Home

User Manual - System Biosciences

image

Contents

1. 21 D Cloning into the gRNA Lentivector seeeeeees 22 E Packaging of Lentivector Constructs ssuuussssse 23 F Concentration of Pseudoviral Particles 24 G Transduction of Pseudoviral Particles into Target Cells 26 H Generation of Stable Cas9 nickase Cell Line 27 Frequently Asked Questions ssesessssess 29 888 266 5066 Toll Free 650 968 2200 outside US Page 1 System Biosciences SBI User Manual IV alu ET 32 V Technical Support cenieni NA 33 VI Licensing and Warranty information 34 I Introduction A Overview of CRISPR Cas9 system In the past decade a great deal of progress has been made in the field of targeted genome engineering Technologies such as designer zinc finger nucleases ZFNs transcriptional activator like effector nucleases TALENs and homing meganucleases have made site specific genome modifications a reality in many different model organisms ranging from zebrafish to mammalian cells Based on the results to date however genome editing tools that are efficient flexible and cost effective have remained elusive to the general research community The recent discovery of the type Il prokaryotic CRISPR Clustered Regularly Interspaced Short Palindromic Repeats system originally discovered in the bacterium Streptococcus pyogenes as a m
2. mscv Puro CASLV220PA 1 Virus Type Promoter Marker Cat Wild Type hspCaso__ cmv Puro CASLV100VA 1 Wild Type hspCas9 MSCV Puro CASLVv120VA 1 Nickase DioA cmv Puro casLv2oova 1 Nickase D10A wScv Puro CASLV220VA 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual WT Cas9 and Nickase Lentivectors Dual Promoter EF1 GFP Format hspCas9 or hspCas9 D10A Plasmid Type Promoter Marker Cat Wild Type hspcas9 cmv copGFP CASLV105PA Wild Type hspCas MSCV copGFP CASLV125PA copGFP CASLV205PA 1 ___Nickase D10A cmv Nickase D10A MSCV copGFP CASLV225PA Virus Type Promoter Marker Cat Wild Type hspCas9 cmv copGFP CASLV105PA 1 Nickase 010A cmv copGrP CASLV205PA Nickase D10A MSCV copGFP CASLV225PA Note Above CASLVxxxPA 1 catalog items are provided as 10 iig of plasmid DNA CASLVxxxVA 1 catalog items are provided as 2 x 25 ul aliquots of pre packaged ready to infect lentivirus 10 7 IFUs ml 10 6 infectious units total Page 8 ver 2 150123 www systembio com PrecisionX Lenti Cas9 System Cat CASLVxxx WT Cas9 and Nickase Lentivectors All in One Format hspCas9 or hspCas9 D10A ipe P
3. 3 Zyppy Plasmid MiniPrep Kit Zymo Research Cat D4019 4 Zyppy Plasmid MaxiPrep Kit Zymo Research Cat D4027 5 PureFection Transfection Reagent SBI Cat LV750A 1 or equivalent 6 293TN Producer Cell Line SBI LV900A 1 or equivalent cells e g HEK293T or HEK293FT 888 266 5066 Toll Free 650 968 2200 outside US Page 17 System Biosciences SBI User Manual 7 Recommended UltraRapid Global Titering Kit SBI Cat LV961A 1 Related Products SBI offers a number of Homologous Recombination HR Donor Vectors including the popular PrecisionX HR Targeting Vectors Cat HRxxxPA 1 for generating gene knockouts and knock ins as well as the piggyBac HR Donor for seamless excision of a selection cassette Cat PBHR100A 1 The full selection of HR Donor vectors may be viewed on the following webpage http www systembio com genome engineering precisionx HR vectors ordering J Shipping and Storage Conditions PrecisionX Lenti Cas9 SmartNuclease Nickase and gRNA cloning amp expression vectors are shipped on blue ice Upon receiving store the kit at 20 C Shelf life of the product is 1 year after receipt if stored in 20 C Components in LentiStarter 2 0 Kit should be stored per the product analysis certificate PAC provided with the Kit Pre packaged viruses are shipped on dry ice and upon receiving please store at 80 C Avoid excess freeze thaw cycles for virus as it may affect perfor
4. System Biosciences SBI User Manual E Key Advantages of the Lenti Cas9 SmartNuclease and SmartNickase System Proven 3 generation lentivector expression backbone containing codon optimized hspCas9 Nickase tagged to your choice of GFP or Puro markers for generation of cell lines stably expressing Cas9 Deliver Cas9 to difficult to transfect cell lines Easily make stable Cas9 cell lines for editing applications gRNA cloning amp expression systems contain necessary scaffolding sequences for crRNA maturation and is pre linearized for cloning no need to prepare or modify vector backbone Precise directional cloning of the gRNA insert into vector backbone Rapid highly efficient cloning with low background 99 cloning efficiency F Applications of the Lenti Cas9 SmartNuclease and SmartNickase Expression System We have developed the Lenti Cas9 expression system to target a wide range of researchers who are interested in the following but not limited to research areas Genome editing and engineering of difficult to transfect cell lines In vivo engineering of model organisms Synthetic biology applications Gene Cell based therapy Genome wide functional screening Page 14 ver 2 150123 www systembio com PrecisionX Lenti Cas9 System Cat CASLVxxx G List of Components 1 WT Cas9 and Mutant Nickase Lentiviral Constructs Cat CASLV1xxPA 1 CASLV2xxPA 1 All WT Cas9 and mutant Nickase expression lentivira
