MicroRNA Target Selection System User Manual
Contents
1. more than 60 of the cells survived the puromycin selection compared to the 293 cells alone where none of the cells survived the selection B THE LUCIFERASE ASSAY Stable cell lines expressing the microRNA selection cassette and control 293 cells was tested for Luciferase activity Promega The luciferase assay was performed according to the manufacturer s recommendation As shown in Figure cell line expressing microRNA selection cassette showed robust Luciferase activity This ensures that the luciferase gene in the vector is highly functional 4500000 4000000 3500000 3000000 2500000 RLU 2000000 1500000 1000000 500000 o Control miR Selection vector Page 8 ver 0526 2010 www systembio com microRNA Target Selection Kit Cat MS040 4xxA 1 C THE CYTOTOXIC CTX KILL CURVE Stable cell lines expressing the microRNA selection cassette was seeded at 80 000 cells per well in a six well plate Next day drug was added with 1000x dilution Cells were harvested on Day 0 day 2 Day 4 and Day 8 Cells were counting using a hemocytometer Trypan blue was added to ensure counting of only the surviving cells Kill Curve with 1X Ctx in medium 250000 200000 150000 100000 Cell number Day 0 Day 2 Day4 Day 8 Representative phase contrast images shown below are 293 control cells and 293 cells transduced with the miR Selection vector treated Ctx drug As shown in the2. Ladder Cat 170 8200 Cell culture media incubator and hood for 293 cells Page 4 ver 0526 2010 www systembio com microRNA Target Selection Kit Cat MS040 4xxA 1 ll Protocol A Clone 3 UTR of interest in miR Selection Vector RSV Downstream of the dual reporter in the microRNA Selection vector contains a convenient multiple cloning site MCS where the 3 UTR of interest can be cloned euceri f miR Selection 2 If the users cannot use any of the enzymes from the multiple cloning sites they can take Fire Ctx Smoter Advantage of SBI s Cold Fusion kit Cat MC101A 1 The Cold Fusion kit employs an Lentivector efficient and simple enzyme free method of cloning Once the 3 UTR has been cloned the svao Poy N sequence can be verified using the EF1 reverse primer EF1 rev primer 5 JANR FIRE CAACTTCTCGGGGACTGTGGGC 3 3 UTR cloning site MCS B Viral Packaging and stable cell line creation The 3 UTR miR Selection construct and the miR Selection vector empty control can be packaged into pseudoviral particles using SBI s LentiStarter kit Cat LVO50A 1 Using the same kit the viral particles can be transduced into desired cell type Three days after viral transduction the cells need to be split 1 2 and puromycin at the concentration of 1ug ml should be added to the cells After three days the cells should be split again and fresh puromycin should be added at a concentration of 1ug ml After two additional d
3. figure five days after the drug treatment only 10 of the cells survive in the 293 cells with miR Selection vector This ensures that the cytotoxic sensor is expressed and responds to the Ctx drug Ctxd a rug Ctx drug d yr a 293 cells control miR Selection vector 293 cells D VALIDATION OF THE MICRORNA SELECTION SYSTEM We cloned 3 UTR of the human c Myc gene in the miR Selection vector and transduced it into 293 cells If microRNAs bind to the 3 UTR being tested then the expression levels of both luciferase and the Ctx sensors will be greatly reduced Lowering the amount of the Ctx sensor is what will enable the cells to survive in the presence of the Ctx drug This interaction between microRNAs and the 3 UTR is key to the selection system and is what is being measured during the screen We also measured the luciferase Fire activities of the c Myc 3 UTR in the miR Selection vector infected with or without Lenti miR 145 virus without Ctx selection 11 12 Our results show that the levels of luciferase were unchanged in the No UTR controls as expected and we also observed a 63 reduction in luciferase activity in the c Myc 3 UTR plus Lenti miR 145 cells We validated the miR Selection system with known binding partners of miR 145 and the 3 UTR from c Myc using both a cellular selection and with luciferase reporter assays The real power of the technology will be to use it as a discover
