BD SMART RACE cDNA Amplification Kit
Contents
1. 5 cycles annealing at 72 C 5 cycles at 70 C 32 cycles at 68 C 5 RACE 3 RACE 1 2 3 4 5 6 Figure 4 5 and 3 RACE sample results At BD Biosciences Clontech we have used the BD SMART RACE Kit to amplify 5 and 3 RACE fragments of many different genes start ing with poly A and total RNA This gel shows several representative 5 and 3 RACE ampli fications starting with total RNA Lanes 1 amp 4 interferon y receptor Lanes 2 amp 5 transferrin receptor Lanes 3 amp 6 HPRT The control PCR reactions described for transferrin receptor amplification should produce the RACE prod uctsinlanes 2 amp 5 The 5 product will be 2 6 kb the 3 product will be 2 9 kb As seen here a minor 0 6 kb product will occasionally be gen erated in transferrin receptor 3 RACE BD Biosciences Clontech www bdbiosciences com Protocol No PT3269 1 Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual IX Rapid Amplification of cDNA Ends RACE This procedure describes the 5 RACE and 3 RACE PCR reactions that gener ate the 5 and 3 cDNA fragments We recommend that you also perform positive control 5 and 3 RACE using the TFR primers UPM and control RACE Ready cDNAs as described in Section VIII Although the Nested Universal Primer A NUP is provided nested PCR is generally not necessary in BD SMART RACE reactions Please note that all RACE PCR reactions have been optimized for use with t2. Tin 265 C best results are obtained if Ta gt 70 C enables the use of touchdown PCR The relationship of the primers used in the BD SMART RACE reactions to the template and resulting RACE products is shown in detail in Figure 3 For the complete BD SMART RACE protocol you will need atleast two GSPs an antisense primer for the 5 RACE PCR and a sense primer for the 3 RACE PCR If you are doing only 5 or a RACE you will only need one GSP All primers should be 23 28 nt long there is generally no advantage to using primers longer than 30 nt The primers shownin Figure 3 will create overlapping 5 and 3 RACE products If a suitable restriction site is located in the region of overlap the fragments can subsequently be joined by restriction digestion and ligation to create the full length cDNA By design ing primers that give a 100 200 bp overlap in the RACE products you will also be able to use the primers together as a positive control for the PCR reactions However it is not absolutely necessary to use primers that give overlapping fragments In the case of large and or rare cDNAs it may be better to use primers that are closer to the ends of the cDNA and therefore do not create overlapping fragments Additionally the primers themselves can overlap i e be complementary GSPs should have a GC content of 50 70 and a T of at least 65 C whenever possible the T should be greater than 70 C as determined by nearest neighbor a
3. 1 2 1 Poly A RNA samples from mammalian cells should produce smears from 0 5 12 kb with much weaker ribosomal RNA bands Size distribution may be smaller with nonmammalian tissue sources Protocol No PT3269 1 www bdbiosciences com BD Biosciences Clontech Version No PR38330 15 BD SMART RACE cDNA Amplification Kit User Manual VII First Strand cDNA Synthesis The two 10 ul reactions described below convert 50 ng 1 ug of total or poly A RNA into RACE Ready first strand cDNA We recommend that you use poly A RNA whenever possible However if you have less than 50 ug of total RNA we do not recommend purification of poly A RNA because the final yield will be too small to effectively analyze the RNA quantity and quality For optimal results use 1 ug of poly A RNA or 1 ug of total RNA in the reactions below We strongly recommend that you perform a positive control cDNA synthe sis using the included Human Placental Total RNA in addition to your experimental reactions This cDNA will be used in the positive control RACE reactions in Section VIII 1 Combine the following in separate 0 5 ml microcentrifuge tubes For preparation of For preparation of 5 RACE Ready cDNA 3 RACE Ready cDNA 1 3 ul RNAsample 1 3 ul RNA sample 1 ul 5 CDS primer 1 ul 3 CDS primer A 1 BD SMART IIA oligo For the control synthesis use 1 ul of Control Human Placental Total RNA 1 ug ul Add sterile H5O to a final volume of 5 ul
4. M amp Higuchi R 1994 Effective amplification of long targets from cloned inserts and human genomic DNA Proc Natl Acad Sci USA 91 5695 5699 Chou Q Russell M Birch D Raymond J amp Bloch W 1992 Prevention of pre PCR mispriming and primer dimerization improves low copy number amplifications Nucleic Acids Res 20 1717 1723 D aquila R T Bechtel L J Videler J A Eron J J Gorczyca P amp Kaplan J C 1991 Maximizing sensitivity and specificity by preamplification heating Nucleic Acids Res 19 3749 Don R H Cox P T Wainwright B J Baker K amp Mattick J S 1991 Touchdown PCR to circumvent spurious priming during gene amplification Nucleic Acids Res 19 4008 Farrell Jr R E 1993 RNA Methodologies A Lab Guide for Isolation and Characterization Academic Press San Diego CA Freier S M Kierzek R Jaeger J A Sugimoto N Caruthers M H Neilson T amp Tumer D H 1986 Improved free energy parameters for predictions of RNA duplex stability Proc Natl Acad Sci USA 83 9373 9377 Frohman M A Dush M K amp Martin G R 1988 Rapid production of full length cDNA from rare transcripts Amplification using a single gene specific oligonucleotide primer Proc Natl Acad Sci USA 85 8998 9002 Kellogg D E Rybalkin l Chen S Mukhamedova N Vlasik T Siebert P amp Chenchik A 1994 TaqStart Antibody Hot start PCR facilitated b
5. fails to give the distinct band s of interest or produces a smear you may wish to perform a Southern blot using a A cDNA probe b A nested primer as a probe Or you may wish to perform a secondary or nested PCR reaction using the NUP primer supplied and a NGSP See the discussion in Section V a Dilute 5 ul of the primary PCR product into 245 ul of Tricine EDTA buffer b Repeat Steps 1 5 above using 5 ul of the diluted primary PCR product in place of the RACE Ready cDNAs e 1 ul of the NUP primer and 1 ul of your nested GSPs e 15 20 cycles of Program 2 Protocol No PT3269 1 www bdbiosciences com BD Biosciences Clontech Version No PR38330 23 BD SMART RACE cDNA Amplification Kit User Manual X Characterization of RACE Products At this point we recommend that you characterize your RACE fragments and confirm that you have amplified the desired product This procedure can prevent confusion and wasted effort when you generate the full length cDNA even if you have single major products from both the 5 and 3 RACE reactions Character ization is especially important if you have multiple bands or if you suspect that you are working with a member of a multigene family We describe three methods for characterizing RACE products A Comparison of RACE products obtained with GSPs and NGSPs B Southern blotting and C Cloning and sequencing Options A and B require nested GSPs for analyzing 5 and 3 RACE pro
6. pattern by autoradiography If the first strand reaction was successful you should see a similar banding pattern to that produced by your RNA Mammalian poly A RNA typically produces a smear from 0 5 12 kb Mammalian total RNA usually exhibits two bright bands at 4 5 and 1 9 kb BD Biosciences Clontech www bdbiosciences com Protocol No PT3269 1 34 Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual XII References Barnes W M 1994 PCR amplification of up to 35 kb DNA with high fidelity and high yield from bacteriophage templates Proc Natl Acad Sci USA 91 2216 2220 Borson N D Sato W L amp Drewes L R 1992 Alock docking oligo dT primer for 5 and 3 RACE PCR PCR Methods Applic 2 144 148 Chenchik A Moqadam F amp Siebert P January 1995 Marathon cDNA amplification A new method for cloning full length cDNAs Clontechniques X 1 5 8 Chenchik A Moqadam F amp Siebert P 1996 A new method for full length cDNA cloning by PCR In A Laboratory Guide to RNA Isolation Analysis and Synthesis Ed Krieg P A Wiley Liss Inc pp 273 321 Chenchik A Zhu Y Diatchenko L Li R Hill J amp Siebert P 1998 Generation and use of high quality cDNA from small amounts of total RNA by SMART PCR In RT PCR Methods for Gene Cloning and Analysis Eds Siebert P amp Larrick J BioTechniques Books MA pp 305 319 Cheng S Fockler C Barnes W
7. use only afraction of this material for each RNA of interest There is sufficient single stranded cDNA for PCR amplification of multiple genes If you intend to use LD PCR to construct your full length cDNA after completing 5 and 3 RACE be sure to set aside an aliquot of the 5 RACE Ready cDNA to use as a template in the PCR reaction Protocol No PT3269 1 www bdbiosciences com BD Biosciences Clontech Version No PR38330 17 BD SMART RACE cDNA Amplification Kit User Manual VIII Positive Control PCR Experiment Prior to performing 5 and 3 RACE reactions with your cDNA we strongly recommend that you perform the following positive control RACE PCR experi ment using the RACE Ready cDNAs generated from the Control Human Placen tal Total RNA These reactions will amplify the ends of the transferrin receptor TFR cDNA This procedure can save you considerable time by ensuring thatthe BD SMART RACE protocol works with your thermal cycler If problems arise later in the protocol the results of this experiment will help you determine immediately if the problem is with your RACE PCR e g different thermal cycler or with your cDNA We recommend that you first perform BD SMART RACE PCR reactions using the BD Advantage 2 Polymerase Mix supplied If your cDNA of interest has high GC content you can use the BD Advantage GC 2 Polymerase Mix Cat No 639114 or PCR Kit Cat Nos 639119 amp 639120 for subsequent analysis For applicat
