TOPO - Thermo Fisher Scientific
Contents
1. 284 933 and 5 310 663 and foreign equivalents from Hoffmann LaRoche Inc Nutley NJ and or Hoffmann LaRoche Ltd Basel Switzerland and is provided only for use in research Information about licenses for commercial use is available from QIAGEN GmbH Max Volmer Str 4 D 40724 Hilden Germany 25 References Andersson S Davis D L Dahlback H J rnvall H and Russell D W 1989 Cloning Structure and Expression of the Mitochondrial Cytochrome P 450 Sterol 26 Hydroxylase a Bile Acid Biosynthetic Enzyme J Biol Chem 264 8222 8229 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A and Struhl K 1994 Current Protocols in Molecular Biology New York Greene Publishing Associates and Wiley Interscience Boshart M Weber F Jahn G Dorsch H sler K Fleckenstein B and Schaffner W 1985 A Very Strong Enhancer is Located Upstream of an Immediate Early Gene of Human Cytomegalovirus Cell 41 521 530 Brownstein M J Carpten J D and Smith J R 1996 Modulation of Non Templated Nucleotide Addition by Tag DNA Polymerase Primer Modifications that Facilitate Genotyping BioTechniques 20 1004 1010 Chen C and Okayama H 1987 High Efficiency Transformation of Mammalian Cells by Plasmid DNA Molec Cell Biol 7 2745 2752 Chu G Hayakawa H and Berg P 1987 Electroporation for the Efficient Transfection of Mammalian Cells with DNA Nucleic2. F 1 760 602 6500 E tech_support invitrogen com For country specific contact information visit our web site at www invitrogen com
3. The C terminal peptide containing the V5 epitope and the polyhistidine region will add approximately 5 kDa to your protein A number of antibodies are available from Invitrogen to detect expression of your fusion protein from pcDNA 3 1 V5 His TOPO The table below describes the antibodies available and ordering information The amount supplied is sufficient for 25 westerns Antibody Purpose Catalog no Anti V5 Detects 14 amino acid epitope derived R960 25 from the P and V proteins of the paramyxovirus SV5 Southern et al 1991 Anti V5 HRP See above Provided as an HRP R961 25 conjugate for time saving detection Detects the C terminal polyhistidine tag R930 25 requires the free carboxyl group for detection Lindner et al 1997 Anti His C term See above Provided as an HRP HRP conjugate for time saving detection Anti His C term R931 25 continued on next page Expression and Purification continued Preparing Cells for Use the procedure below to prepare cells for lysis prior to purification of your protein on ProBond You will need 5 x 10 to 1 x 10 cells for purification of your protein on a 2 ml ProBond column see ProBond Purification System Purification manual 1 Seed cells in five T 75 flasks or 2 to 3 T 175 flasks 2 Grow the cells in selective medium until they are 80 90 confluent 3 Harvest the cells by treating with trypsin EDTA for 2 to 5
4. antigen Neomycin G418 resistance gene Selection of stable transfectants in mammalian cells Southern and Berg 1982 SV40 polyadenylation signal Efficient transcription termination and polyadenylation of mRNA pUC derived origin High copy number replication and growth in E coli Ampicillin resistance gene B lactamase Selection of vector in E coli 21 Map of pcDNA 3 1 V5 His TOPO lacZ Description pcDNA 3 1 V5 His TOPO lacZ is a 8 592 bp control vector containing the gene for B galactosidase The lacZ gene was amplified and TOPO Cloned into pcDNA 3 1 V5 His TOPOS such that it is in frame with the C terminal peptide Map of Control The figure below summarizes the features of the pcDNA 3 1 V5 His Vector TOPO lacZ vector The complete nucleotide sequence for peDNA 3 1 V5 His TOPO lacZ is available for downloading from www invitrogen com or by contacting Technical Support page 24 _I GE lac gt 2 5 35 V5epitope Sl hiso seo 5 ij 5 252254 V5 epitope 2 pcDNA3 1 V5 His TOPO Comments for pcDNA3 1 V5 His TOPO lacZ 8592 nucleotides CMV promoter bases 209 863 T7 promoter priming site bases 863 882 LacZ portion of fusion bases 963 4019 V5 epitope bases 4089 4130 Polyhistidine tag bases 4140 4157 BGH Reverse priming site bases 4180 4197 BGH polyadenylation signal bases 4179 4393 f1 origin of replication bases 4456 4869 SV40
5. diagram below to design your PCR primers Once you have designed your PCR primers proceed to the next page Do not add 5 phosphates to your primers for PCR The PCR product synthesized will not ligate into pcDNA 3 1 V5 His TOPO Note TOPO TA Restriction sites are labeled to indicate the actual cleavage site The vector is Cloning Site supplied linearized between base pair 953 and 954 This is the TOPO Cloning site Note that the full sequence of peDNA 3 1 V5 His TOPO may be downloaded from www invitrogen com or requested from Technical Support see page 24 A map of pcDNA 3 1 V5 His TOPO is provided on page 19 CAAS En Sendar Y prometei Putative transcriptional start 761 CCCATTGACG CAAATGGGCG GTAGGCGTGT ACGGTGGGAG GTCTATATAA GCAGAGCTCT CTGGCTAACT AGAGAACCCA 841 921 987 1053 1122 1202 T7 promoter priming site Hind III Kpn BamH 1 I I I CTGCTTACTG GCTTATCGAA ATTAATACGA CTCACTATAG GGAGACCCAA GCTGGCTAGT TAAGCTTGGT ACCGAGCTCG BstX EcoR V BstX Not I I I I I GATCCACTAG TCCAGTGTGG TGGAATTGCC EEN GGC AAT TCT GCA GAT ATC CAG CAC AGT GGC ACCTTAACGG GAM ERSA TTC CCG TTA AGT Lys Gly Asn Ser Ala Asp Ile Gln His Ser Gly Xho I Xba I Dra II Apal Sacil BstB V5 epitope I I l I r GGC CGC TCG AGT CTA GAG GGC CCG CGG TTC GAA GGT AAG CCT ATC CCT AAC CCT CTC CTC GGT CTC Gly Arg Ser Ser Leu Glu Gly Pro Arg Phe Glu Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Age Polyhistidine region Pme BGH
6. during PCR Be sure to include a final extension step of 7 to 30 minutes during PCR Longer PCR products need a longer extension time Cloning large inserts gt 3 kb Gel purify as described on page 16 Excess or overly dilute PCR product Reduce or concentrate the amount of PCR product Cloning blunt ended fragments Add 3 A overhangs by incubating with Taq polymerase page 18 PCR cloning artifacts false positives TOPO Cloning is very efficient for small fragments lt 100 bp present in certain PCR reactions Gel purify your PCR product page 16 PCR product does not contain sufficient 3 A overhangs even though you used Tag polymerase Taq polymerase is less efficient at adding a nontemplate 3 A next to another A Tag is most efficient at adding a nontemplate 3 A next to a C You may have to redesign your primers so that they contain a 5 G instead of a 5 T Brownstein et al 1996 17 Purifying PCR Products Introduction Note Using the PureLink Quick Gel Extraction Kit Low Melt Agarose Method 18 Smearing multiple banding primer dimer artifacts or large PCR products gt 1 kb may necessitate gel purification If you intend to purify your PCR product be extremely careful to remove all sources of nuclease contamination There are many protocols to isolate DNA fragments or remove oligonucleotides Refer to Current Protocols in Molec
