the TAPHE EXPOSURE PM 4 2 1 SAMPLING r y Z Upon arrival in the field site choose appropriate locations in indoor and near outdoor environments to place air samplers For example if the location is in kitchen place the monitoring bag 1 meter away from the middle of the stove and about 1 5 meter above the floor While placing the samplers outdoor care must be taken to select a location to protect the unit from sun and rain Avoid placing the samplers near windows or doors Follow the same guideline for placing the samplers in other locations i e living and near outdoor and sites Assemble the air sampler unit by removing the top piece of the filter cassette and screw the filter ca
83. esting Re confirm that the participant is in compliance with the following requirements e Ceased smoking at least 1hr before testing e Ceased alcohol consumption at least 4 hrs before testing e Refrained from performing vigorous exercise atleast 30min before testing e Refrained from eating a large meal within 2hrs of testing 4 Ensure that the participant is wearing clothing that enables full chest and abdominal expansion if possible loosen clothing 54 5 Record relevant medical history that may assist in the interpretation reporting of spirometry This may include the following symptoms assessed previously using the Data Form AC INSEARCH 3 e Breathlessness e Cough e Sputum e Wheeze e Symptoms of asthma e Smoking history years packs day current status e Known lung disease chest injuries operations e Work history e Occupational exposure to dust and respiratory irritant 6 Clearly instruct the participant about the procedure prior to the commencement of each test and ensure that the participant understands all requirements of the test Give ample opportunity for the participant to ask questions or receive clarification on the test and its requirements If the participant is found to be eligible for the Spirometry Test proceed further 7 5 4 BRONCHODILATOR ADMINISTRATION Recommended dose of 4 puffs of Asthalin is given to all participants 15 minutes prior to the test maneuver It can be safely used in th
84. filter Vr Volume 3 of air sampled through fine particle fraction filteR V Volume 3 of air sampled through coarse particle fraction filter V Volume M of air sampled through both fine and coarse particle fraction filter Total volume PM25 mass concentration of PM25 ug m Note Total sample time must be between 1 380 and 1 500 minutes 23 and 25 hrs for a fully valid PM25sample 106 Reference 1 Sampling of ambient air for total suspended particulate matter and PM10 using high volume sampler Compendium Method IO 2 1 US EPA 1999 Cincinnati OH 2 Operating guide for Partisol Model 2000 D dichotomous air sampler Operation Manual 2007 Thermo Scientific MA 107 STANDARD OPERATING PROCEDURE FOR SAMPLING AND ANALYSIS OF VOLATILE ORGANIC COMPOUNDS VOCs IN HOUSEHOLD MICRO ENVIRONMENTS TAPHE EXPOSURE STUDY ICMR CAR PROJECT DEPARTMENT OF ENVIRONMENTAL HEALTH ENGINEERING ICMR CENTER FOR ADVANCED RESEARCH ON ENVIRONMENTAL HEALTH AIR POLLUTION SRI RAMACHANDRA UNIVERSITY CHENNAI TAMIL NADU SOP ID 2 5 TAPHE EXPOSURE VOC Date of issue 15 February 2014 Date of last review 3 January 2015 Prepared by Reviewed by Approved by Dr Naveen Puttaswamy Dr Krishnendu Dr Kalpana Balakrishnan Mr Srinivasan Natarajan Mukhopadhyay Dr Sankar Sambandam 108 1 Purpose This document provides instructions for sampling and analysis of volatile organic compounds VOCs in household micro environments
85. fragments created by restriction digestion of the PCR products with Msp1 The expected banding patterns when digested with Msp1 are TT w1 w1 340bp CC m1 m1 200bp 140bp TC w1 m1 340bp 200bp 140bp nt 3801 CT CGG T to C Creates Msp1 restriction site 3 UTR of CYP1A1 CCGG 340 b CTGG Fig 5 3 Diagrammatic representation of the Msp1 MW Molecular weight marker 100bp DNA ladder Lane 1 3 4 5 7 w1 w1 genotype Lane 2 6 8 w1 m1 genotype Fig 5 4 Agarose gel showing CYP1A1 genotypes
86. h by setting the start date and end date along with time in the main screen If these are not displayed properly reset the sampler by pressing lt F1 Edit gt then enter the correct data using the key pad and press the ENTER key Press ESC key to return to the main screen Then press F1 Setup to enter the Filter setup screen Press F1 Edit then enter the sample run Start Time and Start Date End Time and End Date ID 1 ID 2 etc if required Press the ENTER key 104 r Pressthe ESC key to return to the Main screen s Press the lt RUN STOP gt key The sampler should now enter the Wait Mode t Verify that the correct sampler run data start time date etc is displayed on the main screen u When the clock time equals the sample start time the sampler will automatically enter the Sampling Mode and begin the sampling run v Fill every detail in the Air Sampling Data Form Use Data Form EXP 6 with proper signature of the assigned person w Periodic checkup of the sampler system is required for the smooth conduction of the study x During night time if the mechanical fault or other abnormalities of the instrumental setup is found it is necessary to record by the assigned person y When the clock time equals the sample stop time the sampler will automatically end the sampling run and enter the done mode i fault occurs during the sampling run the Error Mode will display instead of Done Mode ii
87. he exhaust for a positive extraction at the exhaust duct Never look into the plasma compartment directly Check the drain vessels frequently Make sure hydrogen gas line without leaks Periodically check equipment for Hydrogen leaks by using soap solutions with leak detector Do not vent hydrogen from a high pressure chamber directly into the atmosphere There is a danger that the gas will self ignite Always turn off hydrogen gas at its source whenever turn off the ICPMS The exhaust duct always be operating to avoid accumulation of the gas in the ICPMS and or exhaust duct Wait for the instrument to cool before performing any maintenance or operation Make sure to check the concentration of acid continuous aspiration of high acid concentration may damage the sample and skimmer cones Do not use flammable solvent in or near the ICPMS which can create explosion and fire hazards 4 3 3 OPERATION OF ICPMS Set gas Supplies Argon Gas 700 850Kpa Hydrogen Gas 20 60Kpa Helium Gas 20 60Kpa Optional Gas 300Kpa Cooling Water Conditions Pressure 230 350 Temperature 15 40 Flow Rate 5L min e Check the exhaust vent bm min 177ft min e Check the chiller is switched ON e Check the peristaltic pump tubing visually and clamp up the tubing e Click the ICPMS chem station software and then click the instrument screen and select Stand by state allow the automated sequence to run turbo pumps will increas
88. he nature of household measurements to be performed The general household and post monitoring questionnaires are somewhat time consuming Check with the convenience of the participant before beginning the questionnaire administration Go over each of questions giving adequate time for the participant to recall describe 6 4 2 GENERAL HOUSEHOLD QUESTIONNAIRE General Information 1 Name of the interviewer Enter the full name of the interviewer 81 Date of interview Record the date of interview in lt dd mm yyyy gt format Interview start time Record the start time of interview ICMR CAR Member ID No 4 9 This is a 10 character alpha numeric code which is unique to each participant of the cohort Please write down this ID from the screening health questionnaire GPS coordinates Switch on the GPS instrument in open place near the participant household and record the readings Address Write the complete address with pin code contact number and landmark Personal Information 1 ICMR CAR HH Member ID Write down the ID from Screening Health questionnaire with participant number Name ofthe participant Write down the full name of the respondent Name of the Husband Father Write down the full name of the respondent s husband Father Date of Birth Record the date of birth of respondent in lt dd mm yyyy gt format If the date is not known record the date based on the age specified by the participant as 15 06 yyy
89. hich present If No enter 99 Are you taking any inhaler pump rotahaler nebulizer or bronchodilator tablets for treatment of breathlessness Self explanatory The bronchodilator tablets should be one from the list given below or identified with the help of local practitioner Give answer in Yes or No In case of doubt give answer as No Bronchodilator tablets include Albutamol Ambro Aminophyllin Asmanil Asmatide Asthalin Bambudil Betaday Betasma Biryth Bricanyl Broncophyl Broncure Bronkomed Bronkoplus Bronkotab Brosmin Carbasma Curamol Deriphyllin Duralyn Durasal Eloxin Etophylate Etosal Lungful ODPhylin Phylobid Relasmin Remetuss Salbetol Salbouxine Salbutamol Salmaplon Salphylate Salvent Slowthyline Somavent Terbutaline Tergil Terfex 45 Theoasthalin Theobric TheoPA Theophyllin TRPhylin Unicontin Vent Ventil Ventorlin Codes Yes 1 No 0 If Yes specify the number of years for which present If No enter 99 History of Atopy 28 Do you often develop skin rash such as urticaria or eczema which come and go off and on Self explanatory Give answer in Yes or No In case of doubt give answer as No Codes Yes 1 No 0 29 Do you often develop sneezing or running nose Self explanatory Give answer in Yes or no In case of doubt give answer as No Codes Yes 1 No 0 30 Do you often de
90. hildren who are close to 2 years of age or more than 85 cms in length the height is measured using stadiometers height boards Fig 3 Both the procedures are explained below with illustrations Fig 5 amp 6 Length measurement e Place the measuring board on a hard flat surface i e ground floor or steady table e Place the questionnaire and pen on the ground floor or table Arrow 1 Kneel with both knees behind the base of the board if it is on the ground or floor Arrow 2 e Kneel on the right side of the child so that you can hold the foot piece with your right hand Arrow 3 e With the mother s help lay the child on the board by doing the following Support the back of the child s head with your hands and gradually lower the child onto the board Support the child at the trunk of the body e Ask the mother to kneel on the opposite side of the board facing the enumerator to help keep the child calm e Cup your hands over the child s ears Arrow 4 With your arms comfortably straight Arrow 5 place the child s head against the base of the board so that the child is looking straight up The child s line of sight should be perpendicular to the ground Arrow 6 Your head should be straight over the child s head Look directly into the child s eyes e Tell the other enumerator that the child is ready to be measured He she should make sure the child is lying flat and in the center of the board Arrow 7 Place you
91. hort notice Prepare a call list based on intended area of visit to inquire about availability of participant via phone Include additional households in each list to accommodate schedule changes Organize data collection steps based on participant availability as well as vehicle logistics Allow sufficient field time to administer lung function tests 4 Screening for eligibility at the household Data Form AC 1 The women and men for the TAPHE Adult respiratory health study are recruited from households or communities i e villages zones providing participants for the TAPHE BW ARI Study While making up the call list for visits to households with M C cohort participants ie pregnant mothers children enrolled in the TAPHE BW ARI study inquire if the team may approach other men or women from the same household with a screening questionnaire for participation in the TAPHE Adult respiratory study Once in the field if no household members from the M C are available eligible approach the nearest available neighbor for recruitment of potential participants with the screening questionnaire 37 4 1 Steps at the household a Introduce yourself in Tamil to the M C cohort participant if visiting a M C cohort household or the household member receiving you if visiting a non M C Cohort participant from the same village or zone b Brief her him about the project provide her with the CAR Information Sheet for participants an
92. ight and the heels and calves are against the board Arrows 6 and 7 Tell the enumerator when you have completed positioning the feet and legs e Tell the child to look straight ahead at the mother if she is in front of the child Make sure the child s line of sight is level with the ground Arrow 8 Place your open left hand on the child s chin Gradually close your hand Arrow 9 Do not cover the child s mouth or ears Make sure the shoulders are level Arrow 10 the hands are at the child s side Arrow 11 the child s feet are flat on the base of the board and the head shoulder blades and buttocks are against the board Arrows 12 13 14 With your right hand lower the headpiece on top of the child s head Make sure you push through the child s hair Arrow 15 e Check child s position Arrows 1 15 Repeat any steps as necessary e When the child s position is correct read and call out the measurement to the nearest 0 1 cm Remove the headpiece from the child s head and your left hand from the child s chin and support the child during the recording 22 e Repeat the measurement called out by the enumerator Immediately record the measurement and show it to the enumerator Note If the assistant is untrained the enumerator records the height e Check the recorded measurement on the questionnaire for accuracy and legibility Instruct the assistant to correct any errors Fig 5 Child length measurement 23 HEADPIECE
