Home

miRNome microRNA Profilers QuantiMir™

image

Contents

1. Tissue tested 1ladipose 7 heart_ 13 prostate_ 2 bladder 8 kidney 14 skeletal muscle 3 brain 9fliver____ 15 smal intestine 4 cervix 10jlung t1jovary 6jesophagus _ 12 placenta_ 18 thymus 888 266 5066 Toll Free 650 968 2200 outside US Page 13 D System Biosciences SBI User Manual Sample Data 1 Analysis of Tumor and Normal Tissue MicroRNA expression levels using the QuantiMir Kit and Real time qPCR The QuantiMir cDNAs were synthesized from both Normal and Tumor Breast Lung Ovary Colon and Lymph node RNAs MicroRNA forward primers specific for miR 9 1 miR 155 miR 125 miR 145 miR 7 miR 17 3p miR 18a miR 20a and miR 92 were using to detect the corresponding microRNA species in the tissues detailed in the expression graph below Fig 6 The signals were normalized to expression levels of the U6 snRNA transcript Fold increases and decreases in Normal vs Tumor tissues are graphed below and are consistent with published findings for the particular microRNA in the specific tumor type Lymph Node pa a m Normal Tumor o gt a Q a wo D 2 a x wW o 2 D amp o oe miR 125b miR 125b Fig 6 Quantitative analysis of MicroRNA expression in tumor and normal tissue samples The Bar graph data are grouped by tissue type with normal tissues in blue bars and tumor tissues in red bars The specific MicroRNAs being detected are listed below the
2. and positive control primers for Human U6 snRNA 10 uM and Human miR 16 10 uM are also included with the kit Lenti miR microRNA precursor clone collection Lentivector based microRNA over exporession clones also available in pooled lentiviral library cat PMIRHxxxPA 1 http www systembio com miRNA_Precursor_Collection htm MicroRNA Discovery Kit Cat RA410A 1 Rapid identification of new MicroRNAs and MicroRNA like molecules Amplification and cloning can be initiated in a single day 3 steps 1 day The alternative method takes approximately 1 week 9 steps Small RNA Amplification and Cloning Kit Cat RA400A 1 Simple amplification kit allows cDNA amplification for qRT PCR and microarray studies from as little as 50 ng of starting total RNA Full Spectrum Global mRNA Amplification Kit Cat RA101A 1 The Full Spectrum RNA Amplification Kit provides an inexpensive method to amplify reverse transcribed RNA in a sequence independent unbiased and uniform manner with better representation of 5 end of mRNA sequences This approach maintains the relative levels of each transcript in the starting mRNA samples even when using starting amounts of RNA as low as 5ng or when using heavily degraded RNA Full Spectrum MultiStart Primers for T7 IVT Cat RA300A 2 Extract more data from your RNA than currently available primers in nearly all commercially available T7 IVT kits using Full Spectrum technology Just replace
3. 6 Meltzer PS MicroRNAs in Gene Regulation When the Smallest Governs It All J Biomed Biotechnol 2006 2006 4 69616 Ouellet DL Perron MP Gobeil LA Plante P Provost P MicroRNAs as oncogenes Curr Opin Genet Dev 2006 Feb 16 1 4 9 Epub 2005 Dec 19 Hammond SM Oncomirs microRNAs with a role in cancer Nat Rev Cancer 2006 Apr 6 4 259 69 Esquela Kerscher A Slack FJ 888 266 5066 Toll Free 650 968 2200 outside US Page 17 System Biosciences SBI User Manual MicroRNAs as oncogenes and tumor suppressors Dev Biol 2006 Aug 16 Epub ahead of print Zhang B Pan X Cobb GP Anderson TA MicroRNAs and the hallmarks of cancer Oncogene 2006 Oct 9 25 46 61 70 5 Dalmay T Edwards DR MicroRNAs exhibit high frequency genomic alterations in human cancer Proc Natl Acad Sci U S A 2006 Jun 13 103 24 9136 41 Epub 2006 Jun 5 Zhang L Huang J Yang N Greshock J Megraw MS Giannakakis A Liang S Naylor TL Barchetti A Ward MR Yao G Medina A O brien Jenkins A Katsaros D Hatzigeorgiou A Gimotty PA Weber BL Coukos G Page 18 ver 1 080721 www systembio com miRNome microRNA Profilers Human Cat RA660A 1 Vil Mouse Cat RA670A 1 Related Products QuantiMir RT Kit Cat RA420A 1 Complete reagent kit to anchor tag small RNAs and convert them to quantifiable cDNA Kit contains enough reagents for 20 RT reactions and can generate hundreds of qPCR templates A universal reverse adaptor primer 10 uM