7. minutes or by scraping the cells in PBS 4 Inactivate the trypsin by diluting with fresh medium if necessary and transfer the cells to a sterile microcentrifuge tube 5 Centrifuge the cells at 1 500 rpm for 5 minutes You may lyse the cells immediately or freeze in liquid nitrogen and store at 80 C until needed Note For cell lysis procedures refer to the ProBond Purification System manual if using ProBond If you are using a different resin refer to the manufacturer s instructions 13 Creation of Stable Cell Lines Introduction Geneticin Selective Antibiotic Geneticin Selection Guidelines 14 If you wish to create stable cell lines select for foci using Geneticin Selective Antibiotic General information and guidelines are provided below Geneticin Selective Antibiotic blocks protein synthesis in mammalian cells by interfering with ribosomal function It is an aminoglycoside similar in structure to neomycin gentamycin and kanamycin Expression in mammalian cells of the bacterial aminoglycoside phosphotransferase gene APH derived from Tn5 results in detoxification of Geneticin Southern and Berg 1982 Geneticin Selective Antibiotic is available from Invitrogen page vi Use as follows 1 Prepare Geneticin in a buffered solution e g 100 mM HEPES pH 7 3 2 Use 100 to 1 000 ug ml of Geneticin in complete medium 3 Calculate concentration based on the amount of activ
8. starting volume of the amplification reaction You may also gel purify your PCR product after amplification with Vent or Pfu see previous page After purification add Taq polymerase buffer dATP and 0 5 unit of Taq polymerase and incubate 10 15 minutes at 72 C Use 4 pl in the TOPO Cloning reaction 19 pcDNA 3 1 V5 His TOPO Map The figure below summarizes the features of the pcDNA 3 1 V5 His TOPO vector The vector is supplied linearized between base pairs 953 and 954 This is the TOPO Cloning site The complete nucleotide sequence is available for downloading from www invitrogen com or from Technical Support page 24 Comments for pcDNA3 1 V5 His TOPO 5523 nucleotides CMV promoter bases 209 863 T7 promoter priming site bases 863 882 Multiple cloning site bases 902 1019 TOPO Cloning site 953 954 V5 epitope bases 1020 1061 Polyhistidine tag bases 1071 1088 BGH reverse priming site bases 1111 1128 BGH polyadenylation signal bases 1110 1324 f1 origin of replication bases 1387 1800 SV40 promoter and origin bases 1865 2190 Neomycin resistance gene bases 2226 3020 SV40 polyadenylation signal bases 3039 3277 pUC origin bases 3709 4382 Ampicillin resistance gene bases 4527 5387 pcDNA3 1 V5 His TOPO 20 continued on next page pcDNA 3 1 V5 His TOPO S continued Features of pcDNA 3 1 V5 His TOPO pcDNA 3 1 V5 His TOPO contains the following eleme
9. 13 15 in parallel with your samples Recent experiments at Invitrogen demonstrate that inclusion of salt 200 mM NaCl 10 mM MgCl in the TOPO Cloning reaction increases the number of transformants 2 to 3 fold We have also observed that in the presence of salt incubation times of greater than 5 minutes can also increase the number of transformants This is in contrast to earlier experiments without salt where the number of transformants decreases as the incubation time increases beyond 5 minutes Inclusion of salt allows for longer incubation times because it prevents topoisomerase I from rebinding and potentially nicking the DNA after ligating the PCR product and dissociating from the DNA The result is more intact molecules leading to higher transformation efficiencies Because of the above results we recommend adding salt to the TOPO Cloning reaction A stock salt solution is provided in the kit for this purpose Note that the amount of salt added to the TOPO Cloning reaction varies depending on whether you plan to transform chemically competent cells provided or electrocompetent cells see below For this reason two different TOPO Cloning reactions are provided to help you obtain the best possible results Review the following information carefully For TOPO Cloning and transformation into chemically competent E coli adding sodium chloride and magnesium chloride to a final concentration of 200 mM NaCl 10 mM MgCl i
10. 24 Purchaser AAA A 25 REC ai li a oler 27 Kit Contents and Storage Shipping and Storage Types of Kits TOPO TA Cloning Reagents The pcDNA 3 1 V5 His TOPO TA Expression Kit is shipped on dry ice Each kit contains a box with pcDNA 3 1 V5 His TOPO TA Cloning reagents Box 1 and a box with One Shot TOP10 chemically competent cells Box 2 Store Box 1 at 20 C and Box 2 at 80 C Ordering information for the pcDNA 3 1 V5 His TOPO TA Expression Kits is provided below Kit Reactions Catalog no pcDNA 3 1 V5 His TOPO TA Expression 20 K4800 01 40 K4800 40 pcDNA 3 1 V5 His TOPO TA Cloning reagents Box 1 are listed below Note that the user must supply Taq polymerase Store Box 1 at 20 C Item Concentration Amount pcDNA 3 1 V5 His TOPO 10 ng ul plasmid DNA in 20 pl 50 glycerol 50 mM Tris HCl pH 7 4 at 25 C 1mM EDTA 2 mM DTT 0 1 Triton X 100 100 ug ml BSA 30 uM phenol red 10X PCR Buffer 100 mM Tris HCI pH 8 3 at 100 ul 42 C 500 mM KCI 25 mM MgCl 0 01 gelatin 50 mM dNTPs 12 5 mM dATP 125mMdCTP 10 ul 12 5 mM dGTP 12 5 mM dTTP neutralized at pH 8 0 in water Salt Solution 1 2 M NaCl 0 06 M MgCl 50 pl T7 Sequencing Primer 0 1 ug ul in TE Buffer 20 ul BGH Reverse Sequencing 0 1 pg pl in TE Buffer 20 pl Primer Control PCR Template 0 05 ug ul in TE Buffer 10 pl Control PCR Primers 0 1 ug ul each in TE Buf
11. 30 minutes does not significantly improve transformation efficiency If you are TOPO Cloning large PCR products toxic genes or cloning a pool of PCR products you may need more transformants to obtain the clones you want To increase the number of colonies e Incubate the salt supplemented TOPO Cloning reaction for 20 to 30 minutes instead of 5 minutes Increasing the incubation time of the salt supplemented TOPO Cloning reaction allows more molecules to ligate increasing the transformation efficiency Addition of salt appears to prevent topoisomerase from rebinding and nicking the DNA after it has ligated the PCR product and dissociated from the DNA To clone dilute PCR products you may e Increase the amount of the PCR product e Incubate the TOPO Cloning reaction for 20 to 30 minutes e Concentrate the PCR product Transfection Introduction Plasmid Preparation Methods of Transfection Positive Control Assay for p galactosidase Activity Once you have the desired construct you are ready to transfect the plasmid into the mammalian cells of choice Note the following guidelines for transfection Included in the kit is an expression control vector peDNA 3 1 V5 His TOPO lacZ which you can use to check both transfection efficiencies and expression in your particular cell line Plasmid DNA for transfection into eukaryotic cells must be very clean and free from phenol and sodium chloride Conta