5. guided Cas9 is able to efficiently introduce precise double stranded breaks at endogenous genomic loci in mammalian cells with high efficiencies and minimal off target effects Cong et al 2013 Mali et al 2013 Cho et al 2013 Page 4 ver 2 150123 www systembio com PrecisionX Lenti Cas9 System Cat CASLVxxx In addition several mutant forms of Cas9 nuclease have been developed to take advantage of their features for additional applications in genome engineering and transcriptional regulation Biochemical characterization of a mutant form of Cas9 nuclease D10A functions as a nickase Jinek et al 2012 generating a break in the complementary strand of DNA rather than both strands as with the wild type Cas9 This allows repair of the DNA template using a high fidelity pathway rather than NHEJ which prevents formation of indels at the targeted locus and possibly other locations in the genome to reduce possible off target toxicity effects while maintaining ability to undergo homologous recombination Cong et al 2013 Recently paired nicking has been shown to reduce off target activity by 50 to 1 500 fold in cell lines and to facilitate gene knockout in mouse zygote without losing on target cleavage efficiency Ran et al 2013 Finally tandem knockout of both RuvCl and HNH nuclease domains which control cutting of the DNA strands shows that the null nuclease mutant double mutant can act as a transcriptional repressor Qi et a
6. down 10 minutes 2 Ligation of Oligo Duplex into Vector Since the tubes might be placed upside down during the shipping and some of reagents may end up at the top of tubes we recommend a brief spin to bring all the reagents down to the bottom of tubes before opening the tubes Set up the ligation reaction as follows Materials Amounts Linearized vector 1 ul Mix reaction well and incubate for 5 7 minutes at room temperature Page 22 ver 2 150123 www systembio com PrecisionX Lenti Cas9 System Cat CASLVxxx 3 o 4 If you are making several constructs at the same time we strongly recommend adding ligase and buffer separately and individually to the linearized vector i e do not make and aliquot a pre mixture of ligase and buffer to the linearized vector Transformation Reaction Add a vial of competent cells to the ligation mix Place cells on ice for 15 minutes Heatshock cells at 42 C for 50 seconds then immediately transfer cells to ice for 2 minutes Add 250 yl SOC medium and incubate at 37 C for 1 hour with shaking Spread 100 ul of cultured cells on a pre warmed LB plate containing 50 pg ml Ampicillin or Carbenicillin and incubate overnight at 37 C Confirmation of Positive Clones Pick 1 to 2 colonies grow in LB Amp medium overnight at 30 C with shaking Next day miniprep plasmid DNAs and send for sequencing using the provided sequencing primer Note Primer provided is ready
7. for robust expression in a wide range of cells The system is designed to accommodate flexible targeting of any genomic loci in the form of No9NGG however other gRNA formats e g N17 89NGG can be utilized as well SBI offers pre packaged ready to infect pseudoviral particles for expression of Cas9 wild type nucleases and mutant nickases for generation of cell lines stably expressing Cas9 Pseudoviral particles have been packaged to exacting QC standards and comes with functional titer and in house transduction data for each production lot of virus For those customers wishing to package any of the Lenti Cas9 SmartNuclease lentivectors in their own lab SBI offers the LentiStarter 2 0 kit which contains all of the necessary reagents to produce high quality virus and transduce target cells The Kit is available as part of a bundled package with any Lenti Cas9 vectors as well as a standalone item SBI Cat LV051A 1 Please refer to Section G for details regarding the LentiStarter 2 0 Kit Page 6 ver 2 150123 www systembio com PrecisionX Lenti Cas9 System Cat CASLVxxx C Vector Information WT Cas9 and Nickase Lentivectors T2A Puro Format hspCas9 or hspCas9 D10A Plasmid Type Promoter Marker Cat Wild TypehspCas cMv Puro CASLV100PA Wild Type hspCas9 mscv Puro CASLV120PA Nickase D10A cmv Puro CASLV200PA Nickase D10A
8. to use concentrated at 5 uM simply use 1 ul per reaction Align your raw sequencing data with the top strand primer sequence Sequence validated clones can be used for subsequent packaging Section E below E Packaging of Lentivector Constructs Transfection of plasmids into HEK293TN or equivalent producer cells 888 266 5066 Toll Free 650 968 2200 outside US Page 23 System Biosciences SBI User Manual a 18 24 hours prior to transfection seed 7 0 8 0 x1 0 293TN cells per 150mm cell culture plate in standard growth media w o antibiotics Cells should be 80 confluent by next day Note The number of plates to use depends on the amount of virus desired As a general guideline we recommend using 2 6 150mm plates for virus production b During transfection day mix 45 ul of pPACKH1 packaging plasmid mix as provided in the LentiStarter 2 0 Kit and 4 5 ug of Cas9 nickase or gRNA lentivector in 1 6 ml of serum free DMEM by pipetting c Add 55 ul PureFection into the same tube Vortex for 10 seconds Note If using other transfection reagents e g Lipofectamine 2000 please follow suggested guidelines for 150mm plates d Incubate mixture at room temperature for 15 minutes e Add mixture drop wise to the dish and swirl to disperse evenly throughout the plates f Change the medium 12 hours or next day after transfection g At 48 hours and 72 hours after transfection collect the medium which now c
