Home

Freedom CHO-S Kit User Guide

1. sites Position of cut Restriction enzyme Recognition site 1 Ndel CATATG 540 Sse8647 AGGWCCT 830 Scal AGTACT 2 134 Bpll GAGNNNNNCTC 2 738 Bael ACNNNNGTAYC 3 009 BamHI GGATCC 3 521 Bcll TGATCA 3 597 Nhel GCTAGC 4 258 SgrAl CRCCGGYG 4 258 Sse232l CGCCGGCG 5 737 Alol GAACNNNNNNTCC 5 765 Avril CCTAGG 5 776 BstZ17 GTATAC 6 053 EcoRI GAATTC 6 942 Fall AAGNNNNNCTT 7 082 Fsel GGCCGGCC 7 834 EcoRV GATATC 7 846 Pacl TTAATTAA 8 397 Fspl TGCGCA 8 701 Ascl GGCGCGCC 8 917 BsiWl CGTACG 8 977 Rsrll CGGWCCG 9 829 Kpnl GGTACC 10 240 Pmll CACGTG 12 070 Pvul CGATCG 12 070 AsiSI GCGATCGC 12 143 Sspl AATATT 12 411 Nrul TCGCGA Non cutting The Freedom pCHO 1 0 vector lacks recognition sites for the following restriction enzymes restriction enzymes Acll FspAL Pmel Psrl SbfL Srfl Swal 62 Freedom CHO S Kit User Guide Accessory products Freedom CHO S Kit products Gibco custom media amp Gibco services ProBioGen AG cell line development amp manufacturing services Appendix E TM Many of the components supplied with the Freedom CHO S Kit are also available separately For more information go to www thermofisher com lifescience or contact Technical Support see page 68 Item Amount Catalog no CHO S Cells CGMP banked and Media Kit includes 1 x 107 CHO S Cells CD CHO 1 kit A1155701 Medium and L glutamine One Shot TOP10 Chemically Competent 1
2. Kit Fisher Scientific Corporation and ProBioGen AG is designed for easy cloning and expression of recombinant proteins in Chinese hamster ovary CHO derived suspension culture CHO S Cells CGMP banked The Freedom CHO S Kit provides reagents for e cloning one or two genes that encode your protein s of interest e transfecting the DNA into CHO S Cells CGMP banked with high efficiency e generating stable cell lines that produce your protein of interest using a single chemically defined animal origin free media Kit contents and storage Item Amount Shipping Storage CHO S Cells cGMP banked 1 x 107 cells mL Liquid nitrogen 1mL Dry ice vapor phase CD FortiCHO Medium Ambient 2 C to 8 C 1000 mL temperature protect from light Anti i i 2 C to 8 C nti Clumping Agent 20 mL Ambient o temperature OptiPRO SFM 100 mL Ambient 2 C to 8 C temperature protect from light FreeStyle MAX Reagent Ambient 2 C to 8 C 1mL temperature do not freeze j _5o t o L glutamine 200 mM 100 mL pee 5 C to 20 C protect from light ES Son Puromycin 10 mg mL PUE BEE 5 C to 20 C protect from light One Shot TOP10 Chemically Competent coli 21x 50 uL Pie 809C 20 reactions Freedom pCHO 1 0 Expression Vector 1 kit Dry ice 5 C to 20 C Flash drive contains the user manual for the MA Ambient EE Freedom CHO S Kit temperature P Freedom CHO S Kit User Guide Materials re
3. e At larger culture scales you may add FoamAway Irradiated AOF to prevent foaming see page 64 Cells too old Use healthy CHO S Cells CGMP banked under generation 25 do not overgrow Cell culture clumpy e Provide agitation to the culture a regular and frequent cell passage schedule and maintenance of cells at recommended densities 2 x 106 cells mL e Use Anti Clumping Agent see page 64 Do not use Anti Clumping Agent during transfection Anti Clumping Agent should to be removed 2 passages before transfection e Usea cell strainer BD Biosciences 40 uM nylon mesh Cat no 352340 before transfection and before seeding for LDC Cells overheat Calibrate the incubator by comparing the actual temperature of the medium in a culture flask while shaking on the platform to the temperature setting of the incubator Use a flask containing growth medium but no cells Then adjust the incubator setting to the defined temperature Freedom CHO S Kit User Guide 51 Transfection The table below lists some potential problems and possible solutions that may help you troubleshoot your transfection experiments Observation Possible cause Recommended action Very few or no stably transfected cells obtained Improperly cultured cells Cells not passed 24 hours before transfection e Exactly follow procedures as outlined in Thaw and subculture CHO S Cells cGMP banked
4. page 18 e Thaw a new vial of early passage cells e Do not add antibiotics during transfection e Always include Anti Clumping Agent in your selection medium Approximately 24 hours before transfection pass cells at 5 x 105 cells mL FreeStyle Max Reagent handled incorrectly e Store at 4 C Do not freeze e Mix gently by inversion Do not vortex Used poor quality expression construct plasmid DNA i e plasmid DNA from a mini prep DNA contaminated Do not use miniprep plasmid DNA for transfection Prepare midiprep plasmid DNA with low or no endotoxin contamination Sterilize DNA using a 0 22 um filter DNA precipitated upon addition of FreeStyle MAX e Toensure that it is free of salt and organic solvents do not purify the DNA following its linearization with Mru before mixing the DNA with FreeStyle MAX for transfection e Be sure to add FreeStyle MAX to DNA and that the addition is made with the tip immersed in the DNA solution with mixing not drop wise to the top Cells did not recover from selection in CD FortiCHO Medium containing Puromycin and MTX The amounts of Puromycin and MTX required for selection of resistant cells vary with a number of factors including the identity of the protein s being expressed Try reducing the amount of Puromycin and MTX used in Selection Phase 1 52 Freedom CHO S Kit User Guide Protein expression The table belo
5. Nrul 12 411 X Position 1 Freedom pCHO 1 0 12 988 bp AWD 733 d Avrll 5 765 BstZ171 5 776 EcoRV 7 834 Pacl 7 846 Comments for Freedom pCHO 1 0 12 988 nucleotides PGK phosphoglycerate kinase promoter 117 623 DHFR dihydrofolate reductase gene 730 1 293 SV40 polyadenylation signal 1 404 1 631 EF2 CMV hybrid promoter 1 728 5 517 CMV polyadenylation signal 5 773 6 052 CMV EF1 hybrid promoter 6 093 7 565 SV40 polyadenylation signal 7 848 8 094 PGK phosphoglycerate kinase promoter 8 351 8 839 Puromycin resistance gene pac 8 860 9 459 SV40 polyadenylation signal 9 583 9 823 pMB1 origin of replication 10 495 11 168 c Kanamycin resistance gene aph 11 684 12 499 c c complementary strand 60 Freedom CHO S Kit User Guide Features TM The Freedom pCHO 1 0 vector contains the following elements Features have been functionally tested and the vector has been fully sequenced Feature Benefit EF2 cytomegalovirus CMV hybrid promoter Allows efficient high level expression of your recombinant protein Avil and amp stZ171 restriction enzyme sites Entry points for gene insertion behind the EF2 CMV promoter see page 18 for sequencing primers used for analyzing EF2 CMV promoter gene of interest junction CMV polyadenylation signal Allows efficient transcription termination and polyadenylation of mRNA CMV EF1 hybrid promoter EcoRV and Facl r
6. Perform your primary screen i e protein assay of choice on day 17 or 18 to identify clones of interest Calculate the percent cloning efficiency Freedom CHO S Kit User Guide 41 Calculate cloning efficiency Next steps 42 Calculate the percent cloning efficiency normalized at 1 cell per well as follows Number of wells showing growth Cloning Efficiency x 100 Number of wells seeded x cells per well seeded For example the cloning efficiency with 120 colonies growing out of total 600 seeded wells 10 plates with 60 seeded wells plate at a seeding density of 0 5 cell per well is 40 Note We have achieved 20 45 cloning efficiency under these conditions The use of the cell strainer prior to diluting cells greatly improves the frequency of monoclonality however the observed frequency of monoclonality will vary from experiment to experiment and will decrease as seeding density increases After testing these clones for high levels of protein production using your method of choice you can proceed to Clone scale up and screening page 43 Freedom CHO S Kit User Guide Clone scale up and screening Introduction After isolating your clones of interest previous section transfer single cell colonies from 96 well plates to 24 well plates in clone growth medium Scale up the volume of cells every 2 5 days by transferring each clone into the next larger plate or vessel i e 24 well plates to 6 well plates or T 25
7. add Puromycin to a final concentration of 30 ug mL and MTX to 500 nM 30P 500M To the second shake flask SF B add Puromycin to a final concentration of 50 pg mL and MTX to 1 000 nM 50P 1 000M Note This protocol generates four Selection Phase 2 shake flasks per transfection 1A 1B 2A and 2B Incubate the cells on a shaking platform at 37 C 80 relative humidity 8 CO and 150 rpm Sample the flasks every 3 4 days if cells do not show signs of recovery i e cell densities above the last measured value leave as is and perform a complete medium exchange once a week Once cells show signs of recovery proceed to step 5 Passage the cells in shake flasks every 3 4 days seeding them at 3 x 10 viable cells mL at each passage Maintain selective pressure by adding Puromycin and MTX appropriate for the volume of fresh media added Cell pelleting and full media exchange is only required when the dilution factor is 2 Note We recommend using a cell strainer whenever clumping is observed Selection is complete when viability meets or exceeds 90 Note Do not proceed with cultures that have not recovered by day 25 of Selection Phase 2 Cryopreserve at least five vials of cells from each stable pool as a back up see page 20 and proceed to Assess productivity page 36 Note Maintain your stable pools by passaging the cells under final selection pressure conditions until the pool s chosen for cloning are determined by
8. 11 found at www who int csr resources publications biosafety Biosafety7 pdf Freedom CHO S Kit User Guide 67 Documentation and support Customer and technical support Visit www thermofisher com techresources for the latest in services and support including e Worldwide contact telephone numbers e Product support including Product FAQs Software patches and updates e Order and web support e Product documentation including User guides manuals and protocols Certificates of Analysis Safety Data Sheets SDSs also known as MSDSs Note For SDSs for reagents and chemicals from other manufacturers contact the manufacturer Limited product warranty Life Technologies and or its affiliate s warrant their products as set forth in the Life Technologies General Terms and Conditions of Sale found on the Life Technologies web site at www lifetechnologies com termsandconditions If you have any questions please contact Life Technologies at www lifetechnologies com support 68 Freedom CHO S Kit User Guide References Ciccarone V Chu Y Schifferli K Pichet J P Hawley Nelson P Evans K Roy L and Bennett S 1999 Lipofectamine 2000 Reagent for Rapid Efficient Transfection of Eukaryotic Cells Focus 21 54 55 D Anna J A 1996 Synchronization of mammalian cells in S phase by sequential use of isoleucine deprivation G1 or serum withdrawal GO arrest and aphidicolin block Methods in
9. 75 flask containing 10 mL of pre warmed complete medium for a total of two T flasks Repeat steps 7 and 8 three more times per plasmid with two repeats dispensed per T flask for a total of four repeats and two T flasks Incubate T flasks at 37 C in a humidified incubator with 8 CO for 2 days pool duplicate T 75 flasks and proceed to Select stable transfectants for protein expression page 31 1 a Cell count cells mL b ml cells to centrifuge 4 x 107 1a Wash 1 mL Wash 2 mL a Recount cells mL b Total cells 4a x mL Wash 2 mL Resuspension Buffer R 4b 5 x 107 Plasmid ID Concentration ug pL uL cells 120 or 480 uL uL DNA 12 or 48 ug conc Neon electroporation settings Pulse voltage V Pulse width ms Number of pulses Freedom CHO S Kit User Guide Phase 1 selection Each time cells are handled strain cells before counting if clumping is observed Day 0 Perform a complete media exchange to seed two T flasks at 5 x 105 cells mL 1 10P 100M 2 20P 200M Day 0 First day of selection Day 7 Is viability 3096 Shaker flask If cells have been in the same medium for 6 11 days perform a complete medium exchange transfer cells to shaker flask at 3 x 105 cells mL and passage every 3 4 days Place T flask back in incubator and sample 3 4 days later Is viability above the previous value
10. AOF animal origin free formulation for high transfection efficiency of plasmid DNA into CHO S Cells cGMP banked See page 12 for more information TM e Additional components One Shot TOP10 Chemically Competent E coli cells used for cloning your gene s into the Freedom pCHO 1 0 vector OptiPRO serum free medium SFM for optimal DNA lipid complex formulation L glutamine supplement for increased medium stability Anti Clumping Agent to prevent cell clumping and Puromycin for stable cell line selection The Freedom CHO S Kit contains the Freedom pCHO 1 0 vector designed by ProBioGen AG to express one or two genes of interest downstream of the vector s two different hybrid CMV promoters This vector contains the dihydrofolate reductase DHFR selection marker and a puromycin resistance gene allowing selection using MTX and Puromycin simultaneously See page 60 for more TM information on the Freedom pCHO 1 0 vector IMPORTANT Your gene s of interest must be engineered with a mammalian secretion signal for secreted protein expression into the cell culture media Freedom CHO S Kit User Guide 7 Advantages of the Freedom CHO S Kit FAQ eBook TM TM The Freedom CHO S Kit provides the following advantages for protein production in mammalian cells cGMP banked CHO S Cells derived from CHO cells Roy et al 1999 Schifferli 1999 provide stable and accurate glycosylation and are observed to yield func
11. b mL fresh medium 30 2a a Plasmid ID b Concentration ug uL c uL DNA for 50 ug 50 3b d uL OptiPRO SFM 1500 3c DNA FreeStyle MAX complex formation Incubation start time Incubation end time 55 Neon transfection protocol and calculations Cell culture before transfection minimum 5 passages viability 2 9576 Note The numbering in this section does not match the numbering within the detailed protocol Prepare Neon Transfection System Set desired voltage pulse width and pulse number record at step 7 TM TM fill the Neon Tube with 3 mL Electrolytic Buffer E2 before inserting it into the Neon Pipette Station 1 10 56 Count cells after cell straining if needed Determine volume needed for harvesting 4 x 107 cells by centrifugation Centrifuge cells discard supernatant and resuspend with at least 20 mL PBS to wash Wash 1 Centrifuge cells discard supernatant and resuspend with at least 20 mL PBS to wash Wash 2 Recount cells prior to centrifuging Wash 2 Discard supernatant and resuspend cells to 5 x 107 cells mL in Resuspension Buffer R Mix cells with DNA generate four tubes containing 120 uL cells 12 ug DNA OR generate one tube containing 480 uL cells 48 ug DNA Without introducing air draw up 100 uL of cell DNA mixture into the Neon Tip electroporate and immediately proceed to step 8 Dispense cells into a T