12. Acids Res 15 1311 1326 Felgner P L Holm M and Chan H 1989 Cationic Liposome Mediated Transfection Proc West Pharmacol Soc 32 115 121 Felgner P L and Ringold G M 1989 Cationic Liposome Mediated Transfection Nature 337 387 388 Goodwin E C and Rottman F M 1992 The 3 Flanking Sequence of the Bovine Growth Hormone Gene Contains Novel Elements Required for Efficient and Accurate Polyadenylation J Biol Chem 267 16330 16334 Innis M A Gelfand D H Sninsky J J and White T S 1990 PCR Protocols A Guide to Methods and Applications Academic Press San Diego CA Lindner P Bauer K Krebber A Nieba L Kremmer E Krebber C Honegger A Klinger B Mocikat R and Pluckthun A 1997 Specific Detection of His tagged Proteins With Recombinant Anti His Tag scFv Phosphatase or scFv Phage Fusions BioTechniques 22 140 149 Miller J H 1972 Experiments in Molecular Genetics Cold Spring Harbor New York Cold Spring Harbor Laboratory Nelson J A Reynolds Kohler C and Smith B A 1987 Negative and Positive Regulation by a Short Segment in the 5 Flanking Region of the Human Cytomegalovirus Major Immediate Early Gene Molec Cell Biol 7 4125 4129 Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition Plainview New York Cold Spring Harbor Laboratory Press Shigekawa K and Dower W J 1988
13. Electroporation of Eukaryotes and Prokaryotes A General Approach to the Introduction of Macromolecules into Cells BioTechniques 6 742 751 Shuman S 1994 Novel Approach to Molecular Cloning and Polynucleotide Synthesis Using Vaccinia DNA Topoisomerase J Biol Chem 269 32678 32684 continued on next page 27 References continued Shuman S 1991 Recombination Mediated by Vaccinia Virus DNA Topoisomerase I in Escherichia coli is Sequence Specific Proc Natl Acad Sci USA 88 10104 10108 Southern J A Young D F Heaney F Baumgartner W and Randall R E 1991 Identification of an Epitope on the P and V Proteins of Simian Virus 5 That Distinguishes Between Two Isolates with Different Biological Characteristics J Gen Virol 72 1551 1557 Southern P J and Berg P 1982 Transformation of Mammalian Cells to Antibiotic Resistance with a Bacterial Gene Under Control of the SV40 Early Region Promoter J Molec Appl Gen 1 327 339 Wigler M Silverstein S Lee L S Pellicer A Cheng Y C and Axel R 1977 Transfer of Purified Herpes Virus Thymidine Kinase Gene to Cultured Mouse Cells Cell 11 223 232 2009 Life Technologies Corporation All rights reserved For research use only Not intended for any animal or human therapeutic or diagnostic use 28 invitrogen Corporate Headquarters Invitrogen Corporation 5791 Van Allen Way Carlsbad CA 92008 T 1 760 603 7200
14. Reverse I r 1 i __ GAT TCT ACG CGT ACC GGT CAT CAT CAC CAT CAC CAT TGA GTTTAAACCC GCTGATCAGC CTCGACTGTG Asp Ser Thr Arg Thr Gly His His His His His His priming site CCTTCTAGTT GCCAGCCATC TGTTGTTTGC CCCTCCCCCG TGCCTTCCTT GACCCTGGAA GGTGCCACTC CCACTGTCCT BGH polyadenylation signal fe el TTCCTAATAA AATGAGGAAA TTGCATCGCA TTGTCTGAGT AGGTGTCATT CTATTCTGGG GGGTGGGGTG GGGCAGGAC Producing PCR Products Introduction Materials Supplied by the User Polymerase Mixtures Producing PCR Products Note Once you have decided on a PCR strategy and have synthesized the primers you are ready to produce your PCR product e Taq polymerase e Thermocycler e DNA template and primers for PCR product If you wish to use a mixture containing Tag polymerase and a proofreading polymerase Taq must be used in excess of a 10 1 ratio to ensure the presence of 3 A overhangs on the PCR product i e Expand or eLONGase If you use polymerase mixtures that do not have enough Tag polymerase or a proofreading polymerase only you can add 3 A overhangs using the method on page 18 1 Setup the following 50 pl PCR reaction Use less DNA if you are using plasmid DNA as a template and more DNA if you are using genomic DNA as a template Use the cycling parameters suitable for your primers and template Be sure to include a 7 to 30 minute extension at 72 C after the last cycle to ensure that all PCR products are full
15. at you plate two different volumes to ensure that at least one plate will have well spaced colonies An efficient TOPO Cloning reaction will produce hundreds of colonies Pick 10 colonies for analysis see Analysis of Positive Clones next page Add 2 pl of the TOPO Cloning reaction into a 0 1 cm cuvette containing 50 ul of electrocompetent E coli and mix gently Do not mix by pipetting up and down Avoid formation of bubbles Electroporate your samples using your own protocol and your electroporator Note If you have problems with arcing see below Immediately add 250 ul of room temperature SOC medium Transfer the solution to a 15 ml snap cap tube i e Falcon and shake for at least 1 hour at 37 C to allow expression of the antibiotic resistance gene Spread 10 50 ul from each transformation on a prewarmed selective plate and incubate overnight at 37 C To ensure even spreading of small volumes add 20 pl of SOC We recommend that you plate two different volumes to ensure that at least one plate will have well spaced colonies An efficient TOPO Cloning reaction will produce hundreds of colonies Pick 10 colonies for analysis see Analysis of Positive Clones next page Addition of the Dilute Salt Solution in the TOPO Cloning Reaction brings the final concentration of NaCl and MgCl in the TOPO Cloning reaction to 50 mM and 2 5 mM respectively To prevent arcing of your samples during electroporation the volum
16. ctor Tag polymerase has a nontemplate dependent terminal transferase activity that adds a single deoxyadenosine A to the 3 ends of PCR products The linearized vector supplied in this kit has single overhanging 3 deoxythymidine T residues This allows PCR inserts to ligate efficiently with the vector Topoisomerase I from Vaccinia virus binds to duplex DNA at specific sites and cleaves the phosphodiester backbone after 5 CCCTT in one strand Shuman 1991 The energy from the broken phosphodiester backbone is conserved by formation of a covalent bond between the 3 phosphate of the cleaved strand and a tyrosyl residue Tyr 274 of topoisomerase I The phospho tyrosyl bond between the DNA and enzyme can subsequently be attacked by the 5 hydroxyl of the original cleaved strand reversing the reaction and releasing topoisomerase Shuman 1994 TOPO Cloning exploits this reaction to efficiently clone PCR products see below Topoisomerase Led ie CCCTT INAGGG GGGARN PCR Product TTCCC HO B Topoisomerase Once the PCR product is cloned into peDNA 3 1 V5 His TOPO and transformants analyzed for the correct orientation of the PCR product the plasmid is transfected into mammalian cells for expression The PCR product may be expressed as a fusion to the V5 epitope and polyhistidine tag for detection and purification or by designing the 3 PCR primer with a stop codon the PCR product may be expressed as a
