Multiplex SNP-SCALE - Molecular Ecology Lab
Contents
1. Journal Molecular Ecology Resources Article mer_2190 Dear Author During the copy editing of your paper the following queries arose Please respond to these by marking up your proofs with the necessary changes additions Please write your answers on the query sheet if there is insufficient space on the page proofs Please write clearly and follow the conventions shown on the attached corrections sheet If returning the proof by fax do not write too close to the papers edge Please remember that illegible mark ups may delay publication Many thanks for your assistance we fey to Author Please supply the fax no of the corresponding author 2 Figure 1 4 are in poor quality please resupply For more information about supplying electronic artwork please see 3 the journal webpage or Blackwell s electronic artwork guidelines at http www blackwellpublishing com bauthor illustration asp Author Please supply the names and main affiliation of all the authors in T Kenta et al unpublished authors in J Gratten et al unpublished and T Kenta et al Author Please confirm if it is ok to delete to test in this sentence so that it will go like Two tests were carried out for this Author Please supply the names and affiliations of all the unpubished Author Please confirm if the book title for Hauser et al 2007 is correct MARKED PROOF Please correct and return this set Please use the proof correction m2. Kunin for providing Arabidopsis lyrata samples to J Pemberton and J Pilkington for Ovis aries samples and to I Stewart S Bird and M Mannarelli for technical help This work was supported by the Post Genomics amp Proteomics thematic programme of the Natural Environment Research Council NERC References Aitken N Smith S Schwarz C Morin PA 2004 Single nucleotide polymorphism SNP discovery in mammals a targeted gene approach Molecular Ecology 13 1423 1431 Brownstein MJ Carpten JD Smith JR 1996 Modulation of non templated nucleotide addition by tag DNA polymerase primer modifications that facilitate genotyping BioTechniques 20 1004 1010 Brumfield RT Beerli P Nickerson DA Edwards SV 2003 The utility of single nucleotide polymorphisms in inferences of population history Trends in Ecology amp Evolution 18 249 256 Chen X Sullivan PF 2003 Single nucleotide polymorphism genotyping biochemistry protocol cost and throughput Phar macogenomics Journal 3 77 96 R Development Core Team 2006 r A Language and Environment for Statistical Computing R Foundation for Statistical Computing Vienna Austria Hauser J Karudapuram S Wheaton A Chen SM Joe LK 2007 Migration Differences Due to Dye Label on Linkage Mapping Set Microsatellites Sized with Genescan LIZ 600 Size Standard Applied Biosystems Foster City California Hinten GN Hale MC Gratten J et al 2007 SNP SCALE SNP scoring by colo
3. 63 67 C respectively and a low self complementarity value annealing temperatures were calculated excluding tails and weights We did not check the annealing temperature and self complementarity of those primers including tails because a preliminary test suggested that as expected this did not improve the PCR results The inclusion of LNAs in allele specific forward primers raises annealing temperature by approximately 5 C Because empirically the actual annealing temperature T_ is lower than T by gt 5 C the T for both classes of primers became lt 60 C The primer design procedure 2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd CON OO OBRWDNDN gt anann naarktrtst HPP HHP HPHPWBWHWWWWWWWWNNNNNNNNNYDND a AH AH AP AH AH AHA Aa a AUN DOAN DAHKPWNHAA EATDOAOAAN DAABRPWBN HAYA DOAN DAP WBNH XVDVOAOAOAN DOA HKRWBNH OC O described above can now be carried out automatically using Our new SNP SCALE PRIMER DESIGNER software www sheffield ac uk molecol software snp html sNP SCALE PRIMER DESIGNER uses PRIMER 3 Rozen amp Skaletsky 2000 for calculating properties of allele specific forward primers and for finding suitable matching locus specific reverse primers The PCR thermocycling conditions were identical for all multiplex sets and loci an initial denaturation step at 95 C for 15 min to activate the hotstart Taq polymerase followed by 10 touchdown cycles of denaturation at 94 C