8. 0 25 BD SMART RACE cDNA Amplification Kit User Manual X Characterization of RACE Products continued Options for generating full length cDNA After RACE products have been characterized by partial or complete sequencing you can generate the full length cDNA by one of two methods 1 By long distance PCR LD PCR using primers designed from the extreme 5 and 3 ends of your cDNA and the 5 RACE Ready cDNA as template 2 By cloning overlapping 5 and 3 RACE fragments using a restriction site in the overlapping region if available In general the LD PCR method is more direct and less subject to complications or artifacts With cloning it is possible to join 5 and 3 cDNA fragments derived from two different transcripts this could occur with two different forms of a polymorphic RNA or with transcripts from a multigene family In contrast with end to end PCR the 5 and 3 end primers will amplify a single cDNA without the possibility of generating a hybrid Virtually all cDNAs are within the range of LD PCR BD Biosciences Clontech www bdbiosciences com Protocol No PT3269 1 26 Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual XI Troubleshooting Guide Optimizing your 5 and 3 RACE reactions is generally advisable and often necessary This process usually consists of improving the yield of your desired fragment s while decreasing the amount of background or nonspecific and or incomplete b
9. 1910 1 639206 K1910 y 639207 BD Advantage 2 Polymerase Mix 8430 1 639201 8430 2 639202 BD Sprint Advantage Single Shots K1953 1 639553 K1953 2 639554 K1953 y 639556 BD Sprint Advantage 96 Plate K1950 1 639550 BD Sprint Combo Kit K1951 1 639551 BD Advantage GC 2 PCR Kit K1913 1 639119 K1913 y 639120 BD Advantage GC 2 Polymerase Mix 8433 1 639114 BD Advantage HF 2 PCR Kit K1914 1 639123 K1914 y 639124 NucleoBond RNA DNA Mini Kit K3025 1 635945 NucleoTrap Gel Extraction Kit K3070 1 636018 NucleoTrap PCR Purification Kit K3071 1 636020 BD Biosciences Clontech www bdbiosciences com Protocol No PT3269 1 36 Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual Appendix A Detailed Flow Chart of 5 RACE s NBAAAAA By RNA ENVTTTT TO 5 CDS BD SMART first strand synthesis gp SMART A M ligo AIS 3 RNA DNA hybrid mese NEMO RT template switching Y 5 RACE Ready cDNA 5 mmm GGG SS NBAAAAA 5 C CC NVTTTTT D 5 Y 5 RACE PCR 5 mw G G G SUVS NBAAAAA 3 Long UP 7 CC INVTTTTT4 5 First round of PCR Incorporation of suppression PCR inverted repeat elements 3 by Long Universal Primer 5 INBAAAAAg 3 GSP1 INVTTTT TAS Second round of PCR Gene specific synthesis 5 NBAAAMAg 2 3 Short UP z i 1 15 Remaining rounds
10. BD SMART RACE cDNA Amplification Kit User Manual Cat No 634914 or K1811 1 PT3269 1 PR38330 Published 09 18 2003 BD SMART RACE cDNA Amplification Kit User Manual Table of Contents l ll Ill IV V VI VII VIII IX X XI XII XIII Introduction amp Protocol Overview List of Components Additional Materials Reguired General Considerations for BD SMART RACE Amplification Primer Design Preparation amp Handling of Total and Poly A RNA First Strand cDNA Synthesis Positive Control PCR Experiment Rapid Amplification of CDNA Ends RACE Characterization of RACE Products Troubleshooting Guide References Related Products Appendix A Detailed Flow Chart of 5 RACE Appendix B Detailed Flow Chart of 3 RACE Appendix C Suppression PCR and Step Out PCR 10 11 12 15 16 18 21 24 27 35 36 37 38 39 BD Biosciences Clontech www bdbiosciences com Protocol No PT3269 1 Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual Table of Contents continued List of Figures Figure 1 Mechanism of BD SMART cDNA synthesis 4 Figure 2 Overview of the BD SMART RACE procedure 6 Figure 3 The relationship of gene specific primers to the cDNA template 13 Figure 4 5 and 3 RACE sample results 20 Figure 5 Detailed mechanism of the 5 RACE reactions 37 Figure 6 Detailed mechanism of the 3 RACE reactions 38 Figure 7 Mechanisms of suppression PCR and step out PCR 40 List of Ta
11. DNA populations you can prime both RACE PCR reactions using the Universal Primer A Mix UPM which recognizes the BD SMART sequence in conjunction with distinct gene specific primers Positive Control RACE Experiment Section VIII Prior to performing RACE with your template we strongly recommend that you perform the positive control RACE experiment using the Control Human Placental Total RNA provided in the kit RACE PCR Reactions Section IX After you generate RACE Ready cDNAs you will have enough material to perform 5 and 3 RACE with many different genes simply by using different gene specific primers All PCR reactions in the BD SMART RACE protocol are optimized for use with the BD Advantage 2 Polymerase Mix The Polymerase Mix is comprised of BD TITANIUM Tag DNA Polymerase a Protocol No PT3269 1 www bdbiosciences com BD Biosciences Clontech Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual 1 Introduction amp Protocol Overview continued nuclease deficient N terminal deletion of Taq DNA polymerase plus BD TagStart M Antibody to provide automatic hot start PCR Kellogg et al 1994 and a minor amount of a proofreading polymerase BD Advantage 2 technology enables you to perform long distance PCR LD PCR reactions with confidence that your products will have high fidelity to the original sequences Barnes 1994 Cheng et al 1994 As a result you will be able to amplify longer te
12. PCR Amplification of 5 fragment 5 r O 3 3 3 r 3 1 5 Double stranded 5 RACE fragment Figure 5 Detailed mechanism of the 5 RACE reactions Protocol No PT3269 1 www bdbiosciences com BD Biosciences Clontech Version No PR38330 37 BD SMART RACE cDNA Amplification Kit User Manual Appendix B Detailed Flow Chart of 3 RACE poly RNA 5 3 NVTTTTT cm 9 3 CDS 3 RACE Ready cDNA SE cr T 5 3 GSP2 3 1 NVTTTT Ts m NBAAAAA 5 Long UP 3 1 NVTTTTT mmm 5 5 5 3 E NVTTTTT X X 5 5 gm mm 3 3 Short UP 3 1 T ANVTTTTT m 1 5 5 E I 3 5 T 1 3 1 5 Double stranded 3 RACE fragment Figure 6 Detailed mechanism of the 3 RACE reactions BD Biosciences Clontech www bdbiosciences com Standard first strand synthesis mem BD SMART II A sequence 3 RACE PCR First round of PCR Gene specific synthesis Next rounds of PCR Incorporation of suppression PCR inverted repeat elements by Long Universal Primer Remaining rounds of PCR Amplification of 3 fragment Protocol No PT3269 1 Version No PR38330 BD SMART RACE cDNA Amplificati
13. RACE reactions As a result you can use either poly A or total RNA as starting material for constructing full length cDNAs of even very rare transcripts BD SMART technology provides a mechanism for generating full length cDNAs in reverse transcription reactions Zhu et al 2001 This is made possible by the joint action of the BD SMART IITM A Oligonucleotide and the BD PowerScript Reverse Transcriptase RT BD PowerScript RT is a variant of MMLV RT that upon reaching the end of an RNA template exhibits terminal transferase activity adding 3 5 residues predominantly dC to the 3 end of the first strand cDNA Figure 1 The BD SMART oligo contains a terminal stretch of G residues that anneal to the dC rich cDNA tail and serves as an extended template for RT BD PowerScript RT switches templates from the mRNA molecule to the BD SMART oligo generating a complete cDNA copy ofthe original RNA with the additional BD SMART sequence at the end Since the dC tailing activity of RT is most efficient if the enzyme has reached the end of the RNA template the BD SMART sequence is typically added only to complete first strand cDNAs This process guarantees that the use of high quality RNA will result in the formation of a set of cDNAs that have a maximum amount of 5 sequence Table 1 Poly A RNA 5 WW WM VV polyA 3 66 q m Oligo dT primer First strand synthesis coupled with dC tailing by RT Y apa OS NN pats Figure 1 Mechanis
14. RT first strand cDNA synthesis Section VII 1 2 Days 5 RACE Ready cDNA 3 RACE Ready cDNA 5 RACE PCR 3 RACE PCR Section IX Section IX 5 RACE fragment 3 RACE fragment Clone and sequence RACE fragments Section X Cloned RACE fragments Conventional Cloning End PGR Full length cDNA Figure 2 Overview of the BD SMART RACE procedure Detailed flow charts of the BD SMART RACE mechanisms can be found in Appendices A amp B Note that with the cloned RACE fragments you can use a restriction site in an overlapping region to construct a full length cDNA by subcloning Alternatively you can sequence the 5 end of the 5 product and the 3 end of the 3 product to obtain the sequences of the extreme ends of the transcript Using this information you can design 5 and 3 gene specific primers to use in LD PCR with the 5 RACE Ready cDNA as template to generate the full length cDNA BD Biosciences Clontech www bdbiosciences com Protocol No PT3269 1 Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual 1 Introduction amp Protocol Overview continued Overview of the BD SMART RACE cDNA amplification protocol An overview of the BD SMART RACE cDNA amplification is presented in Figure 2 Detailed mechanisms of the RACE reactions are provided in Appendices A amp B Primer Design Section V You m