17. e drug 4 Test varying concentrations of Geneticin on your cell line to determine the concentration that kills your cells kill curve Cells differ in their susceptibility to Geneticin Cells will divide once or twice in the presence of lethal doses of Geneticin so the effects of the drug take several days to become apparent Complete selection can take from 2 to 4 weeks of growth in selective medium Appendix pcDNA 3 1 V5 His TOPO TA Cloning Control Reactions Introduction Before Starting Producing the Control PCR Product We recommend performing the following control TOPO Cloning reactions the first time you use the kit to help you evaluate your results Performing the control reactions using the reagents included in the kit involves producing a control PCR product containing the lac promoter and the LacZa protein Successful TOPO Cloning of the control PCR product will yield blue colonies on LB agar plates containing ampicillin and X gal Be sure to prepare the following reagents before performing the control reaction 40 mg ml X gal in dimethylformamide see page 22 for recipe LB plates containing 50 100 pg ml ampicillin and X gal two per transformation To add X gal to previously made agar plates warm the plate to 37 C Pipette 40 pl of the 40 mg ml stock solution onto the plate spread evenly and let dry 15 minutes Protect plates from light To produce the 500 bp control PCR product c
18. e of cells should be between 50 and 80 ul 0 1 cm cuvettes or 100 to 200 pl 0 2 cm cuvettes If you experience arcing during transformation Reduce the voltage normally used to charge your electroporator by 10 Reduce the pulse length by reducing the load resistance to 100 ohms Ethanol precipitate the TOPO Cloning reaction and resuspend in water prior to electroporation continued on next page TOPO Cloning Reaction and Transformation continued Analysis of Positive Clones 1 Pick 10 colonies and culture them overnight in LB medium containing 50 pg ml ampicillin 3 5 ml 2 Isolate plasmid DNA using your method of choice If you need ultra pure plasmid DNA for automated or manual sequencing we recommend the PureLink HiPure Miniprep Kit or the PureLink HiPure Midiprep Kit see page vi for ordering information 3 Note that PCR products clone bidirectionally Analyze the plasmids for insertion and orientation by restriction analysis or by sequencing The T7 and BGH Reverse sequencing primers are included to help you sequence your insert Refer to the diagram on page 3 for restriction sites and sequence surrounding the TOPO Cloning site For the complete sequence of the vector see www invitrogen com or contact Technical Support page 24 If you need help with setting up restriction enzyme digests or DNA sequencing refer to general molecular biology texts Ausubel et al 1994 Sambrook et al 1989 Al
19. ent continued on next page TOPO Cloning Reaction and Transformation continued Long Term Storage Once you have identified the correct clone be sure to isolate a single colony and prepare a glycerol stock for long term storage We recommend that you store a stock of plasmid DNA at 20 C 1 Streak the original colony on LB plates containing 50 100 pg ml ampicillin 2 Isolate a single colony and inoculate into 1 2 ml of LB containing 50 100 pg ml ampicillin Grow until culture reaches stationary phase 3 Mix 0 85 ml of culture with 0 15 ml of sterile glycerol and transfer to a cryovial 4 Store at 80 C Optimizing the TOPO Cloning Reaction Introduction Faster Subcloning More Transformants Cloning Dilute PCR Products 10 The information below will help you optimize the TOPO Cloning reaction for your particular needs The high efficiency of TOPO Cloning technology allows you to streamline the cloning process If you routinely clone PCR products and wish to speed up the process consider the following e Incubate the TOPO Cloning reaction for only 30 seconds instead of 5 minutes You may not obtain the highest number of colonies but with the high cloning efficiency of TOPO Cloning most of the transformants will contain your insert e After adding 2 ul of the TOPO Cloning reaction to chemically competent cells incubate on ice for only 5 minutes Increasing the incubation time to
20. es Visit the Invitrogen website at www invitrogen com for e Technical resources including manuals vector maps and sequences application notes MSDSs FAQs formulations citations handbooks etc e Complete technical support contact information e Access to the Invitrogen Online Catalog e Additional product information and special offers Contact Us For more information or technical assistance call write fax or email Additional international offices are listed on our website www invitrogen com Corporate Headquarters Japanese Headquarters European Headquarters 5791 Van Allen Way LOOP X Bldg 6F Inchinnan Business Park Carlsbad CA 92008 USA 3 9 15 Kaigan 3 Fountain Drive Tel 1 760 603 7200 Minato ku Tokyo 108 0022 Paisley PA4 9RF UK Tel Toll Free 1 800 955 6288 Tel 81 3 5730 6509 Tel 44 0 141 814 6100 Fax 1 760 602 6500 Fax 81 3 5730 6519 Tech Fax 44 0 141 814 6117 E mail tech support invitrogen com E mail jpinfo invitrogen com E mail eurotechQinvitrogen com MSDS Certificate of Analysis Limited Warranty 24 Material Safety Data Sheets MSDSs are available on our website at www invitrogen com msds The Certificate of Analysis provides detailed quality control and product qualification information for each product Certificates of Analysis are available on our website Go to www invitrogen com support and search for the Certificate of Analysis by product
