Applied Biosystems SOLiD 4 System SOLiD Bisulfite
Contents
1. essen nennen 20 Step 10 Bisulfite Convert the DNA conociste tite ren diee b e E RE HR ind 21 Step 11 Desulfonate and Purify the Converted DNA sss 23 Step 12 Amplify the DNA coran ia 25 Step 13 Purify the Amplified DNA eene 27 Step I4 Size Select the DNA s ae ep A Iunior pe nde 28 Step 15 Quantitate the Library iena a tenete nennen nennen 30 Technical SUpport preerie oist i rH thee ine hi i etie et ie habiti HL bas te PLE 31 SOLID Bisulfite Converted Fragment Library Preparation Protocol 3 Required Materials Introduction SOLiD Fragment Library Construction Kit SOLiD Fragment Library Oligos Kit SOLiD Library TaqMan Quantitation Kit This section identifies the kits reagents and equipment needed for this protocol Vendor and catalog information are provided in the following tables TM The following components are needed from the SOLiD Fragment Library Construction Kit Applied Biosystems 4443473 End polishing Enzyme 1 End polishing Enzyme 2 5X End Polishing Buffer 5X T4 Ligase Buffer T4 Ligase Platinum PCR Amplification Mix SOLiD Library Column Purification Kit with B2 S and B2 L buffers TM The following components are needed from the SOLiD Fragment Library Oligos Kit Applied Biosystems 4401151 P2 adaptor 50 uM Library PCR Primer 1 Library PCR Primer 2 TM All components are needed from the SOLiD Library TaqMan Quantitation Kit2. dNTP Mix without dCTP dNTP Mix with Methyl dCTP In this step you prepare the two special dNTP mixes required to construct bisulfite compatible SOLiD fragment libraries e dATP 100 mM e dTTP 100 mM e dGTP 100 mM e 5 methyl dCTP 100 mM TriLink e 10 mM Tris HCl pH 7 5 nuclease free e Nuclease free water Ww Jena Bioscience Germany also supplies 5 methyl dCTP but as a 10 mM stock solution catalog no NU 1125 If you want to use this more dilute stock use 50 uL per 100 uL final volume and reduce the amount of nuclease free water from 74 pL to 29 uL in the following protocol Prepare a 100 uL volume of a dNTP mix without dCTP as follows Store in sub aliquots 8 uL needed per library at 20 C Table 2 dNTP Mix without dCTP Component Volume pL dATP 100 mM stock 10 dTTP 100 mM stock 10 dGTP 100 mM stock 10 10 mM Tris HCl pH 7 5 nuclease free 6 Nuclease free water 64 Total Volume 100 Prepare a 100 uL volume of a dNTP mix with 5 methyl dCTP in place of normal dCTP as follows Store in sub aliquots 5 pL needed per library at 20 C Table 3 dNTP Mix with Methyl dCTP Component Volume uL dATP 100 mM stock 5 dTTP 100 mM stock 5 dGTP 100 mM stock 5 5 methyl 2 deoxycytidine 5 triphosphate 5 methyl dCTP 5 100 mM stock TriLink 10 mM Tris HCl pH 7 5 nuclease free 6 Nuclease free water 74 Total Volume 1
3. Dilution with water is required to maximize the yield of bisulfite converted library DNA by ultrafiltration based purification DO NOT use the water diluted Desulfonation Reagent for any purpose other than the bisulfite conversion reaction in this protocol Desulfonation in water is NOT compatible with the standard silica TM column based purification described in the Cells to CpG kit manual a When adding solutions to centrifugal filtration devices such as the Amicon Ultra 0 5 10K avoid touching the membranes as this can lead to device failure e After the 8 hour conversion reaction some discoloration light yellow or brown of the solution may be evident The color goes away during the course of the desulfonation and purification steps and has no apparent effect on the quality of the final library DNA Desulfonation and Desulfonate and purify each 150 uL bisulfite conversion reaction sub sample Purification Protocol 1 8 separately using an Amicon Ultra 0 5 10K ultrafiltration device All steps are at room temperature Dilute the stock Desulfonation Reagent provided in the Cells to CpG kit with nuclease free water as described in the Important note above Add 200 uL of nuclease free water to the Amicon device then add a 150 uL bisulfite converted DNA sub sample Spin at 14 000 x g for 10 minutes and measure the flow through volume should be 300 pL Replace the flow through with an
4. exchanged into Low TE buffer within the same device Amplify the Library Amplify the library molecules using at least four cycles of PCR The bisulfite conversion process generates many uracil residues within the template DNA strands and also leaves the DNA largely single stranded Amplification replaces the uracil bases with thymidine bases and returns the library to a double stranded state Size Select the DNA To preserve maximum sequence complexity size select the ligated purified DNA to a broad distribution range 100 350 bp with Agencourt AMPure XP beads After bead based sizing the eluate can be directly quantified with the SOLiD Library TaqMan Quantitation Kit Quantitate the Library Using qPCR Quantitate the library using the SOLiD Library TaqMan Quantitation Kit before proceeding to emulsion PCR SOLID Bisulfite Converted Fragment Library Preparation Protocol Before Starting Tips and Notes Methods Start with 5 ug of DNA Note The amount of DNA loaded onto a PureLink column should be lt 5 pg to ensure maximum yield If you want to experiment with larger amounts of starting material be sure to split the TM sample over multiple PureLink columns during the purification steps Adjust microcentrifuge speeds and times according to the g forces specified in the protocols Applied Biosystems recommends the Eppendorf 5417R tabletop microcentrifuge Prior to loading dry spin all PureLink co