4. 70 320 a 340 a0 Fig 2 An electropherogram of 21 plex SNP SCALE using multiplex set 10 in Arabidopsis lyrata GENEMAPPER 3 7 Applied Biosystems output was edited Bars above the size axis indicate each locus The locus ALS076 at c 310 bp is tri allelic Note that the scales of the vertical axes are different between the upper and lower figures indicating that larger products tend to have smaller peaks At each locus the two alleles are discriminated by both size and colour Green HEX peaks are accompanied by smaller black NED peaks at the same positions indicating that there has been some colour bleed through due to usage of a nonstandard dye set see the text However this degree of bleed through does not compromise the scoring of the adjacent yellow allele peak because of the amplified allele size difference UFO4 FAM UFO6 HEX and UFO7 HEX Although filter set G5 on the ABI sequencers is designed for the set of FAM VIC NED and PET labels we found that HEX which is available at relatively low cost e g 20 mer HEX labelled oligonucleotides are currently available in the UK at less than one quarter of the cost of similar VIC labelled primers can satisfactorily substitute for VIC There was sometimes a considerable colour leak from HEX green in Fig 2 to NED black the different alleles labelled by those dyes as for all loci were discriminated by size in SNP SCALE Validating Multiplex SNP SCALE We tried 11 sets of multipl
5. as long as i it meets the general requirements for primers and ii it does not bind to the target genomic DNA For the sake of convenience we designed UFOs by choosing primers that bind to Enterobacteria phage M13 sequence GenBank Accession no 56718463 We chose initial candidate primers whose annealing temperatures T were around 64 C as for the existing UFOs Hinten et al 2007 using PRIMER 3 Rozen amp Skaletsky 2000 We confirmed the absence of sequences similar to these primer sequences in the whole genome of Arabidopsis thaliana which is a close relative of one species that we studied see below using BLAST From the initial candidate primers 2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd two 20 mer primers one 21 mer primer and two 23 mer primers that had relatively low matches to any genomic sequence e gt 2 5 were chosen as the base sequence for the new UFOs They were labelled with the fluorescent dyes 6 FAM HEX NED or PET One to three dyes were tested for each of five base sequences making 13 UFOs in total Table 1 To test the amplification and size separation of SNPs using the new UFOs in comparison with the existing UFOs we used new and existing UFOs in the SNP SCALE protocol detailed in the following section for two SNP loci ALSO75 and ALS149 T Kenta et al unpublished in northern rock cress Arabidopsis lyrata spp petraea We used DNAs of four A lyrata plants
6. as templates The genotypes of those plants were known by sequencing one plant was homozygous at both loci another was the alternative homozygote at both loci and the others were heterozygous at both loci We tried six pairs of UFOs in singleplex reactions and three combi nations of UFOs in multiplex reactions to test compatibility among all possible pairs of UFOs The relative observed size of PCR products obtained using each UFO is summarized in Table 1 together with details of each UFO The estimated sizes of PCR products of the same allele at the same locus varied even when the same size of UFO was used This variation was due to migration differences both among dyes and among the UFO base sequences The former variation was 0 3 8 bp while the latter was 0 1 0 bp Among all dyes PET labelled products showed the biggest difference between expected and observed size Their observed sizes were 2 0 3 8 bp larger than for FAM labels while the differences among the other dyes were within 1 0 bp The pattern of relative migration speed among dyes was consistent with a technical report published by Applied Biosystems Hauser et al 2007 Amplification by UFO6 HEX was relatively poor when used in a multiplex set comprising UFO3 FAM 9D ONO OBWDNDN gt 4 TECHNICAL ADVANCES Observed product size bp a ro 20 50 100 110 r EI 130 200 210 220 230 240 250 260 Relative fluorescent unit 130 440 150 160 170 T 230 230 300
7. medium throughput SNP typing systems although these may require a high initial investment in new equipment or be less flexible in terms of the ease with which loci can be added or removed from the multiplex sets Finally the Multiplex SNP SCALE procedure is summa rized in Box 1 incorporating the recommendations described in detail above We conclude that Multiplex SNP SCALE is possible although PCR products lt 80 bp may be subject to overlap with noise bands Use a weight system to separate the sizes of otherwise overlapping loci Choose a multiplex set by putting each locus at a minimum 7 bp interval Pre mix primers of a multiplex set and try a multiplex reaction There is no need for any preliminary single plex checking To minimize the time consuming primer mixing step we recommend trying SNP sets in a 6 8 plex first and then combining different sets once the sizes and positions of noise bands have been identified Primer mix stocks for each multiplex should be prepared at a high enough concentration to allow subsequent dilution e g mixing two sets is equivalent to diluting them to half concentration Reactions both with and without Q Solution should be attempted particularly when the plex number is high cost and time effective for medium scale evolutionary and ecological projects involving 10s to 100s of loci Acknowledgements We are grateful to S Suyama for his valuable technical advice to P Vergeer and W