4. Biosciences SBI User Manual General References Sonthelmer E J Carthew R W 2005 Silence from within Endogenous siRNAs and miRNAs Cell 122 9 12 Zamore P D Haley B 2005 Ribo gnome The big world of small RNAs Science 309 1519 1524 Bartel D 2004 MicroRNAs Genomics Biogenesis Mechanism and Function Cell 176 281 297 Kim Narry V 2005 Small RNAs Classification Biogenesis and Function Mol Cells 19 1 15 Valencia Sanchez MA Liu J Hannon GJ Parker R 2006 Control of translation and mRNA degradation by miRNAs and siRNAs Genes Dev 20 515 525 Lewis B P Burge C B Bartel D P 2005 Conserved seed pairing often flanked by adenosines indicates that thousands of human genes are microRNA targets Cell 120 15 20 Xie X Lu J Kulbokas E J Goulub T R Mooth V Lindblad Toh K Lander E S and Kellis M Systematic discovery of regulatory motifs in human promoters and 3 UTRs by comparison of several mammals Nature 434 338 45 Lagos Quintana M Rauhut R Lendeckel W Tuschl T 2001 Identification of Novel Coding for Small Expresses RNAs Science 294 853 858 Basyuk E Suavet F Doglio A Bordonne R Bertrand E 2003 Human let 7 stem loop precursors harbor features of RNase III cleavage products Nucleic Acids Res 31 6593 6597 Chomczynski P and Mackey K One hour downward capillary blotting of RNA at neutral pH 1994 Anal Biochem 221 303 305 Shi R Chiang
5. miRNome MicroRNA Profiler Array arrangement The array plate contains assays for microRNAs and also includes three endogenous reference RNAs as normalization signals See accompanying data CD for access to these details MT 384 microRNA Profiler QPCR Array User Manual Protocel and Data Spreadsheet Version 10 are Page 8 ver 1 080721 www systembio com miRNome microRNA Profilers Human Cat RA660A 1 Mouse Cat RA670A 1 E List of Components Each miRNome microRNA Profiler Kit contains the following components with enough material to perform at least 20 QuantiMir cDNA synthesis reactions and enough Primers in the microRNA assay array plate to perform 20 384 well qPCR plate sets as outlined in this manual Optimized for 6 ul qPCR reactions 40 ul 5X PolyA polymerase Buffer wl PolyA polymerase 20 ul 25 mM MnChk 30 pl S5mMATP_ 10 ul 3 Oligo dT Adaptor 80 ul 5X Reverse Transcriptase Buffer 20 ul Reverse Transcriptase 30 ul 0 1 M Dithiothreitol DTT 50 pl dNTP Mix 2400 wl 3 Universal Reverse PCR Primer 20 ul Each of microRNA assays three controls 1 2 mli RNase free Water The kit is shipped on blue ice and should be stored at 20 C upon arrival Properly stored kits are stable for 1 year from the date received Resuspend each primer assay well with 20ul water before use F Additional Required Materials Nuclease free water for GPCR reactions Real time
6. qPCR Instrument Instrument specific optical qPCR plates Thermocycler with heated lid Thermocycler PCR tubes or plates for end point reactions PCR Mastermix including Taq polymerase for PCR 3 0 3 5 Agarose Gel in Tris Borate EDTA TBE or Tris Acetate EDTA TAE Buffer DNA Size Ladder with markers from 50 to 2 000 bp Bio Rad AmpliSize DNA Ladder Cat 170 8200 IMPORTANT e Recommended 2X SYBR Green qPCR Mastermixes SBI has tested and recommends SYBR Green Master mix from three vendors Power SYBR Master Mix Cat numbers 4368577 4367650 4367659 4368706 4368702 4368708 4367660 from Applied Biosystems SYBR GreenER qPCR SuperMix for ABI PRISM instrument from Invitrogen Cat numbers 11760 100 11760 500 and 11760 02K and RT Real Time SYBR Green ROX PCR Cat numbers PA 012 and PA 112 from SuperArray 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual lil Quality Control and Sample Data A miRNome Array Primer Validation Tests amp endogenous Controls e Real time qPCR validation fe Gt Yew Tot peee Anata virion rr t te Cy ek Ileal et aa FOB D eo tt ta tD 48 tS 18 17 8 The miRNome microRNA Profiler qPCR Array plates were tested using a 500 ng RNA sample converted to cDNA using the QuantiMir RT Kit The resulting cDNA was tested using about 1 ng cDNA per well Shown above is the resulting Real time amplification plot for th