4. to generate a stable cell line or even utilized in animal models Additional features in this vector include an EF1 Puromycin cassette that enables the simple generation of a homogenous cell line and a convenient Multiple Cloning Site MCS where your 3 UTR of interest can be inserted SBI s lentiviral transduction system is replication incompetent and hence it is biologically safe 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual C HOW THE MICRORNA TARGET SELECTION SYSTEM WORKS The cytotoxic screening assay is a unique approach where multiple microRNA binding targets within the 3 UTR of interest can be easily identified in a single experiment In this assay the cytotoxic sensor is constitutively expressed via a CMV promoter and its expression becomes lethal to the cell when the cytotoxic drug Ctx is added to the medium In a screen where multiple microRNAs are overexpressed only the cells expressing those microRNAs that interact with the 3 UTR and thus down regulate the sensors will survive the drug selection These effectors microRNAs can be easily identified by PCR analysis from those surviving cells genomic DNA No Binding x Successful Binding luciferase j c K Pa se Cell Death gt Luciferase amp Ctx Cell Survival Luciferase amp Ctx are Unregulated are Down regulated Add Ctx rae Add Ctx Ee Drug 48 pssi Drug 48 f Dual Sensor technology The dual senso
5. to refine microRNA target predictions J Biosci 35 1 p 105 18 10 Sioud M and L Cekaite Profiling of miRNA expression and prediction of target genes Methods Mol Biol 629 p 257 71 11 Sachdeva M et al p53 represses c Myc through induction of the tumor suppressor miR 145 Proc Natl Acad Sci U S A 2009 106 9 p 3207 12 12 Sachdeva M and Y Y Mo miR 145 mediated suppression of cell growth invasion and metastasis Am J Transl Res 2 2 p 170 80 VI Appendix A Related Products e Cancer microRNA qPCR Array Cat RA610A 1 Pre formatted 96 well plate containing assays for 95 oncomirs and U6 control 10 complete profiles plus QuantiMir kit included e Stem Cell microRNA qPCR Array Cat RA620A 1 Pre formatted 96 well plate containing assays for 95 different microRNA invioved in stem cell self renewal hematopoiesis neural development and tissue specificity Arra also contains U6 control 10 complete profiles plus QuantiMir kit included e miRNome Profilers Cat RA660A 1 Human Cat RA670A 1 Mouse Profile all Known microRNAs including minor star forms for Human or Mouse Sanger miRBase 100 updated 20 complete profiles with QuantiMir kit included e pPACKH1 Lentivector Packaging Kit Cat LV500A 1 Unique lentiviral vectors that produce all the necessary HIV viral proteins and the VSV G envelope glycoprotein from vesicular stomatitis virus required to make active pseudoviral particles
6. SSB System Biosciences miR Selection 3 UTR Target Selection Kit Cat MS040 4xxA 1 User Manual Store kit at 20 C upon receipt A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement contained in this user manual microRNA Target Selection Kit Cat MS040 4xxA 1 Contents Vi Vil Introduction and Background moOOWD gt P A B C D E F Q A B c D Troubleshooting OVERVIEW HOW THE MICRORNA TARGET SELECTION SYSTEM WORKS LIST OF COMPONENTS rotocol CLONE 3 UTR OF INTEREST IN MIR SELECTION VECTOR VIRAL PACKAGING AND STABLE CELL LINE CREATION TESTING MICRORNA CANDIDATES THE CYTOTOXIC SCREEN uality Control and Sample Data THE EF1 PUROMYCIN CASSETTE THE LUCIFERASE ASSAY References Appendix A Related Products 888 266 5066 Toll Free 650 968 2200 outside US Page 1 AARON System Biosciences SBI User Manual l Introduction and Background A OVERVIEW This manual provides details and information necessary to use the microRNA Target Selection Kit to detect the successful and productive binding events between gene MRNA 3 UTRs and microRNAs To ensure optimal results please read the entire manual before using the reagents and materials supplied with this kit SIGNIFICANCE OF IDENTIFYING MICRORNA TARGET INTERACTIONS MicroRNAs are a major class of smal