9. 3 Image was taken 72hrs after virus transduction 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual Figure 3 Fluorescence image of Human iPSC cell line infected with pseudoviral particles of MSCV hspCas9 EF 1 copGFP Cat CASLV125VA 1 at MOI 60 Image was taken 6 days after virus transduction Infected Cells Figure 4 Phase microscopy image of MCF 7 breast cancer cells infected with pseudowral particles of CMV hspCas9 T2A Puro Cat CASLV100VA 1 and selected with Puromycin 1 ng ml for 10 days in culture showing distinct colony formation Page 12 ver 2 150123 www systembio com PrecisionX Lenti Cas9 System Cat CASLVxxx Phase GFP RFP Uninfected control Co infected Figure 5 Phase and fluorescent images of modified HEK293T cells stably expressing RFP and GFP top panel which have been co infected with Cas9 Puro MSCV Cas9 T2A Puro and gRNA virus expressing a guide RNA targeting RFP EF1a Blasticidin H1 RFP gRNA bottom panel at MOI 3 for each virus Image of cells were taken 11 days after placing the cells under selection showing ablation of RFP expression in target cells Cas9 protein DAPI Merge Figure 6 lImmunofluorescence staining of Cas9 protein expression in MCF 7 cell lines stably transduced with Cas9 lentiviral vector indicating punctuate nuclear and perinuclear staining 888 266 5066 Toll Free 650 968 2200 outside US Page 13
10. SSB System Biosciences PrecisionX LentiCas9 SmartNuclease System Catalog s CASLVxxx series User Manual Store at 20 C or 80 C Please check storage conditions for each product A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement contained in this user manual PrecisionX Lenti Cas9 System Cat CASLVxxx Contents l inirod cthonsseri aenaran een none ee eecdne e 2 A Overview of CRISP R Cas9 system eccere 2 B Product Information sseeee kiersi a 5 C Vector Information essseesee 7 D Validation Data for Lenti Cas9 SmartNuclease and Nickase VECTORS me PEL mc 11 E Key Advantages of the Lenti Cas9 SmartNuclease and SmartNickase System sssssssseseeeeee 13 F Applications of the Lenti Cas9 SmartNuclease and SmartNickase Expression System ceseeeeeeeeeeeeeeeeeeeeees 14 G List of Components enre n me 15 H Additional Materials Required seeeeeeeesees 17 Related Products cccccsseeeeceeeeeeeceeeeeeceeeeeeeaeaaeeeeaaaaeees 18 J Shipping and Storage Conditions suuuussuus 18 Protocol for the Lenti Cas9 Expression System 19 A Overview of the Protocol sessem 19 B Selection of Target DNA Sequence 20 C Design of Guide RNA Oligonucleotides
11. analysis In either case double trans duced cells can be subjected to assays to determine indel formation as soon as 72 hrs post transduction however indel formation may take as long as 7 10 days after infection with gRNA virus Ill Frequently Asked Questions Q We prepared oligos according to the protocol ligated the oligos to the vector and transformed into competent cells Very few colonies showed up in the plate What is the reason for this 1 Please use very high efficiency competent cells for the reaction e g cells with efficiencies of gt 1 x 10 9 CFUs ug of pUC18 plasmid 888 266 5066 Toll Free 650 968 2200 outside US Page 29 System Biosciences SBI User Manual 2 Please make sure to not freeze thaw stock plasmid as damage to the plasmid may result Either store the plasmid at 4 C for short term use 1 2 weeks or aliquot each reaction into separate tubes for storage at 20 C Q How many guide RNA constructs do you have to design to target a DNA sequence of interest Due to the unpredictable efficacy of a particular guide RNA construct for optimal results we suggest designing multiple 2 or more constructs targeting a particular DNA sequence of interest Q We obtained a very low virus titer after packaging Cas9 nickase construct What might be the problems 1 Poor Transfection Efficiency 293T Cells have too high or too low density Plate fewer or more cells in order to have about 50 80 con
12. ange with the all in one vectors Day 3 5 Aspirate off medium and add complete growth medium to cells Day 4 6 Trypsinize and pool cells from Cas9 nickase infected wells into into a single well of a 6 well plate same for the negative control wells Day 5 7 Virus should be integrated into the host cell genome by this time Begin selection procedure of transduced cells See Section H H Generation of Stable Cas9 nickase Cell Line SBI suggests sequential infections of virus one being the Cas9 nickase virus and the second being the gRNA virus does not apply to all in one constructs We would suggest establishing a stable Cas9 nickase cell line first in a 100mm plate to obtain 4 6 million adherent cells to have enough cells for targeting by multiple gRNA viruses and for archival purposes The following protocol is designed for establishment of adherent cell lines stably expressing both Cas9 nickase and gRNA 888 266 5066 Toll Free 650 968 2200 outside US Page 27 System Biosciences SBI User Manual Note The times listed below are approximate and will depend on growth rate of cells being utilized Please adjust timing as necessary for each step Days 5 6 1 Monitor growth of transduced cells and split when confluent 70 80 into a single 100mm plate Days 7 8 2 For cell transduced with Puro constructs Assuming cells have reached confluency in 100mm plate add appropriate amount of Puromycin to target