7. the qPCR plate using a separate multichannel pipette Page 6 ver 1 080721 www systembio com miRNome microRNA Profilers Human Cat RA660A 1 Mouse Cat RA670A 1 2 Real time qPCR Instrument Parameters Follow the guidelines as detailed for your specific Real time instrumentation The following parameters tested by SBI were performed on an Applied Biosystems 7900HT Real time PCR System but can also apply to any other 384 well system The details of the thermal cycling conditions used in testing at SBI are below A screenshot from SBI s 7900HT Real time instrument setup is shown below also Default conditions are used throughout Create a detector 1 Create a new Detector 2 Name the Detector any name will do 3 Select Reporter Dye as SYBR Green 4 Select Quencher Dye as none Instrument setup qPCR cycling and ray data accumulation 4 remora naa 4 conditions JZ Stet eon Daten smen vamo fo food Protte Auto noremert Ramp Rate Data Cofecton Stage 1 Stage Se f Standard Protocol z 1 50 C 2 min 2 95 C 10 min 3 95 C 15 sec 4 60 C 1 min 40 cycles of Stage 3 data read at 60 C 1 min Step An additional recommendation is to include a Dissociation Stage after the qPCR run to assess the Tm of the PCR amplicon to verify the specificity of the amplification reaction Refer to the User Manual for your specific instrument to conduct the melt analysis and the data ana
8. BR Green qPCR Mastermix buffer 39 ul Universal Reverse Primer 10M 5 ul User synthesized QuantiMir cDNA 1090 ul Nuclease free water 2284 ul Total Aliquot 5ul of Mastermix into every well in your 384 well qPCR Plate SBI has tested and recommends SYBR Green Master mix from three vendors 1 Power SYBR Master Mix Cat numbers 4368577 4367650 4367659 4368706 4368702 4368708 4367660 from Applied Biosystems 2 SYBR GreenER qPCR SuperMix for ABI PRISM instrument from Invitrogen Cat numbers 11760 100 11760 500 and 11760 02K 3 RT Real Time SYBR Green ROX PCR Cat numbers PA 012 and PA 112 from SuperArray Resuspend the MicroRNA assay Primers with 20ul water in each well before use Spin briefly to collect contents at bottom of wells Then Load 1ul per well of each of the Primers from the Primer Stock plate into your qPCR plate well A1 into qPCR plate A1 etc Once reagents are loaded into the wells cover the plate with an optical adhesive cover and spin briefly in a centrifuge to bring contents to bottom of wells Place plate in the correct orientation well A1 upper left into the Real time qPCR instrument and perform analysis run HELP Use a Multichannel pipette to load the qPCR plate with MasterMix and Primers Pour the Mastermix into a reservoir trough and use a 8 or 12 channel pipette to load the entire 384 well qPCR plate with the Mastermix Then load the primers from the primer plate to
9. S SBI System Biosciences miRNome microRNA Profilers QuantiMir Human Cat RA660A 1 Mouse Cat RA670A 1 Rat Cat RA680A 1 User Manual Store kit at 20 C on receipt A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement ver 1 090514 contained in this user manual miRNome microRNA Profilers Human Cat RA660A 1 Mouse Cat RA670A 1 Contents l Introduction and Background A Overview B miRNome microRNA qPCR profiler workflow C How QuantiMir cDNA synthesis works ll Protocol How the microRNA specific primers are designed miRNome microRNA Array arrangements List of Components mmMOOMP gt lll Quality Control and Sample Data A miRNome Array Primer Validation Tests amp Endogenous Controls B Sensitivity Tests C Specificity Tests D Sample Data IV Troubleshooting V General References VII Related products Vill Technical Support IX Licensing and Warranty Statement 888 266 5066 Toll Free 650 968 2200 outside US ARON 15 16 17 19 20 21 Page 1 System Biosciences SBI User Manual I Introduction and Background A Overview This manual provides details and information necessary to use the QuantiMir RT Kit to tag and convert small non coding RNAs into detectable and quantifiable cDNAs The system allows for the ability to quantitate fold diff