93. ing procedure and storage eese nennen 142 Te Sample ii IO VIV TuS LES ONCUEVEIESOUEBV T DE 9 Calculation and reporting eese eene ener nnn nnn nee 14O 10 Safety s 1 11 Quality assurance and quality control eee LOZ 12 References LOD STANDARD OPERATING PROCEDURE FOR LAND USE REGRESSION PRE GO RET oer 157 STANDARD OPERATING PROCEDURE FOR BIOREPOSITORY SAMPLE ARCHIVAL AND ANALYTICAL PROTOCOL rre nnne nnn nnns 160 STANDARD OPERATING PROCEDURES FOR SCREENING RECRUITMENT OF PREGNANT MOTHERS AND COLLECTION OF MATERNAL HEALTH BIRTH OUTCOME AND CHILD HEALTH ARI DATA TAPHE BW ARI STUDY ICMR CAR PROJECT DEPARTMENT OF ENVIRONMENTAL HEALTH ENGINEERING ICMR CENTER FOR ADVANCED RESEARCH ON ENVIRONMENTAL HEALTH AIR POLLUTION SRI RAMACHANDRA UNIVERSITY CHENNAI TAMIL NADU SOP ID 2 1 TAPHE BW ARI Date of issue 15 April 2010 Date of last review 19 November 2014 Prepared by Reviewed by Approved by Mrs Rajarajeswari Kuppuswamy Dx Gurasamy Thangavel Dr Kalpana Balakrishnan Mrs Uma Maheswari Dr Padmavathi Ramaswamy 1 Purpose and scope This document provides instructions to research personnel involved in the ICMR CAR project for collecting health data pertine
94. ion and the investigations done at the PHC UHP Private facility which are mentioned in the ANC records should be marked in the appropriate column against each trimester with the date of the test Section H Treatment History Current Pregnancy Note down all the treatment undertaken during the current pregnancy period excluding the vitamin and mineral supplementation If the interviewer is not sure of the category note down all the treatment from the ANC records From both Government and private facility Remarks If any If the interviewer feels that there is additional pertinent information to be recorded he she can use the remarks field 16 7 Collection of Birth Outcome Data Data form MC 4 This questionnaire MC Data Form 4 is administered to the mother 6 8 weeks after delivery to collect data on outcomes of the pregnancy including live births still birth intrauterine death and abortion This questionnaire uses information available with the participant hospital maintained health records 7 1 Birth Outcome Questionnaire MC Data Form 4 Interview Details 1 Name ofthe interviewer Enter the full name of the interviewer 2 Date of interview Record the date of interview in lt dd mm yyyy gt format 3 ICMR CAR Member ID No This is a 10 character alpha numeric code which is unique to each participant of the cohort Please write down this ID from the screening health questionnaire Section A Deli
95. iv Use fresh standards and reference material whenever necessary v Undertake a method validation step prior to analysis of field samples a Method validation Before the analysis of field samples run a method validation to determine following parameters i Selectivity ii Linearity iii Detection limits and working range iv Accuracy and precision repeatability and reproducibility 11 1 Quality control a Preparing QC filters and blanks i Include a QC filter for every 15 filter during coating process ii Take the weights of these QC filters before and after filter coating process iii calculate the standard deviation to check for consistency in resin coating iv Deviation in weights should be within 1SD v samples is prepared and analyzed at the same time as unknown samples b Include one QC sample blank per batch or one for every 10 samples c Spike all unknown field samples with known concentration 150ng D10 Phenanthrene and 50ng D10 Fluoranthene per ml of internal standards to check for recovery during sample analysis d Blanks i Coating blank keep a blank filter throughout filter coating and storage process and include in analysis to rule out contamination during filter coating and storage ii Field Blank FB Keep open a sampling filter cassette in the field for about a minute before start the sampling processes and store it as like the sample until taken for analysis iii Extractio
96. k the appropriate response Do you have carpet in your house Ask the participant and mark the appropriate answer 7 Do you have air conditioners in your house Ask the participant and mark the appropriate answer 8 How often do you clean service the filters in air conditioners Ask the participant and mark the appropriate answer 9 Whatis the typical non electricity hours Per day Ask participant what is the usual power cut timings and calculate the total duration in hours 10 What source of light do you use during those non electricity hours Please Ask the participant and note down the response Cooking Fuel Details 88 13a How long have you been using LPG If participant is using LPG ask about years of use If they are using since birth calculate the age and write down the years 13b What fuel were you using before LPG Ask the participant and write down the response 13c What is the type of cooking fuel commonly used in your home Tick the appropriate Ask the participant the type of fuel most frequently used for cooking 14 If you are using kerosene Please describe If participant is using kerosene primary or secondary ask about quantities bought and the location 15 How many days do you cook with biomass in a month Ask participant about the number of days in a month that they cook with biomass fuels 16 How many days do you cook with kerosene in a month 17 Ask participant about the number of days in a month th
97. lative appropriately as Yes or No In case of doubt record No After the respondent has enumerated his response specifically ask for the relatives whose data is still missing For relatives not listed among choices select Others and mention the relationship Codes Yes 1 No 0 Missing value 99 For each answer recorded as Yes ask the respondent about the main smoked tobacco product he she was exposed to as well as the number of hours of daily exposure and the approximate number of years for which this exposure occurred Use codes for tobacco product Cigarette 1 Bidi 2 Hookah 3 Cigar 4 Pipe 5 Others 6 For each answer recorded as No fill up 99 in each of Products Hours per day and Years Finish the interview by thanking her him for their valuable time to complete the questionnaire 7 Assessing pulmonary function by spirometry Data Form AC 4 Field staff involved in administration of lung function tests in the TAPHE Adult Respiratory Health study must undergo the spirometry certification program conducted by the Department of Chest Medicine of Sri Ramachandra Hospital 7 1 Requirements for equipment Note The instructions provided in the SOP are specifically directed at using the KOKO spirometer although it is applicable across other comparable instruments Laptop with KoKo software installed power cord and mouse Spirometer with connecting USB cable Con
98. ler parts are supplied by Ogawa amp Co see Fig 1 Pre coated filters are supplied in sealed vials with date of coating Store these filters in their original containers in a cool dark place preferably at 59C Carry out all sampler assembly in a dust free room All components must remain completely dry during the assembly Fig 2 This requires that after forceps are used for a specific filter they are wiped clean with a moist Kim wipe and completely dried before handling the other filters and screens Use the blunt forceps whenever possible to prevent filter damage Follow the procedures for assembling the passive badges as shown in Figure 3 for each sampler follow left to right Follow the general steps given here for assembling passive samplers for NOx amp NO2 502 and and wherever applicable specific procedures are provided for individual gases 118 Figure 1 Pre coated collection pads or filter 1 End Cap 2 Stainless Steel Screen 3 Pre Coated Collection Pad 4 Retainer Ring 5 Inner Base Pad 6 Sampler Body Figure 2 Sampler components Remove the filter vials from the refrigerator and place it in a desiccator for about 12 hours prior to exposure in the field Rinse all sampler parts end cap steel screen inner base pad and sampler body in ultra pure water and dry them thoroughly before assembling To assemble the sampler parts start at the innermost position and progress outwards to the diffu
99. liogseseacieacas teniiniinotis cas icd htc tr R P 2c Lin Druid dl bI LGE Sft nx TUE 36 Be TooL Box Meetings oen onc dii ori EON Rv 37 4 Screening for eligibility at the household Data Form AC 1 37 5 Obtaining informed consent from eligible participants at the household Data Form AC 2 40 6 Collection of data on chronic respiratory symptoms Data Form INSEARCH 3 m 41 7 Assessing pulmonary function by spirometry Data Form AC 4 48 8 Data quality and data management esee eee ena tetra tnn enann 61 STANDARD OPERATING PROCEDURE FOR SAMPLING AND ANALYSIS OF PARTICULATE MATTER IN HOUSEHOLD 63 T oPUuFDOSQss sueta add tint cem aou ecd UR Ade DRE Edu EE a Duc CUu ERR Du di e LA 64 2 Scope and Applicabllity oen c iar caret erai Sha ikea pr ia eda ERE UE cH e LE RITE a CU eia rd 64 3 Sammary of procedures 64 A TOOLS decori eU esaa aaaeaii daen c p ees 65 5 Laboratory activities iisccsicesenizesec cina cinia sine ck DE SD Ri iO cn E 65 6 Field EV Rar cbe DV DN RENS R
100. llection pad on the screen Place sampler into brown screw top vial and close securely Slide the sampler into the sampler clip Figure 3 Steps for sampler assembly from left to right Source www ogawausa com protocols 121 6 Sampling a Arrive at field site and select appropriate location i e away from known nitrogen oxide sources walls tall trees etc to place the samplers b Forindoor locations avoid areas with inadequate movement of air like behind furniture s near gas stoves behind doors or near under the kitchen sink c Mountthe samplers at a distance of 20 30cm from vertical surfaces and 1 5 2m above the ground in well ventilated areas d For outdoor sampling place the samplers in opaque protective shelter Assembly of outdoor protective shelter Opaque shelter for NOX amp NOZPVC Protective Shelter e Supplied by Ogawa to minimize damage or contamination due to rain wind and direct sunlight see Fig 3 f Place the USB data logger nearer to each NOx NO2 502 and samplers for the measurement of temperature and humidity The data logger is launched prior to the placement of the samplers g Note down the start date and start time once the sampler badge is deployed in the field h Also note the sampling location types of indoor surfaces proximity to vehicular traffic weather conditions in the field data sheets 1 Transport field blanks along with samplers and
101. mat If DOB is not known ask for approximate age and write down the date and month as 15 and 6 respectively Year can be deduced from the current year 8 Age in years Write down age in completed years 9 Address of current residence Write down the complete address as provided 6 3 Data Form MC 2 Main Questionnaire General Information Copy responses from Cover page for questions 1 to 5 1 2 3 Name ofthe interviewer Enter the full name ofthe interviewer Date of interview Record the date of interview in lt dd mm yyyy gt format ICMR CAR Member ID No This is a 10 character alpha numeric code which is unique to each participant of the cohort Please write down this ID as explained above OP Scan no Write down the PICME number as OP no if the participant is recruited from PHC UHP If recruitment is done at private facility write their record no Pregnancy ID Section A Marital history Age at marriage Ask the participant what was her age when she got married and write down the completed years History of consanguinity Ask the participant whether she is married to her blood relative and mark the appropriate response If there is consanguinity ask how she is related such as maternal uncle cousin distant relative If relationship is not unknown mark 99 13 4 History of taking oral contraceptive pills Ask the participant regarding oral contraceptive pill usage prior to the current pregnancy a
102. mouthpiece Immediately after positioning the mouthpiece firmly instruct the participant to inhale deeply as much as possible until the lungs get filled completely at the end of inhalation instruct him her to exhale as rapidly and forcibly as possible and encourage continued complete exhalation 26 seconds until the end of the test EOT After EOT ask him to take a deep breath once again and complete the test Encourage the participant to maintain an upright posture i e no bending forwards during the maneuver Observe the participant at all times during the maneuver in case they become unsteady due to light headedness or experience other adverse reactions such as chest pain Repeat the instructions and maneuvers for a minimum of 3 maneuvers or more if necessary coaching vigorously until the end of test criteria are met no more than eight maneuvers should be usually performed Note Give him her a rest of 3 to 5 minutes in between the trials 58 e Then click on the icon Test Information and enter the following details in the window that opens Technician Your name Test Site Local Participant position Sitting standing Comments select any one from the drop down list according to the participant s performance Then click OK which will close the Test Information window e Then close the window FVC Test e It will lead to the window KoKo PFT System for another test for the next participan