13. ar days Purchase and use of any part of the Product constitutes acceptance of the above terms The purchaser of the Product is granted a limited license to use the Product under the following terms and conditions e The Product shall be used by the purchaser for internal research purposes only The Product is expressly not designed intended or warranted for use in humans or for therapeutic or diagnostic use Page 34 ver 2 150123 www systembio com PrecisionX Lenti Cas9 System Cat CASLVxxx e The Product may not be resold modified for resale or used to manufacture commercial products without prior written consent of SBI e This Product should be used in accordance with the NIH guidelines developed for recombinant DNA and genetic research SBI has pending patent applications related to the Product For information concerning licenses for commercial use contact SBI Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein Limited Warranty SBI warrants that the Product meets the specification
14. be provided 4 Pre packaged Lenti Cas9 SmartNuclease Lentiviral Particles Cat CASLV1xxVA 1 CASLV2xxVA 1 CASLV601V A 1 WT Cas9 and mutant Nickase pre packaged lentiviral particles 10 7 IFUs ml gt 10 6 infectious units are provided as 2 x 25 yl tubes with infectious titer data IFUs ml for each virus lot 5 LentiStarter 2 0 Kit Cat LV051 A 1 The LentiStarter 2 0 Kit can be added to any Lenti Cas9 vector Cat CASLVxxxPA KIT or purchased separately for a complete one stop solution for transfection of virus producer cells packaging of lentivectors concentration of pseudovral particles and transduction of target cells The Kit contains the following reagents as listed in the table below Page 16 ver 2 150123 www systembio com PrecisionX Lenti Cas9 System Cat CASLVxxx Table 2 List of components included in LentiStarter 2 0 Kit Reagent Amount pPACKH1 HIV lentiviral packaging plasmids PEG It virus precipitation reagent 20m PureFection Transfection Reagent TransDux virus transduction reagent There will be enough reagents provided in the Kit to produce high quality pseudoviral particles from 2 x 150mm or 5 x 100mm plates of 293T producer cells cells not included H Additional Materials Required 1 LB Agar and Broth containing 50gg ml Ampicillin or Carbenicillin 2 Any high transformation efficiency E coli competent cells e g Stbl2 cells Life Technologies Cat 10268 019
15. cells based on results of kill curve assay For most cell lines a concentration of 0 5 to 1 ug ml is sufficient For cells transduced with GFP constructs You may FACS sort the cells and replate into single wells of 6 well plate and when confluent split them into 100mm plates Days 9 10 3 For Puro constructs Aspirate media containing dead floating cells Replace with 10 ml of fresh complete growth media Puromycin For GFP sorted cells Please continue to grow until they reach confluency in 100mm plates Page 28 ver 2 150123 www systembio com PrecisionX Lenti Cas9 System Cat CASLVxxx Days 11 12 4 When cells have reached confluency they can be archived or re seeded for infection in 24 well plates see Step 1 with the gRNA virus Expression of Cas9 protein can be detected via Western blot or immunofluorescence using a suitable anti Cas9 antibody e g Diagenode Cat C15200203 or equivalent Day 12 20 After seeding 24 well plates with Puro resistant or GFP cells stably expressing Cas9 infect cells with gRNA virus at the same MOI as previously done for the Cas9 nickase virus For gRNA viruses containing a GFP or RFP marker successfully transduced cells can be FACS sorted for further characterization e g Surveyor Nuclease Assay or genotyping If gRNA virus contains the Blasticidin antibiotic selection marker cells can be further selected now Puro and Blast in culture and expanded for further
16. echanism to defend against viruses and foreign DNA has provided yet another tool for targeted genome engineering this time taking advantage of a system that uses small RNAs as guides to cleave DNA in a sequence specific manner With its ease in designing guide sequences to target specific sequences unlike ZFNs and TALENs where construct assembly can be laborious and time consuming as well as its targeting efficiency this system has the potential to be a disruptive technology in the field of genome engineering The CRISPR CRISPR associated Cas system involves 1 retention of foreign genetic material called spacers in clustered arrays in the host genome 2 expression of short guiding RNAs crRNAs from the spacers 3 binding of the crRNAs to specific portions of the foreign DNA called protospacers and 4 Page 2 ver 2 150123 www systembio com PrecisionX Lenti Cas9 System Cat CASLVxxx degradation of protospacers by CRISPR associated nucleases Cas A well characterized Type II CRISPR system has been previously described in the bacterium Streptococcus pyogenes where four genes Cas9 Cas1 Cas2 Csn1 and two non coding small RNAs pre crRNA and tracrRNA act in concert to target and degrade foreign DNA in a sequence specific manner Jinek et al 2012 The specificity of binding to the foreign DNA is controlled by the non repetitive spacer elements in the pre crRNA which upon transcription along with the tracrRNA directs
