Biology 3210 - U of L Personal Web Sites
Contents
1. Protocol Week 1 Plant DNA Isolation 1 Weigh out 0 3 g of plant tissue The mass may vary depending on the type of sample being 8x Micropipettor sets w sterile tips 2 0 mL mcts sterile 8x mct racks Tube pestles 2x Analytical balance small weigh boats 8x small spatulas 1x Microcentrifuge RT 1x Microcentrofuge 4 C 1x Water bath or heat block 65 C 5x Floating racks discard if using heat block Razor blades clean Glass slides 2x Vortex 5x Sharpies extra fine 5x ice buckets large UV spectrophotometer w microcell Mortar amp pestles prepared consult with the lab instructor as needed 2 Ona clean glass slide finely chop up the sample using a razor blade 3 Transfer the sample to a 2 0 mL mct and grind the sample into a paste for wet material or a fine powder dry material using a tube pestle 4 Add 300 pL EBA 900 pL EBB and 100 pL 20 w v SDS 5 Vortex the sample until it is thoroughly mixed and incubate at 65 C for 10 min 6 Transfer the tube to ice add 410 uL of cold 5 0 M potassium acetate mix by inversion and incubate on ice for 3 min 7 Centrifuge for 15 min at 13 200 rpm 15 300 g Use of a refrigerated centrifuge 4 C can increase the yield of DNA but is not necessary for our purposes 8 Transfer 1 0 mL of the supernatant to a new 2 0 mL mct add 540 uL if ice cold isopropanol and incubate on ice for 20 min 20 Fall 2015 9 Centrifuge for2. typically antibiotic or herbicide resistance genes in the process of creating the GMO Attitudes towards the use of GMOs differ significantly both at an individual level and a national level This has led to consumer calls for better labelling of foodstuffs made from GMOs and bitter trade disputes between countries over the export and import of genetically modified crops most notably between the US and the European Union The need for testing of products for the presence of genetically modified material has increased as a result The objective of this exercise will be to test corn foodstuffs commonly available for evidence of genetic modification DNA will be extracted from processed foods and subjected to the polymerase chain reaction PCR using Cry1Ab specific primers designed to amplify a 184 bp region of the Cry1Ab gene Primers for the CaMV 35S promoter and Nos terminator DNA sequences commonly introduced in GMOs as a result of genetic engineering will also be used 199 and 127 bp respectively Due to the potential difficulty in extracting DNA from processed foods PCR will also be carried out using a set of primers specific to a region of the corn invertase gene 226 bp 19 Biology 3210 Equipment amp Supplies Week 1 Corn foodstuffs student supplied EBA buffer EBB buffer 20 SDS 5 M potassium acetate ice cold 3 M sodium acetate pH 5 2 ice cold Isopropanol ice cold 70 ethanol ice cold TE buffer
3. 10 min at 10 200 rpm 9 600 g 10 Discard the supernatant and wash the pellet with 500 uL of ice cold 70 ethanol Remove as much of the ethanol as possible before proceeding To accomplish this pour off as much of the ethanol as possible and then pulse the tube in the centrifuge to force any remaining ethanol to the bottom of the tube Remove the remaining liquid with a micropipettor 10 100 uL usually works best but be careful not to disturb the DNA pellet 11 Resuspend the DNA pellet in 600 uL of TE buffer and then add 60 pL 3 M sodium acetate pH 5 2 and 360 uL cold ice cold isopropanol Incubate on ice for 20 min Pellet the DNA by centrifugation see step 9 and remove as much as the liquid as possible Note If you are running out of time to complete the DNA isolation you may store your preparation in isopropanol at 20 C until the next laboratory period 12 Repeat step 10 amp 11 at least once preferably twice if time permits 13 Wash the DNA pellet as described in step 10 and leave the mct open allowing the pellet to air dry for 10 15 min 14 Resuspend the final pellet in 50 pL TE buffer DNA preparations can be stored at 4 C short term or 20 C long term Quantification amp Qualification of Isolated DNA Time permitting use the UV spectrophotometer with the microcell to quantify determine a concentration and qualify determine the purity of your isolated DNA Be sure to have read Appendix D prior
4. 37 C BstAPI Concentration 5 000 U mL Heat Inactivation 20 min 80 C Storage 20 C Recognition Site 5 GCANNNNNTGC 3 3 CGTNNNNNACG 5 Activity in NEBuffers NEBuffer 1 1 50 NEBuffer 2 2 100 NEBuffer 3 1 25 CutSmart Buffer 100 Reaction Conditions 1X CutSmart Buffer e 50 mM potassium acetate e 20 mM Tris acetate e 10 mM magnesium acetate e 100 pg mL BSA pH7 9 25 C Incubate at 60 C EcoRI HF Concentration 20 000 U mL Heat Inactivation 20 min 65 C Storage 20 C Recognition Site 5 GAATTC 3 3 CTTAAG 5 Activity in NEBuffers NEBuffer 1 1 10 NEBuffer 2 2 100 NEBuffer 3 1 10 CutSmart Buffer 100 Reaction Conditions 1X CutSmart Buffer e 50 mM potassium acetate e 20 mM Tris acetate e 10mM magnesium acetate e 100 pg mL BSA e pH7 9 25 C Incubate at 37 C Hincll Concentration 10 000 U mL Heat Inactivation 20 min 65 C Storage 20 C Recognition Site 5 GTYRAC 3 3 CARYTG 5 Activity in NEBuffers NEBuffer 1 1 25 NEBuffer 2 2 100 NEBuffer 3 1 100 CutSmart Buffer 100 Reaction Conditions 1X NEBuffer 3 1 e 100 mM NaCl e 50 mM Tris HCl e 10mM MgCl e 100 pg mL BSA e pH7 9 25 C Incubate at 37 C Biology 3210 Over Expression of a Fusion Protein Background Obtaining significant amounts of a specific gene product is often required to elucidate the structure and better understand the f
5. Be sure to read the specific guidelines given for each individual lab report 27 Biology 3210 Appendix C Agarose Gel Electrophoresis Agarose a linear polymer composed of alternating residues of D and L galactose joined by a 1 3 and B 1 4 glycosidic linkages These residues form chains of helical fibres that then aggregate into supercoiled structures with a radius of 20 30 nm When gelled a meshwork of channels with 50 200 nm diameter channels is formed Note that commercial preparations of agarose are not homogenous They may contain salts proteins or other polysaccharides for the recovery of DNA it may be necessary to use special purified grades of agarose Factors Determining Rate of Migration of DNA Through Agarose Size of DNA double stranded DNA dsDNA migrates at a rate inversely proportional to the logio of molecular weight Big particles move more slowly as they have more drag and cannot move as readily through agarose channels Concentration of agarose the higher the concentration the slower the migration Concentration of agarose will also affect separation and can be used to enhance separation of different sized fragments of DNA For instance the lower the concentration of agarose the better the separation of larger sized DNA fragments A table can be found at the following link to help you make your decision http www promega com resources articles pubhub enotes what percentage agarose is needed
6. ENN ze To 0 1941 therefore mass of DNA comprising 9 416 Kb band 0 1941 X 0 25 ug 0 049 ug 31 Biology 3210 Since the intensity of the unknown band was equivalent to the 9 416 Kb we know that we have approximately 0 049 ug of DNA present in our unknown band Having loaded 5 uL of our solution it is a simple calculation to determine the concentration of DNA in our original solution f t 0 049 3 concentration pime loaded 5p 98X10 ug uL or 9 8 ng pL References Sambrook J and Russell D W 2001 Molecular Cloning A Laboratory Manual Third Edition Cold Spring Harbor Laboratory Press Cold Spring Harbor Ultrospec 211 pro UV Visible Sprectrophotometer User Manual Biochrom 32
7. find it extremely valuable to load the single digests on the same gel as the double digests preferably flanking their respective double digest Keep this in mind when planning your experimental approach particularly if you are generating double digests by sequential reactions Unused portions of your single or double digests may be stored at 20 C to be re run on later gels if needed Hints e plan ahead Appendix C is good place for background information e make use of your lab book e ensure all tubes are clearly labelled e you may not need to perform all possible combinations of digests to generate the restriction map but certain specific combinations may be required analyze your data and plan ahead e you may have to infer the presence of small DNA fragments as they will be difficult to visualize e discuss your results with each other and your instructor modifications to various aspects of the protocol may be carried out for a variety of reasons Fall 2015 Restriction Enzyme Product Information as supplied by NEB Aval Concentration 10 000 U mL Heat Inactivation 20 min 80 C Storage 20 C Recognition Site 5 CYCGRG 3 3 GRGCY SC 5 Activity in NEBuffers NEBuffer 1 1 10 NEBuffer 2 2 100 NEBuffer 3 1 25 CutSmart Buffer 100 Reaction Conditions 1X CutSmart Buffer e 50 mM potassium acetate e 20 mM Tris acetate e 10 mM magnesium acetate e 100 pg mL BSA e pH7 9 25 C Incubate at
