User Manual - Thermo Fisher Scientific
Contents
1. gene Your expression clone promoter atte gene Your expression clone Overview continued How The pENTR 5 TOPO vector is supplied linearized with Topoisomerase Works e Single 3 thymidine T overhangs for TOPO TA Cloning e Topoisomerase I covalently bound to the vector referred to as activated vector Tag polymerase has a non template dependent terminal transferase activity that adds a single deoxyadenosine A to the 3 ends of PCR products The linearized vector supplied in this kit has single overhanging 3 deoxythymidine T residues This allows PCR inserts to ligate efficiently with the vector Topoisomerase I from Vaccinia virus binds to duplex DNA at specific sites CCCTT and cleaves the phosphodiester backbone in one strand Shuman 1991 The energy from the broken phosphodiester backbone is conserved by formation of a covalent bond between the 3 phosphate of the cleaved strand and a tyrosyl residue Tyr 274 of topoisomerase I The phospho tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5 hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase Shuman 1994 TOPO Cloning exploits this reaction to efficiently clone PCR products Topoisomerase fee E CCCTT LNAGGG GGGARN PCR Product TTCCC HO u Topoisomerase Experimental Outline Flow Chart2. Greater than 85 of these will be blue The vector only reaction should yield very few colonies lt 15 of the vector PCR insert plate and these should be white pUC19 plasmid is included to check the transformation efficiency of the One Shot TOP10 competent cells Transform one vial of One Shot TOP10 cells with 10 pg of pUC19 using the protocol on page 13 Plate 10 ul of the transformation mixture plus 20 ul of S O C Medium on LB plates containing 100 ug ml ampicillin Transformation efficiency should be 2 1 x 10 cfu ug DNA Gel Purifying PCR Products Introduction Note Using the S N A P Gel Purification Kit Quick S N A P Method Smearing multiple banding primer dimer artifacts or large PCR products gt 3 kb may necessitate gel purification If you wish to purify your PCR product be extremely careful to remove all sources of nuclease contamination There are many protocols to isolate DNA fragments or remove oligonucleotides Refer to Current Protocols in Molecular Biology Unit 2 6 Ausubel et al 1994 for the most common protocols Three simple protocols are provided below The cloning efficiency may decrease with purification of the PCR product e g PCR product too dilute You may wish to optimize your PCR to produce a single band see Producing PCR Products page 8 The S N A P Gel Purification Kit available from Invitrogen Catalog No K1999 25 allows you to ra
3. Important LR Clonase Il Plus Enzyme Mix E coli Host 16 TM Once you have obtained your PENTR 5 TOPO entry clone you may e Performa two fragment MultiSite Gateway LR recombination reaction using the pENTR 5 TOPO entry clone an attL1 and attL2 flanked entry clone containing your gene of interest and the pLenti6 R4R2 V5 DEST destination vector to generate a lentiviral expression construct For more information about pLenti6 R4R2 V5 DEST refer to the ViraPower Promoterless Lentiviral Gateway Expression System manual e Perform a three fragment MultiSite Gateway LR recombination reaction using the pENTR 5 TOPO entry clone an attL1 and attL2 flanked entry clone containing your gene of interest an attR2 and attL3 flanked entry clone containing a 3 element of interest and the pDEST R4 R3 destination vector to generate an expression construct For more information about pDEST R4 R3 and how to generate an attR2 and attL3 flanked entry clone refer to the MultiSite Gateway Three Fragment Vector Construction Kit manual General guidelines to perform the MultiSite Gateway LR recombination reaction are provided in this section For detailed instructions see the appropriate manual as recommended above To perform a two fragment or three fragment MultiSite Gateway LR recombination reaction you must use the exact combination of entry clone and destination vector substrates listed abo
4. TOPO vector continued on next page Designing PCR Primers continued TOPO Cloning Use the diagram below to help you design PCR primers and produce your PCR Site for product for TOPO Cloning into the pENTR 5 TOPO vector Note that the pENTR 5 TOPO pENTR 5 TOPO vector is supplied linearized between nucleotides 705 and 706 Features of the TOPO Cloning Region e Restriction sites are labeled to indicate the actual cleavage site e The binding sites for the GW1 and GW3 primers included in the kit are labeled Note When propagating the pENTR 5 TOPO vector and entry clones we have found that one nucleotide within the GW1 priming site can vary in sequence between G and A highlighted in bold below This single nucleotide change does not affect the efficiency of MultiSite Gateway LR recombination or the functionality of the GW1 sequencing primer e The shaded region corresponds to the DNA sequences that will be transferred from the clone into the MultiSite Gateway destination vector after MultiSite Gateway LR recombination For a map and a description of the features of pENTR 5 TOPOS see page 24 The sequence of pENTR 5 TOPO is available for downloading from our Web site www invitrogen com or by contacting Technical Support see page 27 M13 forward 20 priming site 1 501 TAACGCTAGC ATGGATGTTT TCCCAGTCAC GACGTTGTAA AACGACGGCC AGTCTTAAGC TCGGGCCCGA GTTAACGCTA attL4 GW1 primin
5. The flow chart below describes the general steps required to produce and TOPO Clone your Tag amplified PCR product Remember that the PCR product should encode a eukaryotic promoter of interest Produce your PCR product TOPO Cloning Reaction Mix together PCR product and pENTR 5 TOPO vector Incubate 5 minutes at room temperature Transform into competent E coli cells Select and analyze colonies Choose a positive transformant and isolate plasmid DNA Proceed to the MultiSite Gateway LR recombination reaction Methods Designing PCR Primers Introduction Factors to Consider EN Y aZ en Z Novus I Important Before you use the pENTR 5 TOPO TA Cloning Kit you must first design PCR primers and produce your PCR product Guidelines are provided in this section to help you design PCR primers It is important to properly design your PCR primers to ensure that you obtain the PCR product you need for your studies Consider the following when designing your PCR primers e Remember that the pENTR 5 TOPO entry clone will be flanked by attL4 and attR1 sites and can only be used in a MultiSite Gateway LR recombination reaction with one or more types of entry clones and a suitable destination vector Example The pENTR 5 TOPO entry clone may be used in a MultiSite Gateway LR recombination reaction with an attL1 and attL2 flanked entry clone containing