103. n blank spike a known concentration of PAH mix 500ppm into blank filters and extract using the same procedure used for field samples This accounts for recovery bias and extraction efficiency iv Solvent Blank SB include solvent blanks e g DCM magic mix to check for PAH contamination 12 References iii Gundel LA Lee VC Mahanama KR Stevens RK Daisey JM Direct determination of the phase distribution of semi volatile PAHs using annular denuders Atmos Environ 1995 29 1719 1733 Hammond SK 2002 Standard analytical method for the determination of PAHs in air Environmental Chemistry Laboratory UC Berkeley CA Procedure No MLD 144 Revisions 1 0 California Environmental Protection Agency Air Resources Board November 2006 Cathy Peters and Karen Harlin Illinois State Water Survey Office of Atmospheric Chemistry 2204 Griffith Drive Champaign IL 61820 Standard Operating Procedure for the Analysis of PAHs and Atrazine by GC Ion Trap MS Volume 2 chapter 1 July 1995 Table 1 The List of targeted 16 polyaromatic Hydrocarbon PAHs to be quantified are Naphthalene NAP Acenaphthylene ACY Acenapthene ACE Fluorene FLU Anthracene ANT Phenanthrene PHE Fluoranthene FLT Pyrene PYR Benz a anthracene BAA Chrysene CHR Benzo b fluoranthene BBF Benzo k fluoranthene BKF Banzo a pyrene BAP Indeno 1 2 3 cd pyrene ICP Dibenz a h anthracene DBA Benzo ghi perylene BGP
104. n of PM concentration i Compute the average flow rate from initial and final flow rates as Average flow rate in L min initial avg flow rate final avg flow rate 2 ii Compute the volume of air sampled Air volume L Average flow rate pump run time Air volume m Air volume in L 1m 1000 L Calculate the PM mass Sampled PM mass mg Avg post weight Avg pre weight Adjusted PM mass mg Sampled PM weight field blank lab blank iii Calculate the PM concentration Calculate PM concentration C mg m using the formula C mg m3 Adjusted PM weight mg Air volume m3 7 2 Computation of PM exposure concentration Two methods of PM exposure determination are described here Method 1 describes PM exposure estimation using gravimetrically determined PM concentration This is a traditional method typically used as an alternative to real time or personal monitoring measurements of PM to estimate individual s exposure 7 2 1 METHOD 1 Use method 1 to estimate exposure concentration when continuous real time PM measurements are not available Calculate the 24 h or daily PM exposure concentration using PM concentration C mg m and time activity T h data collected from 95 participants using a post monitoring questionnaire The 24 h exposure is computed using the formula given below Exposure concentration mg m K1 T1 L2 T2 03 T3 04 T4 T1 T2 T3 T4 Where K1 concentra
105. nd encircle the appropriate response 5 Ifthe response to the previous question is Yes then write down the duration of use in months years Section B Personal history 1 Do you smoke Ask the participant whether she smokes and encircle the appropriate response 2 Do you consume alcohol Ask the participant whether she drinks alcohol in any form and encircle the appropriate response Section C Obstetric history 1 Are you pregnant for the first time Ask the participant if she is pregnant for the first time If the response is yes Primi then proceed on to the next section Note Primi means a woman who is pregnant for the first time A woman who has had abortion in the previous pregnancy is considered as multi and not primi If the response is no Multi write the number in the space provided after each question from Q No 2 Q no 6 Multigravida means pregnant woman who has had more than one pregnancy 2 Total number of conceptions including present pregnancy Gravida Note Gravida means pregnancy Gravida one means first pregnancy Gravida two means second pregnancy and so on 3 Total pregnancies that attained 24 weeks Para Note Para means the number of live born children a woman has delivered Viable pregnancy is from 24 weeks of gestation 4 Number ofliving children Write down the number of children who are currently living at the time of interview 5 Total number of abortions 14 N
106. nd encircle the appropriate response Section F Water Sanitation Hygiene 1 Cleanliness of the house Observe whether the house is clean or not and encircle the appropriate observation 31 2 Cleanliness of the surroundings Observe whether the surroundings of the house is clean or not and encircle the appropriate observation 3 Treating water Ask the mother whether is treating water before drinking purposes Here treating means boiling filtering or any other method of treatment 4 Toilet facility Ask the mother whether the house has a private toilet facility and encircle the appropriate response Once the interview is over thank the mother primary care taker for her co operation and time spending with you and leave the house Notes for analysis of ARI data ARI Runny nose or congestion either with or without fever lasting at least 72hours being considered a new episode if there was a 48 hour symptom free interval Undifferentiated fever Fever Not associated with other symptoms and lasting for at least 48 hours Diarrhea At least three watery stools in a 24 hour period being considered a new episode if there was a 48 hour symptom free interval Longitudinal prevalence The proportion of days on which a given child suffers symptoms of illness For e g if the child had fever for 2 days in one visit then the LP is 13 3396 based on a recall period is 15 days i e the total observed days per visit per child i
107. ndow i ii iii iv V vi vii viii Last name the participant s actual name First name initials or second name ID ICMR ID DOB Date of birth Sex Male or Female Height cm Weight in kg Predicteds Select Knudson 1976 1983 Ethnic group Select Other and then South Indian 56 3 Then click on the button More which will open the window for Additional Patient Information and add the following details a Address Locality District State Note Now if a dialogue box Patient Information pops up with the message The patient s age height or weight is outside of the published range for the selected predicted equation set Predicted values can still be calculated through extrapolation Do you want predicted values calculated this way for the patient click the button Yes 4 It will lead to the window Enter Edit Patient Information showing only the current participant s details now click on the button Close it will lead to the specific record for that participant in the home window 7 5 7 STARTING THE TEST 1 Click on the icon Perform FVC Test on the home window which will open a window FVC Test with the predicted plot pink squares 2 Now get back to the participant a Position the participant appropriately as mentioned below b Demonstrate the procedure once c Perform the test Positioning the Participant 1 Askthe participant to loosen tight clothing and waist belt if any 2 A
108. necting piece between pneumotach and mouthpiece Disposable Mouthpiece Liter calibration syringe Connecting piece between syringe and pneumotach with filter Stadiometer tape for measuring height scales for weight oN oO Ui BR WN FP Bronchodilator administration Inhaler Spacer Mouthpiece 48 KoKo Spirometer Pneumotach Spirometer connected to laptop Mouthpiece Connecting piece Pneumotach with Mouthpiece between pneumotach and mouthpiece 7 2 Definitions Figure 1 Spirometer and accessories The following standard definitions criteria are used for parameters recorded using the spirometer Abbreviation Parameter Definition Explanation Details units VC Vital capacity litres The volume change between the position of full L inspiration and complete expiration FVC Forced vital capacity The maximal volume of air exhaled with litres L maximally forced effort from a position of maximal inspiration FEV1 Forced expiratory The maximal volume of air exhaled in the first volume in one second of a forced expiration from a position second litres L of full inspiration FEV1 Forced expiratory The ratio of FEV1 to FVC expressed asa 49 FVC volume in one second to forced vital capacity ratio percentage FEF25 75 Forced mid expiratory flow litres per second L s 1 The average flow meas
109. nformed consent using Data Form AC 2 v assessment of chronic respiratory symptoms through administration of the INSEARCH questionnaire Data Form AC 3 and vii assessment of lung function at the household Data Form AC 4 Tool Box meetings for Screening for eligibility assignment of at hosuehold using recruitment locations p questionnairre Data Form TB AC DataForm AC 1 Administration of the Informed consentto INSEARCH enroll eligible women Questionnairre nm and using tne UC informed consent form Data Form AC 3 Data Form AC 2 Lung Function Tests Data Form AC 4 Figure 1 Steps involved in collection of health data in the TAPHE Adult Respiratory Health Study 36 3 Tool Box Meetings A 10 15min tool box meeting is conducted every week to plan field activities and logistics by the scientist in charge Tasks are spread across the data collection elements based on weekly monthly or yearly targets for data collection and availability of field teams vehicles Check against the Tool Box Meeting Information Sheet for your assigned task before assembling relevant field materials Take only required number of copies of questionnaires or data forms Document the date location of field visit type and quantity of field equipment in the tool box meeting data sheet every day see Data Form TB Information Sheet Do not assume a default schedule as the field schedules change frequently and at s
110. ng sound from your chest during the 15 last 12 months Self explanatory Give answer in Yes or No In case of doubt give answer as No Codes Yes 1 No 0 If Yes specify the number of years for which present If No enter 99 Have you ever woken up in the morning with a feeling of tightness in the chest or of breathlessness Self explanatory Give answer in Yes or No In case of doubt give answer as No Codes Yes 1 No 0 If Yes specify the number of years for which present If No enter 99 Shortness of breath 16 17 18 Have you ever felt shortness of breath after finishing exercises sports or other heavy exertion during the last 12 months Self explanatory Give answer in Yes or No In case of doubt give answer as No Codes Yes 1 No 0 If Yes specify the number of years for which present If No enter 99 Have you ever felt shortness of breath when you were not doing some strenuous work during the last 12 months Self explanatory Give answer in Yes or No In case of doubt give answer as No Codes Yes 1 No 0 If Yes specify the number of years for which present If No enter 99 Have you ever had to get up at night because of breathlessness during the last 12 months Self explanatory Give answer in Yes or No In case of doubt give answer
111. ng subsequent visits to same household recruitment location Once the form is complete the study instruments should be stored in an access restricted data storage room after removing the identifier information as the unique ID is the variable which relates with all study instruments Scientists should hand over questionnaires field forms to the data entry operators A log of what was handed to the data entry team must be independently maintained and verified gainst what is handed back after data entry Data is entered into the MS Access database Microsoft Corp Inc designed to accommodate the data analyses requirements for the TAPHE study The relational database architecture allows various tables in the database to be connected through the unique ID The second level data quality check is done at this stage on a half yearly basis wherein simple frequencies are taken to find out artifacts These artifacts are then checked with the data forms for data entry errors The database is then ready for statistical analysis 33 10 References Management of the child with a serious infection or severe malnutrition guidelines for care at the first referral level in developing countries World Health Organization Integrated Management of Childhood Illness WHO FCH CAH 00 1 Available online http www who int child adolescent health publications referral care chap3 chap31 htm 34 STANDARD OPERATING PROCEDURES FOR ASSESSING CHRONIC RESPIR
112. nsfer the filtrate to a clean turbo vap vial Rinse the 50ml pear shaped flask 3x and add the rinse to the turbo vap vial Concentrate up to 6 filter extracts in 6 individual turbo vap vial using ultra pure N2 When the contents in the turbo vap vials reach 300ul turn off the N2 flow to tubes and switch off the turbo vap Using a clean syringe rinse 20x with DCM before each new sample to draw up the contents turbo vap vial Measure and record the final volume of the sample Transfer the syringe contents to a clean 2 ml vial with a glass insert and Teflon septum Label vials with appropriate identification and store them in freezer at 20 C If three filters are used in the sampling train then combine the front and middle filters for extraction extract the third filter separately and analyze to estimate break through concentration 5 Analysis of PAHs 8 1 PREPARATION OF STANDARD SOLUTIONS 1 ii iii iv Take few mL of dichoromethane DCM in 10 ml volumetric flask Add 20ul of PAH standard mix 16 analyte s 500ug mL 500ppm using a positive placement pipette and make it up to the mark with DCM Prepare enough standards to fill the range between 25 50 100 200 500 and 1000 ng ml using 5 ml volumetric flasks to make1 5 serial dilution Run the standards along with extracted PAH samples Each injection takes approximately 90 minutes and samples should not be allowed to sit in the auto sampler tray for more
113. nt to the Tamil Nadu Air Pollution and Health Effects Birth weight Acute respiratory infections TAPHE BW ARI Study It includes details for i screening pregnant women at primary health care centers PHC or urban health posts UHP to assess eligibility for enrollment in the mother child cohort ii seeking informed consent to enroll both the mother and the child iii collecting maternal antenatal health data iv collecting birth outcome data and v collecting data on acute respiratory infections ARI in children less than 2 years old 2 Summary of the method The SOP covers five sequential steps Figure 1 that includes i assigning field tasks for health teams at tool box meetings using the Tool Box Information Sheet ii screening pregnant women presenting themselves at the respective PHCs UHPs using data form MC 1 iii assessment of eligibility iv securing written informed consent using data form MC 2 v collection of maternal health data through household visits to cover every trimester using data form MC 3 vi collection of birth outcome data after delivery of the child using Data form MC 4 and vii collecting data on ARI in children through monthly household visits until 24 months of age using Data form MC 5 Tool Box meetings for assignment of recruitment locations Data Form TB MC Periodic Household Visits Administration of ANC Questionnairre Data Form MC 3 Collection of Birth Outcome Data u