8. for approximately 40 min Do not let the dye front run off the edge of the gel Stain your gels in the ethidium bromide bath with gentle shaking for 10 min disregard this step if the ethidium bromide was added when the gel was cast Caution Ethidium bromide is a mutagen and suspected carcinogen gloves must be worn at all times when working with ethidium bromide Destain the gel as needed and examine your gels on the UV transilluminator Digital photographs will be made available Caution UV light is damaging to the naked eye and exposed skin Always ensure the transilluminator shield is in place or cover bare skin and view through safety glasses that absorb harmful wavelengths A standard curve for each gel should be generated to accurately determine the sizes of the DNA fragments present Fall 2015 Appendix A Preparation of a Lab Book Your lab book provides you with a detailed record of your experiments performed This record proves invaluable when preparing manuscripts for publication or more immediately when preparing lab reports This lab book as with all of the reports and proposals is an individual effort Choice of Lab Book Standard black lab books can be purchased from the book store but these are not required for this course The only required features are 1 Pages are non removable no spiral bindings 2 All pages must be numbered in the top outer corner gt page numbers may be hand written on EVERY page in IN
9. from 20 C storage only to obtain the volume needed and returned to 20 C as quickly as possible The storage buffer contains 50 glycerol making the solution viscous and care should be taken when pipetting Note 2 Ensure all stock reagents are completely thawed prior to starting Once thawed they should be kept on ice and the entire process of setting up the Master Mix should also be carried out on ice 3 Ensure the Master Mix is mixed well and aliquot 19 uL to each of your 0 2 mL PCR tubes with your DNA sample Mix by pipetting and be sure to use a fresh tip each time 22 Fall 2015 Table 2 Working table to determine the volumes of stock reagents needed per a 20 uL PCR 3 column and the volumes of common reagents to be used to make up the Master Mix 5 column Reagents should be added in the same order as listed below and checked off once added to the Master Mix Stock Reagent Reaction Volume req d of rxns Master Mix Concentration per reaction 10 Optima H O GC Buffer 5x 1x dNTPs 8 mM 200 uM Forward Primer 20 UM 0 5 pM Reverse Primer 20 UM 0 5 pM Phusion 2 U L 0 4U DNA Template 1 0 uL Total Volume 20 0 uL Phusion is the NEB trade name for a recombinant thermostable DNA polymerase It has been shown to have increased fidelity increased reaction rate i e shorter elongation times and better success with difficult DNA templates as compared to sta
10. from previous week 8x Column collection tubes 10 mL Lysis Buffer 1 5 mL MCTs sterile 10 mL Wash Buffer 4x MCT racks 10 mL Elution Buffer 4x Micropipettors all sizes w sterile tips 1x Wave Shaker 1x Tape 1x Centrifugre w rotor for MCTs 3x Microcentrifuges RT 4x Sharpies extra fine Protocol Preparation of Cell Lysate l Obtain and completely thaw your cell pellets this will take approximately 10 15 minutes at room temperature Resuspend the pellet in 800 uL of Lysis Buffer 8 M urea 100 mM NaH gt PO 10 mM Tris Cl pH 8 0 and transfer the suspension to a 1 5 mL MCT Ensure that no visible cell clumps are visible before proceeding Incubate the cells for 1 hour at room temperature on the platform shaker Pellet the cellular debris by centrifugation of the lysate at 10 000 g for 30 min at 4 C Transfer the cleared lysate supernatant to anew 1 5 mL MCT Label and save the debris pellet Purification of the Fusion Protein 5 10 Equilibrate the Ni NTA spin column by adding 600 uL of Lysis Buffer and centrifuging at 700 g for 2 minutes Load 600 uL of the cleared lysate to the equilibrated column and centrifuge at 700 g for 2 minutes The centrifugation time may have to be increased for more viscous lysates up to 4 minutes Note The His tagged protein binds to the Ni NTA in the column and is retained Exceeding 700 g will result in lowered protein yields as the lysate will flow too quickly through the co
11. to starting this procedure Your instructor will help you with the operation of the UV spectrophotometer when you are ready The equipment and supplies needed to carry out this procedure will also be made available for the next 2 weeks 21 Biology 3210 Equipment amp Supplies Week 2 Student DNA samples previous week 8x Micropipettor sets w sterile tips PCR Stock Reagents 8x mct racks e 1mL Optima H20 aliquots 1 5 mL mcts e Primers 20 uM 0 2 mL PCR tubes w small racks CrylAb accatcaacagccgctacaacgacc 2X Microcentrifuge RT CrylAs tggggaacaggctcacgatgtccag 8x Sharpies extra fine IvrlA ccgctgtatcacaaggsctggtacc ee aes _ oa a UV spectrophotometer w microcell Camv2 gtgggattgtgcgtcatccc Nos A gaatcctgttgccgestcttgcg Nos D gcgggactctaatcataaaaaccc e dNTPs 8 mM e Phusion w 5x GC buffer TE buffer blank Protocol Week 2 Polymerase Chain Reaction Setup 1 Transfer 1 0 UL of each DNA preparation into separate 0 2 mL PCR tubes and place them on ice 2 Set up the PCRs as outlined in Table 2 It is a common practice to set up a Master Mix containing the reagents common to all the reactions which can then be aliquoted out when setting up the individual reactions This practice increases accuracy as pipetting of very small volumes is error prone and ensures consistency between all reactions Note 1 As with any enzyme the DNA polymerase Phusion should be removed
12. A fragment size of any bands present Protocol Weeks 2 amp 3 The remaining two laboratory periods are to be used to set up the appropriate digests and run the necessary gels to obtain the data required to generate the restriction map of the unknown plasmid You are responsible for the planning and execution of the lab work needed You have been given more than sufficient resources plasmid DNA buffers enzymes etc to successfully complete this exercise However errors in planning or poor technique may result in you running out of these resources Should this happen you will be provided the opportunity to purchase additional resources Double Digests by Sequential Reactions In order to obtain the data needed you will need to set up a series of double digests This can be accomplished by sequentially digesting your DNA sample with different restriction enzymes changing the reaction conditions as required for the second enzyme This method is particularly useful when using two restriction enzymes that have incompatible reaction conditions typically due to differences in the reaction buffers or incubation temperatures Carrying out sequential digests usually requires additional time and effort but this is virtually eliminated in this exercise because you have the single digests from Week 1 However failure to properly adjust the reaction buffer for the second enzyme may result in inefficient digestion or worse complete failure See
13. D DNA Quantification and Qualification eseseseeeeesesesseeesseesresressessresrersersrerreessresserererreessee 31 Date Sept 09 10 Sept 16 17 Sept 23 24 Sept 30 Oct 01 Oct 07 08 Oct 14 15 Oct 21 22 Oct 28 30 Nov 04 05 Nov 11 12 Nov 18 19 Nov 25 26 Dec 02 03 Dec 09 10 Fall 2015 Laboratory Schedule Laboratory Exercise No Labs Introduction S E M Training meet in AWESB Restriction Mapping of an Unknown Plasmid begin Restriction Mapping of an Unknown Plasmid con t Restriction Mapping of an Unknown Plasmid complete amp Over Expression Purification SDS PAGE amp Transfer Western Blotting amp Intro to GMO Detection No Labs Remembrance Day Detection of Genetically Modified Maize begin Detection of Genetically Modified Maize con t Detection of Genetically Modified Maize complete No Labs Complete Biology 3210 Grade Composition The laboratory is worth 40 of your final grade Your laboratory grade is broken down as follows Lab Book see Appendix A 10 e collected at random throughout the semester Assignments and Lab Reports e Assignment Restriction Mapping 5 due Oct 21 22 e Assignment SEM 5 due TBA e Lab Report Western Blotting all inclusive 15 due Nov 18 20 see Appendix B e Assignment GMO Detection 5 due Dec 9 10 Note Concepts and techniques covered in lab will also be subject to examination in the course final exam Penalti