10. V L 2005 Facile means for quantifying microRNA expression by real time PCR BioTechniques 39 519 525 Ding Y Chan C Y and Lawrence C E 2005 RNA secondary structure prediction by centroids in a Boltzmann weighted ensemble RNA 11 1157 1166 Griffiths Jones S Grocock R J Van Dongen S Bateman A Enright A J 2006 miRBase microRNA sequences targets and gene nomenclature Nucleic Acids Research 34 D140 D144 Shingara J Keiger K Shelton J Laosinchai Wolf W Powers P Conrad R Brown D Labourier E 2005 An optimized isolation and labeling platform for accurate microRNA expression profiling RNA 71 1461 1470 He L Thomson J M Hemann M T Hernando Monge E Mu D Goodson S Powers S Cordon Cardo C Lowe S W Hannon G J Hammond S M 2005 A microRNA polycistron as a potential human oncogene Nature 435 828 833 Lai E C Wiel C Rubin G M 2004 Complementary miRNA pairs suggest a regulatory role for miRNA miRNA duplexes RNA 10 171 175 Ambros V Bartel B Bartel D P Burge C B Carrington J C Chen X Dreyfuss G Eddy S R Griffiths Jones S Marshall M Matzke M Ruvkun G Tuschl T 2003 A uniform system for microRNA annotation RNA 9 277 279 Obernosterer G Leuschner P J F Alenius M Martinez J 2006 Post transcriptional regulation of microRNA expression RNA 12 1 7 Dostie J Mourelatos Z Yang M Sharma A Dreyfuss G 2003 Nume
11. ample to be assayed on multiple qPCR 384 well plate It is important to start with total RNA that includes the small RNA fraction RNA input can be as low as 100 ng total For optimum signals perform the following Dilute your RNA to 160 ng ul Start In a thin walled PCR tube or a PCR compatible plate well combine 5 ul Total RNA 800 ng STEP 1 2 ul 5X PolyA Buffer 1 pl 25mM MnCl PolyA Tail 1 5 pl 5mM ATP 0 5 ul PolyA Polymerase 10 ul Incubate for 30 min at 37 C Add 0 5 yl Oligo dT Adapter STEP 2 Heat for von at 60 C Anneal Anchor Let cool to room temp for 2 min dT Adapter Add 4 ul 5X RT Buffer 2 ul dNTP mix STEP 3 1 5 ul 0 1M DTT Synthesize 1 5 ul Nuclease free H20 cDNAs 1 ul Reverse Transcriptase 20 5 ul Total in tube Incubate for 60 min at 42 C Heat for 10 min at 95 C The QuantiMir cDNAs can be stored at 20 C For more sensitive applications a single D O n e l phenol chloroform extraction with ethanol precipitation can be performed on the cDNA to 5 remove proteins unused dNTPs and primers typically this is not necessary 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual B Real time qPCR Reaction Setup 1 Mastermix qPCR Reaction Set up for ONE entire 384 well qPCR plate To determine the expression profile for your miRNAs under study mix the following for 1 entire 384 gPCR plate For 1 entire plate 1150 pl 2X SY
12. arzon R Sevignani C Rassenti L Alder H Volinia S Liu CG Kipps TJ Negrini M Croce CM e Lung Cancer Unique microRNA molecular profiles in lung cancer diagnosis and prognosis Cancer Cell 2006 Mar 9 3 189 98 Yanaihara N Caplen N Bowman E Seike M Kumamoto K Yi M Stephens RM Okamoto A Yokota J Tanaka T Calin GA Liu CG Croce CM Harris CC A polycistronic microRNA cluster miR 17 92 is overexpressed in human lung cancers and enhances cell proliferation Cancer Res 2005 Nov 1 65 21 9628 32 Hayashita Y Osada H Tatematsu Y Yamada H Yanagisawa K Tomida S Yatabe Y Kawahara K Sekido Y Takahashi T MicroRNA and lung cancer N Engl J Med 2005 Jun 9 352 23 2446 8 Eder M Scherr M e Pancreatic Cancer Expression profiling identifies microRNA signature in pancreatic cancer Int J Cancer 2006 Dec 5 Epub ahead of print Lee EJ Gusev Y Jiang J Nuovo GJ Lerner MR Frankel WL Morgan DL Postier RG Brackett DJ Schmittgen TD e Solid Tumors A microRNA expression signature of human solid tumors defines cancer gene targets Proc Natl Acad Sci U S A 2006 Feb 14 103 7 2257 61 Epub 2006 Feb 3 Volinia S Calin GA Liu CG Ambs S Cimmino A Petrocca F Visone R lorio M Roldo C Ferracin M Prueitt RL Yanaihara N Lanza G Scarpa A Vecchione A Negrini M Harris CC Croce CM e MicroRNA and Cancer Reviews Other Publications Cancer genomics small RNAs with big impacts Nature 2005 Jun 9 435 7043 745