6. 1994 Current Protocols in Molecular Biology Greene Publishing Associates and Wiley Interscience New York Brownstein M J Carpten J D and Smith J R 1996 Modulation of Non Templated Nucleotide Addition by Taq DNA Polymerase Primer Modifications that Facilitate Genotyping BioTechniques 20 1004 1010 Innis M A Gelfand D H Sninsky J J and White T S eds 1990 PCR Protocols A Guide to Methods and Applications Academic Press San Diego CA Landy A 1989 Dynamic Structural and Regulatory Aspects of Lambda Site specific Recombination Ann Rev Biochem 58 913 949 Shuman S 1991 Recombination Mediated by Vaccinia Virus DNA Topoisomerase I in Escherichia coli is Sequence Specific Proc Natl Acad Sci USA 88 10104 10108 Shuman S 1994 Novel Approach to Molecular Cloning and Polynucleotide Synthesis Using Vaccinia DNA Topoisomerase J Biol Chem 269 32678 32684 2004 2007 Invitrogen Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 31 invitrogen Corporate Headquarters Invitrogen Corporation 1600 Faraday Avenue Carlsbad CA 92008 T 1 760 603 7200 F 1 760 602 6500 E tech service invitrogen com For country specific contact information visit our web site at www invitrogen com
7. plated Increase the amount of E coli plated Transformants plated on selective plates containing the wrong antibiotic Use the appropriate antibiotic for selection Appendix Performing the Control Reactions Introduction We recommend performing the following control TOPO Cloning reactions the first time you use the kit to help you evaluate your results Performing the control reactions involves producing a control PCR product containing the lac promoter and the LacZa fragment using the reagents included in the kit Successful TOPO Cloning of the control PCR product in either direction will yield blue colonies on LB agar plates containing kanamycin and X gal Before Starting For each transformation prepare two LB plates containing 50 ug ml kanamycin and X gal see page 26 for recipes Producing the Use the procedure below to produce the 500 bp control PCR product using Taq Control PCR polymerase Product 1 Ina0 5 ml microcentrifuge tube set up the following 50 ul PCR Reagent Amount Control DNA Template 50 ng 1 pl 10X PCR Buffer 5 pl dNTP Mix 0 5 pl Control PCR Primers 0 1 ug l each 1 ul Sterile water 41 5 ul Taq polymerase 1 U ul 1 ul Total volume 50 ul Overlay with 70 ul 1 drop of mineral oil if required Amplify using the following cycling parameters Step Time Temperature Cycles Initial Denaturation 2 minutes 94 C 1X Denaturation 1 m
8. 0 10 ul Control PCR Template 0 05 ug ul in TE Buffer pH 8 0 10 ul Primer Sequences The table below provides the sequences of GW1 and GW3 primers Primer Sequence pMoles Supplied GW1 5 GTTGCAACAAATTGATGAGCAATGC 3 260 GW3 5 TTAATATATTGATATTTATATCATTTTACG 3 219 viii continued on next page Kit Contents and Storage continued One Shot TOP10 The following reagents are included with the One Shot TOP10 Chemically Reagents Competent E coli kit Transformation efficiency is gt 1 x 10 cfu ug plasmid DNA Store at 80 C Reagent Composition Amount S O C Medium 2 Tryptone 6 ml may be stored at room 0 5 Yeast Extract temperature or 4 C 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO 20 mM glucose TOP10 cells zu 21 x 50 pl pUC19 Control DNA 10 pg ul in 5 mM Tris HCl 50 ul 0 5 mM EDTA pH 8 Genotype of F mcrA A mrr hsdRMS mcrBC 80lacZAM15 AlacX74 recA1 araD139 A ara leu 7697 TOP10 Strain galU galK rpsL StrR endA1 nupG ix Accessory Products Introduction Additional Products The products listed in this section may be used with the pENTR 5 TOPO TA Cloning Kit For more information refer to our Web site www invitrogen com or contact Technical Support see page 27 Some of the reagents supplied in the pENTR 5 TOPO TA Cloning Kit and other reagents suitable for use with the kit are available separately from Invitrogen Ordering info
9. is mediated via optimized att sites To accommodate simultaneous recombinational cloning of multiple DNA fragments in the MultiSite Gateway Technology these att sites have been further modified and optimized Modifications include alterations to both the sequence and length of the att sites resulting in the creation of new att sites exhibiting enhanced specificities and the improved efficiency required to permit cloning of multiple DNA fragments in a single reaction While traditional Gateway entry vectors contain attL1 and attL2 sites and may be recombined with any standard Gateway destination vector to generate an expression construct the pENTR 5 TOPO vector contains attL4 and attR1 sites refer to the diagram on page 7 for the sequence of the att sites Because of the different att sites entry clones generated in pENTR 5 TOPO are only suitable for use in MultiSite Gateway applications see the next page and not in other standard Gateway applications continued on next page Overview continued Applications for pENTR 5 TOPO Entry Clones ori kan Entry clones generated in the pENTR 5 TOPO vector are suitable for use in the following MultiSite Gateway applications For an illustration see the figure below e Combine a pENTR 5 TOPO entry clone containing a promoter of interest with an attL1 and attL2 flanked entry clone containing a gene of interest and pLenti6 R
10. manual This manual is supplied with the ViraPower Promoterless Lentiviral Gateway Kits but is also available for downloading from our Web site www invitrogen com or by contacting Technical Support see page 27 Each pENTR 5 TOPO TA Cloning Kit is shipped on dry ice and contains two boxes as described below Upon receipt store the boxes as detailed below Box Item Storage 1 pENTR 5 TOPO TA Cloning Reagents 20 C 2 One Shot TOP10 Chemically Competent E coli 80 C continued on next page vii Kit Contents and Storage continued pENTR 5 TOPO Reagents The following reagents are supplied with the pENTR 5 TOPO vector Box 1 Note that the user must supply Taq polymerase Store at 20 C Item Concentration Amount pENTR 5 TOPO vector 5 10 ng l linearized plasmid DNA in 20 pl TOPO adapted 50 glycerol 50 mM Tris HCl pH 7 4 at 25 C 1mM EDTA 1mM DTT 0 1 Triton X 100 100 ug ml BSA 30 uM phenol red 10X PCR Buffer 100 mM Tris HCl pH 8 3 at 42 C 100 pl 500 mM KCl 25 mM MgCl 0 01 gelatin dNTP Mix 12 5 mM dATP 10 pl 12 5 mM dCTP 12 5 mM dGTP 12 5 mM dTTP neutralized at pH 8 0 in water Salt Solution 1 2 M NaCl 50 pl 0 06 M MgCl Sterile Water 1 ml GW1 Primer 0 1 ug ulin TE Buffer pH 8 0 20 ul GW3 Primer 0 1 ug ulin TE Buffer pH 8 0 20 ul Control PCR Primers 0 1 ug ul each in TE Buffer pH 8
11. not for Commercial Purposes Notwithstanding the preceding any buyer who is employed in an academic or government institution may transfer materials made with this product to a third party who has a license from Invitrogen under the patents identified above to distribute such materials Transfer of such materials and or information to collaborators does not convey rights to practice any methods claimed in the foregoing patents or patent applications Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Invitrogen Corporation will not assert a claim against the buyer of infringement of the above patents based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that none of i this product ii any of its components or iii a method claim of the foregoing patents was used in the manufacture of such product Invitrogen Corporation will not assert a claim against the buyer of infringement of the