21. es for analysis Depending on your needs the length of the TOPO Cloning reaction can be varied from 30 seconds to 30 minutes For routine subcloning of PCR products 30 seconds may be sufficient For large PCR products gt 1 kb or if you are TOPO Cloning a pool of PCR products increasing the reaction time will yield more colonies 2 Place the reaction on ice and proceed to One Shot Chemical Transformation next page or Transformation by Electroporation next page Note You may store the TOPO Cloning reaction at 20 C overnight continued on next page TOPO Cloning Reaction and Transformation continued One Shot TOP10 Chemical Transformation Transformation by Electroporation Note 1 MOY OG RA o9 Add 2 ul of the TOPO Cloning reaction from Step 2 previous page into a vial of One Shot TOP10 Chemically Competent E coli and mix gently Do not mix by pipetting up and down Incubate on ice for 5 to 30 minutes Note Longer incubations on ice seem to have a minimal effect on transformation efficiency The length of the incubation is at the user s discretion see page 9 Heat shock the cells for 30 seconds at 42 C without shaking Immediately transfer the tubes to ice Add 250 ul of room temperature SOC medium Cap and shake the tube horizontally 200 rpm at 37 C for 1 hour Spread 25 200 ul from each transformation on a prewarmed selective plate and incubate overnight at 37 C We recommend th
22. fer 10 pl Expression Control Plasmid 0 5 ug ul in TE Buffer 10 pl Sterile Water 1 ml continued on next page Kit Contents and Storage continued One Shot Reagents Sequencing Primers Genotype of TOP10 Cells The table below describes the items included in the One Shot chemically competent cell kit Store at 80 C Item Composition Amount TOP10 cells 21 x 50 pl SOC Medium 2 Tryptone 6 ml may be stored at 4 C or 0 5 Yeast Extract room temperature 10 mM NaCl 2 5 mM KCl 10 mM MgCl 10 mM MgSO4 20 mM glucose pUC19 Control DNA 10 pg ul in 5 mM Tris HCI 50 ul 0 5 mM EDTA pH 8 0 The table below provides the sequence and pmoles of the T7 sequencing primer and BGH Reverse sequencing primer Primer Sequence Amount T7 5 TAATACGACTCACTATAGGG 3 328 pmoles BGH Reverse 5 TAGAAGGCACAGTCGAGG 3 358 pmoles TOP10 Use this strain for general cloning Note that this strain cannot be used for single strand rescue of DNA F mcrA A mrr hsdRMS mcrBC 80lacZAM15 AlacX74 recA1 araD139 A ara leu 7697 galU galK rpsL Str endA1 nupG Accessory Products Additional The table below lists additional products available from Invitrogen which you Products may use in conjunction with the peDNA 3 1 V5 His TOPO TA Expression Kit For details on the product visit www invitrogen com Item Amount Cata
23. g the method on page 10 Addition of 3 A Overhangs Post Amplification Introduction Materials Needed Procedure Note Direct cloning of DNA amplified by Vent or Pfu polymerases into TOPO TA Cloning vectors is often difficult because of very low cloning efficiencies These low efficiencies are caused by the lack of the terminal transferase activity associated with proofreading polymerases which adds the 3 A overhangs necessary for TA Cloning A simple method is provided below to clone these blunt ended fragments e Taq polymerase e A heat block equilibrated to 72 C e Phenol chloroform optional e 3 M sodium acetate optional e 100 ethanol optional e 80 ethanol optional e TE buffer optional This is just one method for adding 3 adenines Other protocols may be suitable 1 After amplification with Vent or Pfu polymerase place vials on ice and add 0 7 1 unit of Taq polymerase per tube Mix well It is not necessary to change the buffer Incubate at 72 C for 8 10 minutes do not cycle Place the vials on ice The DNA amplification product is now ready for ligation into pcDNA 3 1 V5 His TOPO Note If you plan to store your sample s overnight before proceeding with TOPO Cloning you may want to extract your sample s with phenol chloroform to remove the polymerases After phenol chloroform extraction precipitate the DNA with ethanol and resuspend the DNA in TE buffer to the
24. ice Transform 2 ul of each reaction into separate vials of One Shot TOP10 cells page 7 4 Spread 10 50 pl of each transformation mix onto LB plates containing 50 100 pg ml ampicillin and X Gal see page 22 Be sure to plate two different volumes to ensure that at least one plate has well spaced colonies For plating small volumes add 20 pl of SOC to allow even spreading 5 Incubate overnight at 37 C Hundreds of colonies from the vector PCR insert reaction should be produced Greater than 90 of these will be blue and contain the 500 bp insert pUC19 plasmid is included to check the transformation efficiency of the One Shot TOP10 competent cells Transform one vial of One Shot TOP10 cells with 10 pg of pUC19 using the protocol on page 7 Plate 10 ul of the transformation mixture plus 20 ul SOC on LB plates containing 100 pg ml ampicillin Transformation efficiency should be 1 x 10 cfu ug DNA continued on next page pcDNA 3 1 V5 His TOPO TA Cloning Control Reactions continued Factors Affecting Cloning Efficiency Note that lower transformation and or cloning efficiencies will result from the following variables Most of these are easily corrected but if you are cloning large inserts you may not obtain the expected 90 or more cloning efficiency Variable Solution pH gt 9 Check the pH of the PCR amplification reaction and adjust with 1 M Tris HCl pH8 Incomplete extension
25. idase is expressed in mammalian cells under the CMV promoter A successful transfection will result in B galactosidase expression that can be easily assayed see below You may assay for B galactosidase expression by activity assay using cell free lysates Miller 1972 or by staining the cells for activity Invitrogen offers the Gal Assay Kit Catalog no K1455 01 and the B Gal Staining Kit Catalog no K1465 01 for fast and easy detection of P galactosidase expression 11 Expression and Purification Introduction Detection of Fusion Proteins Note Antibodies for Detection 12 Expression of your PCR product can be performed in transiently transfected cells or stable cell lines see page 12 for guidelines to create stable cell lines You may use a functional assay to detect the protein encoded by your PCR product or a western blot analysis if you have an antibody to the protein If you have elected to express your PCR product as a fusion to the V5 epitope and the polyhistidine tag you may use antibodies to the V5 epitope or the polyhistidine C terminus to detect the fusion protein If you wish the fusion protein may be purified using metal ion chromatography see below To detect the fusion protein by western blot you need to prepare a cell lysate from transfected cells We recommend that you perform a time course to optimize expression of the fusion protein e g 24 48 72 hours after transfection