15. Result No amplification GS 5 into Figure 7 Mechanisms of suppression PCR and step out PCR On occasion a reverse transcription reaction can be nonspecifically primed by the BD SMART II A oligonucleotide This will result in the synthesis of a cDNA containing the BD SMART sequence at both ends Through the technique of step out PCR suppression PCR inverted repeat elements are incorporated next to allBD SMART sequences During PCR these inverted repeats anneal to each other intramolecu larly This rapid first order reaction out competes the second order binding of the Short Universal Primer to the cDNA As a result panhandle like structures which cannot be amplified are formed BD Biosciences Clontech www bdbiosciences com Protocol No PT3269 1 Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual Notes Protocol No PT3269 1 www bdbiosciences com BD Biosciences Clontech Version No PR38330 2 BD SMART RACE cDNA Amplification Kit User Manual Notes BD Biosciences Clontech www bdbiosciences com Protocol No PT3269 1 Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual Notes Protocol No PT3269 1 www bdbiosciences com BD Biosciences Clontech Version No PR38330
16. al cDNA sample no 5 or 3 RACE bands are produced but the TFR positive control RACE reactions Tube No 2 give the expected products Your gene may not be abundant in your RNA sample Perform 5 more PCR cycles at the 68 C annealing temperature Repeat these addi tional cycles until your RACE fragments appear but do not exceed 50 cycles for touchdown PCR or 40 cycles for non touchdown PCR If you still fail to produce the expected products you may have to find a new source of RNA in which your gene is more abundant The annealing temperature is too high for your primers Lower the annealing temperature by increments of 2 C Your primers are not suitable for PCR Check them against the criteria in Section V and design new ones if necessary The structure of the gene is difficult for PCR due to secondary conformations or high GC content Try redesigning your primers closer to the ends of the cDNA or try to avoid GC rich regions if they are known For additional tips in troubleshooting GC rich sequences see Section XI B of the Troubleshooting Guide BD Biosciences Clontech www bdbiosciences com Protocol No PT3269 1 30 Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual XI Troubleshooting Guide continued Your gene is too long for RT and or LD PCR Design your primers as close to the ends as possible Then repeat the 5 RACE Ready cDNA synthesis using either a GSP or random hexamers to prime
17. alter the cycling parameters or perform a secondary amplification using the Nested Universal Primer A Tube No 5 A negative control using each GSP by itself This control should produce no product If this control produces a smear or ladder of extra bands you may need to alter the cycling parameters perform a secondary amplification using nested primers or redesign your original primers B General PCR Problems Troubleshooting GC rich templates If the PCR product especially your 5 RACE product is not the expected size or is absent the cause may be a GC rich template BD Biosciences Clontech offers the Protocol No PT3269 1 www bdbiosciences com BD Biosciences Clontech Version No PR38330 21 BD SMART RACE cDNA Amplification Kit User Manual XI Troubleshooting Guide continued BD Advantage GC 2 Polymerase Mix Cat No 639114 and PCR Kit Cat Nos 639119 amp 639120 for efficient amplification of GC rich templates However when using this polymerase mix or kit the master mix recipes will need to be modified to include GC Melt and the 5X PCR Reaction Buffer instead of the 10X buffer supplied with most polymerases Additionally the PCR parameters may need to be optimized for these templates For more information please see the BD Advantage GC 2 PCR User Manual PT3316 1 We recommend that you perform the initial RACE reactions with the BD Advantage 2 Polymerase Mix then perform the RACE reactions using the BD Advanta
18. ands in your RACE reactions The cDNA synthesis protocols contained in this User Manual typically produce enough 5 and 3 RACE Ready cDNA for 100 or more RACE PCR reactions Thus there is plenty of material for optimizing your RACE amplifications A Control PCR Reactions Tables Ill and IV in the User Manual describe several control reactions that will help you troubleshoot the reactions if yields are suboptimal These include Tube No 2 5 or 3 RACE PCR using the positive control TFR Primer the UPM Primer Mix and the 5 and 3 RACE Ready cDNA made from your experimental RNA Figure 4 in Section VIII shows the expected results of 5 and 3 RACE using these positive controls Tube No 3 An additional positive control using both GSPs to amplify the overlapping segment of your 5 and 3 RACE fragments if available This reaction should give a single band corresponding to the overlap between the primers This result confirms that your target cDNA is present in and can be amplified from your RACE Ready cDNA If you do not have suitable 5 and 3 GSPs i e GSPs that create overlapping 5 and 3 RACE products use the control 5 and 3 RACE TFR Primers with 5 ul of your positive control RACE Ready cDNAs if human Tube No 4 A negative control using the UPM alone to amplify your cDNA With fewer than 40 cycles this reaction should produce no product If this control produces a smear or ladder of extra bands you may need to
19. aracterizing genes identified through diverse methods including cDNA subtraction differential display RNA finger printing ESTs library screening and more BD SMART RACE cDNA amplification is a flexible tool many researchers use this kit in place of conventional kits to amplify just the 5 or 3 end of a particular cDNA Others perform both 5 and 3 RACE and many then go on to clone full length cDNAs using one of the two methods described in the latter part of this protocol In many cases researchers obtain full length cDNAs without ever constructing or screening a cDNA library TABLE ADDITIONAL 5 RACE SEQUENCE OBTAINED WITH BD SMART TECHNOLOGY Additional Matches Includes Size of sequence genomic transcription Human gene mRNA kb bp Sequence start site Transferrin receptor 5 0 25 yes yes Smooth muscle g actin 1 28 31 yes yes Vascular smooth muscle a actin 1 33 17 yes yes Cytoskeletal y actin 1 9 1 yes yes 23 kDa HBP 0 67 9 n a yes p53 2 6 4 yes yes Interferon y receptor 2 06 14 yes yes 14 3 3 protein 1 03 1 n a n a Interferon a receptor 2 75 17 yes yes n a not available Compared to GenBank cDNA sequence Protocol No PT3269 1 www bdbiosciences com BD Biosciences Clontech Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual 1 Introduction amp Protocol Overview continued Poly A or Total RNA Standard first strand cDNA synthesis Section VII BD SMA
20. at they have a Tm greater than 70 C and use the cycling parameters for touchdown PCR 2 We recommend that you design new primers that will give RACE products that are slightly differentin size than those expected with the original primers These new primers can either be used by themselves or in combination with the original primers in nested PCR Innested PCR the product of a PCR reaction is reamplified using a second set of primers that is internal to the original primers This often greatly reduces the background and nonspe cific amplification seen with either set of primers alone The design of nested primers is discussed in Section V 3 Prior to performing nested RACE PCR we recommend that you perform two separate primary amplifications with the UPM and either the GSP1 or NGSP1 This test will help show if multiple bands are a result of correctly primed PCR or nonspecifically primed PCR If the multiple bands are real i e the result of correct priming they should be present in both reactions but slightly smaller in the reaction using the nested primers The difference in mobility of the products should correspond to the positions of the GSP and NGSP in the cDNA structure If none of the above suggestions works you may want to try repeating cDNA synthesis using a GSP or random hexamers instead of the CDS Primer provided with this kit J RACE cDNA product is smeared Note Some BD SMART RACE reactions produce very comple
21. ay simultaneously amplify several highly homologous cDNAs Distinguishing true polymorphic forms of an RNA is a matter for scientific investigation However you may be able to find an alternative source of RNA in which one form is more abundant than others Protocol No PT3269 1 www bdbiosciences com BD Biosciences Clontech Version No PR38330 31 BD SMART RACE cDNA Amplification Kit User Manual XI Troubleshooting Guide continued Sources of artifacts Multiple bands often do not correspond to actual complete transcripts These artifact RACE products can be divided into two classes incomplete and nonspecific There are several possible sources of incomplete fragments which are generated from correctly primed sites Premature termination of first strand cDNA synthesis caused by RT pausing generally causes multiple 5 RACE products This problem is common with larger RNAs and is difficult to overcome because it is due to an intrinsic limitation of RT Degradation of the RNA used as starting material generally causes multiple 5 RACE products Difficulty in amplifying certain genes can cause multiple products in either 5 or 3 RACE and is often a result of high GC content Nonspecific RACE products arise from nonspecific binding of the primer to multiple sites in the ds cDNA or primer dimer artifacts Suggestions f you have not already done so repeat your RACE reactions with all of the recommended control