5. 62 15 sec cycles Extend 70 3 min Holding Extend 70 5 min Holding Hold 4 eo 3 Run the amplified samples on an E Gel EX 2 Gel with an E Gel iBase and E Gel Safe Imager Real Time blue light transilluminator Determine the minimum number of cycles needed to generate a faintly visible smear of DNA Usually this will be between 4 and 10 cycles Then prepare and run the following full scale reaction using that number of cycles SOLID Bisulfite Converted Fragment Library Preparation Protocol 25 Amplification 1 Prepare a master mix based on the volume of eluate from page 24 The volumes below allow for one additional reaction for a no template Reaction negative control Table 11 PCR Master Mix Eluate gt 100 pL Eluate lt 100 pL Component Volume pL Volume pL F Volume of eluate 100 Platinum PCR Amplification Mix 380 x F 380 Library PCR Primer 1 10 x F 10 Library PCR Primer 2 10 x F 10 Total 400 x F 400 2 If the volume of the eluate is e 100 uL add 400 uL of master mix to the eluate then distribute equally into four PCR reaction tubes e 100 uL add 400 uL of master mix to every 100 uL of eluate then distribute equally in 100 125 pL aliquots to multiple PCR reaction tubes 3 Prepare and run the following PCR program using the number of cycles determined previously Table 12 PCR Cycling Program Stage Step Temp C Time Holding Denature 95 5 min Cycling
6. Applied Biosystems 4449639 Invitrogen The following Invitrogen reagents are sold separately Reagents Product Catalog no UltraPure DNase RNase Free Distilled Water 10977 015 dATP 100 mM 10216 018 dTTP 100 mM 10219 012 dGTP 100 mM 10218 014 E Gel EX Gels 2 agarose G4010 02 E Gel 50 bp DNA Ladder 10488 099 Optional if performing the lambda DNA spike in Lambda DNA 25250 010 Alu I restriction enzyme 45200 029 PureLink PCR Purification Kit K3100 01 4 SOLID Bisulfite Converted Fragment Library Preparation Protocol Applied Biosystems Reagents Additional Reagents P1 Adaptor Oligos The following Applied Biosystems reagents are sold separately Product Exo Klenow Fragment 5 U L 0 5 M EDTA pH 8 0 Hi Di Formamide Cells to CpG Bisulfite Conversion Kit 50 rxns 8 strip PCR Tubes and Caps RNase free Low TE buffer The following reagents from other vendors are sold separately Product Vendor 5 methyl dCTP 100 mM TriLink USA Alternate source of 5 methyl dCTP Jena Bioscience Germany Amicon Ultra 0 5 10K devices Millipore Agencourt AMPure XP beads Beckman Coulter DNA LoBind Tubes 1 5 mL Eppendorf Covaris microTUBEs snap cap Covaris Isopropanol 100 Various Ethanol 100 Various DTT molecular biology grade Various Catalog no AM2006 AM9260G 4440753 4445249 AM12230 4389764 Catalog no N 2026 NU 1125 UFC501024 A63880 022431021 520045 Various Various Var
7. number of Denature 95 15 sec cycles determined by Anneal 62 15 sec the previous test PCR Extend 70 3 min Holding Extend 70 5 min Holding Hold 4 oo 4 After cycling pool the reactions into 200 250 pL volumes in multiple 1 5 mL LoBind tubes 26 SOLID Bisulfite Converted Fragment Library Preparation Protocol Step 13 Purify the Amplified DNA Introduction In this step you purify the amplified DNA using components in the SOLiD TM Library Column Purification Kit Materials Needed e SOLiD Library Column Purification Kit included with the SOLiD Fragment Library Construction Kit Purification Perform the following workflow for each 200 250 uL pooled PCR volume from Procedure the previous page 1 Before loading the PureLink columns dry spin at 10 000 x g 13 000 rpm 10 11 12 13 14 for 1 minute Add four volumes of Binding Buffer B2 L containing 40 isopropanol to each 200 250 uL volume of amplified DNA from the previous page Mix thoroughly For each sample apply 700 uL of the DNA binding buffer mixture to a PureLink column Let the columns stand for 2 minutes at room temperature Centrifuge the columns at 210 000 x g 13 000 rpm for 1 minute and discard the flow through Repeat steps 3 5 to load the rest of each sample onto the column Place the column back into the same collection tube Add 650 uL of Wash Buffer W1 to each column Centrifuge the columns at 210 000 x g 13 000 rpm fo
8. 00 SOLID Bisulfite Converted Fragment Library Preparation Protocol Step 3 Prepare the Methyl P1 Adaptor Introduction Materials Needed P1 Adaptor Oligos Annealing the Adaptor Oligos In this step you prepare a modified P1 adaptor that contains 5 methyl cytidine residues in place of normal non methylated cytidine residues e PLA adaptor oligo methylated e P1B adaptor oligo unmethylated e 5X T4 DNA Ligase Buffer e Low TE Buffer Qa 5X T4 Ligase Buffer is used as an annealing buffer in the following procedure The P1 adaptor oligos are two complementary single stranded oligos that are annealed together to make the double stranded methyl P1 adaptor The P1A adaptor oligo is methylated P1B is not The oligos can be manufactured by any supplier capable of providing custom oligos containing 5 methyl cytidine residues at 2 90 purity typically HPLC purified IDT Coralville lowa USA is one such supplier The sequences that should be ordered are P1A Adaptor Oligo top strand 41 bp 5 methyl C denoted as M below 5 MMAMTAMGMMTMMGMTTTMMTMTMTATGGGMAGTMGGTGAT 3 P1B Adaptor Oligo bottom strand 43 bp unmethylated 5 ATCACCGACTGCCCATAGAGAGGAAAGCGGAGGCGTAGTGGTT 3 Anneal the adaptor oligos as follows 1 Resuspend each P1 adaptor oligo to 250 uM in Low TE Buffer 2 The extinction coefficient of the methylated strand is 361 400 L mole cm and that of the non methylated