26. invitrogen pcDNA 3 1 V5 His TOPO TA Expression Kit Five minute cloning and expression of Taq polymerase amplified PCR products in mammalian cells Catalog nos K4800 01 K4800 40 Rev Date 10 April 2009 Part no 25 0203 MAN0000055 Table of Contents Kit Contents and Storage nnnnnsnsenene naren enenenenenenenenenenenenenenenenenenenensneneeneneneneneneneneeneneneneneneneenenenenenenenenens iv Ace ssory Products tn EGEN vi Introduction EN NN NE NE anneanne nnna 1 OVA Aaa a eneen ante nn 1 NOT eee 3 PER Primers A O O 3 Producing PCR Products insi nerede se diria eenen deden dana nende 4 TOPO Cloning Reaction and Transtornos calidad rolas dd teneis 5 Optimizing the TORO Cloning Reaction int di iii aaa 10 A NA 11 Expression and Purification nnnsnnenenenenenenseneneneneneneneneneneneneenenenenenenenenenenenenenenenenenneneneneneneneenenenenenenenenenn 12 Creation of Stable Cell Lines reisine a aeee aeyn ieee E An EEEa AERE deesesvaeds Bean Dana EEE EAE E ASERS 14 APPO Drac a sac a A a E E Aaa De 15 pcDNA 3 1 V5 His TOPO TA Cloning Control Reactions cion 15 Puritying PGR Products ota atada 18 Addition of 3 A Overhangs Post Amplification nnn enenensenenenenenensenenenenenenennenenenenenenenenenersenenenenenn 19 PDNA 31 VS Hs TODO ngun e aa bent satel dunia a a E T EA 20 Map of peDNA SL VS MTP etat a eai iae 22 Recipes 23 Technical Supporten eee see a yi O EEEE esta k rder ah shave Geese ER aa EE rias
27. length and 3 adenylated DNA Template 10 100 ng 10X PCR Buffer 5 ul 50 mM dNTPs 0 5 pl Primers 100 200 ng each Sterile water add to a final volume of 49 ul Tag Polymerase 1 unit ul 1 ul Total Volume 50 pl 2 Check the PCR product by agarose gel electrophoresis You should see a single discrete band If you do not see a single band refer to the Note below If you do not obtain a single discrete band from your PCR you may gel purify your fragment before using the peDNA 3 1 V5 His TOPO TA Expression Kit see page 16 Take special care to avoid sources of nuclease contamination and long exposure to UV light Alternatively you may optimize your PCR to eliminate multiple bands and smearing Innis et al 1990 The PCR Optimizer Kit Catalog no K1220 01 from Invitrogen can help you optimize your PCR Contact Technical Support for more information page 24 TOPO Cloning Reaction and Transformation Introduction Note Important Chemically Competent E coli Electrocompetent E coli Materials Supplied by the User TOPO Cloning technology allows you to produce your PCR products ligate them into pcDNA 3 1 V5 His TOPO and transform the recombinant vector into TOP10 E coli in one day It is important to have everything you need set up and ready to use to ensure that you obtain the best possible results If this is the first time you are using TOPO Cloning perform the control reactions on pages
28. liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose Purchaser Notification Limited Use Label License No 5 Invitrogen Technology Limited Use Label License No 22 Vectors and Clones Encoding Histidine Hexamer The purchase of this product conveys to the buyer the non transferable right to use the purchased amount of the product and components of the product in research conducted by the buyer whether the buyer is an academic or for profit entity The buyer cannot sell or otherwise transfer a this product b its components or c materials made using this product or its components to a third party or otherwise use this product or its components or materials made using this product or its components for Commercial Purposes The buyer may transfer information or materials made through the use of this product to a scientific collaborator provided that such transfer is not for any Commercial Purpose and that such collaborator agrees in writing a not to transfer such materials to any third party and b to use such transferred materials and or information solely for research and not for Commercial Purposes Commercial Purposes means any activity by a party for consideration and may include but is not li
29. log no One Shot Kit 10 reactions C4040 50 TOP10 Electrocompetent Cells One Shot TOP10 Chemically Competent 10 reactions C4040 10 cele 20 reactions C4040 03 T7 Promoter Primer 2 ug 328 pmoles N560 02 BGH Reverse primer 2 ug 358 pmoles N575 02 Anti V5 Antibody 25 westerns R960 25 Anti V5 HRP Antibody 25 westerns R961 25 Anti V5 AP Antibody 25 westerns R962 25 Anti His C term Antibody 25 westerns R930 25 Anti His C term HRP Antibody 25 westerns R931 25 Anti His C term AP Antibody 25 westerns R932 25 ProBond Purification System 6 reactions K850 01 ProBond Metal Binding Resin 50 ml R801 01 PureLink HiPure Plasmid Miniprep Kit 100 preps K2100 03 PureLink HiPure Plasmid Midiprep Kit 25 preps K2100 04 vi Overview Introduction How It Works Introduction The pcDNA 3 1 V5 His TOPO TA Expression Kit provides a highly efficient 5 minute one step cloning strategy TOPO Cloning for the direct insertion of Taq polymerase amplified PCR products into a plasmid vector No ligase post PCR procedures or PCR primers containing specific sequences are required Once cloned analyzed and transfected the PCR product will express directly in mammalian cell lines The plasmid vector pcDNA 3 1 V5 His TOPOS is supplied linearized with e Single 3 thymidine T overhangs for TA Cloning e Topoisomerase covalently bound to the vector this is referred to as activated ve
30. lot number which is printed on the box Invitrogen a part of Life Technologies Corporation is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about an Invitrogen product or service contact our Technical Support Representatives All Invitrogen products are warranted to perform according to specifications stated on the certificate of analysis The Company will replace free of charge any product that does not meet those specifications This warranty limits the Company s liability to only the price of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions The Company reserves the right to select the method s used to analyze a product unless the Company agrees to a specified method in writing prior to acceptance of the order Invitrogen makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or other error is inevitable Therefore the Company makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Support Representatives Life Technologies Corporation shall have no responsibility or