12. of your PCR product and a potential loss of cloning efficiency 1 Electrophorese as much as possible of your PCR reaction on a low melt agarose gel 0 8 to 1 2 in TAE buffer Visualize the band of interest and excise the band Place the gel slice in a microcentrifuge tube and incubate the tube at 65 C until the gel slice melts Place the tube at 37 C to keep the agarose melted Add 4 ul of the melted agarose containing your PCR product to the TOPO Cloning reaction as described on page 11 Incubate the TOPO Cloning reaction at 37 C for 5 to 10 minutes This is to keep the agarose melted Transform 2 to 4 ul directly into One Shot competent cells using the method on page 13 The cloning efficiency may decrease with purification of the PCR product You may wish to optimize your PCR to produce a single band Addition of 3 A Overhangs Post Amplification Introduction Direct cloning of DNA amplified by proofreading polymerases into TOPO TA Cloning vectors is often difficult because proofreading polymerases remove the 3 A overhangs necessary for TA Cloning Invitrogen has developed a simple method to clone these blunt ended fragments Before Starting You will need the following items e Taq polymerase e A heat block equilibrated to 72 C e Phenol chloroform optional e 3 M sodium acetate optional e 100 ethanol optional e 80 ethanol optional e TE buffer optional Procedure This is ju
13. one vial of One Shot cells for each transformation continued on next page Transforming One Shot Competent E coli continued One Shot Chemical Transformation Protocol One Shot Electroporation Protocol Use the following protocol to transform One Shot TOP10 chemically competent E coli 1 ON Ol ae Add 2 ul of the TOPO Cloning reaction from Performing the TOPO Cloning Reaction Step 2 page 11 into a vial of One Shot Chemically Competent E coli and mix gently Do not mix by pipetting up and down Note If you are transforming the pUC19 control plasmid use 10 pg 1 ul Incubate on ice for 5 to 30 minutes Note Longer incubations on ice seem to have a minimal effect on transformation efficiency The length of the incubation is at the user s discretion Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tubes to ice Add 250 ul of room temperature S O C Medium Cap the tube tightly and shake the tube horizontally 200 rpm at 37 C for 1 hour Spread 10 50 ul from each transformation on a prewarmed selective plate and incubate overnight at 37 C To ensure even spreading of small volumes add 20 ul of S O C Medium We recommend that you plate two different volumes to ensure that at least one plate will have well spaced colonies An efficient TOPO Cloning reaction should produce several hundred colonies Pick 10 colonies for analysis see Analyzing Transf
14. organizations and by for profit organizations without royalty payment to Invitrogen Invitrogen also understands that Gateway expression clones containing attB1 and attB2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by academic and government organizations without royalty payment to Invitrogen Organizations other than academia and government may also distribute such Gateway expression clones for a nominal fee 10 per clone payable to Invitrogen We would ask that such distributors of Gateway entry and expression clones indicate that such clones may be used only for research purposes that such clones incorporate the Gateway Technology and that the purchase of Gateway Clonase from Invitrogen is required for carrying out the Gateway recombinational cloning reaction This should allow researchers to readily identify Gateway containing clones and facilitate their use of this powerful technology in their research Use of Invitrogen s Gateway Technology including Gateway clones for purposes other than scientific research may require a license and questions concerning such commercial use should be directed to Invitrogen s licensing department at 760 603 7200 References Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K
15. the gene of interest and the pLenti6 R4R2 V5 DEST vector e Your PCR product should encode a eukaryotic promoter of interest suitable for controlling expression of the downstream gene of interest Make sure that the PCR product contains all sequences e g TATA box transcription factor binding sites etc necessary to regulate the downstream gene of interest after MultiSite Gateway LR recombination e Your PCR product should contain a transcriptional start site if one is not included in the entry clone containing your gene of interest e Your PCR product should not contain an ATG for translation initiation if one is included in the entry clone containing your gene of interest If you are planning to use your pENTR 5 TOPO entry clone in a MultiSite Gateway LR reaction with an attL1 and attL2 flanked entry clone and the pLenti6 R4R2 V5 DEST vector to generate a lentiviral expression vector i e ViraPower Promoterless Lentiviral Gateway Kits note that the size of your insert DNA i e promoter gene of interest can influence the viral titer To obtain efficient lentiviral packaging make sure that the combined size of your promoter gene of interest does not exceed 4 5 5 kb Larger inserts may not be properly packaged and may result in lower lentiviral titers When synthesizing PCR primers do not add 5 phosphates to the primers as this will prevent the synthesized PCR product from ligating into the pENTR 5
16. the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The purchase of this product does not convey a license under any method claims in the foregoing patents or patent applications or to use this product with any recombination sites other than those purchased from Invitrogen Corporation or its authorized distributor The right to use methods claimed in the foregoing patents or patent applications with this product for research purposes only can only be acquired by the use of Clonase purchased from Invitrogen Corporation or its authorized distributors The buyer cannot modify the recombination sequence s contained in this product for any purpose The buyer cannot sell or otherwise transfer a this product b its components or c materials made by the employment of this product or its components to a third party or otherwise use this product or its components or materials made by the employment of this product or its components for Commercial Purposes The buyer may transfer information or materials made through the employment of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and
17. to prevent arcing during electroporation Dilute the stock Salt Solution 4 fold with water to prepare a 300 mM NaCl 15 mM MgCl Dilute Salt Solution Use this Dilute Salt Solution to set up the TOPO Cloning reaction as directed on the next page continued on next page Setting Up the TOPO Cloning Reaction continued Materials Needed Performing the TOPO Cloning Reaction You should have the following materials on hand before beginning Your PCR product freshly prepared The pENTR 5 TOPO vector supplied with the kit Box 1 keep at 20 C until use Salt Solution supplied with the kit Box 1 or Dilute Salt Solution see previous page as appropriate Sterile water supplied with the kit Box 1 Use the procedure below to perform the TOPO Cloning reaction Set up the TOPO Cloning reaction using the reagents in the order shown and depending on whether you plan to transform chemically competent E coli or electrocompetent E coli Note The red color of the TOPO vector solution is normal and is used to visualize the solution Reagent Chemically Competent E coli Electrocompetent E coli Fresh PCR product 0 5 to 4 ul 0 5 to 4 ul Salt Solution 1 ul Dilute Salt Solution 1 4 1 ul Sterile Water add to a final volume of 5 ul add to a final volume of 5 ul pENTR 5 TOPO vector 1 ul 1 ul Final volume 6 ul 6 ul Store all reagents at 20 C when finished Salt