9. NA x 106 pg 1 ug x 1 pmol 660 pg x 1 165 9 2 pmol ug DNA Y uL adaptor needed 1 ug DNA x 9 2 pmol 1 ug DNA x 15 x 1 uL adaptor needed 50 pmol 2 76 pL adaptor needed Combine and mix the following components in a 1 5 mL LoBind tube and incubate at room temperature for 15 minutes Table 7 Ligation Mix Component Volume uL Methyl P1 Adaptor ds 50 pmol uL Y P2 Adaptor ds 50 pmol pL Y 5X T4 Ligase Buffer 40 DNA 48 50 Nuclease free Water Variable T4 Ligase 5 U uL 10 Total 200 SOLID Bisulfite Converted Fragment Library Preparation Protocol 17 Step 7 Purify the Adaptor Ligated DNA Introduction In this step you purify the adaptor ligated DNA using components in the SOLiD Library Column Purification Kit Materials Needed SOLiD Library Column Purification Kit included with the SOLiD Fragment Library Construction Kit Purification 1 Procedure 10 11 12 TM Before loading the PureLink column dry spin at 10 000 x g 13 000 rpm for 1 minute Add 800 uL four volumes of Binding Buffer B2 L containing 40 isopropanol to the 200 uL of adaptor ligated DNA from the previous page Mix thoroughly Apply 700 uL of the DNA binding buffer mixture to the column Let the column stand for 2 minutes at room temperature Centrifuge the column at 210 000 x g 13 000 rpm for 1 minute and discard the flow through Repeat steps 3 5 to load the rest of t
10. applied 9 biosystems by Life technologies Applied Biosystems SOLID 4 System SOLID Bisulfite Converted Fragment Library Preparation Protocol Templated Bead Instrument Preparation Operation 4 For Research Use Only Not intended for any animal or human therapeutic or diagnostic use This protocol is the proprietary material of Applied Biosystems LLC or its affiliates and is protected by laws of copyright The customer of the SOLiD System is hereby granted limited non exclusive rights to use this protocol solely for the purpose of operating the SOLID System Unauthorized copying renting modifying or creating derivatives of this protocol is prohibited Information in this document is subject to change without notice APPLIED BIOSYSTEMS DISCLAIMS ALL WARRANTIES WITH RESPECT TO THIS DOCUMENT EXPRESSED OR IMPLIED INCLUDING BUT NOT LIMITED TO THOSE OF MERCHANTABILITY FITNESS FOR A PARTICULAR PURPOSE OR NON INFRINGEMENT OF INTELLECTUAL PROPERTY TO THE FULLEST EXTENT ALLOWED BY LAW IN NO EVENT SHALL APPLIED BIOSYSTEMS BE LIABLE WHETHER IN CONTRACT TORT WARRANTY OR UNDER ANY STATUTE OR ON ANY OTHER BASIS FOR SPECIAL INCIDENTAL INDIRECT PUNITIVE MULTIPLE OR CONSEQUENTIAL DAMAGES IN CONNECTION WITH OR ARISING FROM THIS DOCUMENT INCLUDING BUT NOT LIMITED TO THE USE THEREOF WHETHER OR NOT FORESEEABLE AND WHETHER OR NOT APPLIED BIOSYSTEMS IS ADVISED OF THE POSSIBILITY OF SUCH DAMAGES TRADEMARKS The trademarks
11. bisulfite converted DNA in a PCR reaction The bisulfite conversion process generates many uracil residues within the template DNA strands and also leaves the DNA largely single stranded Amplification replaces the uracil bases with thymidine bases and returns the library to a double stranded state e Platinum PCR Amplification Mix e Library PCR Primer 1 e Library PCR Primer 2 e Thermal cycler e E Gel EX 2 Gel TM e E Gel iBase Power System TM e E Gel Safe Imager Real Time Transilluminator To avoid overamplification determine the minimum number of PCR cycles needed to generate a visible smear of DNA on an agarose gel as described below 1 Prepare a test PCR reaction using 1 10 of the eluate from the previous page typically 8 16 pL Table 9 Test PCR Reaction Component Volume pL Platinum PCR Amplification Mix 38 Library PCR Primer 1 1 Library PCR Primer 2 1 DNA library sample eluate from previous page 8 16 uL 2 Run the PCR program shown in Table 10 Cycle 4 times then pause the reaction at 4 C to remove 5 pL to run on a gel Continue cycling pausing at 4 C every 2 cycles to withdraw another 5 uL sample up to 12 cycles Place each sample in a separate LoBind tube Table 10 Test PCR Cycling Program Stage Step Temp C Time Holding Denature 95 5 min Cycling collect sample at 4 cycles and Denature 95 15 sec at 2 cycle intervals thereafter up to 12 Anneal
12. e experimenting with larger amounts of starting material split the sample over multiple PureLink columns during the purification steps 10 11 12 13 Before loading the PureLink column dry spin at 10 000 x g 13 000 rpm for 1 minute Add 800 uL four volumes of Binding Buffer B2 S containing 55 isopropanol to the 200 uL of end repaired DNA from the previous page Mix thoroughly Apply 700 uL of the DNA binding buffer mixture to the column Let the column stand for 2 minutes at room temperature Centrifuge the column at 210 000 x g 13 000 rpm for 1 minute and discard the flow through Repeat steps 3 5 to load the rest of the sample onto the column After discarding the flow through place the column back into the same collection tube Add 650 uL of Wash Buffer W1 to the column Centrifuge the column at 210 000 x g 13 000 rpm for 2 minutes then discard the flow through Repeat to remove any residual wash buffer Air dry the column for 2 minutes to evaporate any residual alcohol Insert the column into a clean 1 5 mL LoBind tube Add 50 uL of Elution Buffer E1 to the column to elute the DNA then let the column stand for 2 minutes Centrifuge the column at 210 000 x g 13 000 rpm for 1 minute DO NOT DISCARD The flow through contains your sample Add the eluate back onto the column then let the column stand for 2 minutes Centrifuge the column once more at 210 000 x g 13 000 rpm for 1 minu