12. density and viability Frozen CHO S Cells CGMP banked supplied with the kit store frozen cells in liquid nitrogen until ready to use Complete CD FortiCHO Medium prepared as above pre warmed to 37 C 125 mL polycarbonate disposable sterile Erlenmeyer flasks with vented caps Orbital shaker set at 130 150 rpm in a 37 C incubator with a humidified atmosphere of 8 CO The 130 150 rpm shaking speed as well as all the values used in other places in this manual is specific to an Infors Multitron 2 shaker incubator with an orbital throw of 25 mm When using a shaker with a different orbital throw we recommend that you modify the shaking speed to match the relative centrifugal force RCF 1 118 x10 x THROW x SPEED 1 Remove the cryovial of cells from the liquid nitrogen and thaw quickly less than 2 minutes in a 37 C water bath Decontaminate the outside of the vial with 70 ethanol Aseptically transfer the entire contents of the cryovial into a disposable sterile polycarbonate 125 mL Erlenmeyer shaker flask containing 29 mL of pre warmed complete CD FortiCHO Medium Note Removal of the DMSO from the medium is not necessary Incubate the cells in a 37 C incubator containing a humidified atmosphere of 8 CO in air on an orbital shaker platform rotating at 130 150 rpm Note We have thawed and subcultured CHO S cells at both 130 and 150 rpm with the only difference being a slightly faster growth rate at 150
13. flasks and then to 125 mL shaker flasks We recommend performing a secondary screen in 6 well plates and a tertiary screen in shaker flasks Clone scale up and The flowchart below depicts a suggested workflow for the major steps in clone screening scale up and screening procedure workflow Single cell protein producing clones in 96 well plate Transfer remaining volume of each clone to be scaled e g top 100 up to a well of a 24 well plate containing 0 3 0 5 mL of pre warmed medium Transfer 0 5 mL of each clone to a well of a 6 well plate containing 1 5 2 mL pre warmed medium Passage each clone in 6 well plate static or shaking e g 1 mL of each clone into 2 mL of pre warmed medium SECONDARY SCREEN Seed each clone to a well of a 6 well plate static or shaking at 3 x 10 in 3 mL of medium sample for protein production on day 5 Passage top 30 clones at 2x 105 3 x 105 cells mL 10 30 mL in SF125 TERTIARY SCREEN Seed top 30 clones at 3 x 105 cells mL 30 mL in SF125 at 150 rpm perform 14 day simple fed batch with glucose only feeding to identify top 10 clones maintain cell trains Proceed to optimize protein production using different culture conditions or continue the scale up procedure to meet your bioproduction needs Freedom CHO S Kit User Guide 43 Guidelines for clone scale up Required materials The total clone scale up process from a 96 well p
14. into the Neon Tip IMPORTANT Ensure that there are absolutely NO air bubbles in the Neon Tip before proceeding It may take a few attempts to properly fill the TM Neon Tip Freedom CHO S Kit User Guide 29 30 10 11 12 Insert the Neon Pipette with the sample vertically into the Neon Tube placed in the Neon Pipette Station until you hear a click Ensure that you have the desired instrument settings see page 27 and then press Start on the touchscreen The Neon device automatically checks for the proper insertion of the Neon Tube and Neon Pipette before delivering the electric pulse The touchscreen displays Complete to indicate that electroporation is complete TM TM Remove the Neon Pipette from the Neon Pipette Station and immediately transfer the sample from the Neon Tip by pressing the push button on the pipette to the first stop into the prepared T 75 flask containing pre warmed medium without antibiotics You can use the same Neon Tip and T 75 flask for a second repeat before discarding the tip into an appropriate biological hazardous waste container Perform steps 5 9 for the remaining repeats seeding duplicate repeats from the same Neon Tip into a single T 75 flask Gently rock the T 75 flasks for even distribution of the cells Incubate the flasks at 37 C in a humidified static incubator maintained at 8 CO 48 hours after transfection pool duplicate flasks for each plasmid
15. move to shake flasks should occur as soon as an increase in viability is detected see step 10 Sample the flasks every 3 4 days and perform a complete medium exchange once a week until the cells show signs of recovery As soon as the cells show signs of recovery i e increased viability and cell growth from the last measured values transfer them to a shake flask SF at a seeding density of 3 x 10 viable cells mL Incubate the cells on a shaking platform at 37 C 70 80 relative humidity 896 CO and 150 rpm Note While all steps preceding selection including pre culture and transfection of CHO S cells have used 130 150 rpm see Shaking speed page 19 we have found more consistent results in selection using 150 rpm Whatever rpm setting is used during selection we recommend keeping that setting for all subsequent shake flask pool and clone handling steps including productivity assessments Passage the cells in shake flasks every 3 4 days seeding them at 3 x 10 viable cells mL at each passage Maintain selective pressure by adding Puromycin and MTX appropriate for the volume of fresh media added Centrifugation for full media exchange is only required when the dilution factor is 2 Note We recommend using a cell strainer whenever clumping is observed Selection Phase 1 is complete when viability exceeds 85 and the viable cell density exceeds 1 x 10 viable cells mL Cryopreserve at least three vials of cells from
16. or manual controlled rate freezing apparatus following standard procedures For ideal cryopreservation the freezing rate should be a 1 C decrease per minute 24 72 hours after freezing the cells transfer the frozen vials to liquid nitrogen vapor phase for long term storage Note You can check the viability and recovery of frozen cells 24 hours after storing the cryovials in liquid nitrogen by following the thawing procedure on page 19 Freedom CHO S Kit User Guide Transfect CHO S Cells for stable protein expression using the FreeStyle MAX Reagent Introduction Prepare the plasmid Linearize the plasmid Instructions for stably transfecting suspension CHO S Cells CGMP banked using the FreeStyle MAX Reagent are provided below Because individual protein expression may depend on the order of the different subunits of your protein s of interest we recommend performing multiple transfections in parallel using your expression plasmids see page 17 The Freedom pCHO 1 0 plasmid constructs containing your gene s of interest must be clean sterile and free from contamination with organic solvents and sodium chloride for transfection into CHO S cells We highly recommend using aseptic techniques and sterile vessels for both the DNA preparation and the restriction enzyme digestion Chemical contaminants may kill the cells and salt interferes with lipid complexing decreasing transfection efficiency We recommend
17. pCHO 1 0 plasmid DNA containing the subunit s of your protein s of interest prepared as explained on page 23 e Neon Transfection System see page 64 for ordering information Note Resuspension Buffers R and E2 used in this protocol are Animal Origin Free AOF contact Technical Support see page 68 if documentation is required e Disposable sterile T 75 and T 25 tissue culture flasks e Disposable sterile 125 mL polycarbonate Erlenmeyer flasks e Static culture incubator at 37 C with a humidified atmosphere of 8 CO e Orbital shaker in incubator or a shaker incubator set at 37 C with a humidified atmosphere of 8 CO e Reagents and equipment to determine viable and total cell counts e g Trypan Blue hemacytometer or an automated cell counter Single Neon transfections using the 100 nL tip generate enough cells for protocol optimization However because of the scale limitations of the Neon Tips four repeat transfections of each plasmid are required to generate sufficient cells for the subsequent selection steps The four repeats can be pooled on the day of transfection or on the day of selection Our suggested methods for this process are detailed below e Number of cells to harvest per plasmid 4 0 x 10 viable cells this amount allows for cell loss during washing e Amount of plasmid DNA per repeat 48 ug e Neon electroporation settings Pulse voltage 1500 1600 V Pulse width 10 ms Pulse number 2
18. plasmid DNA or cell type being transfected Insert the Neon Tube in the Neon Pipette Station until you hear a click Transfer the plasmid DNA 12 ug DNA per repeat into a sterile 1 5 mL microcentrifuge tube Taking care to not introduce air bubbles during pipetting add 120 uL of cells per repeat to the tube containing the plasmid DNA and gently mix Because of the configuration of the Neon Tip only 100 pL of cells DNA mixture will be transferred to the tip As such approximately 5 x 10 cells will be transfected per repeat Alternatively for each plasmid to be transfected create a 4X mixture by mixing 48 ug DNA and 480 uL cells Be sure to carefully mix the cell DNA suspension TM each time before drawing it up into the Neon Tip Press the push button on the Neon Pipette to the second stop to open the clamp and insert the top head of the Neon Pipette into the Neon 100 uL Tip until the clamp fully picks up the mounting stem of the piston Gently release the push button continuing to apply a downward pressure on the pipette ensuring that the tip is sealed onto the pipette without any gaps TM Note Change the Neon Tip after two uses Use a new Neon Tip for each new plasmid DNA or cell type being transfected TM Press the push button on the Neon Pipette to the first stop and immerse the Neon Tip into the cell DNA mixture Slowly release the push button on the TM pipette to aspirate the cell DNA mixture
19. procedure to assess productivity once a week the productivity trend will be more accurate with more data points so the glucose feeding and sampling schedule can be used with every passage flask 5 Continue passage and day 7 productivity assessments as long as is needed to simulate the time of your scale up process 6 Optional run productivity assessments as full 14 day simple fed batch see page 36 7 Best practice Every 20 30 generations freeze at least 5 vials of each clone as back up TM TM We recommend using EfficientFeed C AGT Supplement with Dynamis Medium Compared to the original CD EfficientFeed C AGT Nutrient Supplement the EfficientFeed C AGT Supplement contains components that are uniquely combined to allow for simple pH neutral reconstitution as well as the ability to super concentrate the supplement from 81 2 g L 1X to 162 4 g L 2X for reduction of product dilution and increased titers with additional feeding 1 Thaw each clone using Dynamis Medium and a 125 mL shaker flask and incubate as previous 37 C 8 CO and 80 humidity while shaking at 150 rpm 2 Passage at least twice before seeding a 250 mL shaker flask at 3 x 10 viable cells mL in 60 mL of Dynamis Medium Sample for cell counts on day 0 4 Sample daily beginning on day 3 for metabolites titer product quality and cell counts 5 Feed glucose up to 6 g L when levels are below 2 g L Freedom CHO S Kit Use
20. protective clothing and gloves when handling Puromycin and Puromycin containing solutions Puromycin in liquid form should be stored 5 C to 20 C Puromycin is stable for one year if stored properly Once thawed the shelf life is only 1 month We recommend that upon initial thaw of the 20 mL bottle Puromycin be aliquoted into smaller volumes 100 uL 1 mL for refreezing such that the drug can be thawed as needed during selection We routinely use 1 mL aliquots and store them at 4 C post thaw until they are used up or have been thawed for 1 month whichever comes first Freedom CHO S Kit User Guide Methotrexate MTX AN Prepare 1mM MTX stock solution Prepare selection medium Methotrexate MTX is a folic acid antagonist that is actively transported into cells by the folate transporter In the cell it is converted to a high molecular weight polyglutamate metabolite by folylpolyglutamate synthase which binds to DHFR and inhibits its activity The Freedom pCHO 1 0 vector contains the DHFR gene DHFR catalyzes the reduction of 5 6 dihydrofolate to 5 6 7 8 tetrahydrofolate which is essential for DNA synthesis CHO S Cells CGMP banked have a basal level of DHFR activity which is enhanced by transfection with Freedom pCHO 1 0 vector Thus cells carrying Freedom pCHO 1 0 are more resistant to MTX than parental cells CAUTION CHEMICAL HAZARD MTX is toxic to the skin eyes and respiratory system Wear suitable
21. single cell by diluting the pool s of stably transfected cells to 1 cell or less per well in a 96 well plate containing CD FortiCHO Medium In most cases a single cell will form a distinct colony that can be scaled up using the procedures described in this section You may also statistically calculate the desired number of cells per well to help ensure monoclonality or subclone the top producing clones Freedom CHO S Kit User Guide Stably transfected CHO S pools 2 hours Prepare cloning medium and determine cell number and viability 4 hours Serially dilute cells and seed 96 well plates 0 5 1 cells well 12 18 days Grow single cell clones undisturbed and without media change until 10 10096 confluent Proceed to clone scale up 37 Cloning considerations 38 When choosing a workflow consider the amount of protein you wish to produce your available resources and the amount of time it will take to obtain your clonal high producing cell lines Because the growth rate and protein production of each clone varies you may need to optimize clone isolation conditions by adjusting the timing of clone scale up Based on your preferred method of statistical analysis the number of cells per well can be adjusted to increase the likelihood of producing monoclonal wells If you choose to seed below 0 5 cells well we recommend that you increase the number of 96 well plates you seed to generate your d
22. that transfection was successful and will provide a useful point of reference when characterizing stable cell pools following selection Prepare media containing Puromycin and MTX fresh each time Do not re use prepared Puromycin and MTX media Puromycin and MTX can be added to each flask individually or when multiple flasks require the same selection pressure to a larger volume of medium to be used to seed multiple flasks For a one page workflow diagram of Phase 1 selection intended to be printed and used in the laboratory see page 57 TM 1 Pre warm selection medium complete CD FortiCHO Medium supplemented with Anti Clumping Agent at 1 100 dilution to 37 C 2 Optional If clumping is observed in the transfection flask use a cell strainer to obtain a uniform single cell suspension we recommend using BD Biosciences 40 um nylon mesh cell strainer Cat no 352340 For each transfection determine viable and total cell counts see page 19 4 Foreach transfection perform a complete media exchange by centrifuging the cells and resuspending them in selection medium and seed two 150 cm T flasks T 150 at 5 x 10 viable cells mL in 40 mL of selection medium per T flask If there are insufficient cells equally reduce the volume of both flasks as needed 5 To the first T 150 flask containing the transfected cells 1 add Puromycin to a final concentration of 10 ug mL and MTX to 100 nM 10P 100M To the second 1 150