7. ays under puromycin selection fresh media should be added to the cells and allowed to recover for two to three days At this point the cells are stably expressing the desired constructs and cells can be expanded and frozen for later use For freezing cells 2x10 cells should be washed with 1xPBS and resuspended in a mixture of FBS with 1 DMSO and frozen at 80 C 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual C TESTING MICRORNA CANDIDATES Transduction of microRNA or a microRNA pooled virus library SBI has the largest collection of microRNA precursor clones that are in lentiviral backbone and they co expresses GFP SBI also has pooled microRNA libraries Cat PMIRHPLVA 1 PMIRHOPLVA 1 SBI can also custom build a desired pool of microRNA viral or plasmid library These clones can be used to transduce the stable cell lines generated previously Three days after transduction the cell lines can be split and are ready for the cytotoxic screen We do not recommend Transfection of microRNAs due to the 4 6 day duration of the Ctx screen D THE CYTOTOXIC SCREEN For the cytotoxic screen please follow the schedule outlined below Day 1 Werecommend that the user seed the control cells miR Selection empty vector and the 3 UTR construct cells at a density of 80 000 cells well of in a six well plate in triplicates Day 2 Add the Ctx drug to the medium at a dilution of 1 1000 in one wel
8. cial bottleneck in the efforts of researchers in the microRNA field to dissect microRNA pathways Page 2 ver 0526 2010 www systembio com microRNA Target Selection Kit Cat MS040 4xxA 1 B THE MICRORNA TARGET SELECTION SYSTEM VECTOR The miR Selection lentivector features a dual reporter system with firefly luciferase Fire and a cytotoxic sensor Ctx The miR Selection platform captures the 3 UTR to microRNA binding event using a survival screen by modulating the reduction of the cytotoxic sensor Quantitative validation is made simple using the built in luciferase reporter This powerful and elegant technology finally enables the accurate identification of microRNA targets and enables high throughput target identification screens RSV pUC ori miR Selection Fire Ctx Lentivector CMV promoter sam a gt FIRE Si EF1 Puro S hess Cassette 3 UTR cloning site MCS The miR Selection lentivector features an EF1 Puro cassette to create stable cell lines for screening orange in vector map The 3 UTR under study is cloned into the Multiple Cloning Site MCS where it influences the expression of the upstream Firefly Luciferase Fire and the Cytotoxic sensor Ctx genes The microRNA target selection technology is in SBI s third generation Lentivector backbone This lentivector backbone allows this construct to be packaged into high titer pseudoviral particles and introduced into hard to infect cell lines
9. he concentration and exposure time to Polybrene during the transduction step Page 10 ver 0526 2010 YLOE 2 W 2 www systembio com microRNA Target Selection Kit Cat MS040 4xxA 1 V References 1 Wightman B Ha and G Ruvkun Posttranscriptional regulation of the heterochronic gene lin 14 by lin 4 mediates temporal pattern formation in C elegans Cell 1993 75 5 p 855 62 2 Kaneda R and K Fukuda MicroRNA is a new diagnostic and therapeutic target for cardiovascular disease and regenerative medicine Circ J 2009 73 8 p 1397 8 3 Hebert S S and B De Strooper Alterations of the microRNA network cause neurodegenerative disease Trends Neurosci 2009 32 4 p 199 206 4 Min H and S Yoon Got target Computational methods for microRNA target prediction and their extension Exp Mol Med 42 4 p 233 44 5 Du L and A Pertsemlidis microRNAs and lung cancer tumors and 22 mers Cancer Metastasis Rev 29 1 p 109 22 6 Subramanian S and C J Steer MicroRNAs as gatekeepers of apoptosis J Cell Physiol 223 2 p 289 98 7 Denli A M et al Processing of primary microRNAs by the Microprocessor complex Nature 2004 432 7014 p 231 5 8 Yousef M L Showe and M Showe A study of microRNAs in silico and in vivo bioinformatics approaches to microRNA discovery and target identification FEBS J 2009 276 8 p 2150 6 9 Heikham R and R Shankar Flanking region sequence information
10. l and 1 1500 in another well and not add any drug ina well Day 4 Change media and add fresh drug Day 5 Remove media and wash the cells three to four times with PBS and add more fresh media without Ctx drug Day 10 Harvest the cells to identify the effector microRNAs SBI s Lenti miR 145 Add Ctx drug Virus GFP to begin selection 4 day selection with Ctx in media C C gt gt SSE Su ee Transduction Ctx Toxin Selection for with MicroRNA Treatment Survivors E RECOVERY OF THE EFFECTOR MICRORNAS Materials required and not supplied in kit For Purification of genomic DNA e DNeasy Tissue Kit QIAGEN Cat 69504 or equivalent For PCR Amplification e Standard PCR kit TITANIUM Taq PCR Kit Clontech Cat 639210 or equivalent e Thermal Cycler DNA Engine MJ Research Cat PTC 200 or equivalent 2 5 1X TAE Agarose gel 1 Purify Genomic DNA from Selected Cells from SBI s Lenti miR Phenotypic Screen Prepare genomic DNA from selected cells according to manufacturers recommendations Measure the yield of DNA by spectrophotometer You should expect to isolate 5 10 ug of genomic DNA from approximately 1x10 cells Dilute the DNA sample in deionized water to a concentration of 0 2 yg ul 2 Asample PCR reaction for SBI microRNA effector clone sequence amplification is provided below A Prepare a PCR Master Mix for all reaction tubes plus one Page 6 ver 0526 2010 www systembio com microRNA Target Se