13. eping the tube in place on the magnet air dry the beads with the tube cap open for 5 minutes at room temperature Elute the DNA by adding 22 uL of Low TE Buffer vortexing for 10 seconds pulse spinning the solution to the bottom of the tube and ensuring homogeneity by pipetting the solution up and down several times Protocol continued on the next page 28 SOLID Bisulfite Converted Fragment Library Preparation Protocol Protocol continued from the previous page 13 Place the tube of beads in the magnetic rack to separate the beads from the solution Wait 2 minutes for the solution to clear before proceeding to the next step 14 Carefully transfer the supernatant to a new 1 5 mL LoBind tube 15 Place the eluted sample again in the magnetic rack to separate any remaining beads from the solution Wait for the solution to clear before proceeding to the next step 16 Carefully transfer the supernatant to a new 1 5 mL LoBind tube The library is now ready for quantitation STOPPING POINT Store the purified DNA at 4 C or proceed directly n to Quantitate the Library SOLID Bisulfite Converted Fragment Library Preparation Protocol 29 Step 15 Quantitate the Library SOLiD Library For accurate library quantitation quantitative PCR qPCR is strongly TaqMan recommended The SOLiD Library TaqMan Quantitation Kit is available Quantitation Kit from Applied Biosystems See the user manual for that kit for in
14. equal volume of nuclease free water added onto the column Repeat steps 3 4 one more time Spin at 14 000 x g for 10 minutes and measure the flow through 300 uL Replace the flow through with an equal volume of diluted Desulfonation Reagent Mix well and then let stand for 15 minutes Protocol continued on the next page SOLID Bisulfite Converted Fragment Library Preparation Protocol 23 Continued from the previous page 9 10 11 12 13 14 15 16 17 Spin at 14 000 x g for 10 minutes and measure the flow through 300 uL Replace the flow through with an equal volume of nuclease free water Spin at 14 000 x g for 10 minutes and measure the flow through 300 uL Replace the flow through with an equal volume of Low TE Buffer Repeat steps 12 13 one more time Spin at 14 000 x g for 15 minutes and measure the flow through This time 350 uL should flow through Invert the device into a clean receiving tube and elute at 1000 x g for 1 minute the volume that elutes should be between 20 and 40 nL Re pool the four sub samples of bisulfite converted DNA into a 1 5 mL LoBind tube The eluted re pooled bisulfite converted single stranded DNA library is now ready for PCR amplification 24 SOLID Bisulfite Converted Fragment Library Preparation Protocol Step 12 Amplify the DNA Introduction Materials Needed Determining the Optimal Number of PCR Cycles In this step you amplify the
15. he sample onto the column After discarding the flow through place the column back into the same collection tube Add 650 uL of Wash Buffer W1 to the column Centrifuge the column at 210 000 x g 13 000 rpm for 2 minutes then discard the flow through Repeat to remove any residual wash buffer Air dry the column for 2 minutes to evaporate any residual alcohol Insert the column into a clean 1 5 mL LoBind tube Add 50 uL of Elution Buffer E1 to the column to elute the DNA then let the column stand for 2 minutes Centrifuge the column at 210 000 x g 13 000 rpm for 1 minute DO NOT DISCARD THE ELUATE The flow through contains your sample Add the eluate back onto the column then let the column stand for 2 minutes Centrifuge the column once more at 210 000 x g 13 000 rpm for 1 minute and collect the flow through STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to Nick Translate the DNA SOLID Bisulfite Converted Fragment Library Preparation Protocol Step 8 Nick Translate the DNA Introduction In this step you nick translate the DNA Materials Needed e Exo Klenow Fragment 5 U uL Applied Biosystems e 10mMDTT e Tris HCl pH 8 0 e MgCl e NaCl e 0 5M EDTA pH 8 0 e 1 5 mL LoBind tube e Nuclease free water Prepare 10X Nick Prepare a stock solution of 10X Nick Translation Buffer 10 uL needed per reaction Store at 20 C 500 mM Tris HCl pH 8 0 Tran
16. iedbiosystems com about offices cfm
17. ious The P1 adaptor oligos are two single stranded oligos that are annealed together to make the double stranded methyl P1 adaptor One of the adaptor oligos P1A is methylated the other P1B is not The oligos can be manufactured by any supplier capable of providing custom oligos containing 5 methyl cytidine residues at 2 90 purity typically HPLC purified IDT Coralville lowa USA is one such supplier The sequences that should be ordered are P1A Adaptor Oligo top strand 41 bp 5 methyl C denoted as M below 5 MMAMTAMGMMTMMGMTTTMMTMTMTATGGGMAGTMGGTGAT 3 P1B Adaptor Oligo bottom strand 43 bp unmethylated 5 ATCACCGACTGCCCATAGAGAGGAAAGCGGAGGCGTAGTGGTT 3 SOLID Bisulfite Converted Fragment Library Preparation Protocol Equipment The following equipment is required Microcentrifuge e g Eppendorf 5417R tabletop microcentrifuge Thermal Cycler e g Applied Biosystems GeneAmp PCR System 9700 NanoDrop ND 1000 Spectrophotometer Covaris S2 ultrasonicator Agilent 2100 Bioanalyzer Vortexer TaqMan compatible qPCR instrument Magnetic rack if using Agencourt AMPure XP Beads for size selection E Gel iBase Power System E Gel Safe Imager Real Time Transilluminator Heat block 6 SOLID Bisulfite Converted Fragment Library Preparation Protocol Description of the Protocol Protocol Overview Workflow Summary This protocol provides detailed steps to prepare a bisu