14. K In General gt all entries must be made in blue or black ink gt date EVERY entry gt never remove a page or use white out e if an entry needs to be deleted strike out the entry with a single straight line the deleted entry must be readable gt keep up to date a lab book is meant to be filled out as the experiments are carried out and NOT after the fact gt record anything that may be useful to you when preparing your lab reports gt leave plenty of space throughout the lab book to add comments after the fact Table of Contents Designate the first 2 pages as the Table of Contents gt record information and pages numbers as you go Lab Entries For each lab session be sure to include the following 1 Objective e state the purpose of the work you are about to carry out e keep it brief no more than a sentence or two 2 Method Summary e do not rewrite the protocol from the lab manual e highlight any specific changes to the lab protocol e include times and dates for when work was performed 25 Biology 3210 e record product names and manufacturers used enzymes chemicals equipment micropipettors baths e include incubation conditions for cultures and reactions 3 Observations amp Results e record any observations this goes beyond number results e include diagrams gel pictures and any other form of raw data e include calculations as appropriate 4 Conclusions e did you achieve your objective Why or why not
15. University of Lethbridge Biology 3210 SII SVE Experimental Methods in Tat NS Molecular and Cellular Biology Laboratory Manual Fall 2015 Quintin J Steynen eee nt of Biological Sci University of L oe nes a ethbr o AB 20 Biology 3210 Table of Contents Laboratory SChe dle sais iericdisasendec show cavasatereranstvnadesevenleuavatercateeeeateasevaddasanenouasbanavalunsnecensmecedategeedaesysauersneaeloes 3 Grade Composition snis evened sadaaisecd sa gh deta E a E E R AEE EAS ari 4 SI TANARA EIE EEE EAA E EEA EE E paves ETE E T AE E E 5 SEANA ETS EE AE E E E T A E AT 8 Restriction Mapping of an Unknown Plasmid eee ceesscessecessceceencecesneececeececeecseececsceecseeeeeneeeesaeeeeees 1 Oye EX pression ofa Fusion Protein isenesi renne nn e ana EE E Taa aaa 6 Purification of Over Expressed Fusion Proteins cssccsccsssssccesnccssscesesscesssccssssseessacesenaccessacessnacsesnsess 9 Western Blotting anacainnt 12 Detection of Genetically Modified Mai 262 sss Gas iscsscen suey hevesedsateaghas saonsiicenavogous Sevetuasaiwecbeneeldentonaas eanicedehs 19 Appendix A Preparation of a Lab BOOK sess joss caesensadey docs sa nsnciates jess taeedavnaees datancuosceande idea Goes tenes sebeateniees 25 Appendix B Lab Report G id lih S sesisrssici rres ans ge iei aE EEn S ea 27 Appendix C Agarose Gel Electrophoresis ssssseesseessessesssetesstessttssesseesssersseeesseesseesseeeseeesssserreesseet 28 Appendix
16. age Fixation which prevents the difussion is only required if the gels will not be immediately used Remove the gel from the stain and rinse excess stain away with water Place the gel into the destain and return to the orbital shaker Blue bands of stained protein should be weakly visible within 15 30 min on a light box but complete destaining typically requires several hours or even overnight The gels themselves will be saved for analysis next week gels can be stored for weeks in destain with no degradation in quality Digital images will also be provided 15 Biology 3210 Supplies and Equipment Week 1 con t SDS PAGE gels from previous week Power Supply 25 V capable Transfer Buffer 4x disposal plastic containers i e Ziploc 48 mM Tris 39 mM Glycine 20 MetOH 1x Semi Dry electrophoretic transfer cell Ponceau S Stain 3x Nitrocellulose sheets 0 5 Ponceau S 5 Acetic acid 10x Whatman filter paper Blocking Buffer Latex gloves all sizes 2 milk powder 0 15 Tween 20 in TBS 4x Sharpies extra fine d H2O 10 mL 3x Scissors 3x glass test tubes 3x forceps flat Protocol Week 1 con t Transfer to Nitrocellulose blotting Gloves must be worn when handling the nitrocellulose membrane to prevent its contamination with proteins from your fingers 16 1 2 Transfer the fixed gel to 25 mL of transfer buffer for at least 15 minutes with gentle agitation Repeat step 1 in 25 mL of fresh transfe
17. and placed on paper toweling to dry SPILLS e Spill of SOLUTION CHEMICAL While wearing gloves wipe up the spill using paper towels and a sponge as indicated by the lab instructor Spill of ACID BASE TOXIN Contact instructor immediately DO NOT TOUCH e BACTERIA SPILLS If necessary remove any contaminated clothing Prevent anyone from going near the spill Cover the spill with 10 bleach and leave for 10 minutes before wiping up Discard paper towels in biohazard bag Discard contaminated broken glass in designated biohazard sharps container DISPOSAL e Broken glass microscope slides coverslips and Pasteur pipets are placed in the upright white broken glass cardboard boxes NO PAPER CHEMICAL BIOLOGICAL OR BACTERIAL WASTE MATERIALS should be placed in this container e Petri plates microfuge tubes pipet tips should be placed in the orange biohazard bags The material in this bag will be autoclaved prior to disposal e Bacterial cultures in tubes or flasks should be placed in marked trays for autoclaving e Liquid chemicals should be disposed of as indicated by the instructor DO NOT dispose of residual solution in the regent bottles In case of any uncertainty in disposal please consult the lab instructor e Slides of bacteria should be placed in the trays filled with 10 bleach that are located at the ends of the laboratory benches HEALTH CONCERNS Students who have allergies are pregnant or who may have othe
18. ated commonly utilizing SDS PAGE and b transferred to a membrane support c The unoccupied sites on the membrane are blocked using an non antigenic protein before d detection with the 1 and 2 antibodies Antibodies that specifically recognize and bind to the protein of interest are used to probe the membrane in order to detect the target protein However antibodies being proteins themselves will bind non specifically to any unoccupied sites on the membrane which would result in complete failure to detect the protein of interest To prevent this from occurring the unoccupied sites on the membrane must be blocked with a non antigenic protein BSA is commonly used prior to detection of the target protein Figure 3c Detection is usually performed in two steps where the membrane is first incubated with antibodies specific for target protein primary antibody followed by an incubation with a secondary antibody which recognizes the primary The secondary antibody is used for the actual visualization of the target protein as it is usually linked to a reporter enzyme Figure 3d 12 Supplies and Equipment Week 1 Purification fractions from previous week Induced cell pellets from 2 weeks prior Prestained molecular weight marker Low molecular weight marker 2x Reducing Sample Buffer RSB SDS PAGE Running Buffer 3 L 15 resolving gel premix 5 stacking gel premix APS 100 mg mL Temed 95 EtOH Coomassie stain Coomassie
19. destain Protocol Week 1 Casting the SDS PAGE Resolving Gel Fall 2015 3x PAGE electrophoresis apparatus 6 gels Power Supply 200 V Heat Block 95 C 4x Micropipettor set w tips Gel loading tips 1 5 mL MCTs 8x MCT racks 4x disposal plastic containers i e Ziploc Latex gloves all sizes 4x Sharpies extra fine Scintillation vials Pasteur pipets w bulbs Filter paper 5 sheets Scissors Orbital platform shaker White light box 1 Assemble the SDS PAGE casting apparatus as shown by your instructor 2 In a scintillation vial or small beaker add 5 uL TEMED and 50 uL of 100 mg mL ammonium persulfate APS to 10 mL of the resolving gel premix and mix by swirling The volume is sufficient for 2 gels Caution Gloves must be worn at all times when working with unpolymerized acrylamide as it is a neurotoxin Using a Pasteur pipet dispense the mixture between the glass plates by placing the tip of the pipet to one side and allowing the solution to run down the edge of the spacer Fill the space between the plates until the level of the solution is approximately 5 mm below where the teeth of the comb will sit when inserted determine this level prior to mixing the resolving gel Note Work quickly as you do not want the gel to polymerize while yo are still casting it Use a Pasteur pipet to overlay the top of the resolving with 95 ethanol a couple of mm above the top of the gel is sufficient The ethanol