22. bles Table Additional 5 RACE sequence obtained with BD SMART technology 5 Table Il Setting up the positive control RACE experiment 19 Table Ill Setting up 5 RACE PCR reactions 21 Table IV Setting up 3 RACE PCR reactions 22 Notice to Purchaser This product is intended to be used for research purposes only Itis not to be used for drug or diagnostic purposes nor is it intended for human use BD Biosciences Clontech products may not be resold modified for resale or used to manufacture commercial products without written approval of BD Biosciences Clontech BD SMART technology is covered by U S Patent Nos 5 962 271 amp 5 962 272 Suppression PCR is covered by U S Patent No 5 565 340 Foreign patents pending This product is optimized for use in the Polymerase Chain Reaction PCR covered by patents owned by Hoffmann La Roche and F Hoffmann La Roche Ltd Roche No license under these patents to use the PCR process is conveyed expressly or by implication to the purchaser by the purchase of this product A license to use the PCR Process for certain research and development activities accompanies the purchase of certain reagents from licensed suppliers such as BD Biosciences Clontech when used in conjunction with an authorized thermal cycler or is available from Perkin Elmer Corporation Further information on purchasing licenses to practice the PCR process may be obtained by contacting the Director of Licensing at the Perkin E
23. caused by the impeding of RT by strong secondary structure and or high GC content in your gene This is especially indicated if the 3 RACE does work the 5 RACE does not work and the positive control GSP1 GSP2 does not produce the expected fragment See Section XI B of the Troubleshooting Guide for help with GC rich templates Additionally you may wish to analyze the quality of your first strand cDNA using the procedure described below in Section XI K Your gene may be expressed weakly or not at all in your starting RNA You may have to find a new source of RNA The efficiency of both 5 and 3 RACE amplifications depends on the abundance of the target transcript There is a problem with your primers This could be due either to poor primer design or poor primer preparation First try lowering your annealing extension temperature If this does not work you may need to design new primers or repurify your GSPs You may be able to obtain more information by amplifying the internal fragment with GSP1 and GSP2 using genomic DNA as the template If the expected band is produced your primers are suitable and the problem is either a the target RNA is a poor template for RT or b the RNA is not Protocol No PT3269 1 www bdbiosciences com BD Biosciences Clontech Version No PR38330 29 BD SMART RACE cDNA Amplification Kit User Manual XI Troubleshooting Guide continued F expressed in the tissue source you have chosen Note
24. ces com Protocol No PT3269 1 28 Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual XI Troubleshooting Guide continued C No band is observed in positive control amplification of the over lapping region of RACE products either with GSP1 GSP2 or TFR1 TFR2 The control PCR reaction using your sense and antisense GSPs and your RACE Ready cDNA to amplify the internal fragment of your gene is very important If this reaction fails to produce the expected internal cDNA fragment there are at least two possible explanations There may be a problem with your polymerase mix If you are not using the BD Advantage 2 Polymerase Mix consider switching The BD SMART RACE protocol was optimized with the BD Advantage 2 Polymerase Mix Be sure to perform the positive control PCR experi ment in Section VIII Your cDNA synthesis reaction may have failed Repeat the first strand synthesis reaction You may wish to analyze the quality of your first strand cDNA using the procedure described below in Section XI K D No band is observed using TFR1 TFR2 with your experimental cDNA but the correct product is seen with cDNA made from the positive control placental RNA Your RNA may be partially degraded or may contain impurities Check the quality of your RNA against the criteria described in Section VI E No band is observed using GSP1 GSP2 but the correct product is seen using TFR1 TFR2 This problem can be
25. commend PerkinElmer GeneAmp 0 5 ml reaction tubes Cat No N801 0737 or N801 0180 Mineral oil e g Sigma Cat No M 3516 BD Biosciences Clontech www bdbiosciences com Protocol No PT3269 1 10 Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual IV General Considerations for BD SMART RACE PLEASE READ ENTIRE PROTOCOL BEFORE STARTING The cycling parameters throughout this protocol were optimized with an authorized hot lid thermal cycler the BD Advantage 2 Polymerase Mix and the reagents and TFR controls provided in the BD SMART RACE Kit The optimal cycling parameters may vary with different polymerase mixes templates gene specific primers and thermal cyclers Prior to performing 5 and 3 RACE with your experimental sample you should perform the positive control PCR experiment Section VIII These reactions which use cDNA generated from the Control Human Placental Total RNA and the Control 5 and 3 RACE TFR Primers will help determine if you need to alter the PCR program for your thermal cycler Please note that the efficiency of RACE PCR depends on the abundance of the mRNA of interest in your RNA sample Additionally different primers will have different optimal annealing extension temperatures Refer to Section XI for suggestions on optimizing PCR conditions You must use some form of hot start in the 5 RACE and 3 RACE PCR reactions The following protocols were optimized using the BD A
26. ducts For more detailed blotting and cloning protocols see Sambrook et al 1989 or other appropriate laboratory manuals A Comparison of RACE Products Obtained with GSPs amp NGSPs For the 5 RACE reaction compare the products of primary amplifications performed with the UPM Mix and GSP1 to the products obtained using the UPM and NGSP1 For 3 RACE compare the products obtained from amplifications with the and GSP2 to those obtained with the and NGSP2 This analysis will help determine if any multiple bands are a result of correctly primed PCR or nonspecifically primed PCR If bands are real i e the result of correct priming they should be slightly smaller in the reaction using the nested gene specific primers The difference in mobility of the products should correspond to the positions of the outer and inner nested gene specific primers in the cDNA structure If you have multiple bands with UPM and GSP1 or GSP2 some may disappear upon ampli fication with UPM and NGSP1 or NGSP2 Note Do not use the Nested Universal Primer A NUP in these reactions because it will cause a size decrease in all of the PCR products B Southern Blot Analysis You can obtain stronger confirmation of your RACE products by probing a Southern blot with an internal gene specific probe usually one of your other GSPs or NGSPs This method can be particularly useful for determining which bands are real when RACE produces multiple ba
27. dvantage 2 Polymerase Mix which contains BD TaqStart Antibody for automatic hot start PCR Kellogg et al 1994 Hot start can also be performed using wax beads Chou et al 1992 or manually D Aquila et a 1991 We recommend the Tricine EDTA Buffer provided in the kit for resuspend ing and diluting your DNA samples throughout this protocol Tricine buffers maintain their pH at high temperature better than Tris based buffers Tris based buffers can lead to low pH conditions that degrade DNA Wear gloves throughout to protect your RNA samples from nucleases Resuspend pellets and mix reactions by gently pipetting the solution up and down or by tapping the bottom ofthe tube Then spin the tube briefly to bring all contents to the bottom Perform all reactions on ice unless otherwise indicated Add enzymes to reaction mixtures last Use the recommended amounts of enzyme These amounts have been carefully optimized for the BD SMART RACE amplification protocol and reagents Ethidium bromide is a carcinogen Use appropriate precautions in handling and disposing of this reagent For more information see Molecular Cloning A Laboratory Manual by Sambrook et al 1989 Protocol No PT3269 1 www bdbiosciences com BD Biosciences Clontech Version No PR38330 11 BD SMART RACE cDNA Amplification Kit User Manual V Primer Design A Primer Sequence Gene Specific Primers GSPs should be 23 28 nt 50 70 GC