18. 4R2 V5 DEST to create a lentiviral expression construct Use the lentiviral construct to facilitate expression of your recombinant protein in dividing or non dividing mammalian cells For more information refer to the ViraPower Promoterless Lentiviral Gateway Expression System manual Combine a pENTR 5 TOPO entry clone containing a promoter of interest with an attL1 and attL2 flanked entry clone containing a gene of interest an attR2 and attL3 flanked entry clone containing a 3 element of interest and pDEST R4 R3 to create an expression construct Use the expression construct to facilitate expression of your recombinant protein in mammalian cells For more information refer to the MultiSite Gateway Three Fragment Vector Construction Kit manual promoter ViraPower Promoterless Lentiviral Gateway Expression System MultiSite Gateway Three Fragment Vector Construction Kit ori kan pENTR gene pENTR 3 element pENTR 5 prom oter atfR1 gt attL1 pENTR 5 prom oter attR1 promoter gene promoter attR2 gene atts attL1 gene a ttL2 pENTR gene ori kan Carra ccdB Cm promoter pLenti R4R2 V5 DEST Ol R ccdB Cm pDEST R4 R3 ri LR Clonase II Plus
19. Allows sequencing of the insert Kanamycin resistance gene Allows selection of the plasmid in E coli pUC origin of replication ori Allows high copy replication and maintenance in E coli 25 Recipes LB Luria Bertani Medium and Plates X Gal Stock Solution 26 Composition 1 0 Tryptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave on liquid cycle for 20 minutes Allow solution to cool to 55 C and add antibiotic if needed 4 Store at room temperature or at 4 C LB agar plates ee De EN ai Prepare LB medium as above but add 15 g L agar before autoclaving Autoclave on liquid cycle for 20 minutes After autoclaving cool to 55 C add antibiotic and pour into 10 cm plates Let harden then invert and store at 4 C in the dark To add X gal to the plate warm the plate to 37 C Pipette 40 ul of the 40 mg ml X gal stock solution see below spread evenly and let dry for 15 minutes Protect plates from light Dissolve 400 mg of X gal in 10 ml dimethylformamide to prepare a 40 mg ml stock solution Store at 20 C protected from light Technical Support Web Resources Visit the Invitrogen Web site at www invitrogen com for e Technical resources includin
20. above patents based upon the use of this product to manufacture a protein for sale provided that no method claim in the above patents was used in the manufacture of such protein If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to use this product for purposes other than those permitted above contact Licensing Department Invitrogen Corporation 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603 7200 For additional information about Invitrogen s policy for the use and distribution of Gateway clones see the section entitled Gateway Clone Distribution Policy next page 29 Gateway Clone Distribution Policy Introduction Gateway Entry Clones Gateway Expression Clones Additional Terms and Conditions 30 The information supplied in this section is intended to provide clarity concerning Invitrogen s policy for the use and distribution of cloned nucleic acid fragments including open reading frames created using Invitrogen s commercially available Gateway Technology Invitrogen understands that Gateway entry clones containing attL1 and attL2 sites may be generated by academic and government researchers for the purpose of scientific research Invitrogen agrees that such clones may be distributed for scientific research by non profit
21. ateway LR recombination reaction with other suitable entry clone s to generate an expression construct For more information about how TOPO Cloning works and the MultiSite Gateway Technology see the rest of this section The Gateway Technology is a universal cloning system that takes advantage of the site specific recombination properties of bacteriophage lambda Landy 1989 to provide a rapid and highly efficient way to move a single DNA sequence of interest into multiple vector systems The MultiSite Gateway Technology uses modifications of the Gateway Technology to allow simultaneous cloning of multiple DNA fragments in a defined order and orientation to facilitate creation of an expression construct that expresses a gene of interest from your promoter of choice To express a gene of interest using the MultiSite Gateway Technology you will 1 TOPO Clone a Tag amplified PCR product encoding a eukaryotic promoter of choice into the pENTR 5 TOPO vector to generate a 5 entry clone 2 Generate an entry clone containing your gene of interest using one of the standard Gateway entry vectors available from Invitrogen Note If you are using the MultiSite Gateway Three Fragment Vector Construction Kit also generate an entry clone containing a 3 element of interest e g polyadenylation signal using the reagents supplied in the kit 3 Perform a MultiSite Gateway LR recombination reaction between your 5
22. c or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research Invitrogen Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Invitrogen Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Invitrogen is willing to accept return of the product with a full refund For information on purchasing a license to this product for purposes other than research contact Licensing Department Invitrogen Corporation 1600 Faraday Avenue Carlsbad California 92008 Phone 760 603 7200 Fax 760 602 6500 Email outlicensing invitrogen com Purchaser Notification continued Limited Use Label License No 19 Gateway Cloning Products Gateway Clone Distribution Policy This product and its use is the subject of one or more of U S Patent Nos 5 888 732 6 143 557 6 171 861 6 270 969 and 6 277 608 and or other pending U S and foreign patent applications owned by Invitrogen Corporation The purchase of this product conveys to the buyer
23. cificity and higher yields we recommend using Platinum Tag DNA Polymerase available from Invitrogen see page x for ordering information to generate your PCR product e Thermocycler e DNA template containing the desired promoter region e PCR primers suitable for amplification of the desired region You may use a polymerase mixture containing Taq polymerase and a proofreading polymerase to produce your PCR product however the mixture must contain a ratio of Taq polymerase proofreading polymerase in excess of 10 1 to ensure the presence of 3 A overhangs on the PCR product We recommend using Platinum Taq DNA Polymerase High Fidelity available from Invitrogen see page x for ordering information If you use polymerase mixtures that do not have enough Tag polymerase or a proofreading polymerase only you may add 3 A overhangs to your PCR product using the method on page 23 1 Set up the following 50 ul PCR reaction Use less DNA if you are using plasmid DNA as a template and more DNA if you are using genomic DNA as a template Use the cycling parameters suitable for your primers and template Be sure to include a 7 to 30 minute extension at 72 C after the last cycle to ensure that all PCR products are full length and 3 adenylated DNA Template 10 100 ng 10X PCR Buffer 5 ul dNTP Mix 50 mM 0 5 ul PCR primers 100 200 ng each 1 uM each Sterile water add to a final volume of 49 ul Tag Polymerase 1 U l 1 ul Total v