8. 0 and the worst B ALS059 genotyping quality based on silhouette score in Arabidopsis lyrata 2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd TT TECHNICAL ADVANCES 7 Fig 3 Histogram of a difference D between observed and expected size for each locus and b difference between expected and observed distance between any two loci D D generated by bootstrapping with 10 000 permutations 0 5 D D bp 10 more variable DNA quality and or the failure to use mineral oil in O aries PCRs First O aries DNA was extracted from samples collected over a 20 year period whereas DNA from A lyrata was extracted from samples collected in the past two years Second low level evaporation due to the absence of mineral oil might have led to changes in reagent concentrations resulting in a decrease in the allele specificity of the reaction particularly in the later PCR cycles The silhouette score was not significantly different between the allo and autotype SNPs P 0 19 2 tailed Welch s t test t 1 48 d f 6 18 For allotype SNPs the slope a was not significantly biased towards the C G allele vs the A T allele P 0 39 2 tailed Welch s t test t 0 88 d f 23 06 These results indicate that Multiplex SNP SCALE does not have a systematic bias with respect to the category of allelic variation Multiplex PCR Kits QIAGEN cost four to eight times more per reactio
9. CON OO OBRWDNDN gt BH ARAARA HP WBWWWWWWWWWNNNNNNNNNYN AH AH AP AH AH AHA OnFRPwWN RY ODOOAOAAN DABPWBN HY DCDOAOAAN DAP ON HY OCOOAOAON DA KPWBNH OC O PE Crystal Chan Copy editor Apple Rosales M E R 2190 Operator Wu Huizhen h Dispatch 05 05 08 Journal Name Manuscript No Proofreader Chen Xiaoming J No of Pages 9 Molecular Ecology Resources 2008 doi 10 1111 j 1755 0998 2008 02190 x TECHNICAL ADVANCES Multiplex SNP SCALE a cost effective medium throughput single nucleotide polymorphism genotyping method T KENTA J GRATTEN N S HAIGH G N HINTEN J SLATE R K BUTLIN and T BURKE Department of Animal amp Plant Sciences University of Sheffield Sheffield S10 2TN UK Abstract We describe a convenient cost effective and flexible medium throughput single nucleotide polymorphism SNP genotyping method Multiplex SNP SCALE which enables the simultaneous amplification by polymerase chain reaction PCR of up to 25 or potentially more loci followed by electrophoresis in an automated DNA sequencer We extended the original SNP SCALE method to include i use of a commercial multiplex PCR kit ii a four dye system iii much reduced 2 uL reaction volumes iv drying down of template DNA before PCR v use of pig tailed primers vi a PCR product weighting system vii a standard optimized touchdown PCR thermocycling programme and viii software SNP SCALE PRIMER DESIGNER that automaticall
10. Excel macro www sheffield ac uk molecol software snp html Hinten et al 2007 In this macro if the peak of an allele was not detected then peak height was set at a default value of 10 relative fluorescent units to reflect the background noise level At least 48 individuals were used in a genotyping quality check for each locus Genotyping of each SNP was regarded as successful if the heterozygous and two homozygous genotypes formed distinctly separate clusters on the peak intensity cluster plot In those SNPs where one allele is a C G while the other is an A T defined here as allotype SNPs the C G alleles could possibly have a slightly higher annealing temperature than the A T alleles and thus start being amplified earlier during the SNP SCALE touchdown cycle leading to a biased relative peak height If this were to happen then genotyping quality would be lower in allotype SNPs than in those where the alternative alleles are C and G or A and T defined here as autotype SNPs Two tests were carried out to test for this possible artefact of SNP SCALE First the silhouette score which provides a numerical estimate of cluster quality was calculated using CLUSTERA Lovmar et al 2005 for the peak intensity cluster plot for every locus These scores were compared between allo and autotype SNPs using t tests after normalizing using the mean and SD of each species to remove any bias in distribution between the species Second the peak h