17. fluency at transfection stage 2 Inefficient Production of the Pseudovirus 293T cells are of poor quality Optimize growth conditions Some suggestions are Check growth medium 293T cells should not be grown for more than 20 passages Check for mycoplasma contamination Make sure the cells have not been overgrown do not allow the cells to reach more than 9096 confluency in order to keep the culture continuously in logarithmic growth phase 3 Pseudoviral supernatant harvested too early or too late Page 30 ver 2 150123 www systembio com PrecisionX Lenti Cas9 System Cat CASLVxxx Harvest supernatant at least twice 48 hours post trans fection and 72 hours after transfection combine the volumes concentrate virus using SBs PEG it reagent and titer 4 Cas9 nickase lenti vector is near limits of efficient packaging The packaging limit for the lentiviral system is 8 5 kb from 5 LTR to 3 dLTR the Cas9 nickase vector is 8kb from LTR to LTR The efficiency of packaging may drop significantly with cDNA insert sizes greater than 2 kb Cas9 nickase is 4kb in size For a 3 kb insert the titers could be 10 fold lower than for a 1 kb insert We would suggest scaling up the number of 150mm plates for generating sufficient amounts of Cas9 nickase virus for best results Q We established a Cas9 nickase stable cell line designed a gRNA packaged it into pseudovirus particles and infected target cells and there is
18. g using CRISPR Cas systems Science 2013 Feb 15 339 6121 819 23 doi 10 1126 science 1231143 Epub 2013 Jan 3 Jinek M et al RNA programmed genome editing in human cells Elife 2013 2 e00471 doi 10 7554 eLife 00471 Epub 2013 Jan 29 Qi LS et al Repurposing CRISPR as an RNA guided platform for sequence specific control of gene expression Cell 2013 Feb 28 152 5 1173 83 Fu et al Improving CRISPR Cas nuclease specificity using truncated guide RNAs Nat Biotechnol 2014 Mar 32 3 279 84 V Technical Support For more information about SBI products and to download manuals in PDF format please visit our web site http www systembio com For additional information or technical assistance please call or email us at 888 266 5066 Toll Free 650 968 2200 outside US Page 33 System Biosciences SBI User Manual System Bioscience s SBI 265 North Whisman Rd Mountain View CA 94043 Phone 650 968 2200 888 266 5066 Toll Free Fax 650 968 2277 E mail General Information info systembio com Technical Support tech systembio com Ordering Information orders systembio com VI Licensing and Warranty information Limited Use License Use ofthe PrecisionX Lenti Cas9 SmartNuclease Expression System e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calend
19. l 2013 with minimal off target effects which leads to possibilities for studying site specific transcriptional regulation Taken together the RNA guided Cas9 system defines a new class of genome engineering tools creating new opportunities for research across basic sciences biotechnology and biomedicine B Product Information Based on our industry leading trans fection based all in one Cas9 SmartNuclease and SmartNickase plasmid systems we have now adapted these constructs into a lentivector format SBI s Lenti Cas9 SmartNuclease system is ideal for targeting cell types that are traditionally difficult to transfect with plasmids effectively expanding the range of target cells amenable for CRISP R Cas9 based genome engineering The Lenti Cas9 system also provides an easy and efficient way to generate stable Cas9 editing cell 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual lines SBI offers lentiviral constructs in two formats 1 An all in one format expressing Cas9 and gRNA from a single vector and 2 a two vector system with separate Cas9 and gRNA expression vectors All of the Cas9 lentivector constructs Section I C express human codon optimized Cas9 wild type nuclease or mutant nickase while the gRNA cloning expression lentivector constructs Section I C contain a pre made tracrRNA scaffold with gRNA cloning sites driven by your choice of H1 or U6 Pol ll promoters