28. e transcription however you cannot exclude the possibility that some of these shorter bands are real and correspond to alternatively spliced transcripts transcripts derived from multiple promoters or other members of a multigene family 6 Once you have pinpointed the band s of interest isolate the DNA from the gel using the NucleoTrap Gel Extraction Kit provided and proceed with your experiments C Cloning amp Sequencing RACE Products Note The Universal Primer contains a T7 priming site Using a cloning vector that contains a T7 site will generate multiple sequencing products if using a T7 primer 1 Gel purify the RACE product s of interest using the NucleoTrap Gel Extraction Kit Then clone the isolated fragment s directly into a T A type PCR cloning vector 2 After you have TA cloned your RACE products identify clones contain ing gene specific inserts by colony hybridization using a P end labeled NGSP as a probe or by sequencing from your GSP For 5 RACE products we recommend picking at least 8 10 different independent clones in order to obtain the maximum amount of se quence at the 5 end Once you have identified the clones containing the largest gene specific inserts obtain as much sequence data as you can Ideally you will be able to sequence the entire open reading frame as well as the 5 and 3 untranslated regions Protocol No PT3269 1 www bdbiosciences com BD Biosciences Clontech Version No PR3833
29. for each reaction Mix contents and spin the tubes briefly in a microcentrifuge Incubate the tubes at 70 C for 2 min Cool the tubes on ice for 2 min Spin the tubes briefly to collect the contents at the bottom Add the following to each reaction tube already containing 5 ul 2 ul 5X First Strand Buffer 1 ul DTT 20 mM 1 ul dNTP Mix 10 mM 1 ul BD PowerScript Reverse Transcriptase 10 ul Total volume 8 Mix the contents of the tubes by gently pipetting Spin the tubes briefly to collect the contents at the bottom 10 Incubate the tubes at 42 C for 1 5 hr in an air incubator or a hot lid thermal cycler Note Using a water bath or thermal cycler for this incubation may reduce the volume of the reaction mixture due to evaporation and therefore reduce the efficiency of first strand synthesis OO fF W c BD Biosciences Clontech www bdbiosciences com Protocol No PT3269 1 16 Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual VII First Strand cDNA Synthesis continued 11 Dilute the first strand reaction product with Tricine EDTA Buffer Add 20 ul if you started with 200 ng of total RNA Add 100 ul if you started with 2200 ng of total RNA Add 250 ul if you started with poly At RNA 12 Heat tubes at 72 C for 7 min 13 Samples can be stored at 20 C for up to three months At this point you have 3 and 5 RACE Ready cDNA samples The RACE reactions in Section IX
30. g overhang The overhang sequence is incorporated into template DNA ends in the early rounds of PCR After overhang addition the second primer which is only complementary to the overhang sequence takes over and serves as an efficient primer for PCR amplification This short primer is essential because the bulky incorporation primer is inadequate for effective amplification The shortprimer is included at a higher concentration than the long primer so that it out competes the long primer in annealing to template DNA during PCR In this same manner the Universal Primer A Mix adds suppression PCR inverted repeat elements to ends of cDNAs in BD SMART RACE One of the primers in the mix the Long Universal Primer UP is complementary to the BD SMART sequence at its 3 end and also has a 5 heel of 20 bp which contains the suppression sequence Figure 7 During the early rounds of RACE PCR this primer incorporates the suppression sequence on the 5 side of all BD SMART sequences present in the cDNA population As a result all cDNAs that were correctly primed by oligo dT and only have one BD SMART sequence at the 3 end ofthe first strand cDNA will contain one suppression sequence at that end Conversely all cDNAs that were primed by the BD SMART II A oligo and which were consequently flanked by the BD SMART sequence become flanked again by the inverted repeat and are subject to suppression PCR Therefore cDNAs that have the BD SMART sequence on
31. ge GC 2 Polymerase Mix to confirm that the product is the same size in both reactions e High fidelity PCR If you are going to use your cloned RACE products for further analysis we recommend that you generate your full length cDNA using the BD Advantage HF 2 PCR Kit Cat No 639123 This kit is designed to yield products of less than 3 5 kb with fidelity comparable to the leading high fidelity polymerase This kit may not be ideal for cDNA templates that are greater than 3 5 kb but itis especially well suited for applications in which the RACE product will be cloned for use in additional experiments Again the initial RACE reactions should be performed using the BD Advantage 2 Polymerase Mix to confirm that the product is present and that the GSPs work well Troubleshooting touchdown PCR When troubleshooting touch down PCR we recommend that you begin by modifying the final set of cycle parameters i e the 20 25 cycles performed with annealing at 68 C If you do not observe an amplified product after the minimum number of cycles at 68 C return your tube s to the PCR machine and run five additional cycles If the product still does not appear add an additional 3 5 cycles at 68 C If you are still unsuccessful run a new PCR experiment changing the annealing temperature in the third set of cycles from 68 C to 65 C This last program is especially useful if your GSP has a T close to 70 C BD Biosciences Clontech www bdbioscien
32. he BD Advantage 2 Polymerase Mix 1 Prepare enough PCR Master Mix for all PCR reactions and one extra reaction to ensure sufficient volume The same Master Mix can be used for both 5 and 3 RACE reactions For each 50 ul PCR reaction mix the following reagents 34 5 ul PCR Grade Water 5 ul 10X BD Advantage 2 PCR Buffer 1 ul dNTP Mix 10 mM 1 ul 50X BD Advantage 2 Polymerase Mix 41 5 ul Total volume 2 Mix well by vortexing without introducing bubbles then briefly spin the tube in a microcentrifuge 3 For 5 RACE prepare PCR reactions as shown in Table III For 3 RACE prepare PCR reactions as shown in Table IV Add the components to 0 5 ml PCR tubes in the order shown and mix gently TABLE Ill SETTING UP 5 RACE PCR REACTIONS 1 2 3 4 5 5 RACE 5 TFR GSP 1 21 UPM only GSP1 only Component Sample Control Control Control Control 5 RACE Ready cDNA 2 5 ul 2 5 ul 2 5 ul 2 5 ul 2 5 ul experimental UPM 10X 5 ul 5 ul 5 ul GSP1 10 uM 1 ul 1 ul 1 ul GSP2 10 uM 1 ul Control 5 RACE TFR 1 ul Primer 10 uM H O 4 ul 1 ul 5 ul Master Mix 41 5 ul 41 5 ul 41 5 ul 41 5 ul 41 5 ul Final volume 50 ul 50 ul 50 ul 50 ul 50 ul Skip this reaction if your RNA is nonhuman t Skip this reaction if your GSPs will not create overlapping RACE fragments For detailed descriptions of the control reactions see Section XI Protocol No PT3269 1 www bdbio
33. however that this test is not conclusive since your primers may be separated by an intron in the genomic DNA If this is the case amplification of genomic DNA will give a larger fragment than expected or no fragment at all The 3 RACE works but the 5 RACE does not in both experimental and TFR amplification This is often the result of a failure in full length cDNA synthesis and or the template switching reaction Try repeating the first strand synthesis reaction You may wish to analyze the quality of your first strand cDNA using the procedure described below in Section XI K Your RT may be degraded This can happen if BD PowerScript RT is not kept on ice at all times or if itis not returned to the freezer promptly after use No bands are observed in any RACE reactions using either gene specific or positive control primers with either experimental or control RNA samples If you still do not observe RACE products after 25 30 cycles of PCR especially in both 5 and 3 RACE reactions return the tubes to your PCR machine and perform 5 additional cycles You may have to optimize the PCR program for your thermal cycler If these steps do not resolve the problem it may be that the cDNA synthesis and or template switching reaction has failed In this case try repeating the cDNA synthesis reactions You may wish to analyze the quality of your first strand cDNA using the procedure described below in Section XI K Using your experiment
34. ions in which the highest fidelity productis desired the BD Advantage HF 2 PCR Kit Cat Nos 639123 amp 639124 can amplify templates up to 3 5 kb For more information see Section XI Troubleshooting Guide 1 Prepare enough Master Mix for all PCR reactions and 1 extra reaction to ensure sufficient volume For each 50 ul PCR reaction mix the following reagents 34 5 ul PCR Grade Water 5 ul 10X BD Advantage 2 PCR Buffer 1 ul dNTP Mix 10 mM in BD SMART RACE or BD Advantage 2 PCR Kit 1 ul 50X BD Advantage 2 Polymerase Mix 41 5 ul Total volume 2 Mixwell by vortexing without introducing bubbles then briefly spinthe tube in a microcentrifuge 3 Prepare PCR reactions as shown in Table Il Add the components to 0 5 ml PCR tubes in the order shown and mix gently BD Biosciences Clontech www bdbiosciences com Protocol No PT3269 1 18 Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual VIII Positive Control PCR Experiment continued TABLE Il SETTING UP THE POSITIVE CONTROL RACE EXPERIMENT Tube No 1 2 3 4 Description 5 RACE 3 RACE Internal Internal Control Control Control Control Component 5 cDNA 3 cDNA Control 5 RACE Ready cDNA 2 5 ul 2 5 ul Control 3 RACE Ready cDNA 2 5 ul 2 5 ul 5 RACE TFR Primer 10 uM 1 ul 1 ul 1 ul 3 RACE TFR Primer 10 uM 1 ul 1 ul 1 ul UPM 10X 5 ul 5 ul H O 4 ul 4 ul Master Mix 41 5 ul 41 5 ul 41 5 ul 41 5 ul Final v