18. ite Conversion Kit e Hi Di Formamide e 1 5 mL LoBind tube e Nuclease free water TM ti One Cells to CpG Bisulfite Conversion Kit provides enough conversion reagent 5 tubes to convert 5 libraries TM Prepare complete Cells to CpG Conversion Reagent immediately before use 1 Ina sterile 1 5 mL tube mix 26 uL of Denaturation Reagent with 800 uL of nuclease free water 2 Add this mixture to one opaque brown tube of powdered Conversion Reagent and mix well by vortexing Perform all subsequent steps in this opaque brown tube 3 Add 50 pL of Conversion Buffer to the tube of resuspended Conversion Reagent and mix again by vortexing 4 Place the complete Conversion Reagent tube in a 60 C water bath for 30 minutes Remove and mix the tube every 10 minutes during incubation 5 Following incubation mix by vortexing 2 3 more times Trace amounts of undissolved material may remain this is normal Keep the tube protected from light at room temperature until use ja The following reaction requires an 8 hour e g overnight incubation and can be held in the thermal cycler at 4 C for several hours afterwards SOLID Bisulfite Converted Fragment Library Preparation Protocol 21 Bisulfite 1 To each purified nick translated 50 uL DNA sample from page 20 add Conversion 50 uL of Hi Di Formamide Protocol 2 Mix thoroughly and heat the mixture at 95 C for 5 minutes to denature the DNA 3 Im
19. lfite converted fragment DNA library for sequencing using the SOLiD 4 System Starting with 5 ug of purified human genomic DNA the protocol can yield a library of sufficient complexity for genome wide measurement of the cytosine methylation pattern at single nucleotide resolution This protocol uses products from Applied Biosystems Invitrogen and other vendors in a streamlined and validated workflow Please refer to the SOLiD 4 System Library Preparation Guide March 2010 pages 16 40 and associated Appendices for additional information on fragment library preparation Shear the DNA To begin sonicate the input DNA into small fragments with a mean fragment size of 165 bp range of 150 180 bp using a Covaris S2 System Conditions have been tested for shearing 5 ug DNA in a total volume of 100 uL For certain DNA samples optimizing the shearing protocol may be necessary End Repair the DNA Next use End Polishing Enzyme 1 and End Polishing Enzyme 2 to convert DNA that has damaged or incompatible 5 protruding and or 3 protruding ends to 5 phosphorylated blunt ended DNA For bisulfite compatible library construction a dNTP mix lacking dCTP must be used You can create such a mix by mixing dATP dTIP and dGIP each at a final concentration of 10 mM Purify the DNA with the SOLID Library Column Purification Kit PureLink columns are supplied with B2 S and B2 L buffers in the SOLID Library Column Purification Kit This kit is
20. lumns at 10 000 x g 13 000 rpm for 1 minute Perform all steps requiring 0 5 mL and 1 5 mL tubes with Eppendorf LoBind Tubes Thaw reagents on ice before use SOLID Bisulfite Converted Fragment Library Preparation Protocol Step 1 Shear the DNA Introduction Materials Needed Shearing the DNA TM In this step you shear the DNA using the Covaris S2 Sonication conditions have been optimized for shearing the DNA into a mean fragment size of 165 bp range of 150 180 bp TM e Covaris S2 ultrasonicator e Covaris microTUBEs e LoBind tubes e Low TE Buffer TM e Set the chiller temperature on the Covaris S2 to 2 5 C to ensure that D the temperature of the water bath is 5 C Higher temperatures during fragmentation can be detrimental The circulated water chiller should be supplemented with 2076 ethylene glycol TM e To load and unload the Covaris microTUBE correctly from the microTUBE holder see the Covaris S2 user manual 1 Dilute the DNA to 100 uL in 1X Low TE Buffer in a LoBind tube as follows Table 1 DNA Dilution Component Amount DNA 5 pg 1X Low TE Buffer Variable Total Volume 100 pL 2 Place a Covaris microTUBE into the loading station on the Covaris S2 Keep the cap on the tube and use a tapered pipette tip to slowly transfer the 100 uL of DNA sample through the pre split septa Be careful not to introduce a bubble into the bottom of the
21. mediately place the DNA formamide sample tube on ice for at least 2 minutes 4 After cooling split the 100 uL DNA formamide sample into equal 25 uL subsamples in 4 PCR tubes 5 Transfer the complete Conversion Reagent from its opaque brown tube previous page to a non opaque 1 5 mL microcentrifuge tube Pulse spin the tube to force any undissolved material to the bottom of the tube Note Inthe next step be careful to pipet Conversion Reagent from the top of the tube to avoid transferring any undissolved solids from the bottom 6 Add 125 uL of complete Conversion Reagent to each 25 uL DNA formamide sample Mix by pipetting up and down 7 Place the tubes in a thermal cycler Program the cycler to heat at 50 C for 8 hours then hold the reaction at 4 C for up to 20 hours 8 Following incubation proceed to Desulfonate and Purify the Converted DNA on the next page 22 SOLID Bisulfite Converted Fragment Library Preparation Protocol Step 11 Desulfonate and Purify the Converted DNA Introduction In this step you desulfonate and purify the bisulfite converted DNA Materials Needed Cells to CpG Bisulfite Conversion Kit Amicon Ultra 0 5 10K ultrafiltration device Millipore Low TE Buffer Nuclease free water IMPORTANT Dilute the stock Desulfonation Reagent provided in the Cells to CpG kit with nuclease free water NOT ethanol Add 10 mL of nuclease free water per bottle of stock Desulfonation Reagent