114. nto the body of the cyclone Remove the inlet cover of the 3 stage filter cassette and attach the cyclone separator along with calibration chamber The outlet of the filter cassette is to be connected to inlet of the air sampler by tygon tube The cyclone should be set up for normal use with a fresh filter The entire assembly primary calibration assembly should be placed vertically as shown in Fig 3 Wet the inner side of the burette wall with soap solution Turn the air sampler on and set the flow rate to 1 5 L min by using the knobs as shown in manual of the air sampler 70 m Take the beaker to the mouth ofthe burette so that a single soap film layer is created in the burette Do not keep the beaker near the mouth for longer duration to avoid multiple film layers n To compute air flow rate follow steps given in 5 1 2 steps m n and o Ifthe average time taken for the soap bubble to travel deviates 0 1 seconds repeat the measurement three times without adjusting the flow rate and take the average p Repeatthe above steps for calibrating air samplers before and after sampling q Record calibration details against each pump ID in Data Form EXP 1 Soap bubble meter Filter cassette BGI Cyclone separator Calibration Tvgon tube SKC air meter Soap bubble Figure 4 Primary calibration assembly 71 5 2 Filter conditioning and weighing Data Forms EXP 3 and EXP 4 A person familiar with standard pr
115. o stand on the scale Record her weight e Give the mother the child to hold Wait until the numbers on the display no longer change e Record the weight of the mother and child to the nearest 0 1 kg in the questionnaire e Thank the respondent and tell her something nice about her child e The scale will turn itself off after a short while Scale Maintenance e Do not drop or bump the scale e Do not store the scale in direct sunlight or other hot places For example do not leave the scale in a parked vehicle on a sunny day e Protect the scale against excess humidity and wetness e Do not use the scales at temperatures below 0 degrees C or above 45 degrees C e To clean the scale wipe surfaces with a damp cloth Never put the scale in water Mid upper arm circumference MUAC MUAC is the circumference of the left upper arm measured at the mid point between the tip of the shoulder and the tip of the elbow olecranon process and the acromium It is measured by using flexible medical measuring tapes called Gullick inch tape Fig 4 With the left arm bent it is recommended to use a string to find the midpoint of the arm between the shoulder and the tip of the elbow MUAC should then be measured while the arm is hanging down the side of the body and relaxed Wrap the measuring tape around the arm at the level of the upper arm mid point mark Position the tape perpendicular to the long axis of the upper arm Check that the tape fits
116. o the end of the body If the end cap is slightly loose the retaining ridge on the pin clip will hold it in place j Next turn the body of the sampler badge over and repeat step iv and then place a NO coated filter by opening the vial another screen and secure both ends with an end cap k Attach the sampler body onto a pin clip supplied by Ogawa and label the sampler sides to identify NOx NO2 SO2 and filters respectively 1 After assembly place the loaded samplers into a re sealable plastic bag and store them in brown airtight containers Fig 3 m Transport the samplers in brown containers to field locations 120 Asse nm b ly of All sampler components should be carefully rinsed with pure water and dried before each use Ogawa Sa nm D I er The sampler is comprised of 2 identical chambers Each of which is assembled as is described below 1 Diffuser End Cap 2 Stainless Screen 3 Collection Pad 14 5mm 4 Teflon Ring 5 Teflon Disk 6 Body Start at the inner most position with the Teflon disk and progress outwards to the diffuser end cap Place stainless screen on the ring Place second Insert end cap screen on the b collection pad to secure ASSEMBLY should be done using pincers for touching all internal parts of sampler ASSEMBLY should be done in a clean area Place Teflon ring Place Teflon disk on the disk into innermost position Place co
117. ocedures for filter weighing should handle filter room conditioning filter weighing and data reporting Also perform the following initial checks prior to setting up for filter conditioning and weighing a Aclean lab coat non powdered gloves and shoe covers must be worn to avoid dust and oils present in the clothes and fingers from contaminating the balance b Usea clean pair of slippers if shoe covers are available c Clean the balance with dry tissue paper supplied with the microbalance at regular intervals d Strictly do not bring any food or drink into the weighing room e Do notleave the balance idle for more than 3 4 days f Make sure that the bubble of the weighing machine is within the circle If not adjust the screws given in the front legs of the balance 5 2 1 MATERIALS REQUIRED a Sartorious microbalance Model CPA2P F b Filters PVC MCE or PTFE types 37 or 47mm 5um pore size c Support pads d Three stage filter cassette e Desiccators with desiccants Drierite amp with indicator 4mesh Petri dishes Anti static ionization strip and cleaning brush a a Cleaning solution like Isopropyl Alcohol Data log sheet and register note book j Lab coat k Hand gloves l Dehumidifier m Air conditioner n Thermal stress monitor WBGT instrument 72 5 2 2 FILTER CONDITIONING SET UP All fresh filters must be conditioned for 24h in temperature and humidity controlled room befo
118. of effect each variable in the model being significant e g p 0 05 and or increasing the R2 for the model by a predefined amount e g 196 removing variables entered later in the process if they cause variables already in the model to become invalid according to guidelines mentioned above avoiding double counting by excluding overlapping buffers such as including roads in 0 20m and 0 40m and avoiding gaps in buffers such as including roads in the 20 40m buffer only if roads in the 0 20m buffer are already in the model Validate the LUR model either by using a reserved set of monitoring data or through cross validation techniques e g leave one out analysis Apply the LUR model For raster LUR apply the regression to the relevant rosters generated in step 3 to derive a final exposure raster e g ArcINFO local grid operators to perform a cell by cell calculation ArcGIS Raster Calculator Inspect the map to ensure that the mapped distribution is sensible If it is not iterate next rounds with the choice of monitoring sites used to develop the model e g identify and exclude outliers filling gaps in the geographic coverage or in specific subzones the range of predictor variables offered into the model the choice of buffer zones the rules for model development the spatial resolution and scale STANDARD OPERATING PROCEDURE FOR BIOREPOSITORY SAMPLE ARCHIVAL AND ANALYTICAL PROTOCOL TAPHE BIOREPOSITORY S
119. of issue 15 April 2010 Date of last review 19 November 2014 Prepared by Reviewed by Approved by Dr Naveen Puttaswamy Dr Sankar Sambandam Dr Kalpana Balakrishnan Mr Arulselvan Dr Krishnendu Sadasivam Mukhopadhyay Ms Amudha Natarajan Mr Venkatesan Doss 63 1 Purpose This document provides instructions for collection and determination of particulate matter PM mass concentrations for the purpose of estimating household micro environment PM concentrations and exposures concentrations following protocols developed by NIOSH method 0600 and standard procedures developed by Environmental Health Sciences division School of Public Health University of California Berkeley and RTI International NIOSH 1998 UCB 2005 RTI 2008 2 Scope and Applicability This document provides instructions to collect and determine PM mass concentrations in household micro environments It also outlines procedures for estimation of PM exposure concentrations using gravimetric method 1 and real time UCB particle monitor method 2 measurements These procedures are developed with specific modifications that are based on recommendations of manufacturers of locally available equipments and requirements related to field conditions i e indoor and near outdoor sites 3 Summary of procedures The SOP for PM collection and analysis involves four major steps grouped under i tool box meeting ii laboratory activities iii field activities iv
120. of the refrigerators and let it attain ambient temperature before the start of digestion Add 5 ml aquaregia mix to the beakers and allow it for 30min 10 In an empty beaker add 5ml aquaregia mix and treat this as blank 11 Switch the hot plate on and set the temperature to 120 C 12 Put the beakers on the hot plate and close the fume hood 13 Let the solution dry until 0 5ml is remaining observer estimation 14 Switch off the hot plate and open the fume hood slightly when the fumes from the beaker diminishes open the fume hood completely 15 Add 2ml of the aquaregia mix to the beaker swirl the acid in the beaker wearing thickly padded cotton gloves 16 Close the fume hood and switch on the hot plate 17 18 Repeat steps 12 to 16 until the solution is clear Once the solution looks clear rinse the beaker sides with distilled water and set the hot plate temperature to 150 C 19 Allow the samples to go dry completely 20 21 Switch off the hotplate Remove the beakers from the fume hood once it is cool 22 Add 2 to 3ml dilute acid rinse the beaker and transfer to 25ml labelled ID and 23 extraction date volumetric flask Make up the volume to 25ml with dilution acid and store it in a safe place at ambient temperature 4 3 2 ANALYSIS USING ICP MS Safety Precautions a b c d e g h Make Sure to close the instrument hoods and panels before operations Make sure to check t
121. om the combustion source and 1 5 m from the floor Avoid placing the pumps near windows walls or any other areas that obstruct air flow Start the pumps 10min prior to cooking activity Once sampling is done remove the filter cassettes from the pumps and cap it Wrap the cassettes in aluminum foil and transport in coolers back to the laboratory ix Store the sampled filters at 20 C in dark condition until further analysis 7 Sample extraction 1 iii iv vi vii viii ix xi xii xiii xiv Wash all glassware used for extraction process using magic mix and dry them at 105 C for 1 hour in oven Remove sampledfilters from the filter cassette place each filter in a 50ml beaker then add 50ul internal standard mixture 150ng D10 Phenanthrene and 50ng D10 Fluoranthene per ml to support the QA QC protocol followed by 5 ml of dichloromethane DCM and cover it with clean Al foil Sonicate for 15 minutes and transfer the extract to a second 50ml beaker Rinse the beaker 3 times with 5ml DCM and add the rinse into the second beaker and sonicate again for 15min Assemble a vacuum filter system with new Millipore FHUP 0 5 pore size filter and apply vacuum to rinse with 30ml of DCM Discard the rinse change to a clean 50ml pear shaped flask Pass the extract through the FHUP filter into the 50ml pear shaped flask Rinse the beaker 3x with DCM and pass it through the filter system Tra
122. ost likely surfaces for contact are mouthpieces and the immediate proximal surfaces of valves or tubing Indirect contact via animate and inanimate objects There is potential for transmission of TB various viral infections and possibly opportunistic infections and nosocomial pneumonia through aerosol droplets The most likely surfaces for possible contamination by this route are mouthpieces and proximal valves and tubing 53 Prevention and Precautions Standard precautions should be followed at all times Disease or cross contamination can be prevented by addressing the following issues regarding the source and the transmission of pathogens Ensuring a clean environment Use of individual mouthpiece Proper hand washing techniques Sterilisation and disinfection of equipment including valves and tubing Personal protective equipment e g gloves gown masks etc Isolation of infected patients Source Isolation Precautions for testing participants with open sores or haemoptysis Isolation of susceptible patients Protective Isolation Hands should be washed between tests and immediately after direct handling of mouthpieces tubing breathing valves or the interior surfaces of equipment to prevent transmission of disease pathogens 7 5 3 PREPARING THE PARTICIPANT Carry out infection control measures prior to testing as described previously Document if the participant has withheld bronchodilator medications prior to t