11. TGAGGGTGGCGGTTCT 20 0 2 0 6 UFO4 NED Same Same 0 4 0 9 UFO5 HEX CATGGGTTCCTATTGGGCTTG 21 1 7 2 1 UFO5 NED Same Same 1 6 2 1 UFO6 HEX GCAAAACCCCGCTAATCCTAATC 23 2 6 3 3 UFO7 HEX AATCAGTGAGGCCACCGAGTAAA 23 2 7 3 3 UFO7 NED Same Same 2 9 3 9 UFO7 PET Same Same 5 4 6 3 Kit QIAGEN ii the use of a four dye system rather than two dyes iii the use of a pigtail an oligonucleotide tail of GTTTCTT Brownstein et al 1996 at the 5 end of each locus specific reverse primer to reduce noise due to the inconsistent addition of adenine by Taq DNA polymerase iv reaction volumes as small as 2 uL v drying down of template DNA before PCR vi the addition of random sequence weights to allele specific forward primers to make otherwise similar sized PCR products distinct allowing greater multiplexing vii the use of an optimized standard thermocycling programme so that further optimization is not needed for every individual locus and viii the use of software that automatically designs suitable SNP SCALE primers for a batch of loci The weight is designed so as not to bind to either the template DNA or UFO so annealing temperatures are not affected Design and preliminary testing of new UFOs We designed new UFOs in order to implement a four dye system as only two UFOs were used in the original SNP SCALE protocol Hinten et al 2007 As UFOs bind to the artificial tail of another primer in theory any sequence would work as a UFO
12. ama H Curiel DT Brantly ML Holmes MD Crystal RG 1989 Rapid nonradioactive detection of mutations in the human 2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd TECHNICAL ADVANCES 9 genome by allele specific amplification Journal of Laboratory and Clinical Medicine 114 105 113 Primmer CR Borge T Lindell J Saetre GP 2002 Single nucleotide polymorphism characterization in species with limited available sequence information high nucleotide diversity revealed in the avian genome Molecular Ecology 11 603 612 Rozen S Skaletsky HJ 2000 primer 3 on the WWW for general users and biologist programmers In Bioinformatics Methods and Protocols Methods in Molecular Biology eds Krawetz S Misener S pp 365 386 Humana Press Totowa New Jersey Singh SK Nielsen P Koshkin AA Wengel J 1998 LNA locked nucleic acids synthesis and high affinity nucleic acid recognition Chemical Communications 455 456 Slate J 2005 OTL mapping in natural populations progress caveats and future directions Molecular Ecology 14 363 379 Syvanen AC 2001 Accessing genetic variation genotyping single nucleotide polymorphisms Nature Reviews Genetics 2 930 942 The International HapMap Consortium 2003 The International HapMap Project Nature 426 789 796 Vallone PM Butler JM 2004 AUTODIMER a screening tool for primer dimer and hairpin structures BioTechniques 37 226 231 Author Query Form
13. arks shown below for all alterations and corrections If you wish to return your proof by fax you should ensure that all amendments are written clearly in dark ink and are made well within the page margins Leave unchanged under matter to remain Insert in text the matter New matter followed by indicated in the margin or k Delete through single character rule or underline or Joa fe M through all characters to be deleted Substitute character or substitute part of one or I through letter or new character or more word s I through characters new characters Change to italics under matter to be changed Change to capitals under matter to be changed Change to small capitals under matter to be changed Change to bold type under matter to be changed Change to bold italic under matter to be changed Change to lower case Encircle matter to be changed Change italic to upright type As above oir te Tat Change bold to non bold type As above or under character ay or X Insert superior character through character or where required Insert inferior character As above A EE e g 4 Insert full stop As above Insert comma As above or X and or Insert single quotation marks As above Yor 4 or 4 and or Insert double quotation marks As above 1 A Yoy Insert hyphen As above H Start new paragraph A No new paragraph Transpose LTI Close up linking charac
14. ed by up to 6 bp from the expected size Fig 3a making D D biased by up to 12 bp Fig 3b The 1 and 0 1 quantiles of D D were 7 0 and 9 7 respectively This means that any two loci 7 0 and 9 7 bp apart from each other in expected size have only a 1 and 0 1 risk of overlapping Given that the size range of a SNP locus is limited to 5 bp and that a 7 bp interval is necessary electrophoresis from 80 to 500 bp could accommodate a 35 plex set without prior size checking Genotype scoring was successfully performed in 16 21 76 and 16 16 100 loci in Ovis aries and Arabidopsis lyrata respectively The best and the worst examples of peak intensity cluster plots are shown in Fig 4 We attribute lower genotyping success in O aries relative to A lyrata to 2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd CON OO OBRWDNDN gt WWWWWNHONNMNNNNNNNYN OH OP AH AH AH AH AH AH HH aa FWNH OOON DAP ON HY TODOOAODAAOAN WD AHBPWBN OC CO iat 1 Colour 41 42 43 44 45 46 47 48 49 50 51 52 53 54 Ww ne A S amp S we Li T LO Cd L oO T P d ao 2 o LL C LES a WwW a D 6 2 0 2 4 6 10 5 D bp 5 45 Ta a P i r 4 Ta H 3 5 i a D ow f x f N 4 wv a 1 2 Z O D 2 7 b 0 0 2 0 4 0 6 0 6 1 Relative peak height Fig 4 Examples of peak height cluster plots of loci displaying the best A ALS14