31. minants kill the cells and salt interferes with lipids decreasing transfection efficiency We recommend isolating plasmid DNA using the PureLink HiPure Miniprep Kit or the PureLink HiPure Midiprep Kit see page vi for ordering information or CsCl gradient centrifugation For established cell lines e g HeLa consult original references or the supplier of your cell line for the optimal method of transfection We recommend that you follow exactly the protocol for your cell line Pay particular attention to medium requirements when to pass the cells and at what dilution to split the cells Further information is provided in Current Protocols in Molecular Biology Ausubel et al 1994 Methods for transfection include calcium phosphate Chen and Okayama 1987 Wigler et al 1977 lipid mediated Felgner et al 1989 Felgner and Ringold 1989 and electroporation Chu et al 1987 Shigekawa and Dower 1988 For high efficiency transfection in a broad range of mammalian cells we recommend using Lipofectamine 2000 Reagent available from Invitrogen For more information on Lipofectamine 2000 and other transfection reagents available visit www invitrogen com or contact Technical Support page 24 pcDNA 3 1 V5 His TOPO lacZ is provided as a positive control vector for mammalian transfection and expression see page 21 It may be used to optimize transfection conditions for your cell line The gene encoding B galactos
32. mited to 1 use of the product or its components in manufacturing 2 use of the product or its components to provide a service information or data 3 use of the product or its components for therapeutic diagnostic or prophylactic purposes or 4 resale of the product or its components whether or not such product or its components are resold for use in research For products that are subject to multiple limited use label licenses the terms of the most restrictive limited use label license shall control Life Technologies Corporation will not assert a claim against the buyer of infringement of patents owned or controlled by Life Technologies Corporation which cover this product based upon the manufacture use or sale of a therapeutic clinical diagnostic vaccine or prophylactic product developed in research by the buyer in which this product or its components was employed provided that neither this product nor any of its components was used in the manufacture of such product If the purchaser is not willing to accept the limitations of this limited use statement Life Technologies is willing to accept return of the product with a full refund For information about purchasing a license to use this product or the technology embedded in it for any use other than for research use contact Out Licensing Life Technologies 5791 Van Allen Way Carlsbad California 92008 or outlicensing lifetech com This product is licensed under U S Patent Nos 5
33. n the TOPO Cloning reaction increases the number of colonies over time A Salt Solution 1 2 M NaCl 0 06 M MgCl is provided to adjust the TOPO Cloning reaction to the recommended concentration of NaCl and MgCl For TOPO Cloning and transformation of electrocompetent E coli salt must also be included in the TOPO Cloning reaction but the amount of salt must be reduced to 50 mM NaCl 2 5 mM MgCl to prevent arcing The Salt Solution is diluted 4 fold to prepare a 300 mM NaCl 15 mM MgCl solution for convenient addition to the TOPO Cloning reaction see next page e 42 C water bath or electroporator with cuvettes optional e LB plates containing 50 100 pg ml ampicillin two for each transformation e Reagents and equipment for agarose gel electrophoresis e 37 C shaking and non shaking incubator continued on next page TOPO Cloning Reaction and Transformation continued Note Preparing for Transformation Setting Up the TOPO Cloning Reaction There is no blue white screening for the presence of inserts Individual recombinant plasmids need to be analyzed by restriction analysis or sequencing for the presence and orientation of insert Sequencing primers included in the kit can be used to sequence across an insert in the multiple cloning site to confirm orientation and reading frame For each transformation you need one vial of competent cells and two selective plates e Equilibrate a water ba
34. native protein continued on next page 1 Overview continued Experimental The flow chart below outlines the experimental steps necessary to clone and Outline express your PCR product Determine strategy for PCR Produce PCR product TOPO Cloning Reaction Mix together PCR product and pcDNA3 1 V5 His TOPO at room temperature Incubate 5 minutes Transform into TOP10 coli cells Select and analyze colonies Prepare purified plasmid for transfection Transfect mammalian cell line and test for expression of PCR product Methods PCR Primer Design Designing Your Design of the PCR primers to clone your DNA sequences of interest is critical for PCR Primers expression This is a C terminal fusion vector that does not contain an ATG initiation codon If there is no initiating ATG codon or optimal sequences for translation initiation Kozak sequences in the DNA to be amplified then these features need to be incorporated into your forward primer Example Kozak consensus sequence is G A NNATGG Depending on the nature of your PCR product you have two options to consider e Clone in frame with the V5 epitope and polyhistidine tag C terminal peptide in order to detect and or purify your PCR product OR e Include the native stop codon to express the native protein Note Cloning efficiencies may vary depending on the 5 primer nucleotide sequence page 15 Use the
35. nts All features have been functionally tested Feature Benefit Human cytomegalovirus CMV immediate early promoter enhancer Permits efficient high level expression of your recombinant protein Andersson et al 1989 Boshart et al 1985 Nelson et al 1987 T7 promoter priming site Allows for in vitro transcription in the sense orientation and sequencing through the insert Gly Lys Pro Ile Pro Asn Pro Leu Leu Gly Leu Asp Ser Thr TOPO Cloning site Allows insertion of your PCR product in frame with the V5 epitope and polyhistidine C terminal tag V5 epitope Allows detection of your recombinant protein with the Anti V5 Antibody or Anti V5 HRP Antibody Southern et al 1991 C terminal polyhistidine tag Permits purification of your recombinant protein on metal chelating resin such as ProBond In addition the C terminal polyhistidine tag is the epitope for the Anti His C term Antibody Lindner et al 1997 and the Anti His C term HRP Antibody BGH reverse priming site Permits sequencing through the insert Bovine growth hormone BGH Efficient transcription termination and polyadenylation signal polyadenylation of mRNA Goodwin and Rottman 1992 fl origin Allows rescue of single stranded DNA SV40 early promoter and origin Allows efficient high level expression of the neomycin resistance gene and episomal replication in cells expressing the SV40 large T