20. e hooks provided stowed in the cupboards beneath the countertops or placed along a side designated by your instructor Take only the absolute essentials needed to complete the exercise with you to your laboratory bench e g Manual pen or pencil e Mouth pipetting is NOT permitted pipet pumps are provided and must be used e Always wash your hands prior to leaving the laboratory e Students are not allowed access to the central Biology Stores area for any reason Consult your instructor if you require additional supplies e Report any equipment problems to instructor immediately Do NOT attempt to fix any of the equipment that malfunctions during the course of the lab e Use caution when handling chemical solutions Consult the lab instructor for instruction regarding the Biology 3210 clean up of corrosive or toxic chemicals e Contain and wipe up any spills immediately and notify your lab instructor see SPILLS below Heed any special instructions outlined in the lab manual those given by the instructor or those written on reagent bottles e Long hair must be restrained to prevernt it from being caught in equipments Bunsen burners chemicals etc e Dispose of broken glass microscopes slides coverslips and glass pipets in the specially marked white and blue boxes There will be NO disposal of glassware in the wastepaper baskets e You are responsible for leaving your lab bench clean and tidy Glassware must be thoroughly rinsed
21. e use your results to support your conclusions e if you created a new strain or DNA construct you should provide it with a name and a description Supply List You may find it helpful to reserve the last page or two of the lab book to be used as a supply list for materials utilized throughout the experiments This can be particularly useful for bacterial strains DNA and enzymes utilized Listing details such as the supplier growth conditions concentrations etc can save you a lot of time searching for this information at a later date 26 Fall 2015 Appendix B Lab Report Guidelines These are meant as general guidelines to aid you in the writing of your lab reports specific guidelines for each topic may also be given out to further guide your work If you wish to do well on your lab reports you are STRONGLY encouraged to make use of the Science Toolkit Format the reports must be typed double spaced size 12 Times New Roman font with 1 margins on 8 5 x 11 paper Any report failing to meet these guidelines will not be graded Title Page should include your name and student ID number the date your instructor s name the lab section including semester and year and last but not least a concise yet descriptive title Please do not include your name on any other page within the report Introduction must include the objective hypothesis of the lab and sufficient background information introducing the reader to the s
22. es for Late Assignments Any assignments or lab reports handed in late will be subject to the following penalties Past specified due time but on the same calender day 10 1 calender day late 25 2 calender days late 50 3 or more calender days late 100 Lab books need to be present during all laboratory sessions If your lab book is not present for one of the random collections you will lose any marks assigned to that particular collection Missed Laboratories Given the nature of the laboratory work make up labs will not be offered Single absences will be permissible without documentation Additional inexcusable absences will result in a failing lab grade Determination of excusable absences is at the discretion of the laboratory instructor Academic Offenses All students are expected to have read the Student Discipline Policy of the current academic Calendar pg 73 75 and should understand what constitutes an academic offense as well as the penalties associated with committing an academic offense There is a zero tolerance policy for academic offenses committed within the Biology 3210 labs Protect your academic integrity do not share your assignments or lab reports particularly in an electronic form Having your work copied and submitted by another can result in penalties for all parties involved including the original author of the work Fall 2015 Safety Students enrolled in laboratories in the Biological Sciences should be awa
23. for specific enzymes and can generate DNA fragments with blunt or overhanging ends Figure 1 5 CYCGRG 3 5 CCGCTC 3 3 GRGCY C 5 3 GGCGAG 5 Figure 1 Recognition sequences and cleavage sites arrows for Aval left and BsrBI right Notice that cleavage by Aval will create overhanging ends while BsrBI will create blunt DNA ends The objective of this exercise is to generate a restriction map of an unknown plasmid through a series of single and double restriction enzyme digests Agarose gel electrophoresis will be used to analyze the DNA fragments produced from these digests in order to map the relative positions of the restriction sites of the unknown plasmid Equipment amp Supplies Student Freezer Box x5 0 5 mL mcts sterile e 100 uL Unknown Plasmid 5x mct racks e 10 pL Aval 2x Microcentrifuge e 10 uL BstAPI 5x Floating racks 10 pL EcoRI HF 1x Water bath 37 C 10 pL HinclI 5x Gel rigs w 12 well combs e 100 pL CutSmart Buffer 10x ne supplies t ee poe Graduated cylinders 5x 50 mL 10mLd H20 5x 100 mL flasks Agarose 1x Analytical balance w small weigh boats 1x TBE l 2x small spatulas Ethidium bromide bath 5 pg mL 1x Microwave w oven mitt Destain bath Parafilm Loading dye Scissors Distilled water carboy 5x Sharpies extra fine Ice 4x large ice buckets UV transilluminator in C770 4x Micropipettors w tips 0 5 10 uL 10 100 uL Biology 3210 Protocol Week 1 1 Use Table 1 to
24. g the Samples Please read the following carefully as you will be treating your induced cell pellets from the over expression lab 0 30 60 90 amp o n differently than the various fractions collected utilizing the batch purification performed last week Flow Through Wash amp Elute The induced cell pellets will be solely analyzed by SDS PAGE whereas the purified fractions will be analyzed by Western Blotting of which SDS PAGE is only the first step 14 As a result these two sets of samples must be loaded to different gels Induced Cell Pellets To each of your induced cell pellets add 50 uL of 2x reducing sample buffer RSB Note Do not resuspend your cell pellet in the RSB simply add the RSB to the top of the cell pellet Purified Fractions Prepare these samples by mixing 5 uL of each fraction with 5 uL d H O and 10 uL of 2x RSB ina 1 5 mL MCT Incubate both sets of samples at 95 C for 10 min Briefly allow the samples to cool and then centrifuge them at 13 000 rpm for 30 sec Using a micropipettor with a gel loading tip load 15 pL from each sample to the gel previously prepared You will need to coordinate with other groups to ensure that each of the samples is loaded Note 1 Remember to load all the induced cell pellet samples and the purified fraction samples to separate gels 5 Fall 2015 Note 2 For gels with the induced cell pellet samples use the low molecular weight marker as a protein sta
25. hased as commercial preparations For an example please see http www neb com nebecomm products productn3200 asp Size Determination In order to determine sizes of unknown fragments we can make use of the relationship between distance migrated from the wells and logio of molecular weight By plotting logio of the nucleotide pairs vs distance migrated in cm mm even pixels of our known for example lambda cut with HindIII 2 log DNA Ladder etc we find that we end up with a curve that is linear for most of the relationship beyond 1 5 cm migrated To simplify you can use semi log graph paper where the y axis is logarithmic and the x axis is linear this can also be carried out using Excel Consequently by measuring the distance that the unknown migrates we can use the standard curve to determine size Any time you are using agarose gels to view an unknown sample of DNA you should plan to plot a standard curve to allow accurate size determination 29 Biology 3210 An online exercise in plotting a curve is found at the following link Take a look and use this information for construction of your own standard curves http www digitalwebb com Downloads LabBench leaming molecular standcur html Additional References in addition to the links above a good reference for the theory of agarose and agarose gel electrophoresis is found in Sambrook J and Russell D W 2001 Molecular Cloning A Laboratory Manual Third Edition Co