13. bar graphs The expression levels are normalized to U6 snRNA transcript levels to control for RNA input The MicroRNA expression levels are depicted as ACt vales Y axis Real time assays were performed as described in Section Il D of this manual Fold changes for these specific microRNAs and the particular tumor type are documented in the literature and verified using the QuantiMir RT kit and the selected miRNA primers from the Cancer Array shown above See MicroRNA and Cancer References in Section VI Page 14 ver 1 080721 www systembio com miRNome microRNA Profilers Human Cat RA660A 1 Mouse Cat RA670A 1 IV Troubleshooting Problem Possible Solution Too much background in qPCR signals Use much less cDNA in the SYBR Green Mastermix No qPCR signals Did you select SYBR Green as the Detectors Reporter Dye Did the controls work Use more cDNA in Mastermix Check Mastermix contents and try a subset with the controls as a positive control Also try lowering the Annealing Temperature to 50 C How do select the Threshold level for Ct analysis Typically place the threshold setting in the upper third of the exponential phase of the amplification curve Also see the User Manual for your specific instrument or phone their technical Support team for guidance 888 266 5066 Toll Free 650 968 2200 outside US Page 15 10 11 12 13 14 15 16 17 18 System
14. e entire plate The Cts ranged from 16 15 to 37 8 and the Ct value for the Human U6 assay was 26 2 in this experiment Page 10 ver 1 080721 www systembio com miRNome microRNA Profilers Human Cat RA660A 1 Mouse Cat RA670A 1 e Endogenous control assays 500 ng total RNA used for QuantiMir cDNA synthesis 0 01 pl CDNA used per 6 ul qPCR reaction 333 nM Assay 170 nM 3 Reverse ABI 7900HT Instrument MCLab HotSYBR Green Reagent Amplification plots RNUAS snoRWA Human US sni DOTGMAGAAAC CAOCACGTTT A snRNA RNA OGACTOCATAATITGTOGTAGTOG CTTATTGAOOG ATACOCCOGTO Dissociation analyses 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual B Sensitivity Tests The QuantiMir cDNAs were synthesized using decreasing amounts of total starting RNA input from a pool of Human Brain Heart Kidney Placenta and Testes RNAs Real time quantitative qPCR assays were performed with Forward primers specific for Human miR 16 am 0 001 0 0001 250ng 25ng 2 5ng 250pg 25pg 25pg 250fg cDNA Input 1000 250 nanograms z y 0 6846e2 0034x R 0 9896 0 1 2 250 femtograms z250 picograms oot gt 6 Logs range of detection aom 0 0001 4 3 2 1 0 1 2 3 Log CDNA Input Fig 4 Real time qPCR data for Human miR 16 Real time qPCR amplification plots are shown in the upper inset Cycle threshold Ct values were determined using the software automatic base
15. erein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein SBI has pending patent applications related to the Product For information concerning licenses for commercial use contact SBI Limited Warranty SBI warrants that the Product meets the specifications described in the accompanying Product Analysis Certificate If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with a refund This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose SBI is committed to providing our customers with high quality prod