24. control reactions on pages 19 20 in parallel with your samples We have found that including salt 200 mM NaCl 10 mM MgCl in the TOPO Cloning reaction can increase the number of transformants 2 to 3 fold In addition incubating the reaction mixture for greater than 5 minutes in the presence of salt can also increase the number of transformants In contrast in experiments performed without salt the number of transformants decreases as the incubation time increased beyond 5 minutes Including salt in the TOPO Cloning reaction allows for longer incubation times because it prevents topoisomerase I from rebinding and potentially nicking the DNA after ligating the PCR product and dissociating from the DNA This yields more intact DNA molecules leading to higher transformation efficiencies You will perform TOPO Cloning in a reaction buffer containing salt i e using the stock salt solution provided in the kit Note that the amount of salt added to the TOPO Cloning reaction varies depending on whether you plan to transform chemically competent cells provided or electrocompetent cells see page x for ordering information e If you are transforming chemically competent E coli use the stock Salt Solution as supplied and set up the TOPO Cloning reaction as directed on the next page e If you are transforming electrocompetent E coli the amount of salt in the TOPO Cloning reaction must be reduced to 50 mM NaCl 2 5 mM MgCl
25. entry clone other suitable entry clone s and the appropriate MultiSite Gateway destination vector to generate an expression construct 4 Introduce your expression construct into mammalian cells and express your recombinant protein For more information about the MultiSite Gateway Technology refer to the ViraPower Promoterless Lentiviral Gateway Expression System or MultiSite Gateway Three Fragment Vector Construction Kit manuals as appropriate Both manuals are available for downloading from www invitrogen com or by contacting Technical Support see page 27 continued on next page Overview continued Features of the pENTR 5 TOPO Vector att Sites in pENTR 5 TOPO Features of the pENTR 5 TOPO vector include e TOPO Cloning site for rapid and efficient cloning of a Taq amplified PCR product encoding a promoter of choice e attL4 and attR1 sites to allow two fragment or three fragment recombination with appropriate entry clone s and a MultiSite Gateway destination vector to generate an expression construct e Primer binding sites within the attL4 and attR1 sites for sequencing using the GW1 and GW3 primers e rrnB transcription termination sequences to prevent basal expression of the PCR product of interest in E coli e Kanamycin resistance gene for selection in E coli e pUC origin for high copy replication of the plasmid in E coli In the Gateway Technology recombinational cloning
26. g manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our website www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters Invitrogen Corporation Invitrogen Japan Invitrogen Ltd 1600 Faraday Avenue LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech_support invitrogen com E mail jpinfo invitrogen com E mail eurotech invitrogen com MSDS Certificate of Analysis Limited Warranty MSDSs Material Safety Data Sheets are available on our Web site at www invitrogen com msds Product qualification is described in the Certificate of Analysis CofA available on our Web site by product lot number at www invitrogen com cofa Invitrogen is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our pr
27. g site I 581 CCATGGAGCT CCAAATAATG ATTTTATTTT GACTGATAGT GACCTGTTCG TTGCAACAAA TTGATAAGCA ATGCTTTTTT EcoR EcoR 661 ATAATGCCAA CTTTG TAT AGA AAA GTT GGC TCC GAA TTC GCC CTI product INAG GGC GAA TTC TTT CAA CCG AGG CTT AAG CGG GAR TTC CCG CTT AAG Lys Val Gly Ser Glu Phe Ala Leu Lys Gly Glu Phe attR1 GW3 priming site I 718 GAC CCA AGT TIG TAC AAAAAAGT TGAACGAGAA ACGTAAAATG ATATAAATAT CAATATATTA AATTAGATTT CTG GGI TCA ARAC ATG TETTTTCA Asp Pro Ser l 791 TGCATAAAAA ACAGACTACA TAATACTGTA AAACACAACA TATGCAGTCA CTATGAACCA ACTACTTAGA TGGTATTAGT mmm 871 GACCTGTAGA ATTAATTCGA GCTCTAGAGC TGCAGGGCGG CCGCGATATC CCCTATAGTG AGTCGTATTA CATGGTCATA M13 reverse priming site 951 GCTGTTTCCT GGCAGCTCTG If you have used other Gateway entry vectors note that the sequences within the att sites may vary slightly The efficiency of LR recombination remains the same Note Producing PCR Products Introduction Materials Supplied by the User Polymerase Mixtures Producing PCR Products Once you have synthesized appropriate PCR primers you may use the primers and a suitable DNA polymerase to produce your PCR product Remember that your PCR product must have single 3 A overhangs You will need the following reagents and equipment for PCR Note dNTPs adjusted to pH 8 are provided in the kit e Taq polymerase or other suitable DNA polymerase Note For improved spe
28. hould be between 50 and 80 ul 0 1 cm cuvettes or 100 to 200 ul 0 2 cm cuvettes If you experience arcing during transformation try one of the following suggestions e Reduce the voltage normally used to charge your electroporator by 10 e Reduce the pulse length by reducing the load resistance to 100 ohms e Ethanol precipitate the TOPO Cloning reaction and resuspend in water prior to electroporation Analyzing Transformants Analyzing Positive 1 Pick 10 colonies and culture them overnight in LB or SOB medium containing Clones Sequencing Long Term Storage 50 ug ml kanamycin 2 Isolate plasmid DNA using your method of choice If you need ultra pure plasmid DNA for automated or manual sequencing we recommend using Invitrogen s PureLink HQ Mini Plasmid Purification Kit Catalog No K2100 01 3 Analyze the plasmids by restriction analysis or PCR to confirm the presence and correct orientation of the insert Note PENTR 5 TOPO contains EcoRI sites flanking the TOPO Cloning site You may use EcoRI digestion to check for the presence of insert if desired Once you have identified the correct clone s you may sequence your construct to confirm that your promoter is cloned in the correct orientation Use the GW1 and GWS3 primers included in the kit to sequence your insert The GW1 and GW3 primer binding sites are located within the attL4 and attR1 sites respectively and therefore minimize the a
29. ii ia 24 RECIPES E E E E aes 26 Technical Support len a 27 LN AA E AE E E E E A EE EE E E E EAE Ea 28 Gateway Clone Distribution Poly A eh 30 References Tenere o e ie aaah eae ele autem EE E 31 iii iv TOPO Cloning Procedure for Experienced Users Introduction This quick reference sheet is provided for experienced users of the TOPO Cloning procedure If you are performing the TOPO Cloning procedure for the first time we recommend that you follow the detailed protocols provided in the manual Step Action Produce PCR product Amplify DNA encoding a eukaryotic promoter of choice using Taq polymerase and your own protocol End the PCR reaction with a final 7 to 10 minute extension step Perform the TOPO 1 Set up one of the following TOPO Cloning reactions using the reagents in the Cloning Reaction order shown For electroporation dilute Salt Solution 4 fold to prepare Dilute pENTR 5 TOPO Vector Total volume 1ul 6 ul Salt Solution Reagent For Chemical For Electroporation Transformation Fresh PCR product 0 5 to 4 ul 0 5 to 4 ul Salt Solution 1 ul Dilute Salt Solution 1 ul Sterile Water to a final volume of 5 ul toa final volume of 5 ul 1 ul 6 ul E coli below 2 Mix gently and incubate for 5 minutes at room temperature 3 Place on ice and proceed to transform One Shot TOP10 chemically competent Transform One Shot TOP10 Chemically Competent E co