11. l non coding RNAs that act as endogenous repressors of target gene expression After the seminal discovery of Lin 4 and let 7 microRNAs in C elegans in 1993 1 over ten thousand microRNAs have been discovered in various species The importance of microRNAs in multiple cellular pathways and the roles they play in human diseases such as cancer neurological and immune diseases are becoming increasingly appreciated 2 6 MicroRNAs target the 3 Untranslated Regions UTRs of messenger RNAs and suppress their protein expression either by translation inhibition or deadenylating the mRNA for ultimate degradation 7 A single microRNA can regulate several hundred target genes in a complex regulatory mechanism In order to gain insights and understanding of microRNA regulatory circuitry it is important to identify their cellular targets However imperfect base pairing of microRNAs to target RNAs results in inaccurate predictions 8 10 The prediction algorithms also yield large numbers of putative microRNA targeted genes thus making the choices unmanageable for researchers to choose which ones to pursue Other cell based experimental approaches using reporters like luciferase only to verify each of these predicted interactions are laborious and time consuming often leading to unproductive results There exists a significant gap between the number of predicted microRNA targets and the number of experimentally validated targets Thus target validation is a cru
12. lection Kit Cat MS040 4xxA 1 additional tube Combine the following components in the order shown 41 ul Deionized H2O 5 ul 10X PCR buffer 1 ul 50X dNTP mix 10 mM of each dNTP 1 ul LVL Primer Mix SBI 10 uM of each primer 1 ul Purified Genomic DNA 200ng 1 ul 50X Taq DNA polymerase 50 ul Total volume Note Include no DNA negative control B Mix contents by vortexing and spin the tube briefly in a microcentrifuge C Perform PCR amplification according to these guidelines e 94 C for 2 min e 94 C for 30 sec 60 C for 30 sec for 25 cycles e 68 C for 1 min e 15 C hold D When the program is completed analyze a 10 ul sample from each tube and suitable DNA size marker 200 bp 2 kb ona 1 5 agarose EtBr gel in 1X TAE Note that each microRNA precursor clone within the library collection varies in length Therefore the expected amplicon size may range from 500 to 600bp 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual F THE FIREFLY LUCIFERASE ASSAYS We recommend using Promega s Luciferase assay system catalog E1501 to detect changes in Luciferase expression from the miR Selection lentivector QUALITY CONTROL AND SAMPLE DATA A THE EF1 PUROMYCIN CASSETTE 293 Cells transduced with psuedoviral particle containing the microRNA selection vector were seeded at 80 000 cells per well Puromycin was added to a concentration of 1 mg ml Seven days after selection
13. ons outlined herein SBI has pending patent applications related to the Product For information concerning licenses for commercial use contact SBI Limited Warranty SBI warrants that the Product meets the specifications described in the accompanying Product Analysis Certificate If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with a refund This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2010 System Biosciences SBI 888 266 5066 Toll Free 650 968 2200 outside US Page 13
14. port For more information about SBI products and to download manuals in PDF format please visit our web site http jwww systembio com For additional information or technical assistance please call or email us at System Biosciences SBI 1616 North Shoreline Blvd Mountain View CA 94043 Phone 650 968 2200 888 266 5066 Toll Free Fax 650 968 2277 E mail General Information info systembio com Technical Support tech systembio com Ordering Information orders systembio com Page 12 ver 0526 2010 www systembio com microRNA Target Selection Kit Cat MS040 4xxA 1 Vil Licensing and Warranty Statement Limited Use License Use of the miR Selection Kit i e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditi
15. q293TN cells SBI Cat LV900A 1 transiently transfected with the pPACKH1 and a pMIRNA1 microRNA expression construct produce packaged viral particles containing a microRNA construct 293TN Human Kidney Producer Cell Line SBI Cat LV900A 1 For packaging of plasmid lentivector constructs PEG it Virus Precipitation Solution Cat LV810A 1 Simple and highly effective means to concentrate lentiviral vector inocula produced with SBI s pPACK Lentivector packaging systems e Transdux Cat LV850A 1 Simple and efficient transduction of cells e Lentivector UltraRapid Titer PCR Kit Cat LV960A 1 for human cells LV960B 1 for mouse cells 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual Allows you to measure copy number MOI of integrated lentiviral constructs in genomic DNA of target cells after transduction with constructs made in any of SBI s FIV or HIV based Lentivectors e QuantiMir small RNA quantitation system Cat RA420A 1 Easily profile miRNAs using a single cDNA synthesis step and realtime qPCR MicroRNA Precursor Clone collection cat s pMIRHxxxPA 1 SBI s collection of individual microRNA precursor expression clones in lentivectors e Lenti miRs Cat PMIRHxxA 1 Over express microRNA precursors using lentivectors e miRZips Cat MZIPxxA 1 Permanent microRNA knockdown using RNAi lentivectors with anti sense microRNAs Technical Sup
16. rs for Luciferase and Ctx are under the direct expression control of the JUTR inserted behind the markers Addition of one or more microRNAs in combination with supplying the Ctx drug to cell culture media begins the selection screen If there is no binding site in the 3 UTR clone for the microRNA being tested the cells do not survive the selection skull and bones but will thrive if microRNAs bind to the 3 UTR in the construct happy face Quantitative validation is made simple using the built in luciferase reporter D LIST OF COMPONENTS Each microRNA target selection Kit contains Amount Component ww microRNA Selection Lentivector plasmid uncut 1000X concentration Ctx drug powder resuspend in 1000p Ctx resuspension buffer 1000 wl Ctx resuspension buffer IMPORTANT Resuspend the Ctx drug with 1000 ul Ctx resuspension buffer and then aliquot into 10 tubes of 100 ul for storage at 20 C stable for 3 months avoid repeated freeze thaws of Ctx drug after resuspension NOTE If precipitates from in the Ctx drug suspension warm the solution at 37 C for 5 10 minutes and vortex to mix E Additional Required Materials Thermocycler with heated lid Thermocycler PCR tubes or plates for end point reactions PCR Mastermix including Taq polymerase for PCR 3 0 3 5 Agarose Gel in Tris Borate EDTA TBE or Tris Acetate EDTA TAE Buffer DNA Size Ladder with markers from 50 to 2 000 bp Bio Rad AmpliSize DNA
17. y tool to identify and validate without prejudice microRNAs that can bind and regulate a 3 UTR of interest 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI Ctx Selection Cell Images User Manual Untreated Ctx Selection Ctx Selection GFP Fire Ctx cMycUTR Fire Ctx Control Luciferase Assays YLN E ON 14 _ miR 145 10 gt a 06 02 Fire Ctx Fire Ctx No UTR c Myc UTR IV Troubleshooting 1 Poor Infection Efficiency Too high a volume of infecting supernatant Keep the volume as low as possible to achieve maximal adsorption of viral particles to the cells The assay is carried out too early Normally the maximal expression of integrated provirus is expected to develop by 48 hours after infection However some cells display delayed expression Try the assay at a later time such as 72 or 96 hours Target cell line may be difficult to transduce Optimize the transduction protocol Use a higher MOI Wrong amount of Polybrene added during titration Add and optimize Polybrene concentration in the range of 4 10 ug ml Loss of pseudoviral titer during storage Store pseudoviral stock at 80 C Each freeze thaw cycle drops the titer 2 4 fold Use a fresh aliquot for transduction 2 Infection Affects Target Cell Viability High MOI may be toxic to some cell types Reduce the amounts of virus used Polybrene is toxic for target cells Optimize t
Download Pdf Manuals
Related Search