16. erences of microRNAs between 20 separate experimental RNA samples The array plate also includesthree endogenous RNA assays as normalization signals To ensure optimal results please read the entire manual before using the reagents and material supplied with this kit These MicroRNA qPCR Array Panels come with all the reagents necessary to tag and convert small RNAs from 20 different total RNA samples into quantifiable cDNA using the sensitive QuantiMir technology The kits include assays in pre formatted plates for either all human cat RA660A 1 or all mouse cat RA670A 1 individual microRNAs with three endogenous reference RNA controls on each plate All microRNA assays based on the Sanger miRBase microRNA database registered entries Page 2 ver 1 080721 www systembio com miRNome microRNA Profilers Human Cat RA660A 1 Mouse Cat RA670A 1 B miRNome microRNA qPCR profiler workflow miRNome microRNA Profiler Workflow Control Sample Test Sample l QuantiMir cDNA synthesis Combine QuantiMir cDNA Universal 3 Primer 2X SYBR Green Pipet mastermix into 384 well qPCR optical plates Perform Real time 5 qPCR runs Cross compare AACt measurements between Control and Test Samples What this Profiling Array Kit does The miRNome microRNA Profilers enable the quantitation of all registered microRNAs along with 3 endogenous RNA controls for normalization 1 QuantiMir cDNA
17. line and Ct settings The Bar graph depicts the relative Signal per RNA input amount for the microRNA The graph below shows the linear regression analysis with a R value of 0 989 for miR 16 Page 12 ver 1 080721 www systembio com miRNome microRNA Profilers Human Cat RA660A 1 Mouse Cat RA670A 1 C Specificity Tests Absolute Ct Value Petettes Eepression Lossi hsa miR 1 muscle hsa miR 122 wor d p S a Retettes Exorennton Losst SEESEEFISTEGGELTS LAEEEREEESEEELELE pyiaepig TERLER EHE UDRIH Fi 5 a if il 3 HE hU6 snRNA 18 human tissue total RNAs analyzed QuantiMir cDNA Normalized to hU6 signals MicroRNA hsa miIR 1 expression abundant in Heart and Muscle MicroRNA hsa miR 122 expression abundant PEHTERP SERS ERGIEES in Liver ELLAS Li i IHLE ret Fig 5 The QuantiMir cDNA sets were synthesized from 18 separate normal Human tissues and tested with 2 primers specific for 2 known miRNA molecules miR 1 heart and skeletal muscle specific and miR 122a abundant in liver The corresponding expression bar graphs are shown in Fig 5 above These two known miRNAs miR 1 and mir 122a have very specific tissue expression patterns Real time qPCR data confirmed that miR 1 is restricted to skeletal muscle and heart The sensitivity of the assays also reveals very low but detectable signals in additional tissues miR 122a is known to be highly abundant in liver
18. lyses of the amplification plots and Cycle Threshold Ct calculations In general Cycle thresholds should be set within the exponential phase of the amplification plots with software automatic baseline settings 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual C How the miRNA specific primers are designed for Detection and Quantitation in the Array MicroRNAs typically range in size from 19 24 nt We recommend using the exact sequence of the miRNA or siRNA being studied when designing the forward primer If the miRNA under study is known and documented using the miRBase database can be an easy starting point http microrna sanger ac uk sequences search shtml An example of the known and documented miRNA Human miR 16 is shown below Hsa miR 16 YU0006 2 Simple Directly use sequence PRESS MiMATOOOO0SS of mature miRNA as forward TD tsamir 16 primer in oligo design 14 uagcagcacguasauauuggcg 35 OERI experimental cloned 1 5 7 Northern 1 6 Sequence The mature miRNA sequence 5 uagcagcacguaaauauuggcg 3 can be simply converted to a DNA sequence and used directly as the forward primer for end point and qPCR analysis Forward primer for hsa miR 16 included in kit 5 TAGCAGCACGTAAATATTGGCG 3 Tm 58 9 C 45 GC and length 22 bases All of the Micro RNA specific primers for the HT 384 microRNA Profiler were designed in this fashion D