30. inute 94 C Annealing 1 minute 60 C 25X Extension 1 minute 72 C Final Extension 7 minutes 72 C 1X 4 Remove 10 ul from the reaction and analyze by agarose gel electrophoresis A discrete 500 bp band should be visible Proceed to the Control TOPO Cloning Reactions next page continued on next page 19 Performing the Control Reactions continued Control TOPO What You Should See Transformation Control 20 Using the control PCR product produced on the previous page and the Cloning Reactions pENTR 5 TOPO vector set up two 6 ul TOPO Cloning reactions as described below 1 Set up control TOPO Cloning reactions Reagent Vector Only Vector PCR Insert Sterile Water 4 ul 3 pl Salt Solution 1 ul 1ul Control PCR Product 1 ul pENTR 5 TOPO vector 1 ul 1 ul Total volume 6 ul 6 ul 2 Incubate at room temperature for 5 minutes and place on ice 3 Transform 2 ul of each reaction into separate vials of One Shot competent cells using the procedure on page 13 4 Spread 10 50 ul of each transformation mix onto LB plates containing 50 ug ml kanamycin and X gal When plating small volumes add 20 ul of S O C Medium to ensure even spreading Be sure to plate two different volumes to ensure that at least one plate has well spaced colonies 5 Incubate overnight at 37 C The vector PCR insert reaction should be produce hundreds of colonies
31. invitrogen pENTR 5 TOPO TA Cloning Kit Five minute TOPO Cloning of Tag polymerase amplified PCR products into an entry vector for the ViraPower Promoterless Lentiviral Gateway and MultiSite Gateway Systems Catalog nos K591 10 K591 20 and K5910 00 Version C 6 June 2007 25 0744 Table of Contents Tableiof Contents 2 u an send Hein ets ashe eG Ht NUR Hees Es tae dete ce ali nase ii Table Ob Contents iria ainia stilo dai iii TOPO Cloning Procedure for Experienced Users un Lesen De v Kit Contents and Storage emonenenononocnnnnnrnnnnnnnnnnnnnananannnnnnn e a e e oe eaa a aE E EOE E E aa T AAT oa Ee vii Accessory Products isaac EEE EE E E EE aati E EE A E a Ih x Introduction costa sd 1 Overview NO 1 Experimental Outline anita usar aia 5 Methods 2 2 2n n nee ehe 6 Desisni g BER Primers sims 6 Producing PER Product vos ii A een nn RE EN 8 Setting Up the TOPO Cloning Resten astra anal 10 Transforming One Shot Competent E coi 12 Analyzing AAA diesel hl ni hen cuenta IrL RENA Seri TAKES 15 Guidelines to Perform the MultiSite Gateway LR Recombination Reaction 16 Trouble IN 17 APBENAN ihrer 19 Performing the Contool Reat HONS sesen meaa eae NEA E nalen ep an 19 Gel Purifying PCR Products ses a e E EEE a e EEE EE ES RE R ae 21 Addition of 3 A Overhangs Post Amplification c cccccccccsesetesesesnsnenesesssesesceceeeneseseseseseeenesesesesesnsnanenesessseaees 23 Map and Features of pENTR OTOP OP
32. li transfer the tube to ice 3 Incubate on ice for 5 to 30 minutes 4 Heat shock the cells for 30 seconds at 42 C without shaking Immediately 5 Add 250 ul of room temperature S O C Medium 6 Incubate at 37 C for 1 hour with shaking 7 Spread 10 50 ul of bacterial culture on a prewarmed LB agar plate containing 50 ug ml kanamycin and incubate overnight at 37 C For each transformation thaw one vial of One Shot TOP10 E coli cells on ice 2 Add 2 pl of the TOPO Cloning reaction into a vial of One Shot TOP10 chemically competent E coli and mix gently Control Reaction We recommend using the Control PCR Template and the Control PCR Primers included with the kit to perform the control reaction See the protocol on pages 19 20 for instructions vi Kit Contents and Storage Types of Kits Shipping Storage This manual is supplied with the following kits Kit Catalog No pENTR 5 TOPO TA Cloning Kit K591 20 ViraPower Promoterless Lentiviral Gateway Vector Kit K591 10 ViraPower Promoterless Lentiviral Gateway Expression Kit K5910 00 TM Note Catalog nos K591 10 and K5910 00 also include ViraPower Promoterless Lentiviral components required for production of a lentiviral expression construct For more information about the ViraPower Promoterless Lentiviral components refer to the ViraPower Promoterless Lentiviral Gateway Expression System
33. mount of vector encoded DNA that needs to be read to less than 55 base pairs see the diagram on page 7 for the location of the priming sites Alternatively the pENTR 5 TOPO vector also includes M13 forward and reverse primer binding sites for sequencing using M13 forward 20 and M13 reverse primers if desired Note that the M13 forward and reverse primer binding sites are located upstream and downstream of the of the attL4 and attR1 sites respectively requiring that at least 130 base pairs of vector encoded DNA be read before reaching the insert DNA Reminder When using the GW1 primer for sequencing note that one nucleotide position 646 within the primer binding site of the vector can vary in sequence between G and A This variation does not affect the functionality of the GW1 sequencing primer or sequencing results Once you have identified the correct clone be sure to purify the colony and make a glycerol stock for long term storage We recommend that you store a stock of plasmid DNA at 20 C 1 Streak the original colony out for single colonies on an LB plate containing 50 ug ml kanamycin 2 Isolate a single colony and inoculate into 1 2 ml of LB containing 50 pg ml kanamycin Grow until culture reaches stationary phase Mix 0 85 ml of culture with 0 15 ml of sterile glycerol Transfer to a cryovial Store at 80 C 15 Guidelines to Perform the MultiSite Gateway LR Recombination Reaction Introduction
34. ng reaction from Step 2 previous page e One Shot TOP10 chemically competent E coli supplied with the kit Box 2 e 0 C Medium supplied with the kit Box 2 e pUC19 positive control to check transformation efficiency if desired supplied with the kit Box 2 e 42 C water bath or electroporator with cuvettes optional e 15 ml sterile snap cap plastic culture tubes for electroporation only e LB plates containing 50 ug ml kanamycin two for each transformation see page 26 for a recipe to prepare LB plates e LB plates containing 100 ug ml ampicillin if transforming pUC19 control e 37 C shaking and non shaking incubator There is no blue white screening for the presence of inserts Most transformants will contain recombinant plasmids with the PCR product of interest cloned into the vector The GW1 and GW3 primers are included in the kit to allow you to sequence across an insert in the TOPO Cloning site to confirm orientation For each transformation you will need one vial of One Shot competent cells and two selective plates e Equilibrate a water bath to 42 C for chemical transformation or set up your electroporator if you are using electrocompetent E coli e Warm the vial of 5 0 C Medium to room temperature e Warm LB plates containing 50 pg ml kanamycin at 37 C for 30 minutes If you are including the pUC19 positive control prewarm LB plates containing 100 ug ml ampicillin as well e Thaw on ice
