Home

GenoSensor Corporation GenoSensor DNA Fingerprinting Kit

image

Contents

1. GenoSensor Corp Introduction Objective overview 1 Understand how DNA is responsible for genotypic differences between individuals 2 Investigate techniques used in DNA fingerprinting DNA sequence diversity and uniqueness gel electrophoresis DNA restriction enzymes 3 Investigate and understand the process for gel electrophoresis including analyzing your data In this lab you will examine a simplified version of a DNA fingerprinting process During the exercise you will learn to analyze and compare a number of DNA fragments to determine whether or not they are from the same individual These fragments can be visualized through a process known as gel electrophoresis DNA is long double helix polymer that is made up by different combinations of the 4 nucleotides Adenine A Thymidine T Cytosine C and Guanine G In a DNA molecule A is paired with T and G is paired with C to form the helix structure Each individual will have different sequences of A T G and C in their DNA There are constant regions and variable regions in human DNA and we can use the variable regions to identify humans by their DNA In this exercise you will use several techniques to figure out if the DNAs of several suspects match the DNA collected at the crime scene Because DNA is a very long polymer scientists have found several ways to fragment the DNA in order to work with it more easily One of the techniques is to use restriction enzymes In 1968
2. cccccsessssccececessesennececececessessaaeseeeeseesseseaeaeeeesens 9 Part 2 QUESTIONS ao ae EEN E EEN EEEE save beceaseees E AE E SRE 10 Results and Discussion iccucc iccsiszciscas cacesndssncsdensacnsceadsacinsniseunsnevases 11 Technical Service assine irune cessed Eee rr rain 13 Literature Citation When describing a procedure for publication using these products we would appreciate that you refer to them as the GenoSensor DNA Fingerprinting Kit GenoSensor DNA Fingerprinting Kit GenoSensor Corp Notes for Instructors Kit Components and Storage Conditions Component Storage 2X Master Mix 20 C Suspect A 20 C Suspect B 20 C Suspect C 20 C Criminal DNA 20 C DNA ladder 20 C Preparation for Restriction Digest Set heat block or water bath to 37 C Thaw 2x Master Mix on ice Before opening tube spin 10 sec at 6 000 rpm or greater ina microcentrifuge Vortex 10 seconds then spin again for 10 seconds Aliquot the 2X Master Mix as necessary after doing the above preparation Each package contains enough 2X Master Mix for 24 digest reactions sufficient to cover all of the suspect and criminal samples provided in the kit Use 10 ul of 2X Master Mix with 10 ul sample DNA for a total digest volume of 20 ul Electrophoresis Electrophoresis reagents are not provided in the kit Please refer to the required materials list Best results are obtained by adding DNA dye i e Gel Red or Sybr Sa
3. other error is inevitable Therefore GenoSensor makes no warranty of any kind regarding the contents of any publications or documentation If you discover an error in any of our publications please report it to our Technical Service GenoSensor assumes no responsibility or liability for any special incidental indirect or consequential loss or damage whatsoever The above limited warranty is sole and exclusive No other warranty is made whether expressed or implied including any warranty of merchantability or fitness for a particular purpose GenoSensor DNA Fingerprinting Kit GenoSensor Corp 13
4. techniques used in DNA research and in forensic analysis The kit creates a crime scene scenario utilizing three different plasmids to represent three suspect samples one of which matches an additional sample labeled as Criminal DNA representing DNA collected from the scene of the crime The goal of the experiment is to identify which of the suspects is the culprit by performing restriction digests with two restriction enzymes EcoRI and Sspl on the four samples After completing the experiment one should be able to understand the concepts behind restriction digests gel electrophoresis and the genetic concepts driving the experiment Kit Components and Storage Conditions for a lab of 24 students Component Amount 30 rxn s Storage 2X Master Mix 240 ul 24 rxns 20 C Suspect A 60 ul 6 rxns 20 C Suspect B 60 ul 6 rxns 20 C Suspect C 60 ul 6 rxns 20 C Criminal DNA 60 ul 6 rxns 20 C DNA ladder 30 ul 20 C Additional Required Materials 1 CONOR WN Heat Block or heat plate Beaker with de ionized water water bath Tube floater Thermometer Microcentrifuge Microcentrifuge tubes Vortex Micropipettes p10 p200 p1000 Pipette tips Tube Racks Electrophoresis equipment Electrophoresis supplies agarose TBE DNA loading buffer running buffer gel dye eg Sybr safe Gel Red 10 UV light box or Gel Doc equipment and program GenoSensor DNA Fingerprinting Kit