15. eight of alleles with dye I y was regressed on the peak height of the other allele with dye II x in the equation y ax for all successfully genotyped allotype loci Then the slope values were normalized using the mean and SD of each species and compared using t tests between two groups of loci those with the C G allele labelled with dye I and those with the C G allele labelled with dye II Results and discussion Multiplex amplification was highly successful Table 2 using the QIAGEN Multiplex PCR Kit QIAGEN We obtained 100 success for eight multiplex sets and 67 86 success for the other three multiplex sets when using the best conditions in terms of the presence of Q Solution an additive included in the multiplex PCR kit The Q Solution had favourable or adverse effects depending on the specific multiplex set and changed the number of successful loci by one to two in each of three multiplex sets This result is consistent with the user s manual which reports that there are cases where Q Solution may work adversely The 6 TECHNICAL ADVANCES Table 2 Summary of loci used and amplification success for each multiplex set Different alleles of a locus are labelled by a pair of different UFOs and discriminated by size and colour In a multiplex set the same pair of UFOs is used for many loci and those products are discriminated by size APS loci and ALS loci will be published elsewhere J Gratten et al unpublished and T Kenta
16. et al unpublished respectively Number of loci Amplified with Amplified without Multiplex set Total Q Solution Q Solution UFOs Loci used Ovis aries 1 6 Not tried 6 1 VIC 2 FAM APS005 APSO09 APSO10 APS027 APS040 and APS065 2 5 Not tried 5 1 VIC 2 FAM APS011 APS030 APS031 APS037 and APS071 3 5 Not tried 5 1 VIC 2 FAM APS003 APS006 APS008 APS012 and APS035 4 5 Not tried 5 1 VIC 2 FAM APS013 APS016 APS028 APSO33 and APS063 Arabidopsis lyrata spp petraea 5 20 17 15 1 HEX 2 FAM ALS004 ALSO07 ALSO09 ALSO11 ALSO14 ALS019 ALS026 ALS049 ALS057 ALS059 ALS075 ALS092 ALS104 ALS137 ALS140 ALS145 ALS149 ALS152 and ALS155 6 vs 7 Not tried 3 PET 4 FAM ALS021 ALSO27 ALS052 ALS087 ALS092 2 5 HEX 7 NED ALS120 ALS130 T 6 4 Not tried 3 PET 4 FAM ALS002 ALS022 ALS037 ALS071 ALS076 5 HEX 7 NED and ALS079 8 6 6 Not tried 3 PET 4 FAM ALS015 ALS025 ALS069 ALS081 5 HEX 7 NED ALS099 ALS102 9 6 6 Not tried 3 PET 4 FAM ALS011 2 ALS035 2 ALS048 ALS065 5 HEX 7 NED ALS074 and ALS101 10 21 19 21 3 PET 4 FAM Multiplex set 6 7 8 and 9 excluding ALS015 5 HEX 7 NED ALS022 ALS079 and ALS099 11 30 25 24 1 HEX 2 FAM Multiplex set 6 ALSO09 ALSO11 ALSO14 3 PET 4 FAM 5 HEX 7 NED ALS026 ALS049 ALSO75 ALS104 ALS145 and ALS149 These numbers include different loci Five loci were successful only in either one of these reactions 21 plex trial worked at 100 success for all individuals i
17. ex reactions each of which consisted of a 5 30 plex for a total of 45 SNP loci in A lyrata and 21 loci in Soay sheep Ovis aries Each sample was PCR amplified in a 2 uL reaction vol ume containing 0 1 20 ng genomic DNA 1x master mix including hotstart Taq DNA polymerase PCR buffer 1 5 mm MgCl 0 2 mm dNTPs and unknown additives and 0 5x Q Solution containing unknown additives as supplied in the QIAGEN Multiplex PCR Kit QIAGEN 0 02 um of each allele specific forward primer 0 2 um of each locus specific primer and 0 50 um of each UFO with the exceptions of UFO1 FAM UFO4 FAM and UFO5 HExX that were used at 0 17 0 71 and 0 59 um concentration respectively as the amplification efficiencies of these UFOs were different from the others DNA was dried down either by incubation at room temperature overnight or at 70 C for 30 min before PCR The PCR mixes were overlaid with 6 uL or 3 uL of mineral oil in 96 well or 384 well plates respectively in A lyrata whereas 384 well plates were used without mineral oil in O aries Reactions that excluded Q Solution were also tried in some multiplex sets and the results were compared to those including it Allele specific forward primers included LNAs at their 3 end Proligo All allele specific forward primers and locus specific reverse primers were designed using PRIMER 3 Rozen amp Skaletsky 2000 to have an annealing temperature T of around 60 range 58 62 C and 65
18. for 30s annealing at 60 51 C decreasing by 1 C per cycle for 90 s followed by 40 subsequent similar cycles with annealing at 50 C for 90 s finally followed by an extension at 60 C for 30 min to allow complete adenine addition PCR was carried out ina Tetrad or Dyad DNA engine thermal cycler MJ Research After dilution of 20 50 times with water 0 5 uL of diluted PCR products could be taken out easily without interference by mineral oil and mixed with 9 5 uL Hi Di formamide Applied Biosystems including GeneScan 500 ROX or 500 LIZ size standards Applied Biosystems Samples were run on an ABI 3730 capillary electrophoresis machine Applied Biosystems with the POP7 matrix using filter set D or G5 respectively Fragment sizes and peak heights relative fluorescent units of PCR products were scored using the SNaPshot analysis method in GENEMAPPER 3 7 software Applied Biosystems The observed sizes of PCR products were compared to the expected sizes to determine the threshold difference in expected size above which any two given loci can be safely multiplexed without their sizes overlapping We used the theoretical size based on genomic sequence as the expected size except that 3 0 bp was added to PET labelled products to reflect their slow migration speed Table 1 The difference D between observed size O and expected size E is expressed by D O E We are interested in D D O O E E that