123. ote Abortion defined as expulsion of product of conception either spontaneous or induced which is less than 24 weeks of gestation MTP Medical termination of pregnancy Non medical 6 No of still births amp Infant deaths Note Still birth is delivery of a dead baby which was alive till the time of delivery This information will be present in the records Infant death is death of a baby who is less than one year of age 7 Fill up the Following details about previous conception s in the table given Note Record details on duration of previous pregnancies to include Term Delivery on or after 37 weeks of gestation pre term Delivery before 37 weeks of gestation or an abortion Expulsion of the fetus which is less than 24weeks of gestation Mark down the gender birth weight and the status of the child at birth of the baby If there is an infant death reported in Q no 6 ask for age in months at which the baby died Section D Details on Current Pregnancy 1 Last menstrual period LMP Write down the LMP Last menstrual period in lt dd mm yyyy gt format from the ANC records and counter check by asking the participant 2 Expected Date of Delivery EDD Write down the EDD Expected Date of Delivery in lt dd mm yyyy gt format from the ANC records and counter check EDD can be calculated by adding 7 days and 9 months to the LMP For example a woman s LMP is 02 01 11 her EDD would be 2 7 days 9 1 9 months 10
124. ould be calibrated at least once per year Follow the steps to perform flow calibration a Set the sampler to Stop mode b Install a filter cassette containing 47mm filter into the filter holding mechanism c Use fresh filters every time flow calibration is performed d In the main screen press F5 setup to display setup screen and press lt F2 Calib gt to display calibration screen e Attach a standard external flow measuring device e g Streamline flow transfer standard to the sample tube f Press lt F4 FlowC gt to calibrate the coarse flow channel and press lt F2 start gt to begin calibration g The screen will display enter actual flow rate when stable h When the flow is stable press lt F1 edit gt to enter the first rate as shown on the external flow measuring device i Press ENTER after inputting the value to register the change and move to the next point j The screen will display messages to enter the flow rates for the second and third flow calibration points k Follow steps f through i to calibrate other flow rates l When the last calibration point has been entered a flow calibration complete message will display m Press lt F5 FlowF gt to calibrate the fine flow channel n Repeat steps fthrough i to calibrate fine flow channel o When fine flow calibration is complete press lt ESC gt key three times to return the main screen 103 6 Sampling procedure Select urban or rural locations
125. out their opinion on the volume of vehicular traffic outside their house using their own judgment and mark the response 86 6 Does your family member own a vehicle Ask the participant and mark the response 7 Where is it parked If the previous question they answered No skip this question Ask participant and mark the response Other sources of ambient air pollution 8 Where do you dispose the garbage Ask the participant to choose among options and mark the appropriate response If there is no collection mention that too in others 9 How long is the garbage disposal facility from your home feet Ask the participant to specify the approximate distance to house and the disposal facility in feet 10 Specify the frequency of collection Ask the participant by listing the options and mark the response If it different from the options mark in others and specify the type 11 Is there a garbage dump near your area Ask participant and mark the response There is no dumping area or not known then skip the next two questions 11 What is the distance between dumping area and your home n feet Ask the participant about approximate distance in feet between dumping area and home If they don t know get help from other family members or get the area name 12 Is waste burnt in the dump Ask the participant and mark the response 13 Is waste burnt in your backyard Ask the participant and mark the appropriate response 14 Is any con
126. overy efficiency greater than 100 the recovery efficiency of 100 will be used to calculate the PAH mass viii The report for each filter sample shall contain the identified PAH names and their individual measured masses flags for high or low recovery efficiency and flags for any possible interference for concentration determination 10 Safety The toxicity or carcinogenicity of each chemical and reagent used in this method has not been precisely defined However each one must be treated as a potential health hazard and exposure to these chemicals should be minimized Some method analytes have been tentatively classified as known or suspected human or mammalian carcinogens Pure standard materials and stock standard solutions of these compounds should be handled with suitable protection to skin eyes etc a Chemists working in the laboratory should follow good laboratory practices amp safety rules i Wear lab coat and safety goggles when working in the lab ii All solvent work should be done in fume hoods iii Store chemicals and solvents under the hoods iv All chemicals and standards must be labeled with chemical name 11 Quality Assurance amp Quality Control QA QC 13 1 Quality assurance i Follow good laboratory practice guidelines strictly ii Use HPLC grade solvents for coating and extraction process iii Prepare fresh stock and working solutions throughout coating extraction and analysis process
127. p watch Filter cassette Three stage 37 mm PTFE filter 0 8 pore size Filter cassette holder PVC luer taper connector Flexible tubing Screw driver Calculator p Calibration form Air leak checking instrument 5 1 2 ROTAMETER CALIBRATION USING SOAP BUBBLE METER a Thoroughly wash the standard glass burette in and out with water 66 b Fixthe washed burette in the burette stand Fig 2 Keep diluted soap solution in the beaker and place under the burette b Clean the BGI cyclone separator and assemble the unit for calibration Use Data Form EXP 2 for instructions to clean and assemble cyclones c Fixthe rotameter in between the soap bubble meter amp calibration chamber Fig 2 d Connect soap bubble meter outlet to the inlet of rotameter by tygon tube e Connectrotameter outlet to the inlet of the BGI calibration chamber by tygon tube f Connect the filter cassette outlet to the inlet of the air sampler by tygon tube g entire assembly should be placed vertically as shown in Figure 2 h Setthe flow rate to 1 5 L min by using flow adjustable screw and start the air samplers i Start with 1 L min and record the readings for 7 times Record the Time and rotameter bottom ball value at the end of 7 reading j Take the beaker to the mouth ofthe burette so that a single soap film layer is created in the burette Do not keep the beaker near the mouth for longer duration to avoid multiple film layers
128. power supply Fill out the chain of custody form when you hand over or receive the filters from the field team with information about date time filter IDs batch number initials ofthe person weighing the filters field location field personnel handling the filters etc See chain of custody form Data Form EXP 4 amp Figure 6 Filter loading into the filter cassette after weighing 75 5 3 Quality Assurance and Quality Control This section provides a description of the steps to be followed to ensure quality assurance and quality control QA QC of filter weighing procedures 5 3 1 UALITY ASSURANCE QA Quality assurance provides confidence in the data and planned analysis Following steps are to be strictly followed to ensure QA objectives are met Measure and record room temperature relative humidity 96 date time and operator s initials during every weighing session in the filter weight log book a Monitor seasonal fluctuations in room temperature and relative humidity by analyzing daily temperature and Rh data b Same person should handle both pre and post weights of the filters and also complete data logging and entry c Ensurethe annual maintenance of the microbalance is completed by the technical personnel from the manufacturer and the certificate of inspection is displayed in the balance room at all times d Checkanti vibration tables and room conditioning devices periodically by service
129. pre weighed cassette Calibration filter Air leak check instrument Filter cassette holder Flexible tubing s Weighing machine Rope dust free Bag to keep air sampler Measuring tape SKC screw driver Digital camera Wrist Watch Tool kit hammer nail teflon tape cello tape sticker marker pen q Air sampling data sheet Data Form EXP 6 6 2 Air sampler Gravimetric placement and retrieval from field locations Data Form EXP 6 a Uponarrival in the field site choose appropriate locations in indoor and near outdoor micro environments to place air samplers For example if the location is in kitchen place the monitoring bag 1 meter away from the middle ofthe stove and about 1 5 meter above the floor b While placing the samplers outdoor care must be taken to select a location to protect the unit from sun and rain c Avoid placing the samplers near windows or doors Follow the same guideline for placing the samplers in other locations i e living and near outdoor and sites d Assemble the air sampler unit by removing the top piece of the filter cassette and screw the filter cassette having support pad filter to the cyclone 78 e Make sure there is no dust deposition over the filter paper f After assembling the air sampling unit test for air leaks using air leak check device g Connect the low volume sampler to the assembled unit and place it in a bag see Fig 7 to safeguard from external dis
130. r Space If you observe MORE THAN 30 breaths in 30 seconds note the first count in the comments section of the page and repeat the count for another 30 seconds Record the repeat count of chest rises you observe in the answer space If for some reason you cannot complete the second measurement record the first measurement in the answer space Q 9 During your observation for question Q 8 look for lower chest wall indrawing Lower chest wall indrawing Fig 9 occurs when the lower chest wall moves in when the child breathes in if only the soft tissue between the ribs or above the clavicle goes in when the child breathes this is not lower chest wall indrawing Q 10 Hear for any whistling sound comes from the child when she inhale or exhale out breathing in Lower chest wall indrawing with inspiration the lower chest wall moves in Fig 9 In drawing of lower chest wall Sick Child Protocol Children with symptoms of ARI cough or difficult breathing high breathing rate 60 min for 0 2 months 250 min for 2 12 months 40 min for gt 12 months lower chest wall indrawing or those who simply look ill or have one or more danger signs convulsions lethargy or unconsciousness inability to feed vomiting will be referred 30 to the nearest primary health centre PHC or district health post or SRMC based on the severity of the condition and feasibility for further diagnosis and management Enumerators should
131. r answers YES proceed to ask about when the symptoms began CIRCLE THE RESPONSE GIVEN L L daysago 1 L 11 Record when the symptoms began For example if the caregiver responds 2 days ago you record a 0 and 2 in the first line When did SYMPTOM begin L L daysago 1 Mark an X on the day that corresponds to the first day of the symptom If the first day was more than 2 weeks in the past then mark an X on day 14 Ask if the child still has the symptom If YES then mark an X on Today and connect the two Xs with a line If the child does not still have the symptom ask how many days the symptom lasted and count from your original X to the end of the symptoms Mark and X for each day with the symptoms or connect two Xs with a line Probe to complete the symptom calendar for the past two weeks If you can use actual days of the week Monday Tuesday Wednesday etc to help orient the respondent In rare circumstances a child may have multiple episodes of a symptom over the 14 day period see example D on the following page If you mistakenly record a day with a symptom where the child did not have the symptom cross out the incorrect day using a diagonal line across the box see example E on the following page Examples of how to record different symptom responses A Started 2 days ago and child still has symptom B Started 7 days ago and lasted for 5 days 28 C Started
132. r left hand on the child s shins above the ankles or on the knees Arrow 8 Press them firmly against the board With your right hand place the foot piece firmly against the child s heels Arrow 9 For infants quickly touch the soles of 21 their feet with your thumb to make the child straighten his or her knees e Check the child s position Arrows 1 9 Repeat any steps as necessary e When the child s position is correct read and call out the measurement to the nearest 0 1 cm Remove the foot piece release your left hand from the child s shins or knees and support the child during the recording e Record the length on the questionnaire Immediately release the child s head Help the child to get up or hand the child to the mother Height measurement e Place the measuring board on a hard flat surface against a wall table tree staircase etc Make sure the board is stable e Askthe mother to remove the child s shoes and upbraid any hair that will interfere with the height measurement Ask her to walk the child to the board and to kneel in front of the child e For mobility kneel on your right knee only on the child s left side Arrow 3 e Place the child s feet flat and together in the center of and against the back and base of the board Place your right hand just above the child s ankles on the shins Arrow 4 and your left hand on the child s knees Arrow 5 and push against the board Make sure the child s legs are stra