5. uL 20 uL Suspect A SA 10 uL 10 uL 20 uL Suspect B SB 10 uL 10 uL 20 uL Suspect C SC 10 uL 10 uL 20 uL 3 Tightly cap on each tube Mix the tube contents Mix the components by gently flicking the tubes with your finger Arrange the tubes in a microcentrifuge and spin for 5 seconds to force all the liquid to the bottom of the tubes Be sure the tubes are ina BALANCED arrangement in the rotor 4 Incubate the tubes at 370C for 45 minutes in a water bath or heat block Part 1 Questions While waiting for your samples to be digested by the endonucleases consider these following questions 1 When you mix the DNA with the endonuclease mix was there any visible change or any sign of reactivity GenoSensor DNA Fingerprinting Kit GenoSensor Corp 2 Can you see any evidence to indicate your samples of DNA were fragmented or altered in any way by the addition of the endonuclease mix Explain 3 Inthe absence of any visible evidence of change is it still possible that the DNA samples were fragmented Explain 4 After the incubation period are there any visible clues that restriction enzymes altered the DNA in any of the tubes Explain Part 2 Agarose Gel Electrophoresis Protocol General Procedure detailed directions as given by instructor Prepare 0 8 1 agarose Set up electrophoresis apparatus and pour the 1 molten agarose for gelation For staining use a DNA dye which is added directly to the molten agar
6. Dr Werner Arber at the University of Basel Switzerland and Dr Hamilton Smith at the Johns Hopkins University Baltimore discovered a group of enzymes in bacteria which when added to any DNA will result in the breakage of the sugar phosphate backbone bond within a specific sequence of nucleotide bases called a recognition site These enzymes cause the double strand of DNA to break within the recognition site and the DNA molecule becomes fractured into two pieces These molecular scissors or cutting enzymes are restriction endonucleases The two endonucleases you are going to use today are called EcoRI and Sspl The following figure depicts the recognition site of these endonucleases Since each individual s DNA is unique the fragmented DNA profile created by these two enzymes will be very different from each other EcoRI 5 GAATTC 3 5B G R AATTC 3 3 CTTAAG 9 4 cCTIAR Geka EcoRI Sspl Yy a 6 AATATT 13 5 AAT gi AT aka 3 TTATAA 9 Jra TTA TAA 5 Sspl GenoSensor DNA Fingerprinting Kit GenoSensor Corp In order to compare the DNA profiles of individuals we have to find a way to separate these fragments and to visualize the DNA profile This can be accomplished by agarose gel electrophoresis a separation of DNA through a matrix within an electric field Since DNA is negatively charged when it is put under an electric field it will migrate from the cathode to the anode When the DNA fragments are put
7. G GenoSensor Corporation eee GenoSensor DNA Fingerprinting Kit Catalog 4000 s Version A Feb 2014 User Manual GenoSensor DNA Fingerprinting Kit Manual Table of Contents Notes for Instructors ss ELLE EEN El alene 2 Preparation for Restriction Digest cccccessssccececessesenseceeeeecsssesesaeseeececesseseaaeseeeesessseseaaeaeeeesens 2 EICCTRO PN ONESIS ss eee eee act EEA SEENDE es E EEO a ets 2 Shipping Storage and Safety cccececeeeeeeeeeeeeneeeeeeeeeeeeeeeeeeaeeees 3 GenoSensor DNA Fingerprinting Kit Overview ccccceseeeeeees 4 Kit Components and Storage Conditions ccccccccccssssssscecececsssessesecececessesssaeaeeeescessesseaeaeeeesens 4 Additional Required Materials sii c2 c Ate eh ed Oe a ee A 4 Intfoducti ON oa edocs cess EDEL EB hende 5 Pre lab QUESTIONS isco cess tater ceca cthatereeccedenas sexeee edad ecaateb Cee ce seeder penis 7 DNA Fingerprinting Protocol ceceeeeeeeeeeeeeeeeneneeeeeeeeeeeeeees 8 Preparation sr ect a ack Geli eee eee ach ari i ie tA ec hee 8 Pre Experiment ObServations ccccscccccccessssesssaeeeeecsssesesneaeeeesceseeseaaeaeeesecssseseaaeseeeessesseseaaees 8 Part 1 Restriction Digest Protocol ccccccesssccececeesessnsececececsssesesaeaesececesseseaaeaeeeesesssesuaeaeeeeeess 8 PEEL QUESTIONS Hoa task a ERE oe ete ceive EEN ce erat eendes Dee ce eee tot 8 Part 2 Agarose Gel Electrophoresis Protocol