19. rous microRNPs in neuronal cells containing novel microRNAs RNA 9 180 186 Page 16 ver 1 080721 www systembio com miRNome microRNA Profilers Human Cat RA660A 1 Mouse Cat RA670A 1 VI MicroRNA and Cancer References e Breast Cancer MicroRNA gene expression deregulation in human breast cancer Cancer Res 2005 Aug 15 65 16 7065 70 lorio MV Ferracin M Liu CG Veronese A Spizzo R Sabbioni S Magri E Pedriali M Fabbri M Campiglio M Menard S Palazzo JP Rosenberg A Musiani P Volinia S Nenci Calin GA Querzoli P Negrini M Croce CM MicroRNA expression profiles classify human cancers Nature 2005 Jun 9 435 7043 745 6 Lu J Getz G Miska EA Alvarez Saavedra E Lamb J Peck D Sweet Cordero A Ebert BL Mak RH Ferrando AA Downing JR Jacks T Horvitz HR Golub TR e B cell Leukemia MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias Proc Natl Acad Sci U S A 2004 Aug 10 101 32 11755 60 Epub 2004 Jul 29 Calin GA Liu CG Sevignani C Ferracin M Felli N Dumitru CD Shimizu M Cimmino A Zupo S Dono M Dell Aquila ML Alder H Rassenti L Kipps TJ Bullrich F Negrini M Croce CM A MicroRNA signature associated with prognosis and progression in chronic lymphocytic leukemia N Engl J Med 2005 Oct 27 353 17 1793 801 Calin GA Ferracin M Cimmino A Di Leva G Shimizu M Wojcik SE lorio MV Visone R Sever NI Fabbri M luliano R Palumbo T Pichiorri F Roldo C G
20. technology tags and converts all small RNAs into cDNAs ready to use as template for real time qPCR 2 Create mastermix with QuantiMir cDNA 3 universal reverse primer and 2X SYBR Green pipet into qPCR optimcal 384 well plate 3 Pipet 1 ul of each of the microRNA assays from the miRNome assay stock plate into each well separately 4 Perform Real time qPCR runs using standard run conditions 40 cycles 60 C anneal extension 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual C How QuantiMir cDNA synthesis works How QuantiMir Works EP Single Tube 10pg 10pg microRNA total RNA j anchor tailed 3 Step Assay v microRNA 5 3 poly A Tag small RNA polymerase polyA tailed B nes AAAA S microRNA Ar Incubate at 37 C 30 min 5 AAAAAAS NV TTTTTT Anneal adaptor Anneal oligo dT adaptor 60 C 5 min 5 fi AAAAS J7 TITT TTT RT to create first strand Convert to cDNA cDNAs 42 C 60 min cDNA pool of anchor tailed microRNAs mmm T ITITI sess 5 Single cDNA synthesis 5 Profile all microRNAs Universal Reverse cDNA templates ready for qPCR primer provided 5 3 FTTTTTTTT PEE microRNA specific Forward Primer Assay Page 4 ver 1 080721 www systembio com miRNome microRNA Profilers Human Cat RA660A 1 Mouse Cat RA670A 1 ll Protocol A QuantiMir RT reaction setup for 1 RNA s
21. the existing T7 primer with the Full Spectrum primers Compatible with Affymetrix GeneChip hybridization 888 266 5066 Toll Free 650 968 2200 outside US Page 19 System Biosciences SBI User Manual Vill Technical Support For more information about SBI products and to download manuals in PDF format please visit our web site http www systembio com For additional information or technical assistance please call or email us at System Biosciences SBI 1616 North Shoreline Blvd Mountain View CA 94043 Phone 650 968 2200 888 266 5066 Toll Free Fax 650 968 2277 E mail General Information info systembio com Technical Support tech systembio com Ordering Information orders systembio com Page 20 ver 1 080721 www systembio com miRNome microRNA Profilers Human Cat RA660A 1 Mouse Cat RA670A 1 IX Licensing and Warranty Statement Limited Use License Use of the miRNome microRNA Profilers with QuantiMir i e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly h
22. ucts If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2008 System Biosciences SBI 888 266 5066 Toll Free 650 968 2200 outside US Page 21

Download Pdf Manuals

image

Related Search

Related Contents

Expert! Tokyo Seimitsu Vol.5  Manual de Instruccions  ANALOX O2 EII® Oxygen Analyser User Manual for  La Cousinade N°56 - Over-blog  FAST LJ150-2 - Ovelha Negra  User Manual    Yamaha (AE031) REV-X Owner's Manual  Support mural Mode d`emploi  1 - Siemens  

Copyright © All rights reserved.
Failed to retrieve file