133. re using for sampling Filter conditioning process removes any trace moisture from the filters Follow the steps given here for filter conditioning a Using air conditioners and de humidifiers maintain the temperature T and relative humidity Rh inside the room at 20 24 C and between 42 to 4696 respectively b Useappropriate instruments e g WBGT monitors to monitor T and Rh c Oncethe room conditions are stabilized and or within the standard operating range then record the temperature and Rh values in the filter weight log book d Clean the desiccators inside and outside with a clean duster and add sufficient amount of fresh desiccants drierite with indicator 4mesh e Make sure that the fresh desiccants are blue in color when used drierite turns red from blue when it is saturated with moisture and no longer absorbs moisture from air f Using the forceps place a support pad in a pre labeled clean petridish and place the filter over the support pad only fresh and undamaged filters should be used g Make sure the non glossy side of the filter is face up and always handle the filters gently by holding at the edges h When placed outside the desiccators keep the petridish closed to avoid contamination of fresh filters i Placeten to twenty petridish in each desiccator Fig 5 j Remove the lids of petridish to allow for conditioning of filters i e to remove moisture k Filters should be desiccated for at least
134. remove UCB from air sampler bag note down the time of removal and place it in the zip lock bag to initiate post sampling zeroing period 80 xv Note down the start time and end time for the post sampling zeroing period in the data sheet xvi Connect the monitor to a computer using 9 pin serial cable or a USB cable xvii Open the UCB Monitor Manager Software and select offload data from this device to download the logged data xviii Select a proper data directory to save the data xix For data processing select initial as the zeroing period and enter the start and end times for zeroing period and sampling period xx graph will display particle concentrations mg m for household sampling duration 6 4 Administration of the General Household and Post Monitoring Questionnaire Data Form EXP 7 The general household questionnaire is administered to the participant to obtain baseline data on housing and household level variables that could potentially influence household and ambient exposures in both urban and rural areas The post monitoring questionnaire elicits information pertaining to the monitoring period to included time activity patterns from individual members as well as exposure variables that are likely to change from day to day such as cooking fuel use duration of coking use of incense etc 6 4 1 STEPS AT THE HOUSEHOLD Introduce yourself to the participant and brief them about t
135. ric analysis of respirable particualte matter collected by samplers with 4 um median cut point NIOSH Manual of Analytical Methods NMAM Fourth Edition 2 Pump and Filter protocol 2005 Standard operating procedure for measuring PM2 5 with SKC pump BGI cyclones and filters Indoor Air Pollution Team School of Public Health University of California Berkeley CA 3 RTI International 2008 Standard operating procedure for PM gravimetric analysis Environmetnal and Industrial Sciences Division RTI International RTP NC 97 STANDARD OPERATING PROCEDURE SOP FOR SAMPLING AND DETERMINATION OF PM10 AND PM2 5 IN AMBIENT AIR USING HIGH VOLUME SAMPLER TAPHE EXPOSURE STUDY ICMR CAR PROJECT DEPARTMENT OF ENVIRONMENTAL HEALTH ENGINEERING ICMR CENTER FOR ADVANCED RESEARCH ON ENVIRONMENTAL HEALTH AIR POLLUTION SRI RAMACHANDRA UNIVERSITY CHENNAI TAMIL NADU SOP ID 2 4 TAPHE EXPOSURE AMBIENT PM Date of issue 15 February 2011 Date of last review 5 January 2015 Prepared by Reviewed by Approved by Mr Sathish Madhav Dr Krishnendu Dr Kalpana Balakrishnan Mr Rengaraj Siva Mukhopadhyay Dr Naveen Puttaswamy Dr Sankar Sambandam 98 1 Purpose This document provides instructions for sampling suspended particulate matter in ambient air for both PM2 5 and PM10 using high volume dichotomous air sampler 2 Scope and Applicability This SOP describes steps involved in simultaneous sampling of PM2 5 and PM10 on separat
136. ropriate answer IL DETAILS ABOUT LIVING BED ROOM AREA Measure in living room in meters 1 Length 2 Width 3 Height 1 4 Height 2 93 Ventilation in living rooms 5 Entrance with door s Mark the appropriate answer 6 Number of door s If previous answer is YES then write the appropriate 7 Window s with door s Mark the appropriate answer 8 Number of door s If previous answer is YES then write the appropriate 9 Eve ventilators Mark the appropriate answer 10 Perforated ventilation jolly Mark the appropriate answer 11 Doors Measure the length and width of door 12 Windows Measure the length and width of window 13 Eves Measure the length width and height of Eve s Observe in kitchen 14 Number of walls Write the number of walls present in kitchen 15 Wall material Mark the appropriate answer 16 Roof material Mark the appropriate answer 17 Floor material Mark the appropriate answer Thank the participant for their time and remind them about your next visit 94 7 Calculation of PM Concentrations Exposures Check raw data for errors if any and have it approved by project scientist before entering data into the database Compute PM concentration in different micro environments i e kitchen living and outdoor followed by daily exposure concentration Follow steps given in sections below to compute PM area concentrations and exposure concentrations 7 1 Computatio
137. s a hydroxyl radical As a consequence of this step reactive molecules that are more toxic than the parent molecule are produced Phase II metabolism Phase II metabolism follows phase I activation in which the reactive intermediates are transformed into water soluble compounds that can be excreted through urine or bile Several types of conjugation reactions are present in the body including glucuronidation sulfation glutathione and amino acid conjugation Some of the phase II enzymes acetyltransferases glutathione 5 transferases uridine 5 diphosphoglucuronosyl transferases sulfotransferases aldoketoreductases transaminases and hydrolases When the body is confronted with a high xenobiotic load the phase I and or phase II enzymes involved in detoxifying this compound are induced leading to xenobiotic detoxification The variations in metabolic activities in each phase or in the coordination of the two phases affect the clearance of toxic metabolites It can therefore be assumed that individuals with increased metabolic activity and decreased detoxifying activity are at a higher risk of prostate cancer In other words in susceptible individuals a much lower level of exposure could produce adverse health effects as that seen with higher exposure in the average or non susceptible population Thus inherited differences in the effectiveness of activation and detoxification of carcinogens play a crucial role in cancer susceptibility
138. s she is not eligible for inclusion Explain to her that she is ineligible as the team will find it difficult to follow her at her workplace to profile dust exposures this being an air pollution related health study and thank her for her time 13 Is this pregnancy conceived naturally Ask the respondent if the current pregnancy was conceived naturally In case she is not sure prompt her with examples of common assisted reproduction methods such as intrauterine insemination IUI in vitro fertilization IVF a Ifthe response is Yes she is not eligible for inclusion Explain to her that she is ineligible as the team will find it difficult to follow her during the course of her pregnancy and thank her for her time 14 Write down her last menstrual period from the hospital records in lt dd mm yyyy gt format 15 Write down her expected delivery date from the hospital records in lt dd mm yyyy gt format 16 Write down her current residence and her parent s residence addresses completely with pin code and contact mobile numbers If she is eligible based on responses to question 10 12 and 13 ask her if she is interested in being a study participant and sign an informed consent If she is eligible and willing to participate encircle the option INCLUDE if not eligible encircle EXCLUDE and if eligible but not willing encircle NOT WILLING If she is not willing request her to provide a reason and encircle the appropri
139. screens for 5 minutes then rotate the beaker a quarter turn this procedure must be continued for a total of 15 minutes Be careful not to damage or lose the wire mesh screens during handling e All parts ofthe passive sampler must be clean and completely dry before assembling the sampler After cleaning lay the parts on Kimwipes to dry While drying cover with one large Kimwipe to prevent dust dirt from settling on the clean parts Inspect the pin clips for obvious dust dirt etc If necessary rinse with Milli Q water and lay on Kimwipes to dry Reference http ogawausa com wp content uploads 2014 04 prono noxno2so206 pdf Last accessed on 29 11 2014 Ogawa amp Co Pompano Beach FL US Liu LS Melvin P Olson III Allen GA Koutrakis P McDonnel WF Gerrity TR Evaluation of Harvard ozone passive sampler on human subjects indoors Environ Eci Technol 1994 28 5 915 923 STANDARD OPERATING PROCEDURE FOR SAMPLING AND ANALYSIS OF TRACE METALS IN HOUSEHOLD MICRO ENVIRONMENTS TAPHE EXPOSURE METALS STUDY ICMR CAR PROJECT DEPARTMENT OF ENVIRONMENTAL HEALTH ENGINEERING ICMR CENTER FOR ADVANCED RESEARCH ON ENVIRONMENTAL HEALTH AIR POLLUTION SRI RAMACHANDRA UNIVERSITY CHENNAI TAMIL NADU SOP ID 2 7 TAPHE EXPOSURE METALS Date of issue 15 February 2011 Date of last review 5 January 2015 Prepared by Reviewed by Approved by Dr Naveen Puttaswamy Dr Krishnendu Dr Kalpana Balakrishnan Mr Srinivasan Nat
140. ser end cap see Fig 2 and Fig 3 Starting at the innermost position at one end of the sampler body first place the Teflon disk followed by Teflon ring and stainless screen This prepares the base for all passive samplers Follow steps below for assembling pre coated filters for specific gases 119 e Open the vial containing the SO2 or pre coated filters Use forceps to gently grip one of the filters by its edge Place the filters top of the stainless screen see Fig 3 Be careful not to damage the filters and watch that it sits flat on the stainless screen If a filter is dropped discard it and get another from the glass vial Be careful not to contaminate the unused filters and close the vial tightly f For 502 samplers only one filter is required for 502 sampling and quantification Therefore leave the other side of the sampler empty or place all parts except the SO2 filter g For samplers use both sides of the sampler for collecting and quantifying in each sampling location For this repeat steps c through e to assemble the opposite side of the sampler h For NO2 NOx sampler assembly open the vial containing the NOx pre coated filters Use forceps to gently grip one of the filters by its edge Figure 6 Place the NOx filter top of the stainless screen on one side of the sampler i Place second stainless screen over the NOx pre coated filter followed by a diffusion end cap Securely place an end cap int
141. sing Birth Outcome Questionnairre Data Form MC 4 Screening for eligibility at PHC UHP using screening questionnairre Data Form MC 1 Informed consentto enroll pregnant mother and child using informed consentform Data Form MC2 Periodic surveillance for child ARI using Child Health Calenders Data Form MC 5 Figure 1 Steps involved in collection of health data in the TAPHE BW ARI Study 3 Tool Box Meetings A 10 15min tool box meeting is conducted every week to plan field activities and logistics by the scientist in charge Tasks are spread across the data collection elements based on weekly monthly or yearly targets for data collection and availability of field teams vehicles Check against the Tool Box Meeting Information Sheet use Data Form TB for your assigned task before assembling relevant field materials Take only required number of copies of questionnaires or data forms Document the date location of field visit type and quantity of field equipment in the tool box meeting data sheet every day see Data Form TB Do not assume a default schedule as the field schedules change frequently and at short notice PHC UHP have designated days of the week assigned for antenatal screening The schedule for recruitment teams should be based on the schedules of relevant PHCs UHPs Prepare a call list based on intended area of visit to inquire about availability of participant via phone Include additional househol
142. skthe participant to stand comfortably 3 Explain and demonstrate the test maneuver to the participant including e Correct use of mouthpiece e Correct posture with head slightly elevated e Position of the mouthpiece including tight mouth seal over the mouthpiece e Complete inhalation prior to FVC and FEV1 e Rapid and complete exhalation with maximal force for FVC and FEV1 4 Askthe participant to sit in front of you looking away from the recording Note The technician s Position should be in such a way that the air blown out by the participant through the pneumotach does not hit his her face or body directly Demonstration of test 57 There are 3 distinct phases to the FVC maneuver as follows 1 Maximal inspiration 2 A blast of exhalation and 3 Continued complete exhalation to the end of test EOT Demonstrate all the 3 phases Performing the test Tear open the cover from the side with a cut and take out a fresh mouth piece in front of the participant and fit it to the pneumotach and hand it over to the participant Guide the participant in placing the mouthpiece properly and instruct the participant to close the lips tightly around the mouthpiece Instruct the participant to perform the test only upon indication tell that he she should not even take the pneumotach near the mouth before asking him her to start Activate the spirometer by clicking the Start icon and Instruct participant to position the