23. 0 reactions C4040 10 E coli 20 reactions C4040 03 FreeStyle MAX Reagent 1mL 16447 100 100 mL 12309 050 RD SEM 1000 mL 12309 019 L glutamine 200 mM liquid 100 mL A2916801 CD FortiCHO Medium 1000 mL A1148301 20 mL 0010057AE Anti Clumping Agent 100 mL 0010057DG Puromycin liquid cure Sp oues Ng 10x 1 mL A1113803 Through our Gibco custom media capability and Gibco services we can develop cloning or growth media formulations specifically suited to your cells We can provide the best nutrient media delivery scheme for your recombinant cell line optimizing a Gibco medium or one in the public domain or your own formulation All final media manufacturing is performed in our ISO 9001 certified OSR cGMP compliant facilities and held to the same high standards as our own Gibco catalog products ensuring scalability robustness and compliance For more information go to or www thermofisher com lifescience contact Technical Support see page 68 For more information of ProBioGen AG s cell line development services including manufacturing go to www probiogen de Freedom CHO S Kit User Guide 63 Additional products 64 The products listed below may be used with the Freedom CHO S Kit For more information go to www thermofisher com lifescience or contact Technical Support see page 68 Item Amount Catalog no Trypan Blue Stain 100 mL 15250 061 Pur
24. 3 pulses Note We have observed equivalent transfection efficiency 40 60 with Freedom pCHO 1 0 at 24 hours and 48 hours post transfection using the above Neon settings the resulting stable pools produce similarly to those generated by FreeStyle MAX transfection We suggest using these settings as a starting point If desired you can further optimize the instrument settings by transfecting cells with the Freedom pCHO 1 0 vector expressing GFP and monitoring the transfection efficiency of green cells at 24 48 hours post transfection Freedom CHO S Kit User Guide 27 General guidelines for Neon transfections Prepare cells for Neon transfection 28 Use only high quality linearized Freedom pCHO 1 0 plasmid DNA containing the subunit s of your protein s of interest prepared as described on page 23 Do not purify the plasmid DNA following linearization because carry over of organic solvents and salts from DNA purification can be toxic to the cells To ensure that the amount of plasmid DNA does not exceed 10 of the total volume used for transfection the concentration of the plasmid DNA should be at least 1 pg pL If possible perform a control transfection in parallel using an appropriate GFP plasmid to determine the transfection efficiency Discard the Neon Tips after two uses and Neon Tubes after ten uses TM Change the Neon Tip Neon Tube and buffer when switching to a different plasmid D
25. 4 g L of glucose e Day 5 add 4 g L of glucose e Day 7 add 6 g L glucose Note We recommend passaging clones at least two times in shaker flasks before initiating the tertiary screen to ensure that the clones doubling times have stabilized IMPORTANT Prepare frozen cell stocks at least 5 vials per clone prior to optimizing protein production You may then optimize protein production using different culture conditions such as including EfficientFeed C AGT Supplement or continue the scale up procedure to meet your bioproduction needs Freedom CHO S Kit User Guide Stability and fed batch assessments of top clones Guidelines for After identifying your top producing clones we recommend transitioning your research cell bank Clones for all subsequent steps from RCB generation all the way through to final and stabilit protein production into Dynamis Medium our next generation production y medium Dynamis Medium is available in both liquid and AGT formats and is 955699 men m the medium of choice for large scale protein production with Freedom CHO S Dynamis Medium clones Clones from the Freedom CHO S workflow can be thawed directly and seamlessly into Dynamis Medium Note The starting formulation for DynamisTM Medium is the same as CD FortiCHO Medium 8 mM L glutamine and 1 100 Anti Clumping Agent but the levels of both of these supplements can be adjusted as needed to optimize for your desired protein pro
26. 4 of culture is reached 4 After sampling feed the cultures with glucose as follows e Day 3 add 4 g L of glucose e Day 5 add 4 g L of glucose e Day 7 add 6 g L of glucose Note To avoid prolonged culture of pools we recommend initiating limiting dilution cloning from the pools frozen at the end of Selection Phase 2 see page 35 instead of stable pool cell trains maintained during the 14 day productivity assessment Alternatively productivity of the pools can be assessed using a 5 day static or shaking batch culture assay With this assay limiting dilution cloning can proceed directly from stable pool cell trains Note Batch culture defined as no feed or supplementation during culture beyond 5 days in CD FortiCHO Medium is not recommended e To perform clone isolation by limiting dilution to obtain single clones expressing high levels of your protein s see page 37 e To scale up your clones for protein expression see page 43 Freedom CHO S Kit User Guide Isolate clones by limiting dilution Introduction Development of a CHO cell line for commercial production of a recombinant protein requires clonality of the final cell population This is achieved by limiting dilution cloning LDC or any method to isolate single cells We provide protocols for LDC since it requires no special equipment Limiting dilution The flowchart depicts the major steps to obtain a clonal cell line i e derived from a cloning workflow
27. 5 mL of fresh Clone Growth Medium complete CD FortiCHO Medium and Anti Clumping Agent at a 1 100 dilution Note Until clones are safely frozen down we recommend adding fresh medium to the wells from which cells were scaled up at each stage as back up After 2 5 days transfer the desired clones into 6 well plates using the same procedure The final culture volume in a 6 well plate is 2 3 mL Perform a second passage such as a 1 5 dilution into new 6 well plates to ensure that the vast majority of the clones are gt 90 viable before performing the secondary screen Ideally this passage in 6 well plate is when shaking conditions are reintroduced but the plates can also be incubated without shaking see above Guidelines for details Note We recommend performing the second passage in a shaking 6 well plate at 130 rpm as described on the preceding page however static 6 well plates also work Ideally this passage in 6 well plate is when shaking conditions are reintroduced but the plates can also be incubated without shaking see above Guidelines for details Set up the secondary screen in static or shaking 6 well plates consistent with the conditions used in the preceding step Seed the cells at 3 x 10 viable cells mL in 3 mL of Clone Growth Medium supplemented with 3 g L glucose and incubate for 5 days before sampling for productivity Note As with the preceding step you may use either static or shaking 6 well plates but we ha
28. 6000606960 GIESE 6960600969 600600900 6960000069 6000000200 6960000069 6000000200 6000096905000 600000 6000696900 EYE OOS O600000000000 CM cells diluted in Cloning Medium Freedom CHO S Kit User Guide 39 Cell counting and dilution 1 10 Ei xc mL of FR i 9 mL of medium 2 77 x 10 viable cells mL initial cell count If using stable pool cell train s for limiting dilution cloning ensure that the cells are gt 90 viable before seeding and proceed to step 2 If using frozen stable pool s for limiting dilution cloning thaw the cells 2 5 days in advance into selection medium lacking Puromycin and MTX no more than one pass should be needed to reach gt 90 viability before seeding limiting dilution cloning We do not recommend extended passage of stable pools in the absence of selection pressure For each pool label five 50 mL conical tubes 1 through 5 Use a cell strainer such as BD Biosciences 40 um nylon mesh cell strainer Cat no 352340 to obtain a uniform single cell suspension with at least 10 mL of your transfected pool CHO S cells into the 50 mL tube labeled 1 Accurately determine the viable cells mL of the strained pool see page 19 Serially dilute the cells to a final concentration of 1 000 viable cells mL using cloning medium as shown in figure below Note Mix cells gently after each dilution by gently inverting the capped tube 5 to 6 times Avoid foaming Manually count
29. 750 cells mL As such you would need to add the following volume from tube 5 to 40 mL of cloning medium 0 267 mL to achieve 5 cells mL for a seeding density of 1 cell well OR 0 134 mL to achieve 2 5 cells mL for a seeding density of 0 5 cells well Always keep the well seeding volume at 200 uL in step 4 below Mix the cell suspension gently by inverting the tube and transfer it into a sterile reagent reservoir Using a multi channel pipettor aseptically dispense 200 uL of the diluted cells into each of the empty wells of each 96 well plate marked as CM on the sample plate on page 39 While stacking no more than 5 plates together incubate the plates undisturbed without moving or opening the incubator for at least 12 days at 37 C and 5 8 CO in humidified air in a static non shaking incubator No earlier than day 12 of incubation examine the wells visually using a microscope for growth of monoclonal colonies Optional On day 13 or 14 feed all wells with 25 50 pL of complete CD FortiCHO Medium with or without the Anti Clumping Agent at 1 100 dilution Note The purpose of this feed is to ensure that there is sufficient volume in the wells for both the primary screen assay and the clone scale up procedures and it depends on the amount of evaporation your plates have experienced within your static incubator Feeding may be unnecessary if evaporation is minimized for example by setting incubator humidity to 95
30. Cell Science 18 115 125 D Anna J A Valdez J G Habbersett R C and Crissman H A 1997 Association of G1 S phase and late S phase checkpoints with regulation of cyclin dependent kinases in Chinese hamster ovary cells Radiat Res 148 260 271 de la Luna S and Ortin J 1992 pac gene as efficient dominant marker and reporter gene in mammalian cells Methods Enzymol 216 376 385 Deaven L L and Petersen D F 1973 The chromosomes of CHO an aneuploid Chinese hamster cell line G band C band and autoradiographic analyses Chromosoma 41 129 144 Gorfien S F Dzimian J L Tilkins M L Godwin G P and Fike R 1998 JAACT 9 247 Kaufman R Wasley L Spiliotes A Gossels S Latt S Larsen G and Kay R 1985 Coamplification and coexpression of human tissue type plasminogen activator and murine dihydrofolate reductase in Chinese hamster ovary cells Mol Cell Biol 5 1750 1759 Lacalle R A Pulido D Vara J Zalacain M and Jimenez A 1989 Molecular analysis of the pac gene encoding a puromycin N acetyl transferase from Streptomyces alboniger Gene 79 375 380 Lin Chao S Chen W T and Wong T T 1992 High copy number of the pUC plasmid results from a Rom Rop suppressible point mutation in RNA II Mol Microbiol 6 3385 3393 Oka A Sugisaki H and Takanami M 1981 Nucleotide sequence of the kanamycin resistance transposon Tn903 J Mol Biol 147 217 226 Puck T T Cieciura
31. Centrifuge cells for a complete medium exchange and seed at 3 x 105 cells mL reduce volume if needed After day 10 11 complete medium exchange is required once a week At each subsequent passage Is viability 85 Passage cells every Seed two shaker flasks 3 4 days at 3 x 105 at 4 x 105 cells mL for cells mL Phase 2 selection 30P 500M 50P 1000M Freeze at least 3 vials Drugs 10P 100M 20P 200M Puromycin 1 uL mL 2 uL mL MTX 0 1 mM stock 1 uL mL 2 uL mL Add drugs based on volume of fresh medium of Phase 1 pool f dilution is less than 2X centrifuge for a complete medium exchange Perform productivity assessment Freedom CHO S Kit User Guide 57 Phase 2 selection Each time cells are handled strain cells before counting if clumping is observed Seed two shaker flasks at 4 x 105 cells mL A 30P 500M B 50P 1000M Check pools every 3 4 days Is viability 2 90 NO Is VCD gt 3 x 105 cells mL or gt 4 x 105 cells mL at first pass Check pools every 3 4 days Is VCD 2 6 x 10 cells mL Were cells passaged at last sampling YES NO NO YES Passage cells at 3 x 105 Centrifuge cells and perform cells mL add drugs complete medium exchange based on volume of seeding cells at 3 x 105 cells mL fresh medium reduce volume if needed Pruge SOEs SOM ESOEITUDUM Freeze at least 5 vials Puromycin 3 uL mL 5 uL mL Perform productivity MTX 1 mM st
32. E see page 64 be included at a 1 100 dilution in complete CD FortiCHO Medium Medium containing Anti Clumping Agent can be prepared in advance by adding 10 mL of Anti Clumping Agent per liter of complete medium or by adding 300 uL of Anti Clumping Agent to each 30 mL culture flask The detailed protocols on pages 33 35 describe a two phase selection scheme that typically takes 3 7 weeks to generate stable pools Because each phase of selection uses two different selection pressures each transfection yields 4 stable pools For detailed workflow diagrams of the two phase selection scheme intended to be printed and used in the laboratory see pages 57 58 TM 48 hours after transfection passage transfected CHO S cells in selection medium complete CD FortiCHO Medium 1 100 dilution of Anti Clumping Agent and varying amounts of Puromycin and MTX as described in the protocols below pages 33 35 TM Note While Anti Clumping Agent containing complete CD FortiCHO Medium can be prepared in advance we recommend that media containing Puromycin and MTX only be prepared fresh for each passage Freedom CHO S Kit User Guide Selection Phase 1 2 3 weeks Initiate the first phase of selection 48 hours post transfection following the protocol below Highly recommended Remove a sample from each transfection to determine the transient levels of your protein s of interest using an appropriate quantitation assay This will confirm
33. GE ON OS GE EG SA GE REG GR Ge Ge EA EE GN GE GES 14 Experimental flowchart for protein expression iss see ee ee ee ee ee ee 14 Create expression plasmids for the Freedom CHO S Kit sesse seek ee ee ee EE 16 Thaw and subculture CHO S Cells CGMP banked Re ER Re 18 Freeze CHO S Cells and make a research cell bank RCB 20 Transfect CHO S Cells for stable protein expression using the FreeStyle MAX REagER US ER see de tetete etes 23 Optional Transfect CHO S Cells for stable protein expression using the Neon Transiection rum nee 27 Select stable transfectants for protein expression eeeeeeeeeeeenneeeeeennne 31 Assess productivity EER EN EU MORIA NIE ERI pM ER Pa PME 36 Isolate clones by limiting dilution ees ee ee Ee ee nnne 37 Clone scale up and screening iss ee GE EE ee ee ee EE ee ee ee ee 43 Stability and fed batch assessments of top CLONES issie ek EE ee ee GE 47 PD DONGIN A metu ce 50 Troubleshooting cocos vh v uoa v ro SEAN a X NY HD ies RR VV VO neta AR GARS VARS ale RS DS N 50 Freedom CHO S Kit User Guide 3 AppendpcB EE SE ia ERE 54 Quick reference protocols 5 5 5 SR GE KS cedant a dedica hn RR dua da RT RR RUNE OE 54 FreeStyle MAX transfection protocol and calculations ssssssss 55 Neon transfection protocol and ca