35. length cDNAs compare favorably in this regard with cDNAs obtained by conventional RACE or from libraries To obtain the maximum possible amount of 5 sequence we recommend that you sequence the 5 end of 5 10 separate clones of the 5 RACE product BD Biosciences Clontech www bdbiosciences com Protocol No PT3269 1 8 Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual ll List of Components Store Control Human PlacentalTotal RNA and BD SMART II A Oligonucleotide at 70 C Store NucleoTrap Gel Extraction Kit at room temperature Store all other reagents at 20 C Purchase ofthe BD SMART RACE cDNA Amplification Kitincludes a free sample of BD PowerScript Reverse Transcriptase and a free trial size BD Advantage 2 PCR Kit Cat No 639207 Together these products provide sufficient reagents for 7 cDNA synthesis reactions and 30 PCR reactions First strand cDNA Synthesis 7 ul BD SMART Oligonucleotide 12 uM 5 AAGCAGTGGTATCAACGCAGAGTACGCGGG 3 7 ul S RACE CDS Primer A 3 CDS 12 uM 5 AAGCAGTGGTATCAACGCAGAGTAC T 49 V N 3 N A C G or T V A G or C 7 ul 5 CDS Primer 5 CDS 12 uM 5 T o5V N 3 N A C G or T V A G or C 7 ul BD PowerScript Reverse Transcriptase e 200 ul 5X First Strand Buffer 250 mM Tris HCI pH 8 3 375 mM KCI 30 mM MgCl e 200 ul Dithiothreitol DTT 20 mM 1ml Deionized H O 5 amp 3 RACE PCR e 400 ul 10X Universal P
36. lmer Corporation 850 Lincoln Centre Drive Foster City CA 94404 or at Roche Molecular Systems Inc 1145 Atlantic Avenue Alameda CA 94501 NucleoBond and NucleoTrap are registered trademarks of Macherey Nagel GmbH amp Co K G GeneAmp6 is a registered trademark of Roche Molecular Systems Inc licensed to The Perkin Elmer Corporation BD BD Logo and all other trademarks are the property of Becton Dickinson and Company 2003 BD Protocol No PT3269 1 www bdbiosciences com BD Biosciences Clontech Version No PR38330 3 BD SMART RACE cDNA Amplification Kit User Manual 1 Introduction amp Protocol Overview The BD SMART RACE cDNA Amplification Kit provides a novel method for performing both 5 and 3 rapid amplification of ends RACE This kit integrates our BD Marathon cDNA Amplification Kit Chenchik et al 1995 1996 with our BD SMART Switching Mechanism At 5 end of RNA Transcript cDNA synthesis technology This powerful combination allows you to isolate the complete 5 sequence of your target transcript more consistently than ever before Furthermore BD SMART technology eliminates the need for problematic adaptor ligation and lets you use first strand cDNA directly in RACE PCR a benefit that makes RACE far less complex and much faster Chenchik et a 1998 The BD SMART RACE Kit also includes recent advances in PCR technology that both increase the sensitivity and reduce the background of the
37. m of BD SMART cDNA 2 ecc synthesis First strand synthesis is primed using a Templ itchi modified oligo dT primer After reverse transcriptase reaches the end of the mRNA template it adds Y several dC residues The BD SMART II A Oligo 5m GGG VAN polyA nucleotide anneals to the tail of the cDNA and serves CC as an extended template for BD PowerScript RT BD Biosciences Clontech www bdbiosciences com Protocol No PT3269 1 Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual 1 Introduction amp Protocol Overview continued Following reverse transcription the first strand cDNA is used directly in 5 and 3 RACE PCR reactions without the need for tedious second strand synthesis and adaptor ligation The incorporation of BD SMART technology also permits the use of universal priming in the RACE PCR amplification This method along with the techniques of suppression PCR and step out PCR ensure high specificity in amplifying your target CDNA These methods are described in detail below and in Appendix C The only requirement for BD SMART RACE cDNA amplification is that you know at least 23 28 nucleotides nt of sequence information in order to design gene specific primers GSPs for the 5 and 3 RACE reactions Additional sequence information will facilitate analysis of your RACE products This limited require ment makes BD SMART RACE ideal for ch
38. mplates than were possible in traditional RACE proce dures Characterization of RACE Products Section X Before constructing your full length cDNA we strongly recommend that you confirm amplification of the desired target You can characterize your RACE products by one or more of the following 1 comparing PCR products obtained using GSP1 and UPM to products generated with NGSP1 and UPM 2 probing a Southern blot of your PCR products with an internal gene specific probe e g labeled NGSP1 and 3 cloning and sequencing your RACE products In general we recommend that you obtain at least some sequence information Careful characterization of your RACE products at this point can prevent confusion and wasted effort in your subsequent experiments even when both RACE reactions produce single major products This analysis is especially important if you have multiple RACE products or suspect that you are working with a member of a multigene family Note on full length cDNAs No method of cDNA synthesis can guarantee a full length cDNA particularly at the 5 end Determining the true 5 end requires some combination of RNase protection assays primer extension assays and cDNA or genomic sequence information Many BD SMART RACE cDNAs include the complete 5 end of the cDNA however severe secondary structure may block the action of RT and or Taq DNA polymerase in some instances In our experience BD SMART RACE products and full
39. nalysis Freier et al 1986 we use the Primer Premier software to calculate T 5 In our experience longer primers with anneal ing temperatures above 70 C give more robust amplification in RACE particularly from difficult samples T s over 70 C allow you to use touch down PCR Section C below Additionally designing GSP1 and GSP2 so that they have similar T s will facilitate their use in the BD SMART RACE protocol Ts of GSP1 and GSP2 can be calculated or determined experimentally by performing PCR at different temperatures Avoid using self complementary primer sequences which can fold back and form intramolecular hydrogen bonds Similarly avoid primers that have complementarity to the primers in the Universal Primer Mix particularly in their 3 ends See Section Il for UPM primer sequences Note Do not incorporate restriction sites into the 5 ends of the 5 and 3 GSPs In our experience these extra sequences can lead to increased background BD Biosciences Clontech www bdbiosciences com Protocol No PT3269 1 12 Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual V Primer Design continued Region of overlap 1 Region to be amplified i by 5 RACE Region to be amplified by 3 RACE E gt NGSP2 EE NN 3 gt NNTITTT s NGSP1 GSP1 Generalized first strand cDNA Figure 3 The relationship of gene specific primers to the cDNA template This diagram
40. nds Multiple bands are more common with 5 RACE than with 3 RACE 1 Examine your RACE products on an agarose EtBr gel 2 Photograph the gel then transfer the DNA to a nylon membrane using standard blotting procedures 3 Prepare a hybridization probe that does not have sequences in com mon with GSP1 or GSP2 The probe can be end labeled NGSP1 or NGSP2 Alternatively if your GSPs define overlapping 5 and 3 fragments GSP2 can be used as a probe to characterize your 5 RACE BD Biosciences Clontech www bdbiosciences com Protocol No PT3269 1 24 Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual X Characterization of RACE Products continued products and GSP1 can be used as a probe to characterize your 3 RACE products Nick translated or random primed internal restric tion fragments from a previously cloned partial cDNA can also be used 4 Hybridize the probe to the Southern blot wash under moderate to high stringency conditions and expose x ray film 5 Compare the hybridization pattern to the photograph of the agarose EtBr gel Generally you will want to isolate the RACE product s that correspond s to the largest band s on the Southern blot There may be larger RACE products that appear on the agarose gel but that do not hybridize to the gene specific probe These bands are generally due to nonspecific priming Smaller bands that hybridize to your probe may be the result of incomplete revers
41. o limited se quence information the 3 end of the inner primer should have as much unique sequence as possible BD Biosciences Clontech www bdbiosciences com Protocol No PT3269 1 14 Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual VI Preparation amp Handling of Total and Poly A RNA A General Precautions The integrity and purity of your total or poly A RNA starting material is an important element in high quality cDNA synthesis The following precau tions will help you avoid contamination and degradation of your RNA Wear gloves e Use freshly deionized e g MilliO grade H O directly without treat ment with DEPC diethyl pyrocarbonate Rinse all glassware with 0 5 N NaOH followed by deionized H O Then bake the glassware at 160 180 C for 4 9 hr Use only single use plastic pipettes and pipette tips B RNA Isolation BD Biosciences Clontech offers several kits for the purification of total RNA such as the NucleoBond RNA DNA Mini Kit Cat No 635945 Many procedures are available for the isolation of poly RNA Farrell 1993 Sambrook et al 1989 C RNA Analysis We recommend that you examine your RNA by electrophoresing asample on a denaturing formaldehyde agarose EtBr gel Mammalian total RNA typically exhibits two bright bands at 4 5 and 1 9 kb these bands corre spond to 28S and 185 ribosomal RNA respectively The ratio of intensities of these bands should be about