36. ontaining the lac promoter and LacZa set up the following 50 ul PCR Control DNA Template 50 ng 1 ul 10X PCR Buffer 5 ul 50 mM dNTPs 0 5 pl Control PCR Primers 0 1 1g pl each 2 pl Sterile Water 40 5 pl Tag Polymerase 1 unit ul 1 ul Total Volume 50 pl 2 Overlay with 70 ul 1 drop of mineral oil 3 Amplify using the following cycling parameters Step Time Temperature Cycles Initial Denaturation 2 minutes 94 C 1X Denaturation 1 minute 94 C Annealing 1 minute 60 C 25X Extension 1 minute 72 C Final Extension 7 minutes 72 1X 4 Remove 10 pl from the reaction and analyze by agarose gel electrophoresis A discrete 500 bp band should be visible Proceed to the Control TOPO Cloning Reactions next page continued on next page 15 pcDNA 3 1 V5 His TOPO TA Cloning Control Reactions continued Control TOPO Cloning Reactions Analysis of Results Transformation Control 16 Using the control PCR product produced on the previous page and the pcDNA 3 1 V5 His TOPO vector set up two 6 ul TOPO Cloning reactions as described below 1 Set up control TOPO Cloning reactions Reagent Vector Only Vector PCR Insert Sterile Water 4 ul 3 ul Salt Solution or Dilute Salt 1 ul 1 ul Solution Control PCR Product 1pl pcDNA 3 1 V5 His TOPO 1 ul 1 ul vector Incubate at room temperature for 5 minutes and place on
37. promoter and origin bases 4934 5259 Neomycin resistance gene bases 5295 6089 SV40 polyadenylation signal bases 6107 6346 pUC origin bases 6778 7451 C Ampicillin resistance gene bases 7596 8456 C C complementary strand 22 Recipes LB Luria Bertani Medium and Plates X Gal Stock Solution Composition 1 0 Tryptone 0 5 Yeast Extract 1 0 NaCl pH 7 0 1 For 1 liter dissolve 10 g tryptone 5 g yeast extract and 10 g NaCl in 950 ml deionized water 2 Adjust the pH of the solution to 7 0 with NaOH and bring the volume up to 1 liter 3 Autoclave on liquid cycle for 20 minutes at 15 psi Allow solution to cool to 55 C and add antibiotic 100 ug ml ampicillin if needed 4 Store at room temperature or at 4 C LB agar plates 1 Prepare LB medium as above but add 15 g L agar before autoclaving 2 Autoclave on liquid cycle for 20 minutes at 15 psi 3 After autoclaving cool to 55 C add antibiotic 100 ug ml of ampicillin and pour into 10 cm plates 4 Let harden then invert and store at 4 C in the dark 1 To make a 40 mg ml stock solution dissolve 400 mg X Gal in 10 ml dimethylformamide Protect from light by storing in a brown bottle at 20 C 3 To add to previously made agar plates warm the plate to 37 C Pipette 40 ul of the 40 mg ml stock solution onto the plate spread evenly and let dry 15 minutes Protect plates from light 23 Technical Support Web Resourc
38. ternative Method You may wish to use PCR to directly analyze positive transformants Use a of Analysis Important combination of either the T7 or the BGH Reverse sequencing primer with a primer that binds within your insert as PCR primers You will have to determine the amplification conditions If this is the first time you have used this technique we recommend that you perform restriction analysis in parallel to confirm that PCR gives you the correct result Artifacts may be obtained because of mispriming or contaminating template The following protocol is provided for your convenience Other protocols are suitable 1 Prepare a PCR cocktail consisting of PCR buffer dNTPs primers and Taq polymerase Use a 20 pl reaction volume Multiply by the number of colonies to be analyzed e g 10 2 Pick 10 colonies and resuspend them individually in 20 ul of the PCR cocktail Don t forget to make a patch plate to preserve the colonies for further analysis 3 Incubate the reaction for 10 minutes at 94 C to lyse the cells and inactivate nucleases 4 Amplify for 20 to 30 cycles using parameters previously determined see text above 5 For the final extension incubate at 72 C for 10 minutes Store at 4 C Visualize by agarose gel electrophoresis If you have problems obtaining transformants or the correct insert perform the control reactions described on page 13 15 These reactions will help you troubleshoot your experim
39. th to 42 C for chemical transformation or set up your electroporator if you are using electrocompetent E coli e For electroporation dilute a small portion of the Salt Solution 4 fold to prepare Dilute Salt Solution e g add 5 ul of the Salt Solution to 15 ul sterile water e Warm the vial of SOC medium from Box 2 to room temperature e Warm selective plates at 37 C for 30 minutes e Thaw on ice 1 vial of One Shot cells for each transformation The table below describes how to set up your TOPO Cloning reaction 6 ul for eventual transformation into either chemically competent One Shot TOP10 E coli provided or electrocompetent E coli Additional information on optimizing the TOPO Cloning reaction for your needs can be found on page 9 Note The red or yellow color of the TOPO vector solution is normal and is used to visualize the solution Reagent Chemically Competent E coli Electrocompetent E coli Fresh PCR product 0 5 to 4 ul 0 5 to 4 ul Salt Solution 1 ul 7 Dilute Salt Solution 1 ul Sterile Water add to a final volume of 5 ul add to a final volume of 5 ul TOPO vector 1 ul 1 ul Performing the TOPO Cloning Reaction Store all reagents at 20 C when finished Store Salt solutions and water at room temperature or 4 C 1 Mix reaction gently and incubate for 5 minutes at room temperature 22 23 C Note For most applications 5 minutes will yield plenty of coloni
40. ular Biology Unit 2 6 Ausubel et al 1994 for the most common protocols Three simple protocols are provided below for your convenience Note that cloning efficiency may decrease with purification of the PCR product You may wish to optimize your PCR to produce a single band see Producing PCR Products page 4 The PureLink Quick Gel Extraction Kit page vi allows you to rapidly purify PCR products from regular agarose gels Follow the protocol in the manual supplied with the kit to gel purify your PCR fragment Use 4 pl of the purified DNA for the TOPO Cloning reaction and proceed as described on page 10 If you prefer to use low melt agarose use the procedure below Note that the gel purification results in a dilution of your PCR product and a potential loss of cloning efficiency 1 Electrophorese as much as possible of your PCR reaction on a low melt agarose gel 0 8 to 1 2 in TAE buffer 2 Visualize the band of interest and excise the band 3 Place the gel slice in a microcentrifuge tube and incubate the tube at 65 C until the gel slice melts 4 Place the tube at 37 C to keep the agarose melted 5 Add 4 pl of the melted agarose containing your PCR product to the TOPO Cloning reaction as described on page 10 6 Incubate the TOPO Cloning reaction at 37 C for 5 to 10 minutes This is to keep the agarose melted 7 Transform 2 to 4 ul directly into chemically competent One Shot TOP10 cells usin
Download Pdf Manuals
Related Search