34. M Freedom pCHO 1 0 vector and the following insertion site e First insertion site Avrll and or BstZ171 blunt Optional When creating a single expression plasmid remove the second expression cassette by Sfil digestion and vector re ligation e Fora transfection efficiency control create a single expression plasmid using a GFP allele inserted into Freedom pCHO 1 0 vector at the first insertion site AvrlI and or BstZ171 blunt Be sure to prepare the control plasmid using the same reagents and procedures as used for your expression plasmid s including the linearization step before transfecting in parallel to assess transient transfection efficiency e For best ligation results be sure your insert is in molar excess of the plasmid in the ligation reaction We recommend trying a few insert vector ratios to ensure the isolation of the desired product for example 3 1 and 5 1 insert vector ratios You can calculate the amount of insert needed when starting with a known amount of vector as follows Size of insert Amount of insert ng x insert vector ratio x ng vector Size of vector For example to achieve a 3 1 insert vector ratio to ligate a 2 kb insert into 20 ng of 13 kb Freedom pCHO 1 0 use 9 2 ng of the insert Freedom CHO S Kit User Guide Freedom pCHO 1 0 bacterial selection marker Types of expression plasmids IMPORTANT Your inserts must contain an ATG initiation codon in the context of a Koz
35. NA or cell type Prepare extra cell suspension during passage to ensure that the desired cell number is available at the time of transfection Note The calculations provided include extra cells to allow for loss during washes and to provide sufficient volume of cells and DNA for the Neon tip to be filled completely without introducing air into the tip For a one page quick reference protocol intended to be printed and used in the laboratory see page 56 24 hours before transfection passage CHO S cells at 1 x 10 viable cells mL in complete CD FortiCHO Medium Place the flask s on an orbital shaker platform rotating at 130 150 rpm at 37 C 80 relative humidity and 8 CO IMPORTANT Cell clumping reduces transfection efficiency If cell clumping is observed in the passage flask on the day of transfection we recommend using a cell strainer such as the BD Biosciences 40 um nylon mesh cell strainer BD Biosciences Cat no 352340 to obtain a uniform single cell suspension Determine the cell count and viability after using the cell strainer On the day of transfection count the cells and harvest the required amount of cells by centrifugation at 100 200 x g for 5 10 minutes To ensure you have sufficient cells harvest 4 0 x 10 viable cells per plasmid to be transfected 1 0 x 10 viable cells per repeat x 4 repeats per plasmid Wash the cells two times with at least 20 mL of phosphate buffered saline PBS without Ca a
36. Purposes except that buyer may transfer this product and its components to service providers for use by such service providers in research conducted for consideration solely for the benefit of the buyer provided that each such service provider agree in writing a not to transfer this product its components or materials or information made using this product or its components to any third party b to use this product its components and any materials or information made using this product or its components solely for research and solely for the benefit of the buyer and c to return to buyer or destroy any and all remaining product components or materials made using this product or its components upon completion or termination of its services for buyer The buyer may also transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not limited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnosti
37. Reagent 50 uL Note Further optimization of culture volume or transfection conditions is not necessary for stable cell line production Calculate the number of CHO S Cells cGMP banked that you will need for your transfection experiment and expand cells accordingly Make sure that the cells are healthy and greater than 95 viable before proceeding to transfection Prepare high quality plasmid DNA at a concentration of 1 5 pg pL in deionized water or TE buffer Carry over of organic solvents and salts from DNA purification can be toxic to the cells therefore DNA purification following linearization is not recommended If possible use an appropriate GFP plasmid transfected in parallel to determine transfection efficiency Prepare extra volume of cell suspension to ensure that the desired cell number is available at the time of transfection For a one page quick reference protocol intended to be printed and used in the laboratory see page 55 Freedom CHO S Kit User Guide Transfection procedure using the FreeStyle MAX Reagent AN Follow the procedure below to transfect CHO S Cells cGMP banked in a 30 mL volume Handle cells at all steps using aseptic technique in a biosafety cabinet We recommend including negative controls no FreeStyle MAX Reagent no DNA in your experiment to help you evaluate your results We suggest that you perform at least 2 transfections with each plasmid construct to increase the likeli
38. S J and Robinson A 1958 Genetics of somatic mammalian cells III Long term cultivation of euploid cells from human and animal subjects J Exp Med 108 945 956 Roy L Cates S Schifferli K Pichet J P Ciccarone V Bennett S and Hawley Nelson P 1999 High Transfection Efficiency of Cloned Cell Lines Focus 21 62 63 Schifferli K Jesse J and Ciccarone V 1999 LipofectamineTM 2000 Reagent for Rapid Efficient Transfection of Eukaryotic Cells Focus 21 54 55 Sheeley D M Merrill B M and Taylor L C 1997 Characterization of monoclonal antibody glycosylation comparison of expression systems and identification of terminal alpha linked galactose Anal Biochem 247 102 110 Vakulenko S Kalman M Horvath B and Simoncsits A 1987 The nucleotide sequence of an aminoglycoside 3 phosphotransferase gene from E coli Nucleic Acids Res 15 8111 Vara J Perez Gonzalez J A and Jimenez A 1985 Biosynthesis of puromycin by Streptomyces alboniger characterization of puromycin N acetyltransferase Biochemistry 24 8074 8081 Werner R G Noe W Kopp K and Schluter M 1998 Appropriate mammalian expression systems for biopharmaceuticals Arzneimittelforschung 48 870 880 Yanisch Perron C Vieira J and Messing J 1985 Improved M13 phage cloning vectors and host strains nucleotide sequences of the M13mp18 and pUC19 vectors Gene 33 103 119 Freedom CHO S Kit User Guide 69 F
39. USER GUIDE gibco Freedom CHO S Kit For transfection of CHO S Cells CGMP banked and development of stable cell lines for protein production Catalog Number A13696 01 Publication Number MANO003505 Revision A 0 ProBio en ThermoFisher SCIENTIFIC Supporting Biopharmaceutical Visions For Research Use Only Not for use in diagnostic procedures Information in this document is subject to change without notice DISCLAIMER TO THE EXTENT ALLOWED BY LAW LIFE TECHNOLOGIES AND OR ITS AFFILIATE S WILL NOT BE LIABLE FOR SPECIAL INCIDENTAL INDIRECT PUNITIVE MULTIPLE OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT INCLUDING YOUR USE OF IT NOTICE TO PURCHASER LIMITED USE LABEL LICENSE No 335 Technology with CRO Rights This product and its use is the subject of one or more issued and or pending U S and foreign patent applications owned or controlled by Life Technologies Corporation The purchase of this product conveys to the buyer whether the buyer is an academic or for profit entity the right under the aforementioned patents and patent applications to use the purchased amount of the product and components of the product in research The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial
40. V viability e T flasks T 150 T 75 e Shaker flasks e MTX available from Sigma Cat no A6770 or M8407 e Anti Clumping Agent Cat no 0010057AE e Static and shaking incubators The Freedom pCHO 1 0 vector contains the puromycin resistance gene which confers resistance to the antibiotic Puromycin and DHFR which can be selected for by the addition of MTX Complete selection can take up to seven weeks of growth in selective medium Freedom CHO S Kit User Guide 31 Prepare selection medium Select stable transfectants for protein expression 32 TM To prepare complete CD FortiCHO Medium containing Puromycin and MTX use complete CD FortiCHO Medium supplemented with Anti Clumping Agent at a 1 100 dilution and only add the required concentration of Puromycin and MTX fresh each time Do not store media containing Puromycin and MTX Alternatively Puromycin and MTX can be added fresh to each selection flask during cell passage Note Development work with this kit used 10 50 pg mL of Puromycin and 100 1 000 nM of MTX However because different transfected cells may exhibit different drug sensitivities we recommend that you generate pools with different concentrations of Puromycin MTX to ensure that you have at least one set of conditions that works with your protein s see Experimental Flowchart page 14 Note For the success of selection it is critical that Anti Clumping Agent Cat no 0010057A
41. ages 31 35 We recommend that you familiarize yourself with the detailed protocols before starting your experiments Freedom CHO S Kit User Guide FreeStyle MAX transfection protocol and calculations Cell culture before transfection minimum 5 passages viability 2 95 Note The numbering in this section does not match the numbering within the detailed protocol IU Count cells after cell straining if needed Determine volume needed for 3 x 107 cells per transfection Dilute cells with pre warmed complete medium to 1 x 106 cells mL in 30 mL maintain with shaking at 37 C until needed Note Do not centrifuge cells prior to transfection Dilute 50 ug of plasmid DNA in 1 5 mL final volume of OptiPRO SFM Dilute 50 uL FreeStyle MAX in 1 45 mL of OptiPRO SFM for each transfection mix without vortexing With tip submerged slowly add 1 5 mL diluted FreeStyle MAX to diluted DNA incubate 10 20 minutes at room temperature to allow for DNA FreeStyle MAX complex formation Note If precipitation is observed start over from step 3 Add all 3 mL of FreeStyle MAX DNA mixture dropwise to cells from step 2 while swirling Incubate with shaking at 37 C in a humidified incubator with 8 CO for 2 days and proceed to Select stable transfectants for protein expression page 31 Freedom CHO S Kit User Guide 1 2 a Cell count cells mL b Viability 96 a mL cells 3 x 107 1a
42. ak translation initiation sequence for proper initiation of translation in mammalian cells Kozak 1987 Kozak 1990 Kozak 1991 An example of a Kozak consensus sequence is provided below Other sequences are possible but the G or A at position 3 and the G at position 4 shown in bold illustrates the most commonly occurring sequence with strong consensus Replacing one of the two bases at these positions provides moderate consensus while having neither results in weak consensus The ATG initiation codon is shown underlined G A NNATGG For the Freedom pCHO 1 0 vector we have successfully used GCCACCATGG Also if you wish to express secreted proteins be sure to include a signal peptide sequence for the secretion of your protein of interest Freedom pCHO 1 0 vector contains the bacterial selection marker aph which allows for selection of transformed cells by generating resistance to the antibiotic kanamycin Oka et al 1981 Vakulenko et al 1987 e When transforming One Shot TOP10 Chemically E coli with the Freedom pCHO 1 0 vector use 50 pg mL of kanamycin e If you wish to use a different strain of E coli ensure that it is kanamycin sensitive and conduct a kill curve study to establish the ideal concentration of kanamycin to use You will create two expression plasmids for two subunits or create one expression plasmid for a single subunit Vector DNA Selection Freedom pCHO 1 0 mammalian secretion s
43. assage Master Cell Bank cultures derived from parental CHO S cells that were re cloned by limiting dilution in CD CHO Medium and selected for their superior serum free cell growth and transfection efficiencies Ciccarone et al 1999 Schifferli 1999 e adapted to serum free suspension growth e compatible with CD FortiCHO Medium for all steps of the workflow TM e compatible with FreeStyle MAX Reagent for high transfection efficiency e manufactured under cGMP guidelines and banked in CD CHO Medium a serum free protein free and chemically defined medium that is formulated with no components of animal or human origin Gorfien 1998 Frozen cells are supplied at a concentration of 1 x 10 cells mL and can be thawed directly into CD FortiCHO Medium see page 18 e available for commercial use with purchase of separate documentation package and license Chinese Hamster Ovary CHO cells are among the most commonly used cell lines for transfection expression and large scale production of recombinant proteins The CHO cell line is a stable aneuploid cell line established from the ovary of an adult Chinese hamster D Anna 1996 D Anna et al 1997 Deaven amp Petersen 1973 Puck et al 1958 Note While cells were banked in CD CHO Medium cell thaw and all subsequent workflow steps are performed directly in the kit provided CD FortiCHO Medium without any separate adaptation steps CAUTION As with other mammalian cel
44. assessing pool productivity Freedom CHO S Kit User Guide 35 Assess productivity Protein production AN Assess productivity Next steps 36 To check for production of your protein s during stable cell establishment you can take an aliquot of spent growth medium and perform SDS PAGE protein specific ELISA or the bioactivity assay of choice to determine that your cells are producing your protein s of interest IMPORTANT When you have a pool of stably transfected cells freeze several aliquots of the pool using the procedure on page 20 The following protocol can be used to assess the productivity in a simple fed batch culture Additional nutrition feeds can be added if desired 1 Seed fully recovered cell pools viability gt 90 at 3 x 10 viable cells mL using 30 mL fresh medium complete CD FortiCHO Medium supplemented with Anti Clumping Agent at 1 100 dilution in 125 mL shaker flasks Inclusion of Puromycin and MTX is not recommended during productivity assessment Scale up the culture volume appropriately if you increase the sampling volume or frequency 2 Incubate the cells on a shaking platform at 37 C 80 relative humidity 8 CO and 150 rpm Note Be sure to use the same rpm speed used during selection 3 Sample cultures daily or at regular intervals e g on day 0 3 5 7 10 12 and 14 to determine the cell density viability and productivity until culture viability drops below 50 or day 1
45. c or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research For products that are subject to multiple limited use label licenses the terms of the most restrictive limited use label license shall control Life Technologies Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Life Technologies Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of the product with a full refund For information on obtaining additional rights please contact outlicensing alifetech com or Out Licensing Life Technologies Corporation 5791 Van Allen Way Carlsbad California 92008 Email outlicensing alifetech com LIMITED USE LABEL LICENSE No 336 Transformed Host Cell Disclaimer This product is not provided with a license to U S Patent No 6 331 415 or any patents or patent applications related thereto Each purchaser of this product should consider whether additional rights are required for the purchaser s particu