26. he ligand bound to an immobile matrix b The column is then washed to remove the impurities c The bound protein is then eluted by use of a solution that either 1 decreased the protein ligand binding affinity or 2 contains an a compound which competes with the protein for the ligand not shown An important consideration is that there may be no known ligands for a specific protein or there is no method to immobilize any known ligands without altering their binding affinity In scenarios such as these one can add or tag the binding affinity for a specific ligand to a protein using techniques in recombinant DNA technology One commonly used tag is the His Tag six histidine residues in a row which have a strong affinity for Ni ions A variety of immobile matrices are available in which Ni ions have been bound to serve as affinity chromatography resins Today you will isolating and purifying the His tagged protein that was previously over expressed from pRNB Ec Rather than performing full scale column chromatography the fusion protein will be 9 Biology 3210 purified using a small spin column in which the protein will be bound washed and eluted directly using a microcentrifuge This method is commonly used for small scale purifications as it is rapid and eliminates the need for specialized liquid chromatography equipment Supplies and Equipment E coli BL21 DE3 frozen cells pellets 4x Ni NTA spin columns student samples
27. itor The choice of ligand varies depending on the nature of the specific protein to be isolated For example if you were interested in isolating enzymes that modified nucleic acids you might use nucleic acids or Mg a common cofactor for this class of enzyme as a ligand The ligand must also be able to be bound to an immobile support matrix in such a manner that does not affect its binding affinity for the desired protein To isolate a protein in this manner a solution containing the desired protein is added to a column containing the immobilized ligand The desired protein binds to the ligand and is itself immobilized within the column Any unbound impurities can then be washed through the column leaving the desired protein behind To elute the protein the conditions within the column are changed so that the protein ligand binding affinity is lowered e g changes in pH or ionic strength resulting in the disassociation of the protein from the ligand The protein can then flow through the column and be collected Alternatively a compound with a higher binding affinity for the ligand e g a competitive inhibitor can be added to the column to elute the protein Figure 3 desired protein npurities g wash g eit 2 a matrix ligand Figure 2 Overview of the steps involved in purification using affinity chromatography a An initial mixture of the desired protein and various impurities is loaded to a column containing t
28. ld Spring Harbor Laboratory Press Cold Spring Harbor 30 Fall 2015 Appendix D DNA Quantification and Qualification Using UV Spectrophotometry At a wavelength of 260 nm nucleic acids DNA or RNA may be quantified based on the fact that an OD optical density of 1 corresponds to a concentration of approximately 50 pg mL for dsDNA and approximately 40 pg mL for ssDNA and RNA For single stranded oligonucleotides an OD of 1 corresponds to approximately 33 pg mL Spectrophotometric assessment is also used to evaluate purity or quality of nucleic acid preparations For this a ratio of the OD260 0D280 is used At 280 nm aromatic amino acids absorb strongly Absorbance values between 1 8 and 2 0 indicate that a preparation of DNA is relatively pure For RNA a value of greater than 2 0 is desirable Anything below this value may suggest contamination with guanidinium thiocyanate found in for instance the commercial solution Trizol Values lower than 1 8 indicate contamination with phenol or with proteins Readings at 230 nm close to the maximum absorbance of peptide bonds and of Tris EDTA and other buffer salts may also be performed to indicate purity of a preparation Unfortunately although spectrophotometric quantification is fast it cannot distinguish between RNA and DNA and larger concentrations at least 1 g mL are required for reliable results Using Comparative Intensities on an Agarose Gel If you have a very low concentra
29. llulose membrane in preparation for Western Blotting during the next laboratory session 11 Biology 3210 Western Blotting Background Western blotting also known as immunoblotting is a technique used to detect specific proteins One significant advantage of this technique is its ability to detect specific proteins within a complex mixture of other proteins such as a cell homogenate Western blotting is routinely used to elucidate where in an organism a particular gene is expressed and under what environmental development conditions ensuring a gene of interest is being expressed in a transgenic organism and even medically such as the detection of HIV positive individuals The first process in performing a Western blot is the separation of proteins with a given sample This is usually accomplished by SDS PAGE but non denaturing native PAGE or even 2 dimensional gel electrophoresis can also be used Figure 3a The separated proteins are then transferred out of the gel matrix to an immobile support with a high affinity for proteins such as a nylon nitrocellulose or polyvinylidene difluoride PVDF membrane Figure 3b h membrane protein mixtures gt A l hy 44 lt y f A J 2 ab lt 7 7 blocking f y 4 F mon 1 ab lt f A i target protein a b c Figure 3 Illustration for the concept of a Western blot a A sample containing a mixture of proteins is separ
30. lumn to allow for efficient binding 10 11 12 Fall 2015 Transfer the entire volume in the collection tube to a new 1 5 mL MCT and label this as flow through Wash the column with 600 uL of Wash Buffer and centrifuge at 700 g for 2 minutes Transfer the entire volume in the collection tube to a new 1 5 mL MCT and label this as Wash 1 Note This step washes away any remaining unbound impurities that may have been left behind from the lysate Furthermore it is common for some naturally occurring proteins to be able to bind to the Ni NTA resin The Wash Buffer while having the same chemical composition as the Lysis Buffer has a lower pH 6 3 which will elute any proteins with a lower binding affinity to the Ni NTA Repeat Step 8 but label the collected liquid as Wash 2 Elute the protein with 200 uL of Elution Buffer and centrifugation at 700 g for 2 minutes Transfer the volume in the collection tube to a new 1 5 mL MCT and label this as Elute 1 Note The Elution Buffer is the same as the Lysis amp Wash Buffer but with a pH of 4 5 This is sufficient to elute proteins with very high binding affinities for the Ni NTA resin including our His tagged protein of interest Repeat Step 10 but label the collected liquid as Elute 2 Ensure all tubes are properly labeled and store at 4 C until the next laboratory session These samples will be analyzed by SDS PAGE and transferred to a nitroce
31. ndard For the purified fraction samples use the pre stained marker as a protein standard as it can be used to visually determine if the proteins have been transferred to the nitrocellulose membrane from the gels during next weeks lab Note 3 Stagger the loading of the prestained molecular weight markers between the different gels so that they can be identified later Coordinate with the other groups to accomplish this Run the gel at 200 V until the dye front provided by the RSB reaches the bottom of the gel 45 min Progress of electrophoresis can also be followed by the pre stained marker as this will be visible during the run for gels loaded with this protein standard Staining and Destaining 6 10 Disassemble the gel rig and split the long and short plates apart using a plastic spatula Work carefully so as not to tear your gel Note Make a unique nick in your gel so as to be able to identify it during staining and destaining Gels with the Induced Cell Pellets Place your gel in the coomassie stain and shake gently on the orbital shaker for 10 min Gels with the Purified Fractions Go directly to step 10 and use the container specifically labeled for these gels Note Once stained with coomassie the gels are unusable for Western Blotting purposes DO NOT STAIN THESE GELS The gels will be stored until the next lab in destain which will act as a fixative preventing diffusion of the proteins out of the gel during stor
32. ndard Taq 4 When all the reactions have been setup transfer the tubes to the thermocycler and start the reactions PCR Cycling Conditions 1 Initial Denaturation 90 sec at 98 C 2 Denaturation 10 sec at 98 C 3 Annealing 20 sec at 60 C 4 Elongation 15 sec at 72 C Steps 2 4 will be cycled 40x 5 Final Elongation 10 min at 72 C 6 Storage at 4 C 5 Reactions will be stored at 20 C until the next laboratory period 23 Biology 3210 Equipment amp Supplies Week 3 PCR samples from week 1 5x Micropipettors 0 5 10 uL w sterile tips Agarose 8x mct racks for 0 2 mL PCR tubes 1x TBE 3 L 2x Microcentrifuge Ethidium bromide bath 5 pg mL 6x Gel rigs w 12 well combs Destain bath 2x Power supplies Loading dye 10x w xylene cyanol 2x Tape DNA ladder 2 log NEB Graduated cylinders 6x 50 mL 6x 100 mL flasks 1x Analytical balance 1x small weigh boat 1x small spatulas 1x Microwave oven mitt Parafilm Razor blade 4x Sharpies extra fine UV transilluminator Platform shaker Latex gloves all sizes 1 5 mL mcts Protocol Week 3 Agarose Gel Electrophoresis 24 1 Cast a 2 0 agarose gel in TBE Note Pay close attention when heating higher concentrations of agarose as they are more likely boil over in the microwave You are responsible for cleaning up should any boil over occur Load your PCR samples don t forget the DNA ladder Run your gels at 100 V