22. mentioned herein are the property of Life Technologies Corporation or their respective owners NanoDrop is a trademark of NanoDrop Technologies LLC Agentcourt and AMPure are trademarks of Beckman Coulter Inc Eppendorf is a trademark of Eppendorf AG Covaris is a trademark of Covaris Inc TaqMan is a trademark of Roche Molecular Systems Inc Copyright 2010 Life Technologies Corporation All rights reserved Part no MAN0003271 Rev date 2 December 2010 Table of Contents Required Materials asserat nieder e Haie t eae i eiiis ee HP HR t reisen 4 Description ofthe Protocol cic aote odiados ida 7 MethodS 9 Before Star tine oto eR n a nie ade E Pea atts d 9 Step Sheardhe DNA esr aee Ha te ette ete ert a deer iren ete er eee ERE nen 10 Optional Spike In Lambda DNA Digested with Alu I seen 11 Step 2 Prepare the Special dNTP Mixes rti rene n erre rta eter 12 Step 3 Prepare the Methyl P1 Adaptor cooccoconononononconononenenonncncncnranannnnnnnnanananananonnnnnnn nana rarananan nara roranananans 13 Step 4 End Repair the DNA Tingini t e aa e E ERE tinet tenete trennen 15 Step 5 Purify the End Repaired DNA sess eene nennen nnne 16 Step 6 Ligate Methyl P1 and P2 Adaptors to the DNA sssssssseee eee eee eene 17 Step 7 Purify the Adaptor Ligated DNA prsh meia e a Kea aE REKREA 18 Step 8 Nick Translate the DN Annaning ne ea a E ro rncncnno 19 Step 9 Purify the Nick Translated DNA
23. nt Library Preparation Protocol Step 4 End Repair the DNA Introduction How End Repair Works Materials Needed End Repair Mixture In this step you end repair the sheared DNA The 5 to 3 polymerase and the 3 to 5 exonuclease activities of End Polishing Enzyme 2 generate blunt ended DNA fragments End Polishing Enzyme 1 and ATP phosphorylate the 5 ends of the blunt ended DNA to enable subsequent ligation e 5X End Polishing Buffer e End Polishing Enzyme 1 10 U uL e End Polishing Enzyme 2 5 U uL e 1 5 mL LoBind tubes e Nuclease free water Combine and mix the following components in a 1 5 mL LoBind tube and incubate at room temperature for 30 minutes Table 6 End Repair Mix Component Volume uL Sheared DNA 5 ug 100 5X End Polishing Buffer 40 dNTP mix without dCTP from page 12 8 Nuclease free Water 32 End Polishing Enzyme 1 10 U uL 4 End Polishing Enzyme 2 5 U uL 16 Total Volume 200 SOLID Bisulfite Converted Fragment Library Preparation Protocol Step 5 Purify the End Repaired DNA Introduction Materials Needed Purification Procedure In this step you purify the end repaired DNA using components in the SOLiD Library Column Purification Kit SOLID Library Column Purification Kit included with the SOLID Fragment Library Construction Kit hw The amount of DNA loaded onto a PureLink column should be lt 5 pg to ensure maximum yield If you ar
24. of DNA solution of Agencourt AMPure XP beads to the sample For example if the pooled eluted DNA from the previous page is in 100 uL add 80 pL of bead solution Mix well and incubate the solution for 5 minutes at room temperature Place the tube of beads in a magnetic rack to separate the beads from the solution Wait 2 minutes for the solution to clear before proceeding to the next step Keep the tube in place in the magnetic rack with the beads held against the tube wall and carefully remove and RETAIN the supernatant in a clean 1 5 mL LoBind tube The supernatant contains your sample To this supernatant add 1 volume original volume of Agencourt AMPure XP beads 100 uL in the example from step 1 above Mix well and incubate the beads and DNA solution for 5 minutes at room temperature Place the tube of beads in a magnetic rack to separate the beads from the solution Wait 2 minutes for the solution to clear before proceeding to the next step Keep the tube in place in the magnetic rack with the beads held against the tube wall and gently remove and DISCARD the supernatant With the tube still in place in the magnetic rack gently add 200 uL of freshly prepared 70 ethanol Keeping the tube in place on the magnet let the bead pellet soak in the ethanol solution for 2 minutes at room temperature Gently aspirate out and discard the ethanol solution Repeat this washing procedure twice with clean 70 ethanol each time Ke
25. r W1 to the column Centrifuge the column at 210 000 x g 13 000 rpm for 2 minutes then discard the flow through Repeat to remove any residual wash buffer Air dry the column for 2 minutes to evaporate any residual alcohol Insert the column into a clean 1 5 mL LoBind tube Add 50 uL of Elution Buffer E1 to the column to elute the DNA then let the column stand for 2 minutes Centrifuge the column at 210 000 x g 13 000 rpm for 1 minute DO NOT DISCARD THE ELUATE The eluate contains your sample Add the eluate back onto the column then let the column stand for 2 minutes Centrifuge the column once more at 210 000 x g 13 000 rpm for 1 minute and collect the flow through Quantitate the purified DNA by using 2 uL of the sample on the NanoDrop ND 1000 Spectrophotometer STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to Bisulfite Convert the DNA 20 SOLID Bisulfite Converted Fragment Library Preparation Protocol Step 10 Bisulfite Convert the DNA Introduction Materials Needed Preparing the Cells to CpG Conversion Reagent In this step you use sodium bisulfite to chemically convert the cytosine bases in the DNA to uracil bases in an overnight reaction Cytosines methylated at the 5 position are resistant to this chemical process and remain as methylated Cs Denaturation is promoted by adding Hi Di Formamide to the DNA sample e Cells to CpG Bisulf