46. ces Freedom CHO S Kit User Guide 47 Sample stability assessment protocol Sample feeding schedule for EfficientFeed C AGT Supplement and Dynamis Medium 48 With a 60 generation stopping point stability assessment takes 6 weeks for clones with doubling times of 17 hours Use Dynamis Medium supplemented with 8 mM L glutamine and 1 100 Anti Clumping Agent as the medium for all subsequent steps 1 Thaw each clone into a 125 mL shaker flask and incubate as previous 37 C 8 CO and 80 humidity while shaking at 150 rpm 2 Passage on a regular schedule such as every 3 days or on a 3 4 day schedule seeding at 1 x 10 2 x 10 viable cells mL 3 Optional At first passage add 100 nM MTX to each flask for this and all subsequent passages Since some customers find it acceptable to include MTX during clone scale up prior to production we have provided the recommended conditions here We have established that most Freedom CHO S clones will be stable defined as maintaining titer at 270 initial values over 60 generations with a minimal amount of MTX 100 nM regardless of the final selection pressure that was used to generate the pool from which the clone was isolated 4 Tracking clone productivity After seeding the new passage flask feed the cells remaining in the old passage flask with 5 g L glucose and incubate the flask to day 7 before sampling for protein titer quality While we have used this
47. cies and lowest cytotoxicity in CHO S Cells CGMP banked and other cell types TM FreeStyle MAX Reagent is also available separately see page 63 for ordering information Store FreeStyle MAX Reagent at 2 8 C Do not freeze OptiPRO SFM is included with the Freedom CHO S Kit to facilitate optimal formation of DNA lipid complexes OptiPRO SFM is a serum free medium that is devoid of components of animal or human origin OptiPRO SFM has an ultra low protein concentration of 7 5 ug mL TM OptiPRO SFM is also available separately see page 63 for ordering information Store OptiPRO SFM at 2 8 C protected from light Selection reagents Puromycin AN Store Puromycin 12 TM The Freedom pCHO 1 0 vector contains the puromycin resistance gene which confers resistance to the antibiotic Puromycin Puromycin is available separately see page 63 for ordering information Puromycin is an aminonucleoside that blocks protein synthesis in mammalian cells by interfering with ribosomal function Expression in mammalian cells of the bacterial gene pac derived from Streptomyces alboniger results in detoxification of Puromycin de la Luna amp Ortin 1992 Lacalle et al 1989 Vara et al 1985 CAUTION Puromycin while non hazardous should be handled with care Avoid contact with skin and eyes In case of contact with skin or eyes immediately rinse with water thoroughly and seek medical advice Wear suitable
48. d nitrogen vapor phase Keep in liquid nitrogen vapor phase until thawing Incorrect thawing medium or method e Use pre warmed CD FortiCHO Medium supplemented with 8 mM L glutamine e Do not add antibiotics to medium because it may negatively impact cell growth e Incubate cultures on an orbital shaker set at 130 150 rpm in a 37 C incubator with a 70 80 humidified atmosphere and 8 CO No viable cells after thawing stocks Cells not frozen correctly Follow the protocol on page 20 to freeze cells Incorrect thawing medium or method e Use pre warmed CD FortiCHO Medium supplemented with 8 mM L glutamine e Do not add antibiotics to medium because it may negatively impact cell growth e Incubate cultures on an orbital shaker set at 130 150 rpm in a 37 C incubator with a 70 8096 humidified atmosphere and 8 CO 50 Freedom CHO S Kit User Guide CulturingCHO S cells cCGMP banked The table below lists some potential problems and possible solutions that may help you troubleshoot your cell culture experiment Observation Possible cause Recommended action Cells grow slowly Incorrect growth medium Shaker not set up properly Use pre warmed CD FortiCHO Medium supplemented with 8 mM L glutamine Shake on an orbital shaker at 130 150 rpm in 37 C incubator with a humidified atmosphere of 8 CO Medium is foamy e Keep shaker speed at 130 150 rpm
49. duction and quality 1 Create a large cell bank of each clone for which productivity and stability will be assessed in Dynamis Medium Note Clones frozen down during clone screening can be directly thawed into Dynamis Medium supplemented with 8 mM L glutamine and 1 100 Anti Clumping Agent without any negative effects TM Note We recommend that you use the Dynamis Medium cell bank for stability assessment preliminary cell sterility testing fed batch and process optimization and subsequent cell banking needs Note We recommend that at least 10 clones be assessed for production stability 2 Determine stability of desired number of clones over the projected time needed to scale up from RCB to your final protein production vessel For example we typically perform stability assessment over 60 generations which is more than enough time to allow for clone scale up from an RCB to a 10 000 L production tank Adjust as needed to meet your scale up process needs 3 Optimize protein production and product quality using Dynamis Medium EfficientFeed C AGT Supplement and process development While we provide a sample feeding schedule below each clone could have unique feed needs and thus the feeding schedule provided is just a relative starting point Note For additional support or customized medium and feed development to optimize protein production and or product quality please contact TM Gibco Bioprocess Servi
50. e swirling the tip Mix the DNA FreeStyle MAX mixture gently by swirling the tube and incubate the mixture for 10 minutes at room temperature to allow DNA lipid complexes to form Do not incubate the mixture for longer than 20 minutes Note If precipitation is observed upon addition of FreeStyle MAX Reagent to DNA do not proceed with transfection Instead prepare fresh dilutions of your DNA and FreeStyle MAX reagent and ensure that your tip is immersed in the DNA solution when adding the diluted FreeStyle MAX Reagent Drop wise add the 3 mL of DNA FreeStyle MAX Reagent complex into the 125 mL flask containing cells while slowly swirling the flask Incubate the transfected cell cultures at 37 C 8 CO on an orbital shaker platform rotating at 130 150 rpm 48 hours after transfection proceed directly to Select stable transfectants for protein expression page 31 Freedom CHO S Kit User Guide Optional Transfect CHO S Cells for stable protein expression using the Neon Transfection System Introduction Required materials Optimal Neon transfection conditions Make sure that the cells are healthy and 295 viable before proceeding to transfection Before starting calculate the number of CHO S Cells CGMP banked that you will need for your transfections and expand the cells accordingly e Suspension CHO S cells cultured in complete CD FortiCHO Medium see page 11 for recipe TM e Linearized Freedom
51. eLink HiPure Plasmid Midiprep Kit 25 preps K2100 04 z 500 mL in a FoamAway Irradiated AOF 1000 mL bag A10369 02 Dynamis Medium liquid 1000 mL A2661501 1L A2617504 10 L A2617501 Dynamis AGT Medium 100 L A2617502 10 Kg A2617503 1L A25031 04 EfficientFeed C AGT Supplement 10L A25031 05 100 L A25031 01 Neon Transfection System 1 each MPK5000 l 50 reactions MPK10025 Neon Transfection System 100 uL Kit 192 reactions MPK10096 Freedom CHO S Kit User Guide Appendix F Safety in the user documentation may result in personal injury or damage to the instrument or device Ensure that anyone using this product has received instructions in general safety practices for laboratories and the safety information provided in this document WARNING GENERAL SAFETY Using this product in a manner not specified Before using an instrument or device read and understand the safety information provided in the user documentation provided by the manufacturer of the instrument or device Before handling chemicals read and understand all applicable Safety Data Sheets SDSs and use appropriate personal protective equipment gloves gowns eye protection etc To obtain SDSs see the Documentation and support section in this document Freedom CHO S Kit User Guide 65 Chemical safety AN 66 WARNING GENERAL CHEMICAL HANDLING To minimize hazards ensure laboratory personnel read and prac
52. each Selection Phase 1 pool as a back up see page 20 and proceed directly to Selection Phase 2 page 35 With cells remaining after cryopreservation and seeding Phase 2 selection seed a separate flask at 3 x 10 viable cells mL but without adding selection pressure to assess productivity of your Phase 1 pools at day 5 post seeding This can be compared back to transient transfection titers to confirm a titer increase and will serve as a reference for determining if there is an increase in production in your Phase 2 stable pools Note Do not proceed with cultures that have not recovered by day 25 of Selection Phase 1 Note During the selection round cell viability may drop dramatically to lt 10 due to the death of untransfected and transiently transfected cells To promote optimal growth of stably transfected cells maintain cultures as described in the protocol above Freedom CHO S Kit User Guide Selection Phase 2 For a one page workflow diagram of Phase 2 selection intended to be printed and 1 3 weeks used in the laboratory see page 58 1 For each Selection Phase 1 pool determine the viable and total cell counts see page 19 Seed two new 125 mL shaker flasks per Selection Phase 1 pool at 4 x 10 viable cells mL in 30 mL of selection medium by performing a complete medium exchange and resuspending cells in fresh medium and then add the appropriate volume of Puromycin and MTX To the first shake flask SF A
53. econdary screen itself be performed using shaking 6 well plates This requires the plates to be incubated in a box which can be done inexpensively by purchasing a plastic storage box compatible with your 6 well plate configuration and incubator space and puncturing the lid with multiple holes to allow for gas exchange We generated our data using 13 x 10 x 5 5 inches plastic boxes shaking at 130 rpm As with static plates shaking plates should not be stacked more than five high If using shaking 6 well plates is not desired we have found that both static and shaking 6 well plates can be used to eliminate low producers during the secondary screen Single cell derived protein producing clones in 96 well plates Clone Growth Medium complete CD FortiCHO Medium and Anti Clumping Agent at a 1 100 dilution Sterile tissue culture dishes 24 well and 6 well and sterile 125 mL polycarbonate shaker flasks Non shaking static incubator set at 37 C 280 humidified atmosphere and 896 CO Shaking incubator set at 37 C 70 80 humidified atmosphere and 8 CO shaking at 130 150 rpm Assay for determining protein production Freedom CHO S Kit User Guide Protocol When individual clones are 10 90 confluent in 96 well plates day 17 or 18 post seeding aseptically harvest the desired clones by pipetting the cells up and down gently and transferring the entire content of each well into a separate well of a 24 well plate containing 0 3 0
54. ed transferred transported and disposed of according to all local state provincial and or national regulations IMPORTANT Radioactive or biohazardous materials may require special handling and disposal limitations may apply Freedom CHO S Kit User Guide Biological hazard safety WARNING BIOHAZARD Biological samples such as tissues body fluids infectious agents and blood of humans and other animals have the potential to transmit infectious diseases All work should be conducted in properly equipped facilities using the appropriate safety equipment for example physical containment devices Safety equipment also may include items for personal protection such as gloves coats gowns shoe covers boots respirators face shields safety glasses or goggles Individuals should be trained according to applicable regulatory and company institution requirements before working with potentially biohazardous materials Follow all applicable local state provincial and or national regulations The following references provide general guidelines when handling biological samples in laboratory environment U S Department of Health and Human Services Biosafety in Microbiological and Biomedical Laboratories BMBL 5th Edition HHS Publication No CDC 21 1112 Revised December 2009 found at www cdc gov biosafety publications bmb15 BMBL pdf World Health Organization Laboratory Biosafety Manual 3rd Edition WHO CDS CSR LYO 2004
55. eded plates should be incubated undisturbed for at least 12 days Improper medium used Prepare Cloning Medium as described on page 39 CD FortiCHO Medium supplemented with 6 mM L glutamine No additional supplements are required Freedom CHO S Kit User Guide 53 Appendix B Quick reference protocols Introduction 54 The following pages contain one page quick reference protocols for transfecting CHO S Cells for stable protein expression using either the FreeStyle MAX Reagent page 55 or the Neon Transfection System page 56 and detailed workflow diagrams for Phase I and Phase II of the two phase selection scheme to generate a pool of stably transfected cells pages 57 58 Each quick reference protocol consists of an outline of the necessary steps and space for notes that you can then transfer to your laboratory notebook The quick reference protocols and the workflow diagrams are intended for experienced users only These protocols and workflow diagrams provide summary instructions for transfecting CHO S Cells and selecting stably transfected cells they do not provide detailed instructions to successfully perform the steps necessary for expressing your protein of interest Detailed protocols for transfecting CHO S Cells using the FreeStyle MAX Reagent are found on page 23 and using the Neon Transfection System on page 27 Detailed instructions for the two phase selection scheme are found on p
56. ell culture suspension and fresh complete medium needed to seed each new shaker flask by dilution Seed the culture at a density of 2 0 x 10 viable cells mL if a subculture step is scheduled for 2 days Seed the culture at a density of 1 0 x 105 viable cells mL if a subculture step is scheduled for 3 days 3 Transfer the calculated volume of pre warmed complete CD FortiCHO Medium into a sterile 125 mL Erlenmeyer shaker flask 4 Transfer the calculated volume of cell suspension into the pre warmed complete CD FortiCHO Medium to give a final cell density of 1 x 10 or 2 x 10 viable cells mL depending on the subculture schedule Be careful to avoid transferring any cell clumps that may be present in the culture 5 Incubate the flasks in a 37 C incubator with 70 80 humidified atmosphere of 8 CO in air on an orbital shaker platform rotating at 130 150 rpm 6 Repeat Steps 1 5 as necessary to maintain or expand cells It is normal to see a small cell ring form on the wall of the flask and or cell clumps of lt 1 mm at the bottom of the flask see image on the right Make sure not to transfer this or any cell clumps into the next passage flask You may use a cell strainer to remove cell clumps however do not use Anti Clumping Agent prior to transfection Note Avoid transferring cell clumps during passaging this will minimize the likelihood of future clumping e Do not allow CHO S Cells CGMP banked to reach a cel