8. ck it is recommended to add water or sand to ensure proper heat transfer For a water bath be sure tubes are tightly sealed and not fully submerged to avoid contamination 2 Thaw 2x Master Mix on ice Before opening tube spin 10 sec at 6 000 rpm or greater in a microcentrifuge Vortex 10 seconds then spin again for 10 seconds Pre Experiment Observations 1 Describe the samples of DNA physical properties color viscosity etc Can you see the DNA 2 Is there any observable difference between the samples of DNA 3 Describe the appearance of the restriction endonuclease mix Can you see the proteins Part 1 Restriction Digest Protocol Keep the enzyme mix all samples and reaction mixtures on ice when not in use 1 Pipette 10 uL of the 2X Master Mix which contains the enzymes Sspl and EcoRI along with the restriction digest buffer to four separate fresh and labeled microcentrifuge tubes 2 Using a NEW pipet tip for each sample pipet 10 uL of each stock suspect DNA sample and the criminal sample into separate tubes from step 1 Pipet up and down carefully to mix well Note Change tips whenever you switch reagents or if the tip touches any of the liquid in one of the tubes accidentally When in doubt change the tip DNA goes in the tube before the enzyme Always add the enzyme last Restriction Digest Reaction Mixtures DNA Samples EcoRI Sspl 2x Master Mix Total Reaction Volume Criminal C 10 uL 10
9. fe to molten agarose Avoid exposing the agarose gel to light It is best to store and run the gel in a dark room or cover the gel with a box during gel polymerization and the whole electrophoresis process There is enough DNA ladder to load 3 lanes with 10 ul GenoSensor DNA Fingerprinting Kit GenoSensor Corp Shipping Storage and Safety Shipping and Storage GenoSensor DNA Fingerprinting kits are shipped on dry ice Components should be stored at temperatures shown in the above table At proper storage conditions components are stable for 1 year from the date received Expiration dates are also noted on product labels Safety Warnings and Precautions This product is intended for research use only It is not recommended or intended for the diagnosis of disease in humans or animals Do not use internally or externally in humans or animals Consider all chemicals as potentially hazardous Only persons trained in laboratory techniques and familiar with the principles of good laboratory practice should handle these products Wear suitable protective clothing such as laboratory overalls safety glasses and gloves Exercise caution to avoid contact with skin or eyes if contact should occur wash immediately with water Material Safety Data Sheet for products is available upon request GenoSensor DNA Fingerprinting Kit GenoSensor Corp GenoSensor DNA Fingerprinting Kit Overview The GenoSensor DNA Fingerprinting Kit introduces common
10. field with positive and negative poles at the ends of the gel DNA molecules are negatively charged To which electrode pole of the electrophoresis field would you expect DNA to migrate 2 After the DNA samples are loaded into the sample wells they are forced to move through the gel matrix What size fragments large vs small would you expect to move toward the opposite end of the gel most quickly Explain 3 Can you see the DNA moving while the gel is under the electric field Explain 4 The sequence of a DNA fragment is shown below Use it to answer the following questions 5 GTGAATTAATATTAAATATTGGGAATCCTTGGGAATTCGTACA 3 3 CACTTAATTATAATTTATAACCCT TAGGAACCCTTAAGCATGA S a How many EcoRI and Sspl restriction sites are there in the sequence b How many pieces of DNA would result from cutting this DNA fragment with EcoRI alone Sspl alone Both EcoRI and Sspl together c Write out the sequences of the possible DNA fragments from a EcoRI cut alone and indicate their sizes Which fragment will migrate the farthest distance in the gel Which fragment will travel the shortest distance GenoSensor DNA Fingerprinting Kit GenoSensor Corp 10 Base Pairs Mass ng 1 517 45 1 200 35 1 000 95 900 27 800 24 700 21 600 18 500 517 97 400 38 300 29 200 25 100 48 Fig 1 100 bp DNA Ladder DNA Ladder reference Results and Discussion Take a look at the bands visible in
11. hat the DNA dye has not degraded in storage been contaminated or expired GenoSensor DNA Fingerprinting Kit GenoSensor Corp Technical Service For more information or technical assistance please call write fax or email GenoSensor Corporation 4665 S Ash Avenue Suite G 18 Tempe Arizona 85282 Tel 1 480 598 5378 Fax 1 480 755 3319 Email tech_service GenoSensorcorp com Web www GenoSensorcorp com Limited Warranty GenoSensor is committed to providing our customers with high quality goods and services Our goal is to ensure that every customer is 100 satisfied with our products and our service If you should have any questions or concerns about a GenoSensor product or service please contact our Technical Service at tech_service GenoSensorcorp com GenoSensor warrants that all of its products will perform according to the specifications stated on the certificate of analysis This warranty limits GenoSensor Corporation s liability only to the cost of the product No warranty is granted for products beyond their listed expiration date No warranty is applicable unless all product components are stored in accordance with instructions GenoSensor reserves the right to select the method s used to analyze a product unless GenoSensor agrees to a specified method in writing prior to acceptance of the order GenoSensor makes every effort to ensure the accuracy of its publications but realizes that the occasional typographical or