20. l constructs are provided as 10 ug of plasmid The plasmid can be propagated using transformation into chemically competent bacteria per standard transformation protocols We recommend the use of Stbl2 chemically competent cells per manufacturer s recommended protocol for best results 2 All in One Cas9 gRNA Cloning amp Expression Lentiviral Constructs Cat CASLV3xxPA 1 CASLV4xxPA 1 CASLV 601 A 1 The all in one lentiviral constructs are provided pre linearized for cloning of guide RNAs A single sales unit contains enough reagents to perform up to 10 ligation reactions i e cloning of 10 individual gRNAs 3 gRNA cloning amp expression lentiviral constructs Cat CASLV5xxPA x The gRNA lentiviral constructs are provided pre linearized for cloning of guide RNAs A single sales unit contains enough reagents to perform up to 10 ligation reactions i e 10 gRNA clonings Table 1 List of components included in all in one and gRNA cloning and expression vectors 888 266 5066 Toll Free 650 968 2200 outside US Page 15 System Biosciences SBI User Manual Reagent Amount Linearized lentiviral cloning vector 5x ligation buffer H1 Fwd Sequencing primer 5 pM 5 GTCATCAACCCGCTCCAAGG 3 U6 Fwd Sequencing primer 5 pM 5 GGACTATCATATGCTTACOCG 3 Fast ligase 25 pl Note The forward sequencing primer provided will depend on the vector ordered For all in one vectors only the H1 sequencing primer will
21. lection of Target DNA Sequence The selection of the target DNA sequence is not limited by any constraints with exception of a PAM sequence in the form of 5 NGG 3 where N any base immediately following the target sequence The typical length of the target sequence is 20bp as shown here however gRNA lengths of 17 18bp have been successfully utilized for genomic editing Fu et al 2014 5 NNNNNNNNNNNNNNNNNNNNNGG 3 In order to enhance specificity paired gRNA with Lenti Cas9 Nickase constructs can be used to generate double nicking with 5 overhangs Please follow the guideline below for paired gRNA selection and design E gRNA1 c Targeting site TIAGCCGTAACGAATGGCAAT 5 ATCGGCATTGCTTACCGTTA CGTAAGCTTACGCGATGCAC 3 CN y Cas9 D10A Nickass ar NGG 3 an Cas9 D10A Nickase 3 SEN TWAGCCGTAACGAATGGCAAT N IGCATTCGAATGCGCTACGTG Nee 5 5 CGTAAGCTTACGCGATGCAC gRNA2 p al 1 0 5 overhang Choose your gRNA1 from the anti sense strand upstream of your targeting site Choose your gRNA2 from the sense strand downstream of your targeting site Fig 4 Schematic illustration of generating 5 overhang double strand DNA breaks using paired gRNAs with Cas9 Nickase adapted from Ran et al 2013 Please note that only gRNA pairs creating 5 overhangs with less than 8bp overlap between the guide sequences were able to Page 20 ver 2 150123 www systembio com PrecisionX Len
22. ls Day 1 1 Plate 50 000 cells per well into 2 wells of a 24 well plate in cell culture medium Make sure that cells are well dispersed and are not clumped together Include wells for negative non infected cells For suspension cells please plate recommended amount suitable for two wells in a 24 well plate Note If infecting target cells for the first time or an optimal MOI is not known please titrate virus at varying MOls 1 5 10 and 20 etc to optimize transduction using a positive control virus with a fluorescent marker such as SBI s pre packaged positive transduction control Cat ZCD511V B 1 Day 2 2 Cells should be between 50 to 70 confluent Aspirate medium from cells 3 Combine culture medium with TransDux to a 1X final concentration For example add 2 5 yl of TransDux to 500 ul culture medium and then transfer to each well If using other types of transduction reagents e g Polybrene please dilute the reagent to a final working concentration of 2 8 ug ml Page 26 ver 2 150123 www systembio com PrecisionX Lenti Cas9 System Cat CASLVxxx 4 Add Cas9 or nickase virus to each well and swirl to mix for negative control wells only add media viral transduction reagent FOR ALL IN ONE VECTORS Due to the size of the vector we suggest infection of target cells at higher MOls than with Cas9 nickase vector For example if using MOI of 3 for a given cell type we would suggest an MOI of 10 20 as a starting r
23. mance Shelf life of the product is 1 year after receipt if stored in 80 C Page 18 ver 2 150123 www systembio com PrecisionX Lenti Cas9 System CatfCASLVxxx I Protocol for the Lenti Cas9 Expression System A Overview of the Protocol The general workflow of the cloning and infection of the Cas9 and gRNA lentiviral expression constructs into cells is listed here 1 Design two DNA oligonucleotides that are sense and antisense sequences of the target DNA which is 20bp upstream of the PAM 5 NGG 3 Other lengths e g 17 or 18bp may work as well Anneal the two oligonucleotides to generate a duplex Clone the duplex into the provided linearized gRNA cloning lentivector by ligation reaction Transform into competent cells and grow in LB Amp plate 50 ug ml Confirm positive clones by direct sequencing Produce lentiviral particles for gRNA and Cas9 nickase lentivectors using the LentiStarter 2 0 Kit Infect target cells with Cas9 or nickase virus from Step 6 please see Section II G for details Establish stably transduced cells via FACS sorting for GFP constructs or Puromycin selection Transduce the gRNA lentiviral particles into stable cells established in Step 8 888 266 5066 Toll Free 650 968 2200 outside US Page 19 System Biosciences SBI User Manual 10 Assay for desired activity or phenotype 4 5 days after gRNA lentivirus transduction through Surveyor Nuclease Assay B Se