33. one is chosen Although TBE has one of the higher buffering capacities of the buffers of choice much greater than that of Tris Acetate EDTA TAE for instance resolution of larger fragments is better in TAE DNA will move faster in TAE than in TBE and extraction of DNA from agarose may be more effective when performed on gels made with TAE Other Aspects To Consider Loading Dyes In this laboratory we make use of mixtures containing xylene cyanol FF This dye migrates in 0 5x TBE at approximately the same rate as linear DNA of 4000 bp in size Often bromophenol blue is used in conjunction with xylene cyanol or separately Bromophenol blue migrates at approximately the same rate as linear DNA of 300 bp in size in 0 5x TBE 2 2 fold faster than xylene cyanol FF independent of agarose concentration Size Standards There are different types of size standards used to help in determining sizes of fragments run on gels For instance known DNA molecules such as Lambda DNA may be digested with different enzymes such as HindIII resulting in a series of fragments of known sizes Total Lambda DNA is usually purchased then digested as needed Another type of size standard is produced by ligating a monomer DNA fragment of known size into a ladder of polymeric forms The 2 log DNA ladder from New England Biolabs consists of a mixture of a number of proprietary plasmids digested to completion with different restriction enzymes Ladders tend to be purc
34. onstrated by your instructor as needed 4 Prepare your samples for electrophoresis by mixing 4 uL of each digested sample with 4 uL of 2x loading dye You should also prepare an undigested sample for electrophoresis containing an equivalent amount of plasmid as is present in your 4 uL sample Load all of your samples to the gel as well as the supplied DNA ladder 2 log DNA Ladder NEB 5 The gels will be run at 100 V for 45 min 6 Once the electrophoresis is complete stain your gels in the ethidium bromide bath with gentle shaking for 10 min Caution Ethidium bromide is a mutagen and suspected carcinogen gloves must be worn at all Fall 2015 times when working with ethidium bromide Alternative Ethidium bromide can be added to the molten agarose prior to casting the gel at a final concentration of 0 5 pg mL 7 Examine your gels on the UV transilluminator Additional staining or destaining may be required to properly visualize any resulting bands While photographs of the gel will be supplied you should make detailed notes of your observations especially of any faint bands as these may not show up well on the photograph Caution UV light is damaging to the naked eye and exposed skin Always ensure the transilluminator shield is in place or cover bare skin and view through safety glasses that absorb harmful wavelengths 8 You will need to generate a standard curve for each gel produced in order to accurately estimate DN
35. r buffer For the blotting of a single gel you will need to pre wet 5 sheets of Whatman filter paper and 1 nitrocellulose membrane cut to the size of the gel in transfer buffer A Western Blot sandwich will be prepared by adding the layers in the following order 2 layers of wet Whatman filter paper wet nitrocellulose membrane polyacrylamide gel equilibrated in transfer buffer 3 layers of wet Whatman filter paper Each layer of the sandwich is added to the previous one directly on the transfer cell After the addition of each layer the sandwich should be rolled with a test tube to remove any trapped air bubbles from between the layers Note It is critical that no air is trapped between any of the layers and this will significantly affect the transfer of proteins from the gel to the nitrocellulose membrane Once the sandwich is assembled for all the gels set up the transfer cell and apply 25 V for 45 minutes Note Extra care should be taken to ensure the polarity of the electrodes is correct before applying power as the semi dry transfer cell can be damaged by reversing the polarity in addition to the samples being transferred AWAY from the nitrocellulose membrane Use forceps to peel the layers from the nitrocellulose the filter paper and the gel can be Fall 2015 discarded alternatively the gel can be coomassie stained to detect any residual proteins Incubate the nitrocellulose membrane in the Ponceau S stain for 5 minu
36. r health concerns should inform their lab instructor so that appropriate precautions may be taken where necessary Fall 2015 Safety Waiver This form must be completed signed and submitted to the laboratory instructor before any laboratory work is begun x k OK k k OK Ok k I have read and I understand the safety rules that appear in this manual I recognize that it is my responsibility to observe them and agree to abide by them throughout this course Name please print Signature Date Biology 3210 Fall 2015 Biology 3210 This page has been left blank intentionally Fall 2015 Restriction Mapping of an Unknown Plasmid Background Ever since the isolation of the first restriction endonuclease from Haemophilus influenzae in the 1970 s the use of these enzymes has been central to molecular biology Today restriction enzymes are utilized for the creation of recombinant DNA molecules genetic mapping through restriction fragment length polymorphism RFLP and small nucleotide polymorphism SNP analysis clonal comparison determination of evolutionary relationships DNA fingerprinting and even to diagnose disease Type II restriction enzymes are the most used for applications in molecular biology These enzymes have specific recognition sequences in double stranded DNA usually palindromes of 4 8 bp that they bind to and subsequently cleave the phosophodiester bond of both DNA strands The site of cleavage varies
37. re that there are risks of personal injury through accidents fire explosion exposure to biohazardous materials corrosive chemicals fumes cuts etc The guidelines outlined below are designed to a minimize the risk of injury by emphasizing safety precautions and b clarify emergency procedures should an accident occur EMERGENCY NUMBERS City Emergency 911 Campus Emergency 2345 Campus Security 2603 Student Health Centre 2484 Emergency 2483 THE LABORATORY INSTRUCTOR MUST BE NOTIFIED AS SOON AS POSSIBLE AFTER THE INCIDENT OCCURS EMERGENCY EQUIPMENT Your lab instructor will indicate the location of the following items to you at the beginning of the first lab period e Closest emergency exit e Closest emergency telephone and emergency phone numbers e Closest fire alarm e Fire extinguisher and explanation of use e Safety showers and explanation of operation e Eyewash facilities and explanation of operation e First aid kit GENERAL SAFETY REGULATIONS e Eating and drinking is prohibited in the laboratory Keep pencils fingers and other objects away from your mouth These measures are to ensure your safety and prevent accidental ingestion of chemicals or microorganisms e Personal protective wear is mandatory Lab coats safety glasses and closed toed shoes must be worn at all times during lab exercises which involve potential for chemical or biological spills e Coats knapsacks briefcases etc are to be hung on th
38. roth 8x 100 mL 1 5 mL MCTs sterile Kanamycin stock 1000x 16x 15 mL Falcon tubes IPTG stock 1 M 4x Micropipettor sets w sterile tips 1x UV spec w semi micro cuvettes 3x Microcentrifuges RT 4x Ice buckets large Protocol Culture Inoculation will be performed for you 1 Start the cultures for over expression by inoculating 100 mL LB broth containing the appropriate antibiotic with 2 0 mL of the assigned overnight culture of E coli BL21 DE3 transformed with pRNB Ec In addition one control culture will be setup by inoculation with E coli BL21 DE3 2 Incubate the cultues at 37 C with vigorous shaking 200 rpm and record the ODgoo values optical density 600 nm at periodic intervals to follow the growth of the cultures Over expression induction and sample collection 3 When the ODeoo value for the culture reaches 0 6 induce expression with a final concentration of 1 mM IPTG Quickly return the cultures to the 37 C incubator with vigorous shaking 200 rpm Note PRIOR to induction transfer the appropriate volume of the culture to a sterile 1 5 mL MCT to serve as a negative control and perform Step 5 In order to ensure that an equivalent number of cells is transferred at each of the selected time intervals the volume used will be normalized to an OD6 00 value of 1 00 for 1 0 mL of culture i e the number of cells that would be present in 1 0 mL of culture at an ODs of 1 00 Use the following formula to de