35. nsformation reactions To help evaluate your results we recommend that you perform the control reactions see Problem Reason Solution Few or no colonies obtained from sample reaction and the transformation control gave colonies Incomplete extension during PCR Include a final extension step of 7 to 30 minutes during PCR Longer PCR products will need a longer extension time Excess or overly diluted PCR product used in the TOPO Cloning reaction Reduce or concentrate the amount of PCR product PCR primers contain 5 phosphates Do not add 5 phosphates to your PCR primers Used a proofreading poly merase or a Tag proofreading polymerase mixture for PCR Use Taq polymerase or another DNA polymerase that leaves 3 A overhangs to produce your PCR product Add 3 A overhangs to your blunt PCR product by incubating with Taq poly merase see page 23 Large PCR product Increase the amount of PCR product used in the TOPO Cloning reaction Increase the incubation time of the TOPO Cloning reaction from 5 minutes to 30 minutes Gel purify the PCR product to remove primer dimers and other artifacts PCR reaction contains artifacts i e does not run as a single band on an agarose gel Optimize your PCR conditions Gel purify your PCR product continued on next page 17 Troubleshooting continued TOPO Cloning Reaction and Transformati
36. oducts and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives Invitrogen warrants that all of its products will perform according to specifications stated on the certificate of analysis The company will replace free of charge any product that does not meet those specifications This warranty limits Invitrogen Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions Invitrogen reserves the right to select the method s used to analyze a product unless Invitrogen agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore Invitrogen makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Invitrogen assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness f
37. olume 50 ul 2 Use agarose gel electrophoresis to verify the quality of your PCR product You should see a single discrete band of the correct size If you do not see a single band refer to the Note on the next page continued on next page Producing PCR Products continued Note If you do not obtain a single discrete band from your PCR try the following Optimize your PCR to eliminate multiple bands and smearing Innis et al 1990 The PCR Optimizer Kit available from Invitrogen Catalog no K1220 01 incorporates many of the recommendations found in this reference For more information refer to our Web site www invitrogen com or contact Technical Support see page 27 Gel purify your fragment using one of the methods on pages 21 22 Take special care to avoid sources of nuclease contamination Setting Up the TOPO Cloning Reaction Introduction Note Using Salt Solution in the TOPO Cloning Reaction 10 Once you have produced the desired PCR product you are ready to TOPO Clone it into the pENTR 5 TOPO vector and transform the recombinant vector into One Shot TOP10 competent E coli You should have everything you need set up and ready to use to ensure that you obtain the best possible results We suggest that you read this section and the section entitled Transforming One Shot Competent E coli pages 12 13 before beginning If this is the first time you have TOPO Cloned perform the
38. on continued 18 Problem Reason Solution Few or no colonies obtained from sample reaction and the transformation control gave colonies continued PCR product does not contain sufficient 3 A overhangs even though you used Taq polymerase e Increase the final extension time to ensure that all 3 ends are adenylated e Tag polymerase is most efficient at adding a non template 3 A next to a C and less efficient at adding a nontemplate 3 A next to another A You may have to re design your primers so that they contain a 5 G instead of a 5 T Brownstein et al 1996 Large number of incorrect inserts cloned PCR cloning artifacts e Gel purify your PCR product to remove primer dimers and smaller PCR products e Optimize your PCR conditions e Include a final extension step of 7 to 30 minutes during PCR Longer PCR products will need a longer extension time Few or no colonies obtained from sample reaction and the transformation control gave no colonies One Shot competent E coli stored incorrectly Store One Shot competent E coli at 80 C If you are using another E coli strain follow the manufacturer s instructions Did not perform the 1 hour grow out period before plating the transformation mixture After the heat shock step add S O C Medium and incubate the transformation mixture for 1 hour at 37 C before plating Insufficient amount of E coli
39. or a particular purpose 27 Purchaser Notification Introduction Limited Use Label License No 5 Invitrogen Technology 28 Use of the pENTR 5 TOPO TA Cloning Kit is covered under the licenses detailed below The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnosti
40. ormants page 15 Use ONLY electrocompetent cells for electroporation to avoid arcing Do not use the One Shot TOP10 chemically competent cells for electroporation 1 Add 2 ul of the TOPO Cloning reaction from Performing the TOPO Cloning Reaction Step 2 page 11 into a sterile microcentrifuge tube containing 50 ul of One Shot TOP10 Electrocompetent E coli and mix gently Do not mix by pipetting up and down Avoid formation of bubbles Transfer the cells to a 0 1 cm cuvette Electroporate your samples using your own protocol and your electroporator Note If you have problems with arcing see the next page Immediately add 250 ul of room temperature S O C Medium Transfer the solution to a 15 ml snap cap tube i e Falcon and shake for at least 1 hour at 37 C to allow expression of the kanamycin resistance gene Spread 10 50 ul from each transformation on a prewarmed selective plate and incubate overnight at 37 C To ensure even spreading of small volumes add 20 ul of S O C Medium We recommend that you plate two different volumes to ensure that at least one plate will have well spaced colonies An efficient TOPO Cloning reaction should produce several hundred colonies Pick 10 colonies for analysis see Analyzing Transformants page 15 continued on next page 13 Transforming One Shot Competent E coli continued 14 To prevent arcing of your samples during electroporation the volume of cells s
41. pidly purify PCR products from regular agarose gels 1 Electrophorese amplification reaction on a 1 to 5 regular TAE agarose gel Note Do not use TBE to prepare agarose gels Borate interferes with the sodium iodide step below 2 Cut out the gel slice containing the PCR product and melt it at 65 C in 2 volumes of the 6 M sodium iodide solution 3 Add 1 5 volumes Binding Buffer Load solution no more than 1 ml at a time from Step 3 onto a S N A P column Centrifuge 1 minute at 3000 x g in a microcentrifuge and discard the supernatant If you have solution remaining from Step 3 repeat Step 4 Add 900 ul of the Final Wash Buffer Centrifuge 1 minute at full speed in a microcentrifuge and discard the flow through Repeat Step 7 Elute the purified PCR product in 40 ul of TE or sterile water Use 4 ul for the TOPO Cloning reaction and proceed as described on page 11 An even easier method is to simply cut out the gel slice containing your PCR product place it on top of the S N A P column bed and centrifuge at full speed for 10 seconds Use 1 2 pl of the flow through in the TOPO Cloning reaction see page 11 Be sure to make the gel slice as small as possible for best results continued on next page 21 Gel Purifying PCR Products continued Low Melt Agarose Method Note 22 If you prefer to use low melt agarose use the procedure below Note that gel purification will result in a dilution