12. ose For light sensitive dyes keep the gel in the dark during gelation either by performing in a dark room or placing a box over the gel Mix sample with loading dye according to instructor directions to ensure that the sample will sink to the bottom of the well and properly enter the agarose gel Use at least 10 uL of digested DNA product to visualize results by electrophoresis on agarose gel If gel well volume will accommodate more than 10 ul a higher volume is Ons gt A preferred Sample Gel Loading Setup Digested DNA Samples Loading Mix Total Volume Criminal C 20 uL 5 HL 25 uL Suspect A SA 20 uL 5 UL 25 uL Suspect B SB 20 uL 5 UL 25 uL Suspect C SC 20 uL 5 HL 25 HL 5 Load samples with loading dye into the gel Record which wells hold which samples ka EKI ea Run at 120V for 30 minutes and stop before loading dye has run off gel Depending on the DNA dye used caution may need to be taken to reduce exposure of gel to light Visualize under UV and record the results manually or by photography Compare the bands The DNA ladder can be used as a band size reference Recommended Gel Loading Lane 1 ep DE Ladder C ell DE Be HR HR D oo N GenoSensor DNA Fingerprinting Kit GenoSensor Corp Part 2 Questions While waiting for your samples to electrophorese answer these questions with your group members 1 The electrophoresis apparatus creates an electrical
13. through a matrix within an electric field the smaller fragments will migrate faster than the bigger fragments Lastly the DNA profile can be visualized by staining the DNA and viewing it under UV light Remember that each individual has a different fragmented DNA profile cut by the same restriction endonucleases thus each individual will have a different DNA separation pattern on the gel GenoSensor DNA Fingerprinting Kit GenoSensor Corp Pre lab questions What is DNA profiling In this lab we will use small pieces of DNA instead of chromosomal DNA to simplify our DNA profile If you cut a human s chromosomal DNA containing 3 billion base pairs bp into 4000 bp pieces how many DNA pieces would you get If the whole human chromosomal DNA of 3 different individuals are subjected to the EcoRI and Sspl enzyme mix and then those samples are separated by DNA gel electrophoresis would you be able to compare the DNA profiling Explain Below is an example of a gel electrophoresis of 6 different DNA profiles Which of them do you think come from the same individual Explain p v aei gei Ss lt Z Qa el e2 e3 e4 e5 e6 DNA Profi DNA Profi DNA Profi DNA Profi DNA Profile DNA Profi 5 When working with DNA what do you think is a critical factor Explain GenoSensor DNA Fingerprinting Kit GenoSensor Corp DNA Fingerprinting Protocol Preparation 1 Set heat block or water bath to 37 C For a heat blo
14. your samples on the gel Recall which lanes contained the suspect samples and which contained the criminal sample Do any of the suspect samples match with the criminal sample on the gel Visually analyzing the bands in relation to each other is quick and useful but how would you better quantitatively measure each band s position for comparison Other members of your class will have done their own digests using the same samples Compare your results with theirs Do your results agree What did you learn today GenoSensor DNA Fingerprinting Kit GenoSensor Corp Troubleshooting Problem Possible causes Solutions Incomplete or no digestion of DNA 2X Master Mix not properly prepared It s vital that the Master Mix be properly thawed spun down and vortexed before use to ensure the enzyme and all components are properly mixed Heat block Water bath Heating source temperature incorrect Be sure the heat source used for incubation sits stably at 37 degrees Celsius Incubation time too short Shorter times should work but if you re having trouble increase the incubation times Weak bands faint signal DNA Dye degradation during preparation Light sensitive dyes should be kept in the dark during gel preparation Prepare in dark room or place a box over the electrophoresis apparatus during gelation and electrophoresis Expired contaminated or degraded DNA dye Verify t

Download Pdf Manuals

image

Related Search

Related Contents

GO PDF  Badnet  C:\Documents and Settings\X\My Documents\JSVGX MANUAL 2006  6. 浴室  W 101 S doc - map yachting  Printed in China W476 / W576 Notebook  NorskWall NSNW4PP Installation Guide  BOLARDOS Bollards Potelets  INTRODUCTION HARDWARE INSTALLATION  PDF, 3 MB  

Copyright © All rights reserved.
Failed to retrieve file