39. set up the digests of the unknown plasmid for each of the supplied restriction enzymes in 0 5 mL microcentrifuge tubes mcts All reagents except the restriction enzymes should be completely thawed and stored on ice All work should be carried out on ice Note Restriction enzymes are costly and heat labile and should therefore be handled with care Every effort should be made to minimize the amount of time the enzymes are removed from 20 C storage When in use they must be stored on ice at all times and should be returned to 20 C as quickly as possible You should only handle the tops of the tubes containing the enzymes to prevent the heat from your hand transferring to the tubes Table 1 Reagents and their respective volumes to be used for the restriction of the unknown plasmid in single digests Reagents should be added in the same order as listed below Reagent Volume d H2O 12 0 pL Unknown plasmid 5 0 pL Buffer 10x 2 0 pL BSA 10x if needed 2 0 pL Restriction Enzyme 1 0 pL Total Volume 20 0 uL The volume of d H O indicated assumes that BSA is not required if BSA is required the volume of d H2O should be adjusted accordingly see manufacturer supplied info 2 Ensure the contents of your 0 5 mL mcts are well mixed and incubate the digests at 37 C for 1 hr 3 Cast a 1 0 agarose gel in Tris Borate EDTA buffer TBE using the supplied casting apparatus The casting procedure will be dem
40. t is often desirable for the researcher to be able to control when transcription is initiated from the viral promoter a process known as induction This control of transcription allows for sufficient growth of the cell culture prior to induction of the viral promoter and therefore more of the desired protein is produced In particular this regulation of transcription is required if the gene product of interest is lethal to the host cells Many expression vectors are specialized to create fusion products a chimeric protein generated from two or more genes with functional properties of both of the original gene products In addition to the transcriptional promoter elements these vectors must also have the DNA elements encoding the translation initiator region TIR The insertion of the sequence of interest requires more effort as care must be taken to preserve the reading frame of the original coding sequence Significant reductions in the effort and time spent on the purification can result from the addition of an affinity tag e g Poly His or GST allowing for purification by affinity chromatography or a signal peptide targeting the protein for export from the cell e g PhoA Additionally visualization of the protein can be aided through the addition of epitope tags e g Myc or reporter proteins e g GFP Fall 2015 Supplies and Equipment E coli BL21 DE3 with 8x Bunsen burners w strikers pPRNB Ec 37 C shaking incubator LB b
41. termine this volume 1 0 mL _ volume of culture measured OD f 4 Thirty minutes post induction measure the ODgoo and use this value to determine the appropriate volume to transfer to a sterile 1 5 mL MCT as above Work quickly to minimize the time the culture flask is removed from the incubator 5 Pellet the cells by centrifugation at 13 000 rpm for 10 min remove as much of the supernatant as possible and store the cell pellet on ice The pellet will be stored at 80 C for analysis at a later date Biology 3210 6 Repeat steps 4 amp 5 when 60 and 90 min have elapsed since the induction of the culture 7 The induced cultures will be incubated overnight to allow for the maximal expression of the gene of interest The following morning 8 Repeat steps 4 amp 5 with the overnight culture 9 Aliquot 20 mL of the overnight culture into two 15 mL Falcon tubes 10 mL each and pellet the cells by centrifugation at 5000 rpm for 15 min at 4 C Discard the supernatant and store the pellet at 80 C for use in next weeks lab Fall 2015 Purification of Over Expressed Fusion Proteins Background Affinity chromatography is a simple and relatively rapid technique to effectively isolate a specific protein from a complex mixture such as would be found within a cell This technique makes use of the of the binding affinity of the protein for a specific ligand which could be a substrate cofactor or even an inhib
42. tes and destain in water Pictures of the Ponceau S stained membranes will be provided and the membranes will be completely destained prior to the actual detection of the His tagged proteins next lab Note Ponceau S staining is one method to determine if protein transfer to the membrane has occurred prior to continuing with the western blotting procedure which is time consuming and uses expensive reagents The use of a pre stained protein marker will also demonstrate protein transfer making the use of the reversible Ponceau S stain optional 17 Biology 3210 Supplies and Equipment Week 2 Student nitrocellulose membranes previous week 1x Micropipettor Set w tips Blocking Buffer 1x MCT racks 2 milk powder 0 15 Tween 20 in TBS 4x disposal plastic containers i e Ziploc Mouse anti His antibody 1 Latex gloves all sizes Goat polyclonal anti mouse antibody 2 4x Sharpies extra fine Alkaline Phosphatase Incubation Buffer AP 4x forceps flat 100mM Tris pH 9 5 100mM NaCl 5mM MgCl BCIP 5 bromo 4 chloro 3 indolyl phosphate NBT nitroblue tetrazolium Protocol Week 2 Blocking of the nitrocellulose membrane Step 1 will be performed for you 1 18 Submerge the nitrocellulose membrane in approximately 20 mL of Blocking buffer Incubate at room temperature for at least 2 hours with gentle agitation Wash the membrane in fresh blocking buffer for 5 10 minutes Repeat step 2 two more times 3
43. the information provided by the manufacturer NEB for each restriction enzyme Keep in mind that you will use your single digests as controls for your double digests failure to properly plan may result in unusable data thereby wasting your assigned resources Double Digests in a Single Reaction Alternatively double digests can be carried out in a single reaction provided the enzymes have compatible reaction buffers and incubation temperatures It is often still possible to utilize this method even if one of the restriction enzymes has a reduced efficiency in a given reaction buffer simply adding 3 Biology 3210 more of that enzyme to the reaction to compensate or increasing the incubation period Performing a single reaction with two restriction enzymes generally requires less time and will not require altering the buffer conditions between subsequent digests While there will be no time savings for this exercise as compared to utilizing sequential reactions you will save the effort of having to adjust the reaction buffer for the second enzyme Agarose Gel Electrophoresis Gels will be cast and run as performed in Week 1 You are welcome to vary the concentration of your agarose gels between 0 7 and 2 0 Higher concentrations of agarose give better resolution of smaller DNA fragments but you will lose resolution for longer DNA fragments Do not forget to load the DNA ladder or the gel will be unusable for mapping purposes You will
44. tion of DNA present in a solution or you suspect contamination with RNA quantification using ethidium bromide may be more accurate In general the greater the mass of DNA present the greater the amount of ethidium bromide that will intercalate Consequently the intensity of fluorescence will reflect the mass of DNA present The intensity of fluorescence of the unknown band of interest can be compared to a band for which the mass of DNA is known and therefore the mass of the unknown band can be estimated Both the fragment sizes and masses are readily available for each band within many commercially available DNA marker preparations It is also relatively easy and cheaper to prepare your own DNA marker and provided you know the fragment sizes and their respective mass estimation of an unknowns size and mass is possible Lambda genomic DNA digested with Hind III is commonly used as a homemade DNA marker for agarose gel electrophoresis For example let s say that 5 pL excluding loading dye of a solution containing an unknown band of DNA was loaded to an agarose gel After electrophoresis the intensity of fluorescence of the unknown band was equivalent to that of the 9 416 Kb band of lambda HindIII If we have loaded 0 25 ug of Hind III digested lambda genomic DNA we can determine the mass of the unknown band First we need to calculate the mass of DNA present for the 9 416 Kb band proportion of genome comprised the 9 416 Kb fragment