24. no evidence of activity What are the possible reasons for this There are many possibilities of why a particular guide RNA does not show any measureable effects Some of the possibilities include the following 1 Poor transduction efficiency of target cells For certain cell types e g primary stem suspension cells transduction may not be very efficient In these cases we would suggest infections using an higher MOI 30 50 may be appropriate with certain cells or performing forced wirus cell infections Spin Inoculation Certain cell types e g T cells also may need to be artificially stimulated from Go state for efficient transduction 2 Errors in guide RNA design The sequences of oligo duplexes targeting the DNA should be carefully checked to follow design rules 888 266 5066 Toll Free 650 968 2200 outside US Page 31 System Biosciences SBI User Manual 3 Mutation s in DNA sequence targeted In certain cases the DNA sequence targeted may contain mutations which affect recognition of the gRNA sequence leading to failure of cleavage It is difficult to know in advance but if it happens repeatedly it may be necessary to follow up with another gRNA sequence or perhaps sequence verifying the genomic target prior to design of gRNA constructs 4 Length of time before assaying We suggest a minimum of 72 hours post infection to begin assaying for cleavage of a DNA target however in certain cases it may be useful
25. ntainer Spin down residual PEG it solution by centrifugation at 1500 x g for 5 minutes Remove all traces of fluid by aspiration taking great care not to disturb the precipitated lentiviral particles in pellet 5 Resuspend lentiviral pellets in 1 500 to 1 1000 of original volume of pooled virus supernatant using cold sterile Phosphate Buffered Saline PBS or DMEM containing 25mM HEPES buffer at 4 C For example if you performed 2 collections from 2 x 150mm plates 20m per plate this would be approximately 80ml of media You would resus pend the resulting pellet in 80 160 pl of 1X PBS or DMEM 6 Aliquot in cryogenic vials and store at 80 C until ready for use 7 The resulting pseudoviral particles can be accurately titered using SBI s UltraRapid Global Titering Kit Cat LV961A 1 888 266 5066 Toll Free 650 968 2200 outside US Page 25 System Biosciences SBI User Manual http www systembio com lentiviral technology delivery systems ultrarapid overview G Transduction of Pseudoviral Particles into Target Cells For efficient transduction of target cells the negative charges present in the virus envelope protein and the cell surface must be neutralized SB s TransDux reagent provided in the LentiStarter 2 0 Kit is a non toxic proprietory formulation that promotes cell virus contact and subsequent fusion by negating these charges The following protocol can be utilized for delivery of virus to your target cel
26. ontains pseudoviral particles into a 50 ml sterile capped conical centrifuge tube Centrifuge at 3000 x g for 15 minutes at room temperature to pellet cell debris Transfer the viral supernatant into a new tube Caution You are working with infectious pseudoviral particles at this stage Please follow the recommended guidelines for working with BSL 2 biosafety agents F Concentration of Pseudoviral Particles The PEG it Virus Precipitation Solution in the LentiStarter 2 0 Kit provides a simple and highly effective means to concentrate lentiviral particles PEG it is a formulation of polyethylene glycol Page 24 ver 2 150123 www systembio com PrecisionX Lenti Cas9 System Cat CASLVxxx optimized for the precipitation of lentiviral based particles The PEG it Virus Precipitation Solution is provided as a 5x solution 1 Transfer supernatant containing virus to a sterile vessel and add 1 volume of cold PEG it Virus Precipitation Solution 4 C to every 4 volumes of virus supernatant Example 5bml PEG it with 20ml viral supernatant 2 Refrigerate overnight at least 12 hours Viral supernatants mixed with PEG it Virus Precipitation Solution are stable for up to 4 5 days at 4 C 3 Centrifuge supernatant PEG it mixture at 1500 x g for 30 minutes at 4 C After centrifugation the virus particles may appear as a beige or white pellet at the bottom of the vessel 4 Discard the supernatant into a suitable biohazard waste co
27. romoter Marker Cat Wild TypehspCas9 CMV Puro CASLV300PA 1 MSCV Puro CASLV320PA 1 Nickase 010A cuv Puo CASLV400PA 1 Nickase D10A MSCV Puro CASLV420PA 1 Note 1 SBI also offers a positive control all in one construct Cat CASLV601A 1 CMV hspCas9 T2A Puro H1 AAVS1 gRNA vector with a validated gRNA to cut the human AAVS1 safe harbor locus Note 2 All in one expression vectors are provided in a pre linearized format for ease of cloning gRNAs These vectors cannot be propagated unless a gRNA insert has been cloned in 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual gRNA Cloning and Expression Lentivectors MCS Blasticidin GFP or RFP Promoter Marker Cat H1 Blasticidin CASLVSOOPAB H1 copGFP CASLVSOTPACG RFP CASLVS502PA R copGFP CASLV511PA G RFP CASLV512PA R uw 5 Ane Note gRNA Cloning and Expression vectors are provided in a pre linearized format for ease of cloning gRNAs These vectors cannot be propagated unless a gRNA insert has been cloned in Page 10 ver 2 150123 www systembio com PrecisionX Lenti Cas9 System Cat CASLVxxx D Validation Data for Lenti Cas9 SmartNuclease and Nickase Vectors Figure 2 Fluorescence image of HT1080 cell line infected with pseudowral particles of MSCV hspCas9 EF1 copGFP Cat CASLV 125VA 1 at MOI