19. is the difference between expected and observed distance between any two loci where subscripts 1 and 2 indicate any two loci The distribution of D D was obtained by bootstrapping with 10000 permutations using R 2 4 0 R Development Core Team 2006 We evaluated the success of our assay for each locus at each of two steps PCR amplification and genotype scoring All 66 loci were used for the former while 16 loci in A lyrata and all 21 loci in O aries were used for the latter If the largest peak height of alleles at a locus was less than 100 relative fluorescent units PCR amplification was considered to have failed At least eight individuals were used to check the amplification of each locus and amplification was regarded as successful if gt 95 of individuals were amplified In theory some loci might fail to amplify due to primer incompatibility with another locus We used AUTODIMER 1 0 Vallone amp Butler 2004 to try to predict such incompatibil 2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd TECHNICAL ADVANCES 5 ities in multiplex PCR and evaluated whether the program successfully predicted which loci would fail To score genotypes at each SNP absolute total T and relative R peak heights of the two alleles at a locus x y were calculated by T Log x y R x x y and T was plotted against R for each sample to generate a peak intensity cluster plot with the help of a Microsoft
20. llele specific primers labelled with different p e a 2 O O ON OA ARWHNDN gt Colour 18 19 20 21 22 23 24 25 26 27 28 29 30 2 3 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 2 TECHNICAL ADVANCES Allele 1 Allele 2 en See eee G T 1 Allele specific amplification commences Allele specific forward primers have 17 10 concentration of the other C primers and thus exhaust before 3 TOP P CeCe CPP eee ee 5 TOP Pe ee eee iy aj Toe eee ee TE CEEE iy Nios am F Papam T Pn y DE te C e y 2 Tails of primers are amplified 3 Annealing temperature decreased so that UFOs further amplify allele specific products Note that different fluorescent dyes are always Incorporated in corresponding allele specific products ma eight or short randam sequences to control size of PCR product x Universal fluorescent primers referred as UFOs see the text T Allele specific forward primers which have LNA fred weight and tails blue or green lt a 4 whose sequences are identical to UFO Fig 1 Overview of Multiplex SNP SCALE procedure dyes each identical in sequence except for the 3 base that complements its corresponding SNP base There are two drawbacks of this method the high cost of fluorescent dyes and the low allele specificity of the assay SNP SCALE Hinten et al 2007 solved these problems by
21. n multiplex set 10 Fig 2 In multiplex set 11 25 of 30 loci were successfully amplified for all eight individuals while 95 8 of genotypes 230 8 individuals x 30 loci were obtained including those loci classified as unsuccessful Variation in peak height among loci tended to increase with the number of loci in the multiplex although this did not cause a problem in scoring individual loci using the SNaPshot analysis method in GENEMAPPER 3 7 Applied Biosystems Noise bands were relatively abundant in the lower size range lt 80 bp There was a general tendency for relatively low concentration DNA samples to be more prone to amplification failure All five loci that used the PCR product weighting system were successfully amplified confirming its usefulness Although we only tried weighting by up to 3 bp there is no reason why bigger weights should not be successful Noise due to 1 bp differences was less obvious or negligible when pigtails were used Fig 2 compared to the original SNP SCALE method Hinten et al 2007 Noise bands of the same colour sometimes appeared in the vicinity of target bands These noise peaks created much less of a problem in peak scoring when loci of adjacent sizes used a different pair of UFOs AUTODIMER did not predict any of the loci whose amplification failed while some pairs of loci that were predicted to form primer dimers by AUTODIMER amplified well The observed size of PCR products was bias