42. olume 50 ul 50 ul 50 ul 50 ul Expected product size 2 6 kb 2 9 kb 0 3 kb 0 3 kb 4 Overlay the contents of each tube with 2 drops of mineral oil and place caps firmly on each tube Note Mineral oil is not necessary if you are using a hot lid thermal cycler 5 Commence thermal cycling using the following program for touchdown PCR 5 cycles 94 C 30 sec 72 C 3 min 5 cycles 94 C 30 sec 70 C 30 sec 72 C 3 min 27 cycles 94 C 30 sec 68 30 sec 72 C 3 min 6 Analyze 5 ul of each sample on a 1 2 agarose EtBr gel Store the remaining 45 ul of each reaction at 20 C until you are sure the control experiment has worked Protocol No PT3269 1 www bdbiosciences com BD Biosciences Clontech Version No PR38330 19 BD SMART RACE cDNA Amplification Kit User Manual VIII Positive Control PCR Experiment continued Expected results see lanes 2 and 5 of the gels in Figure 4 The 5 RACE control reaction should produce a 2 6 kb band The 3 RACE control reaction should produce a 2 9 kb band If you do not observe these bands return the tube s to your PCR machine and try cycling the remaining portion of the reaction for 5 additional cycles If you still do not see the desired product consult Section XI for troubleshooting Before you attempt 5 and 3 RACE with your primers and experimental cDNA we recommend that the positive control reactions produce single strong bands of the correct size in 42 or fewer total cycles
43. on Kit User Manual Appendix C Suppression PCR and Step Out PCR In our initial BD SMART based 5 RACE experiments we tended to observe a heavy background amplification We determined that undesired bands were produced by nonspecific priming of reverse transcriptase by the BD SMART IIA oligo during synthesis of the 5 RACE Ready cDNA When reverse transcription and template switching are completed these cDNAs contain the BD SMART sequence at both ends Figure 7 As a result RACE PCR using primers based on the BD SMART sequence amplifies these cDNAs in addition to the desired gene specific fragment This problem was overcome with the use of suppression PCR and step out PCR In suppression PCR Siebert et al 1995 an inverted repeat is incorporated in the ends of DNA sequences to prevent amplification during PCR The suppres sion effect occurs when these inverted repeats anneal intramolecularly to form panhandle structures which cannot be amplified by PCR see the bottom of the flow chart in Figure 7 The BD SMART RACE Kit uses the technique of step out PCR to add these inverted repeats and thus suppress the amplification of cDNA species that were synthesized by BD SMART II A oligo priming during reverse transcription Step out PCR uses a mixture of two primers to incorporate additional sequence at the end s of template DNA Matz et a 1999 One of these primers is exceptionally long and contains the additional sequence as a non annealin
44. only one end and the gene specific sequence will be amplified exclusively As described above the Short UP which is present at five times the concentration of the Long UP only contains the 5 heel sequence of the Long UP and simply serves as an efficient PCR primer after incorporation of the inverted repeat Protocol No PT3269 1 www bdbiosciences com BD Biosciences Clontech Version No PR38330 39 BD SMART RACE cDNA Amplification Kit User Manual Appendix C Suppression PCR and Step Out PCR continued NNAAAAA 3 poly At RNA 5 WAR SMART Siga Occassional priming of RT by the BD SMART II A oligonucleotide SMART WA oligo AI 3 RNA DNA hybrid M NNAAAAA 3 Creates first strand cDNA with BD SMART sequence RT template switchin at both ends BD SMART flanked avn 3 first strand cDNA ees 5 RACE PCR 5 G G G VV NNAAAAA 3 Long UP F CC First round of PCR Incorporation of suppression PCR inverted repeat elements by Long Universal Primer 5 r GG Q m C Remaining rounds of PCR Inverted repeat is incorporated into both ends of all BD SMART flanked cDNAs Inverted repeat flanked t double stranded cDNA 3 va ae Suppression PCR effect _ Intramolecular hybridization of inverted repeat sequences prevents Panhandle DNA structure binding of Short Universal Primer
45. reverse transcription instead of the 5 CDS Primer provided l RACE product consists of multiple bands In some cases your initial experiments will produce multiple 5 and or 3 RACE products As mentioned above you will have to determine which products are real and which are artifacts While the following guidelines will help you eliminate artifacts confirmation of real and complete bands requires additional studies such as mapping of transcription start sites intron exon structure and polyadenylation sites and genomic sequencing Multiple fragments do not mean you cannot proceed with generating the full length cDNA However you may save time in the long run if you try to eliminate nonspecific fragments by troubleshooting the reactions If mul tiple fragments persist and you want to proceed you should generally start with the largest fragment from each RACE reaction because it is most likely to be a true complete RACE product Sources of real multiple RACE products Individual genes can give rise to multiple sizes of transcripts and hence to multiple RACE fragments via at least three mechanisms Alternative splicing can cause multiple products in 5 or 3 RACE Use of different transcription initiation sites causes multiple 5 RACE products Use of different polyadenylation sites causes multiple 3 RACE prod ucts Alternatively the gene may be a member of a multigene family in which case your gene specific primers m
46. rimer A Mix Long 0 4 uM 5 CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT 3 Short 2 uM 5 CTAATACGACTCACTATAGGGC 3 e 50 ul Nested Universal Primer A NUP 10 uM 5 AAGCAGTGGTATCAACGCAGAGT 3 Control Reagents 5 ul Control Human Placental Total RNA 1 ug ul 25 ul Control 5 RACE Primer 10 uM 25 ul Control 3 RACE Primer 10 uM Protocol No PT3269 1 www bdbiosciences com BD Biosciences Clontech Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual ll List of Components continued General Reagents e 70 ul dNTP Mix dATP dCTP dGTP and dTTP each at 10 mM 2X1 ml Tricine EDTA Buffer 10 mM Tricine KOH pH 8 5 1 0 mM EDTA NucleoTrap Gel Extraction Kit Cat No 636053 or K3070 y e 100 ul NucleoTrap Suspension 3ml Buffer 10ml NT2 Buffer 2ml Buffer User Manual PT3169 1 Free trial size BD Advantage 2 PCR Kit Cat No 639207 or K1910 y The BD Advantage 2 kit provides sufficient reagents for 30 PCR reactions The following components are included e 30 ul 50X BD Advantage 2 Polymerase Mix e 200 ul 10X BD Advantage 2 PCR Buffer e 50 ul 50X dNTP Mix 10 mM each e 30 ul Control DNA Template 100 ng ul 30 ul Control Primer Mix 10 uM each e 1 ml PCR Grade Water User Manual PT3281 1 lll Additional Materials Required The following reagents are required but not supplied 0 5 ml PCR reaction tubes We re
47. s In particular be sure that your GSPs do not give bands when used alone and that they give a single band when used together If either GSP alone gives persistent bands we recom mend altering the cycling parameters or designing nested primers as discussed below Also repeat the Positive Control RACE PCR Experi ment Repeat your reactions using 5 ul of a 5 10 fold lower dilution of the RACE Ready cDNA f you have not already done so examine the size distribution of your RNA starting material as discussed in Section VI If your RNA looks smaller than expected repurify your RNA and repeat cDNA synthesis f multiple bands persist try altering the PCR cycling parameters 1 Increase the stringency of your PCR by raising the annealing temperature in increments of 2 5 C In many cases bands arising from nonspecific priming will disappear while real or incomplete products will persist 2 Reduce the cycle number Again bands arising from nonspecific priming may disappear while real or incomplete products will persist 3 Reduce the extension time 4 Inthe case of large RACE products increasing the extension time may help eliminate extra bands BD Biosciences Clontech www bdbiosciences com Protocol No PT3269 1 32 Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual XI Troubleshooting Guide continued f multiple bands persist try designing a new set of primers 1 Redesign your primers so th