143. snug around the arm Take the measurement to the nearest 0 1 cm 25 Length measurement using SECA mat Height measurement using Stadiometer Mid upper arm circumference Weight measurement using MUAC Electronic Weighing scale Fig 7 Actual field photos of the anthropometry assessment Precautions while doing anthropometry in children Two trained people are required to measure a child s height and length When measuring a child the field staff member holds the child and takes the measurements Another field assistant or the mother helps hold the child while the former records the measurements on the questionnaire If two members are not available only weight measurements are feasible Restraining the child When you weigh and measure you must restrain the child The strength and mobility of even very young children should not be underestimated Be firm yet gentle with children Your own sense of calm and self confidence will be felt by the mother and the 26 child When a child has contact with any measuring equipment i e on a measuring board you must hold and restrain the child so the child will not trip or fall Never leave a child alone with a piece of equipment Maintaining patience while making measurements on the children Since weighing and measuring requires touching and handling children normal stress levels for this type of survey work are higher than for surveys where only verbal information is collected
144. ssette having support pad filter to the cyclone Make sure there is no dust deposition over the filter paper After assembling the air sampling unit test for air leaks using air leak check device Connect the low volume sampler to the assembled unit and place it in a bag Switch on the sampling pump and program the air sampler for 24 hours After 24 h of sampling remove air samplers and disassemble the unit aa Separate the filter cassette from the cyclone and recap it immediately bb Administer a post monitoring questionnaire to collect information relevant to metal sources cc Transport the sampled filters in air tight containers along with the field blanks dd Upon arrival in the laboratory hand over the sampled filters and record this in the chain of custody sheet 4 3 Analysis 4 3 1 ACID DIGESTION 1 2 ge gt 9 Prepare aquaregia mix 1 3 v v HNO3 and in an ice bath Rinse all glass wares with conc nitric acid and then with distilled water and dry them before use Carefully fold the filter paper in two three folds with the exposed portion in the inner side Place the folded filter paper in a clean beaker and cover it with watch glass Place blank filters in separate beakers Label the beakers appropriately and note down the beaker numbers filter ID If digestion is not carried out immediately seal the beakers with paraffin film and refrigerate in 4 C Take the beakers out
145. struction activity going on near your house Ask the participant and mark the appropriate response If the answer is NO or Unknown Unspecified then skip the next question 15 At what distance 1 feet Ask the participant about the distance between house and place were construction activity is going Note down their response in feet 87 Household air pollution sources 1 Is your house situated inside agricultural field Ask the participant and mark the response The house situated inside means it should surrounded by four sides 2 How far is the field from your house feet If the agricultural field is nearby to the house one side also then approximate distance to the field in feet 3 Do you store Pesticides Fertilizers in your house Ask participant regarding storage of the Pesticides Fertilizers for farming purposes and mark the appropriate response 4 Do you have domestic animals at your house An animal that has been tamed and kept by humans as a work animal or food source is called as domestic animal If No for Q G 4 skip next question 5 If Q G 4 is yes specify the type animal Ask the participant about the type of domestic animal and mark the appropriate response Do you have any pet animals inside your house Pet animal is an animal kept primarily for a person s company or protection 6 If Q G 6 is yes specify the type of animal Ask the participant about the type of pet animal they have and mar
146. t e If unable to record 3 technically correct tracings inform the participant that he she can try it during the next visit note down his her next probable day of visit in the log book e case thank the participant for sparing the time Demonstration Participant Performance Observation of tracings Peak of flow volume should be sharp Expiratory effort should last for 6 seconds in the volume time curve The test should be repeated if coughing occurs during the first second of tracing which interferes with FEV1 At least 3 efforts should be acceptable and reproducible 7 5 8 DETERMINING ACCEPTABILITY AND REPEATABILITY OF MEASUREMENTS e Clinically useful spirograms must be acceptable ie meet the criteria that comprises a good quality maneuver and repeatable i e the two highest FEV1 FVC and VC from three acceptable maneuvers are in close agreement A spirogram is acceptable if the following are met 59 Start of test criteria Begins from full inspiration A rapid start of test If the maneuver has an obviously hesitant start then the trial should be terminated early to avoid unnecessary prolonged effort Middle of test criteria No obstruction hesitation or artifact impeding the blow including Cough during the first second of exhalation Glottic closure that influences the measurement Early termination or cut off Effort that is not maximal throughout Air leaks at
147. than 8 hours before injection 8 2 METHOD PARAMETERS The instrument parameters used in Gas Chromatograph Thermo Scientific trace GC ultra and the mass detector Quantum MS MS TSQ is provided here 1 iii vi vii Prior to PAH analysis allow the calibration standards or RS if assessing recovery efficiency the extract samples the IS and the QC solutions to reach room temperature Clean and fill the GC pre cleaning and post cleaning vials for the auto sampler with DCM All sample vial septa for GC analysis must be Teflon to avoid PAH contamination Load the DCM blank calibration standards sample extracts IS and QC samples to the GC MS auto sampler Start the analysis with the DCM blank followed by calibration standards to establish GC MS background and performance Analyze at least one QC and one duplicate sample for every 10 sample extracts Set up the sequence for sample analysis OVEN Coloumn DB 5MS Length 30m Internal Diameter 0 25mm Film Thickness 0 24 Maximum Temperature C 350 Prep Run Time out min 10 Equilibration time min 0 5 Enable Cryogenics off Initial Temperature C 80 Initial Time min 0 4 Number of ramps 3 Rate 1 C min 25 Final Temperature 1 C 185 Hold Time 1 min 0 00 Rate 2 min 10 Final Temperature 2 C 250 Hold Time 2 min 0 00 Rate 3 min 1 5 Final Temperature 3 C 310 Hold Time 3 min 0 00 Post Run Temper
148. tion in kitchen location1 T1 total time spent in kitchen area L2 concentration in living area location2 T2 total time spent in living area 03 concentration in near outdoors location3 T3 total time spent in near outdoors 04 concentration in outdoor environment location 4 T4 total time spent in outdoor environment and T1 T2 T3 T4 24 7 2 2 METHOD 2 This is a hybrid of two methods i e gravimetric and UCB PM measurements This method provides both spatial and temporal resolution for estimating PM exposure concentrations Follow the steps to compute PM exposures using method 2 ili Co locate UCB monitors and active air samplers gravimetric method in household micro environments Identify six time windows i e 4 h each from the real time UCB records such that the individual peaks are covered at least within two 4 h time window see data form EXP 8 Calculate ratio for 4 h 24 h UCB PM concentration for each time window Compute 24 h exposure concentration as follows Ck Tk R1 Ck Tk R6 CI TI R1 CI TI R6 Co To R1 Co To R6 Exposure mg m Tk To 96 Where Ck Cl Co 24 h gravimetric PM conc in kitchen living amp outdoor locations respectively Tk TI To Total time spent in kitchen living amp outdoor locations respectively R1 R2 R6 ratio 4 h PM 24 h PM from UCB real time records 8 References 1 NIOSH Method 0600 1998 Gravimet
149. tion should be done and 3 The dates of computer software and hardware updates or changes calibration checks and quality control procedures must be repeated before further testing begins References 1 American Thoracic Society Pulmonary Function Laboratory Management and Procedures Manual 1st ed American Thoracic Society 1994 2 Jindal S Aggarwal A Gupta D Agarwal R Kumar R Kaur T Chaudhry K Shah B Indian Study on Epidemiology of Asthma Respiratory Symptoms and Chronic Bronchitis in adults INSEARCH The International Journal of Tuberculosis and Lung Disease 16 9 2012 pp 1270 1277 8 3 Miller MR Crapo R Hankinson J Brusasco V Burgos F Casaburi R et al General considerations for lung function testing Eur Respir J 2005 Jul 26 1 153 61 4 Miller MR Hankinson J Brusasco V Burgos F Casaburi R Coates A et al Standardisation of spirometry Eur Respir J Practice Guideline 2005 Aug 26 2 319 38 5 Queensland Guideline for Spirometry Adult Respiratory Science Document Number QH GDL 386 2012 www inspirehealth com 62 STANDARD OPERATING PROCEDURE FOR SAMPLING AND ANALYSIS OF PARTICULATE MATTER PM IN HOUSEHOLD MICRO ENVIRONMENTS TAPHE EXPOSURE STUDY ICMR CAR PROJECT DEPARTMENT OF ENVIRONMENTAL HEALTH ENGINEERING ICMR CENTER FOR ADVANCED RESEARCH ON ENVIRONMENTAL HEALTH AIR POLLUTION SRI RAMACHANDRA UNIVERSITY CHENNAI TAMIL NADU SOP ID 2 3 TAPHE EXPOSURE PM Date
150. to handle each blank similarly to the samplers remove the blanks from the sealed bags and then immediately place it back in the bag and put it in brown containers At the end of the sampling period usually 3 to 5 days remove the sampler and place it in re sealable bag and put it in the same brown containers used to transport the samplers to the field locations Remove the USB data logger and record the stop time and date in the data log sheets Make sure all fields in the field data log sheets are entered before leaving the field location 7 Disassembly of the sampler Sampler disassembly and preparation for analysis is done in a clean and dust free space in the laboratory The following supplies are needed for this process i ii iii iv V vi vii clean dry extract vials with caps beakers for used sampler components glass Petri dish small and large Kimwipes tissues squeeze bottle with Milli Q water forceps blunt for filter handling forceps un serrated sharp with curved tip Follow the general steps given here for disassembling NOX NO2 S02 and 03 passive samplers and wherever applicable specific procedures are provided for individual gases a To prevent mislabeling of the samplers process only one sampler at a time b If you start with NOx NO2 complete disassembly of all NOx NO2 samplers and then move on to others c Removethe sampler from the brown container and remove the sampler badge from
151. turbances like sound unwanted collision of tubing etc h Switch on the sampling pump and program the air sampler for 24 hours i After 24 h of sampling remove air samplers and disassemble the unit j Record placement and removal details on Data Form EXP 6 k Separate the filter cassette from the cyclone and recap it immediately l Administer a post monitoring questionnaire refer to section 6 4 to the study participant m Transport the sampled filters in air tight containers containing a field blank n Uponarrival in the laboratory hand over the sampled filters and record this in the chain of custody sheet Data Form EXP 5 Follow the procedures outlined in section 5 2 for taking post weights of the sampled filters p Enter the filter weights into the database along with values for other parameters q Calculate PM mass concentration using methods provided in section 7 Figure 7 Air sampling unit placement in kitchen area in secured bags 79 6 3 Real time particle monitor UCB placement and retrieval A continuous portable data logging device developed by the University of California Berkeley referred to as UCB monitors is used to measure PM2 5 mass concentrations in real time in household micro environments and also for estimating exposure concentrations This section outlines instructions for the use of UCBs in PM monitoring based on UCB Particle Monitor User Manual 2008 1 vi vii
152. u ER EE HD EGER NE RE ROG 77 6 4 Administration of the General Household and Post Monitoring Questionnaire Data Form EXP 7 inicusasxininac cua cuna nudi cuna ria d Cara cape S 81 6 5 Post Monitoring Questionnaire eeeeeeeeseeeeenetet nnne tn tn enata atate ns 90 7 Calculation of PM Concentrations Exposures erre etate nns 95 REPO CE E LL LIII 97 STANDARD OPERATING PROCEDURE SOP FOR SAMPLING AND DETERMINATION OF PM10 AND PM2 5IN AMBIENT AIR USING HIGH VOLUME My Wi d B orc 98 T PurpOSe A 99 2 Scope and Applicability eese eene tnt tete tatum enata tna tates 99 3 Apparatus WES CHU UI OM eyed 99 4 Apparatus raga e d ed arx 100 b tut iecore daten aine 103 6 Sampling c der pd tees ci annunin amanaia aranana A AUGEN 104 7 Field QC procedure i i tid i nc da 105 9 Calculations iussi heri itn Di a asina DRE RERO LEUR e ELE EVA iU Sad REG 106 STANDARD OPERATING PROCEDURE FOR SAMPLING AND ANALYSIS OF VOLATILE ORGANIC COMPOUNDS VOCs IN HOUSEHOLD MICRO ENVIRONMENTS RENI DD ETUR dud 108 T