22. n than alternative Taq polymerase based PCRs The extra reagent cost is therefore compensated for by using a multiplex of four to eight loci which we found to be easily achievable Moreover multiplexing also increases the efficient use of equipment and most importantly labour Multiplex SNP SCALE is a quick and simple procedure consisting of only a single PCR and electrophoresis and is flexible in terms of the number of loci analysed it is easy to make a new multiplex set by adding or removing loci Our usage of small volume 2 uL reactions further reduces costs Although QIAGEN recommends 50 uL reaction CONDO OF WN 8 TECHNICAL ADVANCES Box 1 Recommended procedure for Multiplex SNP SCALE 1 Choose two pairs of UFOs whose sizes differ by 2 3 bp within a pair see Table 1 2 Runa PCR with the same thermocycling condition as SNP SCALE using only UFOs as primers and confirm that they do not amplify significant noise bands Otherwise design your own UFOs For each locus design a locus specific reverse primer and a pair of allele specific primers with tails whose sequences are the same as each UFO The most important steps in the primer design are checking the annealing temperature and self complementarity of primers excluding tails It is not necessary to check between locus primer compatibility Any type of SNP can be analysed using Multiplex SNP SCALE Make the sizes of PCR products as different as volumes our small
23. nomes SNPs have been widely exploited in human clinical biology such as in the HapMap project The International HapMap Consortium 2003 while several useful properties of SNPs make them advantageous in molecular ecology evolutionary genetics and conservation biology reviewed in Brumfield et al 2003 Morin et al 2004 These useful properties include their codominant inheritance low likelihood of homoplasy the ability to target markers in specific regions of the genome Aitken et al 2004 and aan at amp A Nae O CO N O1 relatively easy ascertainment in almost any species e g Primmer et al 2002 SNPs are likely to become particularly useful where it is necessary to type a large number of markers dispersed throughout the genome such as in population genomics Luikart et al 2003 and gene mapping Slate Correspondence T Kenta Fax XXXXXXX E mail kenta tanaka sheffield ac uk 2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd One of the common limitations in molecular studies of wild species is the quantity and quality of DNA This can be overcome by polymerase chain reaction PCR based analyses Allele specific PCR AS PCR is one of several techniques that make use of the PCR procedure for SNP genotyping Newton et al 1989 Okayama et al 1989 AS PCR relies on variation in primer template binding efficiency to discriminate among target alleles The typical reaction contains two a
24. rescently labelled forward primers hereafter UFO universal fluorescent oligonucleotides following Hinten et al 2007 that differ in size and colour The initial PCR products that incorporate the UFO sequences are subse quently amplified by using the UFOs and the locus specific reverse primer in the same PCR The PCR products are then separated by electrophoresis and each allele at each locus is discriminated by both size and colour In this new protocol we implement multiplex PCR by making several adaptations to the original SNP SCALE protocol These are i using the QIAGEN Multiplex PCR 2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd CON OO OBRWDNDN gt anann naa rth HP HPAP HPHPAPAPAPWBWHWWWWWWWWNNNNNNNNNYNDN AH AH AP AH AH AAA AUN DOAN DW AHKPWNH gt TDOAOAAN DAABRPWN HAYA DOAN DWDAPWNHA X VDOAOAN WDA HKRWBNH OC CO TECHNICAL ADVANCES 3 Table 1 Universal fluorescent primers referred to as UFOs following Hinten et al 2007 Relative migration is the observed size difference of PCR products including each UFO relative to UFO3 FAM the UFO that gave the smallest observed product size Both the length and dye of a UFO determine its relative migration Name with dye 5 3 mer Relative migration base pair UFO1 HEX CAGGGTTTTCCCAGTCACGAC 21 0 7 1 5 UFOI1 VIC Same Same 1 1 2 4 UFO2 FAM AGCGGATAACAATTTCACACAGGA 24 3 54 2 UFO3 FAM AGCCGTTGCTACCCTCGTTC 20 0 UFO3 PET Same Same 2 44 0 UFO4 FAM GTTC
25. ters O M M Insert or substitute space through character or between characters or words A where required Reduce space between between characters or characters or words words affected
26. the use of universal fluorescent labelled primers to reduce costs and locked nucleic acids LNA at the 3 end of each allele specific primer LNAs have a higher binding affinity and specificity to their complementary base than standard nucleic acids Koshkin et al 1998 Singh et al 1998 Latorra et al 2003 However the original SNP SCALE protocol is based on singleplex PCR and is not sufficiently time efficient to enable the analysis of 10s 100s of loci Here we present a new SNP SCALE protocol based on multiplex PCR in a much reduced reaction volume This cost effective and medium throughput protocol consisting of only a single PCR and electrophoresis in a DNA sequencer with a fluorescent dye detection system allows us to genotype 25 or potentially more SNP loci simultaneously We also compared the success rates between alternative protocols and between different types of SNPs to assist potential users to choose the best protocol GTTITCTT Lacus specific reverse primer which has Pig tail Methods Protocol overview The protocol is outlined in Fig 1 The fundamental reaction in the new protocol is the same as in the original SNP SCALE formulation for each locus two allele specific forward primers and a locus specific reverse primer amplify the targeted SNP region The allele specific forward primers which are at relatively low concentration include distinct 5 tails that are identical in sequence to two universal fluo