57. esired number of monoclones Alternatively proceed with cloning at 1 cell well with the intent of subsequently subcloning top producing clones To achieve the highest cloning efficiency in LDC with CD FortiCHO Medium supplement only with 6 mM L glutamine Supplementation with conditioned TM media or Anti Clumping Agent is not necessary for LDC with CHO S cells Note Do not use media containing 8 mM L glutamine for LDC Depending on how many clones you wish to screen before scale up you may increase the number of LDC plates according to your anticipated cloning efficiency The number of clones obtained from a 96 well plate varies depending on the experiment For greatest clone diversity we recommend seeding multiple stable pools for LDC For example if 30 40 plates are desired seed 10 20 plates per pool if cloning from 2 3 pools and screen an equivalent number of clones per pool Because the two phase selection scheme described above will generate up to 4 stable pools per transfection there should be multiple pools from which to choose for LDC Due to the amount of dilution required to perform LDC and the inherent differences between stable pools cloning efficiency varies from experiment to experiment and from pool to pool One advantage of cloning from multiple pools is that it averages out the overall pool to pool cloning efficiency IMPORTANT When using stable pool cell trains for LDC be sure to include selective pressure du
58. estriction enzyme sites Simian virus 40 SV40 polyadenylation signal Allows efficient high Level expression of your recombinant protein Entry points for gene insertion behind the CMV EF1 promoter see page 18 for sequencing primers used for analyzing CMV EF1 promoter gene of interest junction Allows efficient transcription termination and polyadenylation of mRNA Sfi restriction enzyme sites Allows for removal of the CMV EF1 expression cassette when using vector for single subunit expression Dihydrofolate reductase DHFR gene Allows selection of transfected CHO S cells using methotrexate MTX Kaufman et al 1985 Puromycin resistance gene pac Puromycin N acetyl transferase pMB1 origin of replication Allows selection of transfected CHO S cells using Puromycin de la Luna amp Ortin 1992 Lacalle et al 1989 Vara et al 1985 Allows high copy number replication and growth in col Lin Chao et al 1992 Yanisch Perron et al 1985 Kanamycin resistance gene ap aminoglycoside phosphotransferase also known as kanamycin kinase type Allows selection of transformants in E coli Oka et al 1981 Vakulenko et al 1987 Freedom CHO S Kit User Guide 61 TM Unique restriction The Freedom pCHO 1 0 vector contains the following unique restriction enzyme recognition EnZyme recognition sites
59. flask 2 add Puromycin to a final concentration of 20 pg mL and MTX to 200 nM 20P 200M IMPORTANT Puromycin can form a white powder at the bottom of the tube at thaw Ensure that the drug is in solution by inverting the tube several times before opening 6 Incubate T flasks at 37 C 70 80 relative humidity and 5 8 CO in a static incubator non shaking 7 Sample flasks on day 7 post selection for a viable cell count only This will serve as a reference data point if selection is occurring you can expect a drop in viability and cell density relative to day 0 of selection If viability is gt 30 proceed directly to step 10 Otherwise return the flask to incubator and proceed to step 8 8 Sample flasks on day 10 or 11 post selection for a viable cell count Note If cell viability is still below the 7 day measured value perform a complete media exchange by centrifuging the cells and resuspending them in fresh selection medium adding Puromycin and MTX to maintain the selection pressure Reduce the volume and T flask size as needed to keep the viable cell density above 3 x 10 viable cells mL Freedom CHO S Kit User Guide 33 10 11 12 13 14 15 34 Note If viability has increased since day 7 perform a complete media exchange as described and transfer cells to shake flask as described in step 10 While it is typical that cells are gt 30 viable when this transition occurs for best results the
60. ful selection Anti Clumping Agent must be included in the selection medium at a 1 100 dilution Medium containing Anti Clumping Agent can be prepared in advance by adding 10 mL of Anti Clumping Agent per liter of complete medium or by adding to each flask 100 uL of Anti Clumping Agent for every 10 mL of culture medium Development work with this kit used 10 50 pg mL of Puromycin and 100 1 000 nM of MTX However because different transfected cells may exhibit different drug sensitivities we recommend that you generate pools as described in the Experimental Flowchart on page 14 with multiple concentrations of Puromycin MTX to ensure that you find the optimal conditions for your protein s Freedom CHO S Kit User Guide 13 Methods Experimental flowchart for protein expression Introduction 14 The diagram on the following page schematically depicts the steps necessary to express your one or two subunit protein s of interest using the Freedom CHO S Kit and it shows our recommended experimental path from stable transfectants to clone scale up TM Note The times shown for various experimental steps are approximations and the actual times depend on your protein s of interest and the specific workflow you choose Note For a two subunit protein create two expression plasmids each containing the subunits in a different order SU1 SU2 or SU2 SU1 Transfect CHO S Cells cGMP banked with each plasmid in parallel at least th
61. g the Freedom CHO S workflow from thaw to tertiary screen in a single medium lot we recommend that you pre order or reserve at least 25 L now See page 63 for ordering information CD FortiCHO Medium is e developed for the growth of Chinese Hamster Ovary CHO cells and expression of recombinant proteins in suspension culture e made with animal origin free chemically defined components and contains no proteins hydrolysates or components of unknown composition e formulated without L glutamine for flexibility of use and to avoid ammonia accumulation however it should be supplemented as required e formulated to minimize potential lactic acid accumulation under typical culture conditions e Note Additional glucose supplementation may be required for terminal batch cultures as determined empirically or by using our suggested simple glucose fed batch protocol on page 36 Freedom CHO S Kit User Guide Prepare complete CD FortiCHO Medium Growth characteristics of CHO S Cells cGMP banked in CD FortiCHO Medium CD FortiCHO Medium requires supplementation with L glutamine Aseptically add L glutamine to a final concentration of 8 mM to the medium before use Note We recommend that you do not use thawed L glutamine or medium supplemented with L glutamine beyond one month See page 59 for all CD FortiCHO Medium formulations used in this kit IMPORTANT 8 mM L glutamine is used for all steps in thi
62. hly recommend that you have the nucleotide sequences optimized not only for codon usage but also for cryptic splice sites RNA secondary structure killer motifs etc GeneArt GeneOptimizer software has given us the most consistent success from molecule to molecule and is a service available from our website www thermofisher com lifescience You can assess the results of gene optimization of your gene s of interest prior to any financial commitments The Freedom CHO S Kit contains the Freedom pCHO 1 0 vector Refer to page 60 for map and the features of the vector Using the instructions in this manual you will e For two subunits create two expression plasmids by cloning two separate PCR products corresponding to each of the two subunits SU1 and SU2 SU subunit of your protein s of choice separately into Freedom pCHO 1 0 vector Because protein expression may depend on the order of the different subunits of your protein s of interest clone SU1 and SU2 in two different combinations using the following insertion sites to optimize protein expression A First insertion site AvrII BstZ171 blunt Second insertion site EcoRV blunt Pacl We recommend testing each linearized expression plasmid in parallel in transient transfection to determine which orientation gives the best protein expression before proceeding with stable pool generation e For single subunit proteins create a single expression plasmid using the T
63. hood of generating the highest producing stable pools before initiating limiting dilution cloning Note that the same transfection protocol is used whether you are expressing one or two subunits Note For a one page quick reference protocol intended to be printed and used in the laboratory see page 55 IMPORTANT Anti Clumping Agent will interfere with FreeStyle MAX transfection We have specifically not included Anti Clumping Agent in any cell passage steps prior to transfection for this reason If you choose to use Anti Clumping Agent in your passage medium be sure to remove it at least 2 passages prior to transfection with the FreeStyle MAX Reagent 1 At 24 hours before transfection pass CHO S Cells CGMP banked at 5 x 10 to 6 x 10 viable cells mL in complete CD FortiCHO Medium Place the flask s on an orbital shaker platform rotating at 130 150 rpm at 37 C 8 CO 2 On the day of transfection perform a viable cell count To ensure optimal transfection results viability of cells must be over 95 Note Cell clumping reduces transfection efficiency If cell clumping is observed in the passage flask on the day of transfection we recommend using a cell strainer such as the BD Biosciences 40 um nylon mesh cell strainer BD Biosciences Cat no 352340 to obtain a uniform single cell suspension Determine the cell count and viability after using the cell strainer 3 For each transfection or control seed a new 125
64. ignal and SU1 SU1 upstream of SU2 mammalian secretion signal and SU2 Freedom pCHO 1 0 mammalian secretion signal and SU2 MTX SU2 upstream of SU1 mammalian secretion signal and SU1 Puromycin Freedom pCHO 1 0 mammalian secretion signal and single SU single SU Freedom CHO S Kit User Guide 17 Sequence We strongly recommend that you analyze your recombinant expression plasmid s recombinant by sequencing the promoter gene of interest junctions before transfecting CHO S Cells CGMP banked and expressing your protein s of interest For your expression i l id convenience the sequences of the primers used for analyzing the promoter gene of prasmes interest junctions in the recombinant expression plasmid s are provided below Note The sequencing primers are not supplied as part of the Freedom CHO S Kit they need to be ordered separately and custom synthesized Primer Primer sequence Location Comments AB For 5 GTCTGAGCCTCCTTGTCTTO 3 begins 270 bp upstream of forward primer for EF2 CMV AvnV BstZ17l insertion site hybrid promoter ORF begins 90 bp downstream reverse primer for EF2 CMV AB Rev 5 AGAAGACACGGGAGACTTAG 3 of Avrll BstZ17l insertion site hybrid promoter ORF s 4 begins 285 bp upstream of forward primer for CMV EF1 N e ADDERE EcoRV Pacl insertion site hybrid promoter ORF EP Rev 5 GAGGCAGCCGGATCATAATC 3 begins 250 bp downstream reverse primer for CMV EF1
65. isolating plasmid DNA using an endotoxin free or a low endotoxin kit such as the PureLink HiPure Plasmid Midiprep DNA Kit see page 64 We have found that the easiest and most efficient way to avoid organic solvents and salts that interfere with transfection is to use the plasmid in the restriction digest mix without any further processing Prior to using the Freedom CHO S Kit to transfect CHO S Cells cGMP banked with your Freedom pCHO 1 0 construct you may linearize the plasmids Linearizing your vectors may not improve transfection efficiency but it does increase the chance that the vectors will integrate into the host cell genome without disrupting the gene s of interest or other elements required for expression in mammalian cells Follow the guidelines below to linearize your plasmids e We suggest using Nru I which cuts once in the kanamycin resistance gene on the plasmid Other unique restriction sites are possible See page 62 for a list of unique sites and non cutting restriction enzymes Be sure that your inserts do not contain the restriction enzyme site you use to linearize the vector Note If an appropriate linearization site is not present you may transfect the circular plasmid e After digestion purification of the plasmid DNA is not required If purification is desired be careful to ensure complete removal of all organic solvents and salts Freedom pCHO 1 0 may precipitate during mixing with the FreeStyle MAX due
66. l density above 2 x 10 cells mL transfection to avoid a decrease of transfection efficiency e Aminimum of 5 passages under 2 x 10 cells mL is recommended before proceeding with transfection e After 25 passages thaw a new vial of cells To maintain sufficient stocks of low passage cells i e under 25 passages be sure to freeze aliquots of CHO S cells in liquid nitrogen vapor phase Freeze CHO S Cells and make a research cell bank RCB 20 Freedom CHO S Kit User Guide Introduction You may freeze CHO S Cells CGMP banked directly in complete CD FortiCHO Medium with 10 DMSO We recommend that you freeze the cells at a density of 2 x 10 viable cells mL at least 3 passages post thaw and that you make a research cell bank of at least 20 vials from the vial of CHO S cells provided in the kit Guidelines for preparing freezing medium and to freeze cells are provided in this section These protocols can also be used to freeze cells throughout the cell line development workflow Required materials Complete CD FortiCHO Medium See page 11 e Tissue culture grade DMSO e Reagents and equipment to determine viable and total cell counts e Sterile labeled cryovials e Sterile 15 mL or 50 mL conical tubes e Automated or manual controlled rate freezing apparatus Prepare freezing Prepare freezing medium immediately before use medium 1 Ina sterile conical centrifuge tube mix together the following reagents for e
67. l lines when working with CHO S Cells cGMP banked handle them as potentially biohazardous material under at least Biosafety Level 1 containment Note that the CHO S Cells CGMP banked are provided in freezing medium containing DMSO and the components of the product may be absorbed into the body through the skin In case of contact with eyes rinse immediately with plenty of water and seek medical advice Always wear suitable protective clothing and gloves when handling CHO S Cells CGMP banked Freedom CHO S Kit User Guide 9 CD FortiCHO Medium Introduction AN Features of CD FortiCHO Medium 10 CD FortiCHO Medium is a chemically defined animal origin free AOF serum free medium for high density suspension culture of untransfected or transfected TM CHO S Cells The medium contains no human or animal origin components IMPORTANT Do not use CD FortiCHO Medium containing either MTX and or Puromycin to propagate untransfected CHO S Cells CGMP banked Parental CHO S cells are sensitive to both Puromycin and MTX in the concentrations used below for selection Only cells that have both increased DHFR enzyme and an active puromycin resistance gene such as cells that have been transfected with Freedom pCHO 1 0 vector can be propagated in CD FortiCHO Medium MTX and or Puromycin Parental CHO S cells however can be propagated in CD FortiCHO Medium supplemented with L glutamine If completin