45. to sufficiently resolve my dna sample DNA conformation the three forms of DNA supercoiled form I nicked circular form IT and linear form II migrate at different rates through agarose please see the following web page for an explanation and animation of the three forms and of their migration http bio classes ucsc edu bio20L info animate anim2 topo htm Under the conditions we make use of it is assumed that supercoiled migrates fastest through the gel while the other two forms may not be resolveable When ethidium bromide is incorporated into agarose the ethidium bromide intercalates and will slow down stiffen the linear DNA molecules Applied voltage For maximum resolution of DNA fragments gt 2Kb in size agarose gels should be run at no more than 5 8 V cm note that cm refers to distance between the positive and negative electrodes Types of agarose Standard from 2 species of seaweed Gelidium and Gracilaria Standard agarose can be used for separation of DNA fragments from 1 25 Kb 28 Fall 2015 Low melting temperature modified by hydroxyethylation and consequently melts at 65 C because of this low melting temperature agarose can be used for recovery of DNA from the agarose In terms of handling this agarose is more delicate and takes a longer time to set or gel Buffer ions are required for DNA migration Different buffers may be used and it may not matter significantly which
46. ubject area You must cite relevant literature as recent as possible i e stay away from the 70 s 80 s early 90 s unless necessary Materials and Methods this section only contains information on how the experiment was carried out It should be written so that the reader can repeat your results by reading this section Results this section contains what you found You do not describe the significance of your results or put forward hypothesis based on the results in this section Just state the facts Here you should generate and reference appropriate figures and tables in a neat fashion Discussion this is the section that you can put forward hypothesis and interpret your results This section should also include references to relevant literature References in text references should be of the form authors last name date and the references at the end of the text should be formated as specified by the Journal of Molecular and Cellular Biology http mcb asm org use on the Authors link to access the instructions to authors which include reference format guidelines As many as you want The more the better Figures and Tables figures and tables may be included within the text after their first mention within the text or appended to the back of the report NOTE You must be concise Any text beyond the allowed page limit will not be marked Page limits will be given for each report and may vary between reports
47. ully be transferred and expressed by the GMO One common commercial example of a GMO is Bt corn Bt maize in which the Cry1Ab gene from the bacterium Bacillus thuringiensis has been inserted into the genome of corn This gene encodes a protein d endotoxin which is specifically toxic to Lepidopterans moths and butterflies Upon ingestion the d endotoxin protein binds to and breaks down the gut wall of the Lepidopteran larvae resulting in death The European corn borer a Lepidopteran is a common pest with a significant financial impact on a variety of crops including soybeans cotton and com The introduction of genetically modified crops such as Bt corn has resulted in higher crop yields and a reduction in the amount of insecticides applied These benefits have not gone unnoticed as nearly 50 of all corn planted in Canada was Bt corn 2003 While the benefits have not gone unnoticed neither have the concerns surrounding crops modified to produce the d endotoxin and GMOs in general Losey et al 1999 in a preliminary study raised concerns that the Monarch butterfly might be negatively impacted by corn pollen being blown from crops to neighbouring areas While subsequent studies have shown that this impact is negligible Sears et al 2001 it demonstrates the difficulty in predicting all possible side effects from the intended use of a specific GMO Other concerns include the impact upon human health and the use of selective markers
48. unction of the protein being studied This is not limited solely to research purposes as it is often desirable to produce significant quantities of protein for commercial e g many of the enzymes used in this course or medicinal purposes e g human insulin production Under normal conditions gene expression is a highly regulated process ensuring the gene products are only present at the correct time and in the quantities actually required by the cell This regulation can be extremely problematic for obtaining a sufficient quantity and quality of the desired gene product to facilitate research or for commercial enterprises Cloning of the desired gene into an expression vector is an effective way to easily obtain large quantities of the gene product Expression vectors are generally plasmids that at minimum posses the DNA elements needed to allow for the transcription promoters of the cloned sequence The promoters encoded on the expression vector are typically viral in origin as they allow for very high levels of transcription overcoming the limitations imposed by the genes native promoter In some cases the level of gene expression is so high that nearly 50 of the total protein mass of the host cell is the desired gene product The high levels of gene expression offered by viral promoters can have a significant impact on the overall growth of the host cell as cellular resources are diverted to producing a single gene product Consequently i
49. washes in total For binding of the 1 antibody add 5 uL of the mouse monoclonal anti His antibody to 15 mL of blocking buffer and incubate the membrane in this solution for at least 30 minutes with gentle agitation Wash the membrane 3 times as described in Step 2 Bind the 2 antibody by adding 5 uL of the polyclonal anti mouse antibody to 15 mL of blocking buffer and incubate the membrane in this solution for at least 30 minutes with gentle agitation Wash the membrane 3 times in AP buffer Begin the colour development by incubation of the membrane in 0 56 mM BCIP and 0 48 mM NBT You must watch the membranes during this step as the colour development may occur rapidly Once you are satisfied with the colour development immediately transfer the membrane to a bath of d H20O to quench the reaction Fall 2015 Detection of Genetically Modified Maize Background One of the predominant uses of restriction enzymes is to create recombinant DNA molecules a single DNA molecule comprised of sequence information from two or more organisms This has led to the creation of genetically modified organisms GMOs an organism which has had its genome modified by the addition of genetic material from another species Typically the genetic material integrated into the GMOs genome is a gene conferring some favourable trait upon the host organism Due to the near universality of the genetic code genes from distantly related organisms can successf
50. will disperse any air bubbles you may have introduced while pouring the resolving gel so do not worry about them prior to this point Wait 20 min for the resolving gel to polymerize do not disturb the casting stand while waiting Note You will be able to tell when the gel is polymerized by examining the unused resolving gel in your Pasteur pipet or scintillation vial 13 Biology 3210 Casting the SDS PAGE Stacking Gel 6 10 Once the resolving gel has polymerized invert the gel casting stand and all to pour off the ethanol Blot away any remaining ethanol with a kimwipe or a piece of filter paper In another scintillation vial add 5uL TEMED and 25uL of 100 mg mL APS to 5 mL of the stacking gel premix and mix by swirling again this is enough for 2 gels Use a Pasteur pipet to dispense this solution on top of the polymerized resolving gel until you just slightly overflow the short plate this helps to flush out any residual ethanol and air bubbles If no air bubbles are present gently insert the 15 well comb ensuring that the top of the comb sits flush with the top of the long plate aka spacer plate Wait as before for the stacking gel to polymerize Once polymerized assemble the gel rig as shown by your instructor submerge the assembled rig in the buffer chamber and flush out the wells gently with running buffer using a micropipettor or a syringe The gel is now ready to be loaded with samples Preparing and Runnin
Download Pdf Manuals
Related Search