27. ur and length exclusion Molecular Ecology Notes 7 377 388 2008 The Authors Journal compilation 2008 Blackwell Publishing Ltd 6 CON OO OBRWDNDN anann oaa rrtrtt HPP HHP PPWBWHWWWWWWWWNNNNNNNNNYDND AH AH AP AP AH AA Aa AUN DOAN DAHPWN gt DOAODAAN DAABRPWBN HAYA TDOAOAAN DAP ON gt VDVDOAOAOAN DOA KRWBNH OC CO Koshkin AA Singh SK Nielsen P et al 1998 LNA locked nucleic acids synthesis of the adenine cytosine guanine 5 methylcytosine thymine and uracil bicyclonucleoside monomers oligomerisation and unprecedented nucleic acid recognition Tetrahedron 54 3607 3630 Latorra D Campbell K Wolter A Hurley JM 2003 Enhanced allele specific PCR discrimination in SNP genotyping using 3 locked nucleic acid LNA primers Human Mutation 22 79 85 Lovmar L Ahlford A Jonsson M Syvanen A 2005 Silhouette scores for assessment of SNP genotype clusters BMC Genomics 6 35 40 Luikart G England PR Tallmon D Jordan S Taberlet P 2003 The power and promise of population genomics from genotyping to genome typing Nature Reviews Genetics 4 981 994 Morin PA Luikart G Wayne RK and the SNP workshop Group 2004 SNPs in ecology evolution and conservation Trends in Ecology amp Evolution 19 208 216 Newton CR Graham A Heptinstall LE et al 1989 Analysis of any point mutation in DNA The amplification refractory mutation system ARMS Nucleic Acids Research 17 2503 2516 Okay
28. volume reactions have proven to be consistently stable We attribute this to the use of mineral oil to block evaporation and the initial drying down of the DNA By drying down the DNA any variation in the pipetted volumes of the DNA or the premixed PCR solution does not affect the concentration of any component of the reaction other than possibly the DNA which appears to be less critical Indeed this technique is generally useful in reducing costs while maintaining consistency in a wide range of applications For example we have also found multiplexed microsatellite amplification to be highly successful using these small reaction volumes T Kenta unpublished data The cost of Multiplex SNP SCALE including all the consumables and labour required throughout the steps from primer design to genotyping analysis is currently in the range of 0 04 0 15 per genotype for 384 1920 samples using 15 25 plex reactions The reduced labour cost of primer design achieved by using SNP SCALE PRIMER DESIGNER software contributes to this low cost There is a relatively high initial cost for primers currently c 43 per locus and so the final per genotype cost largely depends on the number of samples analysed The per genotype cost is similar for any total number of loci when the number of the plex exceeds 15 This cost is considerably less than for the original SNP SCALE method 0 12 0 22 per genotype and is comparable to commercially available
29. y designs suitable SNP SCALE primers for a batch of loci This new protocol was validated for different types of SNPs The method is cost and time effective for medium scale evolutionary and ecological projects involving 10s to 100s of loci Keywords genotyping locked nucleic acid LNA medium throughput nonmodel organism single nucleotide polymorphism SNP small reaction scale universal fluorescent labelled oligonucleotide UFO primer Received 29 September 2007 revision accepted 29 January 2008 2005 Many commercial SNP genotyping protocols have Introduction been developed using various assay methods based on Single nucleotide polymorphisms SNPs are the most hybridization ligation primer extension or enzymatic cleavage reviewed by Syvanen 2001 and Chen amp Sullivan 2003 However the majority of these methods are designed for high throughput human or model organism studies and 100s or 1000s of loci must be analysed before the protocols become cost effective although some commercially available SNP typing protocols including Sequenom s MassARRAY might be suitable for smaller projects Ecological or evolu tionary studies of nonmodel organisms which typically involve 10s 100s of loci for 100s 1000s of samples would therefore benefit from a cost effective medium throughput generic genotyping method abundant form of genetic variation and are widely distributed in both coding and noncoding regions of most ge
Download Pdf Manuals
Related Search