68. lar application under the above patents LIMITED USE LABEL LICENSE No 432 CHO Freedom Related Products Notice to Purchaser An additional license is required to use the clones derived from the Kits to produce products for use in humans For information on obtaining additional rights please contact outlicensing alifetech com TRADEMARKS All trademarks are the property of Thermo Fisher Scientific and its subsidiaries unless otherwise specified BD is a registered trademark of Becton Dickinson and Company 2015 Thermo Fisher Scientific Inc All rights reserved Freedom CHO S Kit User Guide Contents About His guide sec Pac edidere eun conce ad tu ue s duc cats wax KA a ee Ee usus cor ado wack RR an c od Crus duis ous 5 Revision A ISTO SI SR EEN 5 Product intormatIO i s SERE ERAS ERA GN OSSE RE SA Eg RE LR AGE Ge AG EA EE GN DA ee ie 6 Product descripUOM ciun EE EE SE nee ee ee ee ee 6 Kit coritents and storage NG se Deswegen Se Ge GR GE Go ER OS Ge GR GEE TENE 6 Materials required but not included issie EE ek Ge GE ee ee ee EE ee ee ee EE 7 Description OF the di AO N EE 7 CHO S Cells EGMP banked se ee oec eed 9 CD FortiCHO S TT EE OE OE EO OE OE OE OE OE OE OIE NE 10 FreeStyle MAX Reagent and OptiPRO SEM ees ee ee ee Ee ee ee ee 12 Selection reagens SEEN AG Ge ER Ge UR WR ke a SE SR Be RR ERROR GE GR M KR RE GR ERN ge dE 12 Methods IE EES ARE GESE ESEG AE N GO
69. late to a 125 mL flask takes 2 3 weeks depending on the growth rate of each clone Assess the protein production of each clone using your method of choice see below or refer to Protein production page 36 and carry forward the top producing clones to the next stage in the scale up process We have observed that clones that are 210 confluent on day 17 or 18 post seeding in 96 well plates will readily scale up However clones lt 10 confluent should also be scaled up because they can potentially score as high protein producers If desired clones lt 10 confluent can be allowed to grow for an additional 3 5 days and re screened for protein production We have had success scaling clones from 96 well plates to 24 well plates to 6 well plates followed by an assessment of clone productivity after 2 passages in 6 well plates This is sufficient for the vast majority of clones to be gt 90 viable before the secondary screen For the secondary screen we suggest seeding all clones at 3 x 10 viable cells mL in a 3 mL volume in 6 well plates and assessing protein productivity at day 5 post seeding After assessing productivity we recommend counting and scaling up the top 30 clones from 6 well plates to shake flasks At this stage do not let the clones grow more than 4 days without passaging to prevent their health from becoming compromised For best results in secondary screen we recommend that the second 6 well plate passage as well as the s
70. lculations cccccccceeeeeeeeeeeeeeeeeeeeeaseeeeenaaeeeeeee 56 PRES Ezio ib o 57 Phase 2 seleetln EE EE eR en eR ea E EDDIE OER NP CER EIE E 58 AppendpeE REM M DIL 59 Media formulations sisi 59 PO DONG D eec mE ES 60 Map and features of Freedom pCHO 1 0 vector eeeeeeeeeeeeenenenene nnne 60 Appendix E ME EE OE N E dox v coru N RE N o 63 Accessory pDFOQUEIS oss EE Ee ED GE Ge ee GE E UA 63 Appendix RE EO OO EO OE N EE RR NA 65 Sale ASA EE AE AG DA rM 65 Chemical Sal ety RR 66 Biological bazard safely so ded d oe orca pu dS rone da ecu OR a AR aaae saan 67 Documentation and support loui occu tod eco ou eI e unas een Re Ee eie Pp ecol RM ke ee US 68 Customer and technical support iese see Ee eene nennen nenne nnn nnn nnn nnns 68 Limited product warranty sseeesseeeeeeeee nennen nennen nnn nnne nnn nnn nnns nnn nn nnn nnn nnn 68 lg dle Rt MEE 69 4 Freedom CHO S Kit User Guide Revision history About this guide Revision Date Description AO July 2015 Addition of Dynamis fed batch guidance plus minor revisions 3 0 2013 Addition of Quick Reference protocols plus minor revisions 20 2012 Addition of Neon protocol plus minor revisions 1 0 2011 New manual Freedom CHO S Kit User Guide Product description Freedom CHO S Product information The Gibco Freedom CHO S Kit Cat no A13696 01 co developed by Thermo
71. mL flask with 1x 10 viable cells mL in 30 mL of pre warmed complete CD FortiCHO Medium Place the flask in shaker until ready to transfect TM Note Do not centrifuge cells prior to transfection because centrifugation decreases transfection efficiency TM 4 Gently invert the tube of FreeStyle MAX Reagent several times to mix Do not vortex 5 Using a vessel large enough for proper mixing of the final transfection mixture e g 50 mL conical centrifuge tube add 50 ug of plasmid DNA to a final volume of 1 5 mL of OptiPRO SFM and mix gently Note While the volume of DNA added is not critical we typically use DNA that is 1 pg pL after linearization with Nrul for transfection which equates to adding 50 uL of DNA to 1 45 mL of OptiPRO SFM 6 Add 50 uL of FreeStyle MAX Reagent into 1 45 mL of OptiPRO SFM for a 1 5 mL final volume and mix gently Note Do not vortex FreeStyle MAX stock solution or the FreeStyle MAX reagent diluted in OptiPRO SFM Freedom CHO S Kit User Guide 25 26 IMPORTANT It is critical that step 7 below is followed exactly as described in the protocol to achieve the maximum transfection efficiency Read the remaining steps of the transfection procedure carefully before performing them exactly as described 7 10 11 TM Immediately add the diluted FreeStyle MAX Reagent solution to the diluted DNA solution by first immersing the tip and expelling the solution slowly whil
72. nd Mg For accuracy recount the cells prior to centrifugation in the second PBS wash TM Note During the wash steps prepare the Neon system and Neon Tube see page 29 Resuspend the cell pellet in an appropriate volume of Resuspension Buffer R included with Neon Kits to a final density of 5 0 x 10 cells mL based on the cell count performed in step 3 For example if 4 0 x 10 viable cells remain after the wash in step 3 then you will need to resuspend the cells in 0 8 mL of Resuspension Buffer R to achieve the desired 5 0 x 10 viable cells mL Freedom CHO S Kit User Guide AN Neon transfection procedure IMPORTANT Because the cells in Resuspension Buffer R need to be transfected within 10 minutes of resuspension we recommend only resuspending enough cells for 6 repeats at a time If more than 6 repeats are desired we suggest centrifuging the total desired number of cells in the first PBS wash step but only performing the second PBS wash and step 4 using a maximum of 5 0 x 10 viable cells at a time Prepare two T 75 flasks for each plasmid to be transfected by filling the flask s with 10 mL of complete CD FortiCHO Medium without antibiotics place flask s in a humidified incubator set at 37 C and 8 CO while the cells are being prepared for transfection Fill the Neon Tube with 3 mL of Electrolytic Buffer E2 TM TM Note Change the Neon Tube after ten uses Use a new Neon Tube for each new
73. ock O 5uL mL 1uL mL assessment 58 Freedom CHO S Kit User Guide Appendix C Media formulations Introduction The table below lists the various media formulations required for the development of stable cell lines for protein production using the Freedom CHO S Kit All the media formulations use CD FortiCHO Medium as the basal medium Note We do not recommend using L glutamine or medium supplemented with L glutamine beyond one month Final concentration Additional Medium Basal medium Anti Clumping L glutamine supplements Agent Complete medium 8 mM Selection medium 8 mM 1 100 dilution Puromycin MTX Cloning medium 6 mM Clone growth CD FortiCHO d ik Mediurh 8 mM 1 100 dilution Clone productivity 1 100 1 100 mediumt PM dilution 7 Freezing medium 8 mM optional 10 DMSO TM Used for thawing and passaging parental CHO S cells Used for clone scale up t Used for assessing clone productivity inclusion of lower concentrations of Anti Clumping Agent may be desired for protein purification Inclusion of higher concentrations of Anti Clumping Agent however may improve the productivity of some clones Freedom CHO S Kit User Guide 59 Appendix D Map and features of Freedom pCHO 1 0 vector Map The map below shows the elements of the Freedom pCHO 1 0 vector See page 61for detailed descriptions of the elements of the Freedom pCHO 1 0 vector
74. of EcoRV Pacl insertion site hybrid promoter ORF Recommendation The methods for transfection into mammalian cells and the selection process for the Freedom CHO S Kit are the same whether you are expressing 1 or 2 subunits See page 14 for an overview Thaw and subculture CHO S Cells CGMP banked Follow the protocol below to thaw CHO S Cells CGMP banked The cells are supplied in a vial that contains 1 mL of cells at 1 x 10 viable cells mL in 90 complete CD CHO Medium and 10 DMSO Thaw the cells directly into complete CD FortiCHO Medium supplemented with 8 mM L glutamine No separate adaptation is required Introduction TM For information on making a research cell bank in CD FortiCHO Medium refer to Freeze CHO S Cells and make a research cell bank RCB page 20 All solutions and equipment that come in contact with the cells must be sterile Always use proper aseptic technique and work in a biosafety cabinet Prepare complete CD FortiCHO Medium e Supplement CD FortiCHO Medium with L glutamine to a final concentration of 8 mM before use See pages 10 and 59 e Addition of antibiotics is not recommended e CD FortiCHO Medium is light sensitive For optimal results store medium at 2 C 8 C protected from light 18 Freedom CHO S Kit User Guide Required materials You need the following reagents and materials before beginning Shaking speed Thawing procedure Determine cell
75. or support visit thermofisher com techresources or email techsupportfdlifetech com thermofisher com lifescience ThermoFisher SCIENTIFIC 20 July 2015
76. protective clothing gloves and eye and face protection when working with MTX Refer to the product SDS for complete precautions Note MTX powder is insoluble in neutral pH aqueous solutions and the below protocol ensures complete solubilization before its addition to PBS This volume of MTX is sufficient for both phases of selection We recommend performing selection using a single lot of MTX stock solution 1 Dissolve 10 mg MTX in 100 150 uL of 1 M NaOH Immediately proceed to step 2 as soon as MTX is completely dissolved as prolonged exposure to high pH inactivates MTX 2 Bring the volume up to 22 mL using PBS The pH of this solution should be 10 11 3 Filter sterilize the solution through a 0 22 um filter 4 Store the MTX stock solution in 100 uL 1 mL aliquots at 20 C e To prepare selection medium use complete CD FortiCHO Medium supplemented with Anti Clumping Agent at a 1 100 dilution and only add the required concentration of Puromycin MTX fresh each time see page 59 Do not store media containing Puromycin MTX e Alternatively Puromycin MTX can be added to each selection flask at each step of selection e Cells will divide once or twice in the presence of lethal doses of Puromycin so the effects of the drug take several days to become apparent Complete selection can take 3 7 weeks of growth in selective medium depending on your transfection drug stocks and protein s of interest Note For a success
77. quired but not included Unless otherwise indicated all materials are available on our website www thermofisher com lifescience e Methotrexate MTX available from Sigma Aldrich as methotrexate hydrate Cat no A6770 or M8407 e Disposables for molecular biology and cell culture polypropylene conical centrifuge tubes microcentrifuge tubes T flasks shaker flasks e Cell strainer such as BD Biosciences 40 um nylon mesh cell strainer BD Biosciences Cat no 352340 e Static and shaking incubators with humidity and CO e Biosafety cabinet i e laminar flow hood for all cell manipulations Description of the system Components of the Freedom CHO S Kit Freedom pCHO 1 0 vector AN e CHO S Cells cGMP banked cGMP banked CHO derived cells adapted to high density serum free suspension culture in chemically defined medium that are capable of producing high levels of secreted recombinant protein See page 9 for more information e Freedom pCHO 1 0 vector A plasmid for cloning ORFs containing a mammalian secretion signal and up to two subunits of your protein s of interest See page 60 for the map and features of the vector e CD FortiCHO Medium Chemically defined animal origin free serum free medium formulated for growth of CHO S Cells CGMP banked and for expression of the recombinant protein s of interest See page 10 for more information e FreeStyle MAX Reagent A proprietary
78. r Guide 6 Feed CD EfficientFeed C AGT Supplement Plus as follows EFC Culture day concentration B4 IE qas qe 39 38 1X 10 10 10 10 2X 5 5 5 5 Using the above protocol viability can be readily maintained above 50 through day 17 or longer if your protein of interest s quantity or quality does not degrade with extended incubation Additional feeding schedules may also need to be tested to find the optimal feed process for your lead clone s but the above protocol provides a starting point for measuring feed responsiveness Clone feed screening will also generate material for Spent Media Analysis analytical service and other media optimization and process development services available through Gibco Bioprocess Services Freedom CHO S Kit User Guide 49 Troubleshooting Appendix A In addition to a few common problems highlighted below the most commonly asked questions regarding the Freedom CHO S Kit have been compiled for reference into the Freedom CHO S FAQ eBook http www life technologies uberflip com i 330570 Thawing CHO S The table below lists some potential problems and possible solutions that may help Cells cGMP you troubleshoot your cell culture experiment banked Observation Possible cause Recommended action No viable cells after thawing original vial Cells not stored correctly Order new cell stock and store in liqui
79. ring pool passage Note In our experience we achieve 20 45 cloning efficiency using the conditions as described in the next section Freedom CHO S Kit User Guide Prepare cloning medium Setup plate The procedure described below using one 50 mL conical tube is sufficient to seed approximately 200 wells For greater numbers of wells or plates increase the number of prepared 50 mL conical tubes accordingly Note Because of the dilutions that occur during limiting dilution cloning there is no need to eliminate Anti Clumping Agent in the passages prior to cloning 1 Thaw L glutamine to be used in preparation of CD FortiCHO Medium based cloning medium Note Cloning medium is CD FortiCHO Medium supplemented with 6 mM L glutamine 2 For each 100 mL of cloning medium required aseptically mix the following 97 mL of basal CD FortiCHO Medium 3 mL of freshly thawed 200 mM L glutamine 3 For each every 2 x 96 well plate required add 40 mL of cloning medium to a 50 mL centrifuge tube 4 Pre warm the medium at 37 C 1 Label a sufficient number of 96 well plates for your procedure we recommend Falcon 96 well plates Cat no 353072 2 Optional Add 200 uL well of sterile PBS to all peripheral wells to avoid evaporation during incubation as shown in the figure below Alternatively peripheral wells can be used for LDC and evaporation can be minimized by setting the incubator humidity to 9576 6900000000000