42. rmation for these reagents is provided below Note Other reagent quantities may be available Item Quantity Catalog no Platinum Tag DNA Polymerase 100 reactions 10966 018 250 reactions 10966 026 500 reactions 10966 034 Taq DNA Polymerase Recombinant 100 units 10342 053 250 units 10342 012 500 units 10342 020 Platinum Tag DNA Polymerase High Fidelity 100 units 11304 011 500 units 11304 029 One Shot TOP10 Chemically Competent E coli 10 reactions C4040 10 20 reactions C4040 03 One Shot TOP10 Electrocompetent E coli 10 reactions C4040 50 Kanamycin Sulfate 100 ml 10 mg ml 15160 054 PureLink HQ Mini Plasmid Purification Kit 100 reactions K2100 01 Gateway LR Clonase II Plus Enzyme Mix 20 reactions 12538 020 100 reactions 12538 100 MultiSite Gateway Three Fragment Vector 1 kit 12537 023 Construction Kit Overview Introduction The MultiSite Gateway Technology Introduction The pENTR 5 TOPO TA Cloning Kit combines Invitrogen s TOPO Cloning and MultiSite Gateway Technologies to facilitate five minute one step cloning of a Tag polymerase amplified PCR product encoding a eukaryotic promoter of interest into a MultiSite Gateway entry vector with gt 85 efficiency Once cloned your eukaryotic promoter may be transferred from the pENTR 5 TOPO vector to a suitable MultiSite Gateway destination vector in a MultiSite G
43. s 268 295 c rrnB T1 transcription terminator bases 427 470 c M13 forward 20 priming site bases 537 552 attL4 bases 592 691 GW1 priming site bases 630 654 TOPO recognition site 1 bases 701 705 TOPO recognition site 2 bases 706 710 attR1 bases 721 845 GWS3 priming site bases 752 781 M13 reverse priming site bases 945 961 Kanamycin resistance gene 1074 1883 pUC origin bases 2004 2677 c complementary strand continued on next page Map and Features of pENTR 5 TOPO continued Features of pENTR 5 TOPO 2680 bp contains the following elements All features have pENTR 5 TOPO been functionally tested and the vector fully sequenced Feature Benefit rrnB T1 and T2 transcription termination sequences Reduces potential toxicity in E coli by preventing basal expression of the PCR product M13 forward 20 priming site Allows sequencing of the insert GW1 priming site Allows sequencing of the insert attL4 and attR1 sites Bacteriophage A derived recombination sequences that have been optimized to allow recombinational cloning of a DNA fragment in the entry construct with a suitable MultiSite Gateway destination vector in conjunction with any attL1 and attL2 flanked entry clone Landy 1989 TOPO Cloning site Allows rapid cloning of your Tag amplified PCR product GW3 priming site Allows sequencing of the insert M13 reverse priming site
44. solution and water can be stored at room temperature or 4 C 1 Mix reaction gently and incubate for 5 minutes at room temperature 22 23 C Note For most applications a 5 minute incubation will yield a sufficient number of colonies for analysis Depending on your needs the length of the TOPO Cloning reaction can be varied from 30 seconds to 30 minutes For routine subcloning of PCR products 30 seconds may be sufficient For large PCR products gt 1 kb or if you are TOPO Cloning a pool of PCR products increasing the reaction time may yield more colonies Place the reaction on ice and proceed to Transforming One Shot Competent E coli next page Note You may store the TOPO Cloning reaction at 20 C overnight 11 Transforming One Shot Competent E coli Introduction Materials Needed Note Preparing for Transformation 12 Once you have performed the TOPO Cloning reaction previous page transform your pENTR 5 TOPO construct into competent E coli One Shot TOP10 Chemically Competent E coli are included with the kit to facilitate transformation You may also transform electrocompetent cells if desired see page x for ordering information Protocols to transform chemically competent or electrocompetent E coli are provided in this section In addition to general microbiological supplies i e plates spreaders you will need the following reagents and equipment e TOPO Cloni
45. st one method for adding 3 adenines Other protocols may be suitable 1 After amplification with a proofreading polymerase place vials on ice and add 0 7 1 unit of Taq polymerase per tube Mix well It is not necessary to change the buffer A sufficient number of PCR products will retain the 3 A overhangs 2 Incubate at 72 C for 8 10 minutes do not cycle 3 Place on ice and use immediately in the TOPO Cloning reaction Note If you plan to store your sample overnight before proceeding with TOPO Cloning extract your sample with an equal volume of phenol chloroform to remove the polymerases Ethanol precipitate the DNA and resuspend in TE buffer using the starting volume of the PCR You may also gel purify your PCR product after amplification with a proofreading polymerase After purification add Taq polymerase buffer dATP and 0 5 unit of Tag polymerase Incubate the reaction for 10 15 minutes at 72 C and use in the TOPO Cloning reaction Note 23 Map and Features of pENTR 5 TOPO pENTR 5 TOPO The figure below shows the features of the pENTR 5 TOPO vector Note that Map 24 the pENTR 5 TOPO vector is supplied linearized between nucleotides 705 and 706 The complete sequence of pENTR 5 TOPO is available for downloading from www invitrogen com or by contacting Technical Support see page 27 Comments for pENTR 5 TOPO 2680 nucleotides rrnB T2 transcription terminator base
46. ve Note that Gateway destination vectors other than the ones listed above cannot be used For optimal results we recommend performing the MultiSite Gateway LR recombination reaction using e Supercoiled entry clones e Supercoiled destination vector TM Use LR Clonase II Plus enzyme mix available from Invitrogen to catalyze the MultiSite Gateway LR recombination reaction Note that the LR Clonase enzyme mix used for standard Gateway LR recombination reactions cannot be used for MultiSite Gateway LR recombination reactions See page x for ordering information Once you have performed the MultiSite Gateway LR recombination reaction you will transform the reaction mixture into competent E coli and select for expression clones For pLenti6 R4R2 V5 DEST expression clones use Stb13 E coli for transformation For pDEST R4 R3 expression clones use any recA endA E coli strain including TOP10 Mach1 T1 DH5a or equivalent for transformation Do not transform the MultiSite Gateway LR reaction mixture into E coli strains that contain the F episome e g TOP10F These strains contain the ccdA gene and will prevent negative selection with the ccdB gene Troubleshooting TOPO Cloning Reaction and Transformation pages 19 20 in parallel with your samples The table below lists some potential problems and possible solutions that may help you troubleshoot the TOPO Cloning and tra
Download Pdf Manuals
Related Search