26. r 2 minutes then discard the flow through Repeat to remove any residual wash buffer Air dry the columns for 2 minutes to evaporate any residual alcohol Insert each column into a clean 1 5 mL LoBind tube Add 50 pL of Elution Buffer E1 to each column to elute the DNA then let the column stand for 2 minutes Centrifuge the columns at 210 000 x g 13 000 rpm for 1 minute DO NOT DISCARD THE ELUATE The eluate contains your sample Add the eluate back onto each column then let the columns stand for 2 minutes Centrifuge the columns once more at 210 000 x g 13 000 rpm for 1 minute and collect the flow through Pool the eluted DNA from the PureLink columns into a LoBind tube Quantitate the purified DNA library by using 2 pL of the sample on the NanoDrop ND 1000 Spectrophotometer STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to Size Select the DNA SOLID Bisulfite Converted Fragment Library Preparation Protocol 27 Step 14 Size Select the DNA Introduction In this step you size select the DNA Materials Needed AMPure XP Beads 1 5 mL LoBind tubes Magnetic rack 70 ethanol freshly prepared Low TE Buffer Bead Based This method selects for amplified adaptor ligated DNA molecules that are Selection Using between 100 and 350 bp in length with an average length of 200 bp AMPure XP 1 Beads 10 11 12 Add 0 8 volumes relative to the volume
27. sines in lambda derived sequences are converted to thymidine after treatment with bisulfite and subsequent amplification provides a good measure of the overall conversion efficiency within a complex sample Digestion with an enzyme such as Alu I is convenient because it produces a large number of fragments with varying sequences that fall within a useful size for such monitoring Furthermore since Alu I is a blunt cutter that cuts between G and C of the 5 AGCT 3 palindromic motif the sequences coming from the lambda spike can be identified by their ability to be mapped to the lambda genome and by a characteristic CT converts to TT 5 dinucleotide or AG 3 dinucleotide To create a lambda DNA standard 1 Digest 50 ug of whole lambda DNA to completion with 100 units of Alu I enzyme in a 250 pl volume in an appropriate buffer at 37 C overnight 2 Purify the digested DNA fragments with the PureLink PCR Purification Kit 3 Measure the concentration of the purified DNA by spectrophotometry 4 Dilute to a working stock concentration of 10 ng pL with Low TE Buffer 5 Forevery 1 ug of starting material add 10 ng 1 uL of Alu I digested lambda DNA directly to the sheared genomic DNA from the previous page e g add 50 ng of digested lambda DNA to 5 ug of sheared sample DNA SOLID Bisulfite Converted Fragment Library Preparation Protocol 11 Step 2 Prepare the Special dNTP Mixes Introduction Materials Needed
28. slation Buffer 100 mM MgCl 500 mM NaCl Nick Translation 1 Combine and mix the following components in a 1 5 mL LoBind tube Procedure Table 8 Nick Translation Mix Component Volume pL DNA 48 50 10X Nick Translation Buffer prepared as above 10 10 mM DTT 1 dNTP mix with methyl dCTP from page 12 5 Nuclease free Water Variable Exo Klenow Fragment 5 U uL 4 Total 100 2 Incubate at 16 C for 1 hour 3 Stop the reaction by adding 4 uL or 0 5 M EDTA pH 8 0 SOLID Bisulfite Converted Fragment Library Preparation Protocol 19 Step 9 Purify the Nick Translated DNA Introduction Materials Needed Purification Procedure In this step you purify the nick translated DNA using components in the SOLiD Library Column Purification Kit e SOLiD Library Column Purification Kit included with the SOLiD 10 11 12 Fragment Library Construction Kit TM Before loading the PureLink column dry spin at 10 000 x g 13 000 rpm for 1 minute Add 416 uL four volumes of Binding Buffer B2 L containing 40 isopropanol to the 104 uL of nick translated DNA from the previous page Mix thoroughly Apply the DNA binding buffer mixture to a PureLink column Let the column stand for 2 minutes at room temperature Centrifuge the column at 210 000 x g 13 000 rpm for 1 minute and discard the flow through Place the column back into the same collection tube Add 650 pL of Wash Buffe
29. strand is 430 500 L mole cm Measure the exact concentration of the resuspended oligos by UV spectrophotometry 3 Dilute each oligo to a final concentration of 125 uM and prepare a mixture of the oligo strands as follows Table 4 Methyl P1 Adaptor Annealing Mix Component Volume uL P1A adaptor oligo 125 uM 40 P1B adaptor oligo 125 uM 40 5X T4 Ligase Buffer 20 Total Volume 100 amp After annealing the proportions above will yield a solution that contains double stranded methyl P1 adaptor at a concentration of 50 uM Protocol continued on the next page SOLID Bisulfite Converted Fragment Library Preparation Protocol 13 Protocol continued from the previous page 4 In a thermal cycler such as the Applied Biosystems GeneAmp PCR System 9700 heat the solution to 95 C then controllably cool it as shown below to permit the complementary oligos to efficiently anneal into double stranded adaptor molecules Table 5 Cooling steps for annealing methyl P1 adaptor in a thermal cycler Temperature C Time minutes 95 5 72 5 60 5 50 3 40 3 30 3 20 3 10 3 4 forever After annealing the double stranded methyl P1 adaptor may be handled and stored alongside the P2 adaptor from the SOLiD Fragment Library Oligos Kit As always be careful to avoid denaturing the annealed adaptors do not bring them above 37 C SOLID Bisulfite Converted Fragme