80. rough transient transfection to identify the optimal gene orientation For a single subunit protein clone your gene of interest behind the first promoter For information on cloning each subunit TM of your protein of interest into the Freedom pCHO 1 0 vector refer to page 16 For TM a map and features of the Freedom pCHO 1 0 vector see page 60 Freedom CHO S Kit User Guide Clone your genels of interest into Freedom pCHO 1 0 Transfection 1 day Transfect 22x CHO S CGMP banked cells Selection Phase 1 begins 2 days post transfection lasts 2 3 weeks Selection Phase 1 20P 200M Selection Phase 1 10P 100M Selection Selection Phase 2 Selection Phase 2 Selection Phase 2 Selection Phase 2 Phase 2 30P 500M 50P 1000M 30P 500M 50P 1000M 1 3 weeks Legend Assessing P ug mL Puromycin productivity T M nM MTX 5 14 days Assess productivity of pools choose 1 3 pools for clone isolation Limiting Dilution Cloning Clone isolation by limiting dilution cloning 17 18 days 30 40 96 well plates 1st screen identify 2100 clones Clone screening 4 5 weeks 2nd screen identify top 30 clones 3rd screen identify top 10 clones Freedom CHO S Kit User Guide 15 Create expression plasmids for the Freedom CHO S Kit Gene optimization Clone into Freedom pCHO 1 0 16 Prior to cloning your gene s of interest into the Freedom pCHO 1 0 vector we hig
81. rpm The speed range is provided here for your convenience Optional After 24 hours in culture sample to determine the cell density and viability using the protocol described below Once the culture reaches 1 x 109 2 x 10 viable cells mL typically 2 3 days post thaw expand the culture using the subculturing protocol see page 20 Follow the procedure below to determine the viable and total cell counts 1 Transfer a small aliquot of the cell suspension into a microcentrifuge tube Be careful to avoid any cell clumps that may be present in the culture 2 Determine cell viability and cell density using your method of choice Freedom CHO S Kit User Guide 19 Subculture cells Passage CHO S Cells CGMP banked every 2 3 days into fresh medium When passaging the cells use disposable sterile polycarbonate 125 mL Erlenmeyer shaker flasks with vented caps and pre warmed complete CD FortiCHO Medium for instructions on preparing complete CD FortiCHO Medium see page 59 We have used a 125 mL shaker flask for 15 40 mL of suspension culture If larger volumes and or cell numbers are required increase the number of 125 ml Erlenmeyer shaker flasks you seed or increase your shaker flask size to allow for increased culture volume 1 Determine the viable and total cell counts taking caution to avoid any cell clumps that may be present in the culture 2 Using the cell density determined in step 1 calculate the volume of c
82. s manual except limiting dilution cloning which requires 6 mM L glutamine See page 37 for more details IMPORTANT Anti Clumping Agent will interfere with FreeStyle MAX transfection Do not use CD FortiCHO Medium containing Anti Clumping Agent during or for the two passages prior to transfection For MTX Puromycin selection aseptically add drugs fresh to CD FortiCHO Medium Do not store drug containing CD FortiCHO Medium See page 31 for details on selection Store complete CD FortiCHO Medium at 2 C 8 C protected from light Typically CHO S Cells CcGMP banked cultured in CD FortiCHO Medium have a doubling time in the range of 17 20 hours however doubling time can exceed 20 hours during the first few passages after the cells have been thawed Do not allow CHO S Cells CGMP banked to reach a cell density above 2 x 10 cells mL before transfection because this may cause a decrease in transfection efficiency TM Note Individual culturing and passaging techniques of CHO S Cells cGMP banked cells may result in experimental variation Freedom CHO S Kit User Guide 11 FreeStyle MAX Reagent and OptiPRO SFM FreeStyle MAX Reagent OptiPRO SFM FreeStyle MAX Reagent is a proprietary animal origin free formulation for the highly efficient transfection of plasmid DNA into eukaryotic cells FreeStyle MAX Reagent is specifically formulated to achieve the highest transfection efficien
83. the last dilution tube 5 and adjusting the volume accordingly in step 2 of Plate cells page 41 For example pipette 8 uL of the cell suspension into 12 wells of a well plate 96 uL total volume Allow the cells to settle before examining them under the microscope no staining is required Counting is facilitated by maintaining the 8 pL as a droplet in each well If the cells in tube 5 are at 1 000 cells mL then psk will count 96 cells 1 10 1 10 1 2 77 E Eur Seca Ed ET EU Suspen EP suspension 9mLof Sim of 177 mL of medium medium medium 2 77 x 10 2 77 x 104 2 77 x 10 1 000 viable cells mL viable cells mL viable cells mL viable cells mL Example of serial dilution scheme of cells with initial count of 2 77 x 10 viable cells mL 40 Freedom CHO S Kit User Guide Plate cells Place the warmed cloning medium page 39 in the biosafety cabinet Pipette the necessary volume from Tube 5 1 000 cells mL into each tube containing 40 mL of cloning medium This brings the final cell density to 5 cells per mL allowing a seeding density of 1 cell per well when 200 uL of diluted cells is added into each well see page 40 Note If a different seeding density is desired or if manual counting determines that the cells are not at 1 000 cells mL step 6 on page 40 adjust the volume transferred from tube 5 For example if manual counting gave 72 cells in 96 uL of total volume then cells in tube 5 are at 72 96 x 1000
84. tice the general safety guidelines for chemical usage storage and waste provided below and consult the relevant SDS for specific precautions and instructions Read and understand the Safety Data Sheets SDSs provided by the chemical manufacturer before you store handle or work with any chemicals or hazardous materials To obtain SDSs see the Documentation and support section in this document Minimize contact with chemicals Wear appropriate personal protective equipment when handling chemicals for example safety glasses gloves or protective clothing Minimize the inhalation of chemicals Do not leave chemical containers open Use only with adequate ventilation for example fume hood Check regularly for chemical leaks or spills If a leak or spill occurs follow the manufacturer s cleanup procedures as recommended in the SDS Handle chemical wastes in a fume hood Ensure use of primary and secondary waste containers A primary waste container holds the immediate waste A secondary container contains spills or leaks from the primary container Both containers must be compatible with the waste material and meet federal state and local requirements for container storage After emptying a waste container seal it with the cap provided Characterize by analysis if necessary the waste generated by the particular applications reagents and substrates used in your laboratory Ensure that the waste is stor
85. tional glycoproteins Sheeley et al 1997 Werner et al 1998 Freedom pCHO 1 0 is a single vector containing strong promoter elements designed to ensure high expression levels of one or two subunits A single medium CD FortiCHO Medium is used for the entire stable cell line development process cell passage transfection selection and limiting dilution cloning with easy transition into Dynamis production medium for production which eliminates the need for any adaptation of cells into other media TM FreeStyle MAX Reagent offers high transfection efficiency of suspension CHO cells with low cytotoxicity FreeStyle MAX Reagent OptiPRO SFM and CD FortiCHO Medium are AOF animal origin free and serum free Robust streamlined cell line development process with step by step instructions We have also created an interactive FAQ eBook to supplement the Freedom CHO S Kit User Guide to highlight critical steps and milestones We highly recommend that you become familiar with both this User Guide and the eBook http life technologies uberflip com i 330570 prior to initiating the workflow Freedom CHO S Kit User Guide CHO S Cells CGMP banked Characteristics of CHO S Cells CGMP banked Parental cell line TM The CHO S cell line is a stable aneuploid cell line established from the ovary of an adult Chinese hamster Puck et al 1958 The CHO S cells CGMP banked are e prepared from low p
86. to carry over of organic solvents or salts and DNA precipitation decreases transfection efficiency Freedom CHO S Kit User Guide 23 Required materials Optimal transfection conditions using the FreeStyle MAX Reagent General guidelines for transfection using the FreeStyle MAX Reagent 24 CHO S cells cultured in complete CD FortiCHO Medium at 1 x 10 viable cells mL Linearized Freedom pCHO 1 0 plasmid DNA containing the subunit s of your protein s of interest see page 23 FreeStyle MAX Reagent supplied with the kit store at 4 C until use OptiPRO SFM supplied with the kit pre warmed to room temperature Disposable sterile 125 mL polycarbonate Erlenmeyer flasks Orbital shaker in 37 C incubator with a humidified atmosphere of 8 CO Reagents and equipment to determine viable and total cell counts e g Trypan Blue hemacytometer or an automated cell counter TM Transfect suspension CHO S cells in 30 mL with the recommended optimized conditions Final transfection volume 30 mL Number of cells to transfect total of 3 x 10 viable cells cell density at time of transfection should be 1 x 10 viable cells mL IMPORTANT It is best to use CHO S cells that have been passaged at least 5 times without cell densities exceeding 2 x 10 viable cells mL Amount of each plasmid DNA 50 ug regardless of whether the plasmid has been engineered to express 1 or 2 subunits FreeStyle MAX
87. transfected and proceed directly to Select stable transfectants for protein expression page 31 Freedom CHO S Kit User Guide Select stable transfectants for protein expression Introduction Workflow Required materials Puromycin and MTX To obtain cell lines that produce high levels of your protein s a two phase selection scheme generates up to 4 pools of stably transfected cells in which the linearized Freedom pCHO 1 0 has integrated into the host cell genome Perform the selection using complete CD FortiCHO Medium containing a combination of Puromycin and MTX Note that only cells that have been transfected with the Freedom pCHO 1 0 construct can be propagated in CD FortiCHO Medium containing Puromycin and MTX because untransfected CHO S Cells cGMP banked lack pac activity and only have basal DHFR activity The following flowchart depicts the major steps of the two phase selection scheme to generate a pool of stably transfected cells The two phase selection scheme takes approximately 3 7 weeks to complete Stably transfected CHO S cells Selection Phase 1 20P 200M Selection Phase 1 10P 100M VCD 21 x 105 V 285 VCD 21 x 105 V 285 Selection Phase 2 50P 1000M V 290 Selection Phase 2 30P 500M Selection Phase 2 50P 1000M V 290 Selection Phase 2 30P 500M Legend P pg mL Puromycin P d to stable pool t M nMMTX
88. ve seen better signal to noise ratio and cell growth when using shaking 6 well plates Note Fast growing clones may starve during the 5 day incubation period which is why we recommend supplementing the medium with additional glucose For example if you are working with a 45 sterile glucose solution and need 300 mL of fresh medium add 2 mL glucose to 300 mL of Clone Growth Medium before using to seed cells in 6 well plates On day 5 post seeding a Determine the titer within each well using your protein assay of choice b Count and passage the desired number of top producing clones into 125 mL shaker flasks in 15 30 mL of Clone Growth Medium Once the clones are expanded to 125 mL shaker flasks incubate the cells at 37 C and 8 CO with shaking at 130 150 rpm and passage every 2 3 days For best results use the rpm speed that was used during stable pool selection As soon as there are sufficient cells freeze down a mini RCB of each top producing clone Freedom CHO S Kit User Guide 45 46 8 Perform a tertiary screen with the top producing clones in 125 mL shaker flasks We recommend using a 14 day simple fed batch in Clone Growth Medium i Sample cultures daily or at regular intervals e g on days 0 3 5 7 10 12 and 14 to determine the cell density viability and productivity until culture viability drops below 50 or day 14 of culture is reached ii Feed with glucose after sampling as follows e Day 3 add
89. very 1 mL of freezing medium needed Complete CD FortiCHO Medium 0 9 mL DMSO 0 1 mL Note We recommend preparing extra freezing medium to compensate for losses during pipetting 2 Place the tube on ice or store at 2 8 C until use Discard any remaining freezing medium after use Freedom CHO S Kit User Guide 21 Freeze cells 22 The following protocol describes how to prepare 1 mL of 1 x 107 cells per cryovial Plan ahead to ensure that you have sufficient cells for the desired number of vials 1 Grow the desired quantity of CHO S Cells in shaker flasks harvesting when the cells are in mid log phase of growth with a viability gt 90 Typically the cells will be at 41 5 x 105 3 x 10 cells mL on day of freezing Note Cells should be passaged at least 3 times after thaw before freezing Transfer the cells to a sterile conical centrifuge tube Determine the viable and total cell counts see page 19 and calculate the volume of the cell suspension and the freezing medium required to yield a final cell density of 1 x 10 viable cells mL Centrifuge the cells at 100 200 x g for 5 10 minutes at room temperature and carefully aspirate the medium Resuspend the cells in the pre determined volume of chilled freezing medium 90 complete CD FortiCHO Medium and 10 DMSO see above Place the cryovials in a microcentrifuge rack and aliquot 1 mL of the cell suspension into each cryovial Freeze the cells in an automated
90. w lists some potential problems and possible solutions that may help you troubleshoot your protein expression levels Observation Possible cause Recommended action No or low protein detected in the supernatant after transient or stable transfection Gene of interest does not contain Kozak translation initiation sequence Add a Kozak consensus site to the forward PCR primer resynthesize your gene s of interest Premature stop codons Improper or ineffective secretion signal Genes not optimized Remove stop codons by your method of choice Replace secretion signal Use endogenous secretion signal if possible Have your genes optimized not only for CHO codons but also for cryptic splice sites RNA secondary structure killer motifs etc We highly recommend GeneArt GeneOptimizer Process for Multi parameter Gene Optimization Clone selection The table below lists some potential problems and possible solutions that may help you troubleshoot your clone selection experiments Observation Possible cause Recommended action Very few or no single cell clones obtained after cloning Error in cell counting and dilution during limiting dilution cloning e Follow procedures exactly as outlined in Cell counting and dilution page 40 e Dilute cells no more than 1 10 with a very small amount s1mL of cell suspension Plates moved too soon after seeding the cells Se

Freedom CHO-S Kit User Guide

Contents

Download Pdf Manuals

Related Search

Related Contents