28. s described in this manual If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with acredit This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a credit limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose 888 266 5066 Toll Free 650 968 2200 outside US Page 35 System Biosciences SBI User Manual SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2015 System Biosciences SBI All Rights Reserved Page 36 ver 2 150123 www systembio com
29. the Cas9 nuclease to the protospacer crRNA heteroduplex and induces double strand breakage DSB formation Additionally the Cas9 nuclease cuts the DNA only if a specific sequence known as protospacer adjacent motif PAM is present immediately downstream of the protospacer sequence whose canonical sequence in S pyogenes is 5 NGG 3 where N refers to any nucleotide 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual Streptococcus pyogenes native type II CRISPR locus Direct repeats tracrRNA 4 Y Y lt Cas9 Casi Cas2 Csn2 K T i Pre crRNA expression V crRNA Processing by RNaselll and other enzymes Pre crRNA DNA Double stranded Target DNA Cleavage Recognition Mediated by Cas9 Protospacer Target Genomic Locus Mature gt crRNA Processed tracrRNA x Target DNA sequence to cleave Figure 1 Overview of the CRISPR system Figure adapted from Cong et al Multiplex Genome Engineering Using CRISPR Cas Systems Recently it has been demonstrated that the expression of a single chimeric crRNA tracrRNA transcript which normally is expressed as two different RNAs in the native type II CRISPR system is sufficient to direct the Cas9 nuclease to sequence specifically cleave target DNA sequences By adapting the endogenous type Il CRISPR Cas system in S pyogenes for utility in mammalian cells several groups have independently shown that RNA
30. ti Cas9 System Cat CASLVxxx mediate detectable indel formation Ran et al 2013 To achieve high cleavage efficiency using Lenti Cas9 Nickase with paired gRNAs make sure each gRNA is able to efficiently induce indels on its own when coupled with wild type Cas9 C Design of Guide RNA Oligonucleotides Design two DNA oligonucleotides a top strand and a bottom strand according to the following structure shown below For H1 based gRNA lentivectors 5 ATCCNNNNNNNNNNNNNNNNN NNN 3 3 NNNNNNNNNNNNNNNNNNNNCAAA 5 For U6 ba sed gRNA lentivectors 5 ACCGNNNNNNNNNNNNNNNNNNNN 3 3 NNNNNNNNNNNNNNNNNNNNCAAA 5 Example If your target sequence is AGCGAGGCTAGCGACAGCATAGG AGG PAM sequence then the oligo sequences would be the following if cloned into H1 gRNA lentivector Top strand oligo 5 ATCCAGCGAGGCTAGC GACAGCAT 3 Bottom strand oligo 5 AAACATGCTGTCGCTAGCCTCGCT 3 888 266 5066 Toll Free 650 968 2200 outside US Page 21 System Biosciences SBI User Manual D Cloning into the gRNA Lentivector 1 Anneal the two single strand DNA oligonucleotide s Dilute your primer at the concentration of 10uM using dH5O and set up the annealing reaction as follows Materials Amount 10uM Top strand oligo 5 ul 10uM Bottom strand oligo 5 ul Total volume 10 ul Incubate reaction mixture at 95 C for 5 minutes can be done in PCR machine Remove the tube and leave it on bench at room temperature to cool
31. to wait up to 7 10 days to observe the full effect of cleavage IV References Carr PA Church GM Genome engineering Nat Biotechnol 2009 Dec 27 12 1151 62 doi 10 1038 nbt 1590 Bhaya D et al CRISPR Cas systems in bacteria and archaea versatile small RNAs for adaptive defense and regulation Annu Rev Genet 2011 45 273 97 doi 10 1146 annurev genet 1 10410 132430 Terns MP Terns RM CRISPR based adaptive immune systems Curr Opin Microbiol 14 321 2011 Curr Opin Microbiol 2011 Jun 14 3 321 7 doi 10 1016 j mib 2011 03 005 Epub 2011 Apr 29 Makarova KS et al Evolution and classification of the CRISPR Cas systems Nat Rev Microbiol 2011 Jun 9 6 467 77 doi 10 1038 nrmicro2577 Epub 2011 May 9 Wiedenheft B et al RNA guided genetic silencing systems in bacteria and archaea Nature 2012 Feb 15 482 7385 331 8 doi 10 1038 nature1 0886 Jinek M et al A programmable Dual RNA guided DNA endonuclease in adaptive bacterial immunity Science 2012 Aug Page 32 ver 2 150123 www systembio com PrecisionX Lenti Cas9 System Cat CASLVxxx 17 337 6096 816 21 doi 10 1126 science 1225829 Epub 2012 Jun 28 Barrangou R RNA mediated programmable DNA cleavage Nat Biotechnol 2012 Sep 30 9 836 8 doi 10 1038 nbt 2357 Mali P et al RNA guided human genome engineering via Cas9 Science 2013 Feb 15 339 6121 823 6 doi 10 1126 science 1232033 Epub 2013 Jan 3 Cong L et al Multiplex genome engineerin

Download Pdf Manuals

image

Related Search

Related Contents

EN Operator`s manual, pp. 2-21 FR Manuel d`utilisation, pp. 22  こちら - バイオマス産業社会ネットワーク  Gigaset A160/A260/A165/A265 Présentation de la base avec    Benutzerhandbuch  PDF  Hi-Copy DMX- 8711E User's Guide Revision 2.0  Sharp AUUOS LC-26DA5U User's Manual    mantenimiento y ajustes periódicos  

Copyright © All rights reserved.
Failed to retrieve file