30. structions STOPPING POINT Following quantitation store the purified DNA at D 20 C or proceed directly to emulsion PCR as described in the Applied Biosystems SOLiD 4 System Templated Bead Preparation Guide PN 4448378 or the Applied Biosystems SOLiD EZ Bead Emulsifier Getting Started Guide PN 4441486 30 SOLID Bisulfite Converted Fragment Library Preparation Protocol Technical Support Support For the latest services and support information for all locations go to Information www appliedbiosystems com At the Applied Biosystems web site you can Access worldwide telephone and fax numbers to contact Applied Biosystems Technical Support and Sales facilities Search through frequently asked questions FAQs Submit a question directly to Technical Support Order Applied Biosystems user documents SDSs certificates of analysis and other related documents Download PDF documents Obtain information about customer training Download software updates and patches SOLID Bisulfite Converted Fragment Library Preparation Protocol 31 Part number MAN0003271 Revision date 2 December 2010 v a ppl i ed Headquarters International Sales E38 b H t x 850 Lincoln Centre Drive Foster City CA 94404 USA For our office locations please call the division a losyS ems Phone 650 638 5800 Toll Free 800 345 5224 headquarters or refer to our Web site at by Life technologies www appliedbiosystems com www appl
31. te and collect the flow through Quantitate the purified DNA by using 2 uL of the sample on the NanoDrop ND 1000 Spectrophotometer STOPPING POINT Store the purified DNA in Elution Buffer E1 at 4 C or proceed directly to Ligate Methyl P1 and P2 Adaptors to the DNA SOLID Bisulfite Converted Fragment Library Preparation Protocol Step 6 Ligate Methyl P1 and P2 Adaptors to the DNA Introduction Materials Needed Calculating the Amount of Each Adaptor Needed Ligating the Adaptors In this step you ligate the methyl P1 adaptor and non methylated P2 adaptor to the DNA e 5X T4 Ligase Buffer e T4 Ligase e Methyl P1 adaptor double stranded from page 13 e P2 Adaptor double stranded included in the SOLiD Fragment Library Oligos Kit e 1 5 mL LoBind tube e Nuclease free water Before proceeding calculate the amount of each double stranded adaptor needed based on the amount of the DNA from the previous purification procedure using the formulas below X If DNA fragments were sheared as described on page 9 the average insert size should be approximately 165 bp before adaptor ligation Formulas X pmol ug DNA 1 ug DNA x 10 pg 1 ug x 1 pmol 660 pg x 1 average insert size Y uL of adaptor needed of ug DNA x X pmol 1 ug DNA x 15 x 1 pL adaptor needed 50 pmol Example For 1 ug of purified end repaired DNA with an average insert size of 165 bp X pmol ug DNA 1 ug D
32. tube 3 Fill the Covaris S2 tank with fresh deionized water to level 12 on the graduated fill line label The water should cover the visible glass part of the tube 4 Shear the DNA using the following Covaris S2 System conditions Number of Cycles 6 e Bath Temperature 5 C e Bath Temperature Limit 10 C e Mode Frequency sweeping e Water Quality Testing Function Off Duty cycle 10 e Intensity 5 e Cycles burst 100 Time 60 seconds TM 5 Remove the Covaris microTUBE from the loading station While keeping the snap cap on insert a pipette tip through the pre split septa then slowly remove the sheared DNA Transfer the sheared DNA into a new 1 5 mL LoBind tube SOLID Bisulfite Converted Fragment Library Preparation Protocol Optional Spike In Lambda DNA Digested with Alu Introduction Materials Needed Purpose of the Lambda DNA Creating and Adding the Lambda DNA Standard In this optional step you add endonuclease digested phage lambda DNA to your sample as a control e Whole lambda DNA e Alu I restriction enzyme e PureLink PCR Purification Kit e Low TE Buffer The addition of endonuclease digested phage lambda DNA is useful for monitoring the conversion efficiency of the bisulfite reaction Lambda grown in dcm bacteria contains only a very small amount of cytidine methylation on the internal cytosines of CCWGG motifs Consequently the frequency with which all other cyto
33. uniquely designed for SOLID workflows and is used at different steps throughout this protocol Ligate Methyl P1 and P2 Adaptors to the DNA Next ligate double stranded P1 and P2 Adaptors to the ends of the end repaired DNA The non methylated P2 adaptor is included in the SOLiD Fragment Library Oligos Kit For bisulfite compatible library construction a modified P1 adaptor containing methylated cytosines must be annealed from high purity single stranded oligos purchased separately After ligation purify samples using the SOLiD Library Column Purification Kit Nick Translate the DNA After ligation the library molecules undergo nick translation with a nucleotide mix that contains 5 methyl dCTP in place of normal dCTP This step yields bisulfite compatible amplifiable library molecules After nick translation purify TM samples with the SOLiD Library Column Purification Kit Bisulfite Conversion The Cells to CpG Bisulfite Conversion Kit is the preferred set of reagents to use for this step Add Hi Di Formamide to denature the DNA sample The temperature and length of time for bisulfite conversion have been optimized to maximize the conversion efficiency and preserve library molecules SOLID Bisulfite Converted Fragment Library Preparation Protocol Desulfonation and Purification Desulfonate the library at room temperature within a centrifugal filtration device Immediately afterward the converted DNA is concentrated and
Download Pdf Manuals
Related Search