48. s noted above we recommend using primers with T m s gt 70 C to allow you to use the touchdown cycling programs in the protocol Non touchdown cycling programs are also included for use with primers with Tm s 70 C Nested Primers We recommend that you do notuse nested PCR in yourinitial experiments The UPM Primer and a GSP will usually generate a good RACE product with a low level of nonspecific background However Southern blotting with nested GSPs NGSP1 and NGSP2 as probes is useful for characterizing your RACE products Furthermore nested PCR may be necessary in some Protocol No PT3269 1 www bdbiosciences com BD Biosciences Clontech Version No PR38330 13 BD SMART RACE cDNA Amplification Kit User Manual V Primer Design continued cases where the level of background or nonspecific amplification in the 5 or 3 RACE reaction is too high with a single GSP In nested PCR a primary amplification is performed with the outer primers and if a smear is produced an aliquot of the primary PCR product is reamplified using the inner primers The BD SMART RACE protocols include optional steps indicating where nested primers can be used The Nested Universal Primer A provided with the kit can be used for both 5 and 3 RACE Nested gene specific primers should be designed according to the guide lines discussed above If possible nested primers should not overlap with the outer gene specific primers if they must overlap due t
49. sciences com BD Biosciences Clontech Version No PR38330 21 BD SMART RACE cDNA Amplification Kit User Manual IX Rapid Amplification of cDNA Ends RACE continued TABLE IV SETTING UP 3 RACE PCR REACTIONS 1 2 3 4 5 3 RACE 3 TFR GSP1 2t UPMonly GSP2 only Component Sample Control Control Control Control 3 RACE Ready cDNA 2 5 ul 2 5 ul 2 5 ul 2 5 ul 2 5 ul experimental UPM 10X 5 ul 5 ul 5 ul GSP1 10 uM 1 ul GSP2 10 uM 1u 1 ul 1 ul Control 3 RACE TFR 1 ul Primer 10 uM H O 4 ul 1 ul 5 ul Master Mix 41 5 ul 41 5 ul 41 5 ul 41 5 ul 41 5 ul Final volume 50 ul 50 ul 50 ul 50 ul 50 ul Skip this reaction if your RNA is nonhuman t Skip this reaction if your GSPs will not create overlapping RACE fragments For detailed descriptions of the control reactions see Section XI 4 Overlay the contents of each tube with 2 drops of mineral oil and place caps firmly on each tube Note Mineral oil is not necessary if you are using a hot lid thermal cycler 5 Commence thermal cycling using one of the following programs both programs 1 and 2 work with the positive control 5 and 3 RACE TFR and UPM Primers Be sure to choose the correct number of cycles as noted based on whether you started with poly At or total RNA Notes on cycling Because the necessary number of cycles depends on the abundance of the transcript you may need to determine
50. shows a generalized first strand cDNA template This RNA DNA hybrid does not precisely represent either the 5 RACE Ready or 3 RACE Ready cDNAs For a detailed look at those structures see Appendices A amp B Note that the gene specific primers designed here produce overlapping RACE products This overlap permits the use of the primers together in a control PCR reaction Additionally if a suitable restriction site is located within this region it will be possible to construct the full length cDNA by subcloning Location of Primer Sequences within Gene We have had good success using the BD SMART RACE Kit to amplify 5 and 3 cDNA fragments that extend up to 6 5 kb from the GSP sites Nevertheless for optimum results we recommend choosing your primers so that the 5 and 3 RACE products will be 2 kb or less Touchdown PCR We have found that touchdown PCR Don et al 1991 Roux 1995 significantly improves the specificity of BD SMART RACE amplification Touchdown PCR uses an annealing temperature during the initial PCR cycles that is higher than the Tm of the Universal Primer If the Tm of your GSP is gt 70 C only gene specific synthesis occurs during these cycles allowing a critical amount of gene specific product to accumulate The annealing temperature is then reduced to a level compatible with the UPM permitting efficient exponential amplification of the gene specific template See Appendices A C for more details A
51. the optimal cycling parameters for your gene empirically Run 20 or 25 PCR cycles first as described and analyze 5 ul from each tube along with appropriate DNA size markers on a 1 2 agarose EtBr gel If you see weak bands or no bands return the tube s to your PCR machine and perform five additional cycles according to the third set of cycles for touchdown PCR The optimal extension time depends on the length of the fragment being amplified We typically use 3 min for cDNA fragments of 2 4 kb For 0 2 2 kb targets we reduce the extension time to 2 min For 5 10 kb targets we increase the extension time up to 10 min Note Figure 4 in Section VIII shows TFR sample results BD Biosciences Clontech www bdbiosciences com Protocol No PT3269 1 Version No PR38330 BD SMART RACE cDNA Amplification Kit User Manual IX Rapid Amplification of cDNA Ends RACE continued Program 1 preferred use if GSP T gt 70 C 5 cycles 94 C 30 sec 72 3 min 5cycles 94 C 30 sec 70 C 30 sec 72 3 min 20 cycles Poly At RNA OR 25 cycles Total RNA 94 C 30 sec 68 C 30 sec 72 C 3 min If fragments gt 3 kb are expected add 1 min for each additional 1 kb Program 2 if GSP T 60 70 C 20 cycles Poly At RNA R 25 cycles Total RNA 94 C 30 sec 68 30 sec 72 C 3 min If fragments gt 3 kb are expected add 1 min for each additional 1 kb 6 Optional If the primary PCR reaction
52. ust design gene specific primers for the 5 and or 3 RACE reactions GSP1 and GSP2 respectively As described nested primers NGSP1 and NGSP2 will facilitate analysis of your RACE products They can also be used for nested RACE PCR if necessary Primer design is discussed in detail in Section V Figure 3 shows the relationship of primers and template used in BD SMART RACE reactions First strand cDNA synthesis Section VII Since the 5 elongation benefits of BD SMART technology are only relevant for 5 RACE the BD SMART RACE Kit includes a protocol for the synthesis of two separate cDNA populations 5 RACE Ready cDNA and 3 RACE Ready cDNA The cDNA for 5 RACE is synthesized using a modified lock docking oligo dT primer and the BD SMART II A oligo as described above The modified oligo dT primer termed the 5 RACE CDS Primer 5 CDS has two degenerate nucleotide positions at the 3 end These nucleotides position the primer at the start of the poly A tail and thus eliminate the 3 heterogeneity inherent with conventional oligo dT priming Borson et al 1994 The 3 RACE cDNA is synthesized using a traditional reverse transcription procedure but with a special oligo dT primer This 3 RACE CDS Primer A 3 CDS primer includes the lock docking nucleotide positions as in the 5 CDS primer and also has a portion of the BD SMART sequence atits 5 end By incorporating the BD SMART sequence into both the 5 and 3 RACE Ready c
53. x patterns of bands that appear almost as smears In most cases of true smearing a problem has occurred prior to the RACE reaction especially if the 3 RACE reaction produces a smear Smearing of only the 5 RACE reaction products may indicate a difficult template for reverse transcription or degraded RNA Smearing of both reactions is a strong indication of contamination of your starting RNA or a problem in reverse transcription In these cases we recommend repeating the entire procedure after repurifying your RNA or confirming that your RNA is intact and clean See Section VI for more details If smearing is apparently not due to a problem that occurred prior to RACE try optimizing your RACE reactions using the troubleshooting tips de scribed above for multiple bands Protocol No PT3269 1 www bdbiosciences com BD Biosciences Clontech Version No PR38330 33 BD SMART RACE cDNA Amplification Kit User Manual XI Troubleshooting Guide continued K Analyzing the quality of first strand cDNA If you suspect that problems amplifying your RACE fragments may be due to a failure of the reverse transcription reaction you can check the quality of first strand cDNA if generated from poly At RNA using a P labeling procedure To do this repeat the first strand synthesis substituting 1ul of 0 1 uCi ul P dATP or dCTP for one of the microliters of water Run the reaction products on an alkaline agarose gel and examine the banding
54. y a neutralizing monoclonal antibody directed against Taq DNA polymerase BioTechniques 16 1134 1137 Matz M Lukyanov S Bogdanova E Diatchenko L amp Chenchik A 1999 Amplification of cDNA ends based on template switching effect and step out PCR Nucleic Acids Res 27 6 1558 1560 Roux K H 1995 Optimization and troubleshooting in PCR PCR Methods Applic 4 5185 5194 Sambrook J Fritsch E F amp Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition Cold Spring Harbor Laboratory Cold Spring Harbor NY Siebert P D Chenchik A Kellogg D E Lukyanov K A amp Lukyanov S A 1995 An improved method for walking in uncloned genomic DNA Nucleic Acids Res 23 6 1087 1088 Zhu Y Y Machleder E M Chenchik A Li R amp Siebert P M 2001 Reverse transcriptase template switching ASMART approach for full length cDNA library construction Bio Techniques 30 892 897 Protocol No PT3269 1 www bdbiosciences com BD Biosciences Clontech Version No PR38330 35 BD SMART RACE cDNA Amplification Kit User Manual XIII Related Products For a complete listing of all BD Biosciences Clontech products please visit www bdbiosciences com clontech Cat No New Cat No BD Marathon Ready cDNAs many many BD Clontech PCR Select cDNA K1804 1 637401 Subtraction Kit BD Delta Differential Display Kit K1810 1 637405 BD Advantage 2 PCR Kit K
Download Pdf Manuals
Related Search