153. u use any of the following on the monitoring day Ask the participant and mark the response Other information 1 Wasthe weather same during the monitoring period Ask the participant and mark the response 2 Please describe the weather If they answered NO for previous question ask the participant and write down the response 3 Were there any disturbances to the equipment and or to the household members Ask the participant and mark the appropriate response 4 Please describe the disturbance s If they answered YES for previous question ask the participant and write down the response 5 Whether the outside traditional stove was used at the time of monitoring Ask the participant and mark the appropriate response 6 Whether the door was open during the monitoring period Ask the participant and mark the appropriate response 7 Whether the window was open during the monitoring period Ask the participant and mark the appropriate response 91 6 3 4 TIME ACTIVITY SURVEY ICMR CAR HH ID Please write down this ID from the household questionnaire Monitoring ID Ask the participant during the 24 hrs monitoring period what they did and where they spent the time for particular activities Use the activity code and location code to write If they cannot respond assist them further with questions such as What time did you cook How long did it take etc 6 4 5 OBSERVATIONS AND MEASUREMENTS 1 Is the house surrounded by
154. uire battery powered air samplers are easy to assemble install sample and analyze 3 Summary of Methods The passive monitor badges consist of pre coated filters with specific oxidizing reagents that collect NOx and NO2 simultaneously SO2 and Pre coated filters are supplied by Ogawa amp Co FL These filters are extracted with ultra pure water and the extract is analyzed either by spectrophotometer or chromatography to determine the concentrations of different gases Tool box meeting Assembly of passive samplers Sampling Disassembly of passive samplers Figure 1 Steps involved in preparing and sampling for NOx NOz SO and using passive samplers badges 117 4 Equipment and supplies 16 sampler body with 2 spacer disks amp 2 rings 17 diffusion end caps 1 per end 18 stainless steel screens 2 screens per end 19 pin clip holder 20 storage bottle amber polystyrene 21 re sealable plastic bag tape to seal storage bottles Other materials A Pre coated filtersor collection pads for NOx NOz SO and ID identification labels Forceps sharp with curved tip Desiccator Aluminum Foil Clean paper towel B E Milli Q water or di ionized water F G Kimwipe tissue H Carrying case Tool kits 4 2 Assembly of Ogawa passive samplers Pre coated collection pads or filters for specific gases i e NOx amp NO 502 and 03 along with other samp
155. ured over the middle 50 of an FVC maneuver Also known as mid expiratory flow PEF Peak expiratory flow The maximum expiratory flow achieved froma litres per second L s maximum forced expiration starting without 1 or litres per hesitation from a point of maximal lung minute L min 1 inflation TLC Total lung capacity The volume of gas in the lungs after maximal litres L inspiration or the sum of all volume compartments Definition Explanation Satisfactory start middle and end of test Acceptability Criteria conditions Closeness of agreement between the results of successive measurements of the same maneuver carried out subject to all of the following conditions same Repeatability Criteria method same observer same instrument same location same conditions of use and repeated over a short space of time 7 3 Screening Checklist for PFT Use Data Form AC 4 Contraindications for performing spirometry Some conditions may pose a relative danger to a participant or affect the validity of spirometry performance and results These include but are not limited to the following 50 Unstable cardiovascular status unstable angina recent myocardial infarction within one month or pulmonary embolism Haemoptysis of unknown origin Recent pneumothorax Thoracic abdominal or cerebral aneurysms Recent thoracic abdominal or eye surgery Acute disorders such as nause
156. using external standard calibration Gas Chromatography Agilent 6890 GC Mass Spectroscopy HP 5973 Thermal Desorption Chamber 200 C for 5 min using He Gas at 20 ml min Column DB 17 30 m x 0 25 mm ID 0 25 um film thickness Carrier Flow Rate 1 0 mL min Cold Trap Temperature 10 C Desorption Temperature 200 C for 4 min Transfer Line Temperature 150 C Initial Column temperature 50 C Final Column temperature 228 C Rate of increase of temperature 10 C min Auxiliary Temperature 250 C 30 0 Min Total Run Time 114 9 1 QC procedure a Prepare a 100ng solution of internal standard mix in methanol b Prepare surrogate standard mix similar to internal standard mix c Spike 5 of internal standard mix i e 100 ng of each inside the sampled tube through the inlet followed by 5 of surrogate standard mix d Add 5 of methanol and purge He gas slowly just to dry excess methanol e Immediately place the tube in TD chamber for analysis f Calculate the 96 recovery of internal and surrogate mix standards g Permissible recovery for surrogate and internal standards should be between 70 130 9 2 Calculation Volume of sample L duration of sampling min sampling flow rate L min Concentration of VOC ug m3 a b 20 45 1000 L a Observed Concentration sample ppm b Observed Concentration Field Blank ppm 10 References 1 EPA 625 R
157. using sorbent media and analysis scheme as outlined in the US EPA TO 17 method 2 Scope and Applicability This SOP outlines procedure for collecting airborne VOCs in household microenvironments during cooking and non cooking activities following active air sampling 3 Summary of Method Indoor VOCs are collected on a mixed bed sorbent media i e Tenax and Carbopack B using active air sampling followed by automated thermal desorption and analysis by high resolution GC MS system Tool box meeting Laboratory activities Repeat steps for next sampling cycle Review QC data amp field data sheets Quality check QA QC amp data entry Figure 1 Steps involved in collection and determination of indoor VOCs 109 4 Tool box meeting A 10 15min tool box meeting is conducted every day to plan field activities and logistics Based on sampling requirement select the areas i e rural and or urban for sampling and assign field teams Contact participants and get their consent to place samplers in kitchen during cooking duration Document sampling date location number of field teams and logistics information in the tool box meeting data sheet everyday Use data form TB 1 5 Laboratory activities Several steps are grouped under laboratory activities that involves sorbent tube conditioning and preparation sampler calibration before and after sampling and instrument analysis Each of these steps are explaine
158. velop itchiness in eyes Self explanatory Give answer in Yes or No In case of doubt give answer as No Codes Yes 1 No 0 Family history of asthma atopy 31 Do any of your family members have any of the above three symptoms Self explanatory Give answer in Yes or No In case of doubt give answer as No Codes Yes 1 No 0 If answer to question 31 is Yes go to next question else to question 33 32 If yes who Grandparents Parents Brother Sister Children Others Record who in the family has the above mentioned symptoms out of the choices listed in the question Codes If grandparents parents brothers sisters or children has symptoms code 1 If any other family member has symptoms code 0 Code for missing value 0 33 Do any of your family members suffer from asthma 46 Self explanatory Give answer in yes or no In case of doubt give answer as No Codes yes 1 no 0 If answer to question 33 is Yes go to next question else to question 35 34 If Yes who Grandparents Parents Brother Sister Children Others Record who in the family has the above mentioned symptoms out of the choices listed in the question Codes If grandparents parents brothers sisters or children has symptoms code 1 If any other family member has symptoms code 0 Code for missing value 0 Environmental Tobacco Smoke E
159. very details Note Before filling up this section request the participant to get ready with the hospital records of child s birth Please make sure you are recording the delivery details of the child who was born out of the current pregnancy 1 Date of delivery Record the date of delivery in lt dd mm yyyy gt format 2 Place of delivery Encircle the appropriate place of delivery from the list provided All non profit hospitals should be categorized as private hospital If hospital cannot be categorized encircle the option Others and write down the name of the hospital in the space provided Home delivery can also be entered here 3 Mode of delivery This can be obtained from the hospital record If forceps or vacuum delivery was mentioned it should be encircled as Assisted Section B Details on baby 1 Status of the child at birth This information is always recorded in the discharge summary of the participant Encircle the appropriate answer from the discharge summary Ascertain the abortion details of the recruited pregnancy from the participant herself if the discharge summary is not available with her 17 10 Maturity Term or preterm delivery is always recorded in the discharge summary of the participant Encircle the appropriate answer from the discharge summary Sex Write down the gender of the baby also from the discharge summary Birth weight Write down from the discharge summary as exactly as it
160. ves of the filter cassette d Repeat with another cassette e Placethe cassette in the rectangular cassette carrier on the filter platform The slot and hole line up with the hardware on the platform f Insert the cassette carrier with its installed filter cassettes and new 47 mm filters into the lower part of filter exchange mechanism Ensure that notches in the filter carrier fit into the pins at back of the lower part of the filter exchange mechanism Figure 5 Figure 5 4 5 Assembling the stand Note Always place the split ring washer between the head of the bolt and the washer a b Assemble the bottom of the stand by laying out the front back and sides Place one leg on each bottom stand inside corner fastens with hardware G H and I Attach the top front and back longer top pieces to the outside of the legs with hardware G H and I Do not tighten Position the right and left side pieces so that the holes closest to the edge are in facing up Fasten the right and left stand to the legs and top front and back rails with hardware G H and I Tighten all hardware 102 f 5 Place the dichotomous sampler onto the stand and secure using hardware E G and H Calibration The manufacturer recommends the user to perform flow calibration whenever the sampler has been transported electromechanical maintenance has been done or the sampler flow deviates from the set flow by 5 Otherwise the sampler sh
161. xposure 35 36 Do did any of your family members i e people residing in the same household regularly smoke in your presence This question aims at assessing exposure to passive smoke at home during early years of life Family members include persons regularly residing in the same household Lay stress on regularity of smoking to exclude occasional or casual smokers Emphasize that smokers must have been smoking at home in the presence of respondent Include ex smokers as well as smokers who are now dead but were alive during the period for which data is collected Give answer in Yes or No In case of doubt give answer as No Codes Yes 1 No 0 Missing Value 99 Who all in the family are were regular smokers during your childhood and adulthood Ask the respondent to tell which all family member regularly smoked at home in his her presence both during his childhood and during adulthood Family members include persons regularly residing in the same household Lay stress on regularity of smoking to exclude occasional or casual smokers Emphasize that smokers must have been smoking at home in the presence of respondent Include ex smokers as well as smokers who are now dead but were alive during the period for which data is collected For married women replace father mother and siblings with corresponding relatives of husband while recording family members during 47 adulthood Tick each re
162. y May also ask other family members in case of difficulty Age In Years If date of birth is known calculate the age in completed years If not ask the respondent his age and record the response Questions like age of marriage age ofthe first child age at which first child was delivered etc can be asked to get the age of the person Gender Self explanatory Record male or female Household Characteristics 1 What type of house do you live in Ask them what type of house they are living and mark the appropriate answer If it is different from listed types mark as others and note down the type If they don t know mark it as unknown unspecified Whattype of construction is your house 82 This can be noted by observation as Kutcha Semipucca and Pucca 3 How old is your house Ask the participant about the age of the house If the participant does not know the answer prompt them with questions such as have you been living in this house right from birth Where were you living before marriage etc to help them estimate the age of the building 4 What is the main source of lighting in your house Ask the participant about the source for energy for lighting and mark the response 5 Isthere any dampness in your house Explain the meaning of dampness as presence of moist wet or watery patches on the walls floors and ask if the participant has observed sign of the same 6 How many rooms does your house h

Download Pdf Manuals

Related Search

Related Contents

Livre 2.indb - Ville de Lausanne  Sikaguard -65.cdr - Pretensur, SA de CV  8e6 Technologies 3 Network Card User Manual  Annexe 5 Manuel d`instructions aux enquêteurs  installation, operating, service and maintenance manual for oil    JVC TH-S33 User's Manual  Chef Buddy 80-SM15 Use and Care Manual  AVANZADAS PAC  Murphy RP75 User's Manual  

Copyright © All rights reserved. Failed to retrieve file