Home
pEco™-T7-nGST PCR Cloning kit
Contents
1. 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com pEco T7 nGST PCR cloning Kit User Manual Patent pending Cloning PCR products for E Coli expression of C term His tagged protein Cat Contents Amounts Application pEco T7 nGST vector built in 10 tubes x 50ul ea Eco Cloning cells for 10 rxn E Coli expression of N IC 1004 Positive PCR insert 1 x 10ul ea term GST tag protein Sequencing primer pair Forward and reverse 15ul each 25ng ul Storage Eco Cloning Kit is shipped on dry ice Upon received stored at 80 C Once thawed must be used do not re freeze Product should be stable for 6 months Product Description 1 Introduction The revolutionary Eco Fusion in vivo cloning method is the easiest PCR cloning method available 1 Simply amplify your gene of interest with a primer pair that is flanked with short arms homologous to the expression vector 2 Add 2 ul of purified PCR into the engineered vector build in cloning cells 3 Immediately proceed to transformation 2 How it works The engineered E Coli strain in GenTarget s Eco PCR Cloning Kit has an enhanced E Coli competent cells enabling an in vivo joining reaction for cloning with no tube reactions Let the E Coli do the job for you In Vivo GenTarget provides E Coli cloning cells with a selection of built in vectors for mamm
2. minimize PCR errors we recommend using high fidelity DNA polymerase Use any PCR purification column to clean your PCR products If you do not obtain a single discrete band from PCR gel purify your fragment Important if your PCR template can generate background clones having Amp resistance treat the PCR product with DPNI or perform gel purification 3 Transformation Thaw Eco Cloning cells in ice water After they are completely thawed add 1 2 ul purified PCR product from 20ng to 150ng into each vial of cells and mix briefly by tapping the tube with your finger For control vials add 1ul positive PCR insert provided as a positive control and then add ul water to a negative control cells vial Put tubes back on ice and proceed to heat shock at 42 C for 40 seconds Note Do not leave DNA cells mixture on ice for prolonged period less than 15min are fine Put tubes back on ice for 1 min add 250 pl of SOC medium and incubate at 37 C shaking for 1hr Plating take a 250 pl competent cells above spread out on pre warmed LB agar plates containing 100 ug ml ampicillin Grow colonies at 37 C overnight Eco Cloning of pEco T7 nGST product manual Page 4 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Note In the absence of a PCR insert ce
3. primer IC 1004 pEco T7 nGST IC 1004 fwd IC 1004 rev 5 catggcctttgcagggct 5 tgctagttattgctcagcgg 5 Protein expression Once positive clones are confirmed they can be used directly for protein expression without re transformation into another strain Transformation transform the sequencing verified plasmid DNA into any strain containing a T7 RNA polymerase such as BL21 DE3 or BL21 DE3 pLys from which protein are expressed upon IPTG induction Transformation uses standard heat shock protocol such as add 1ul DNA into 50ul competent cell set ice 5 15min heat shock at 420C for 30 seconds back to ice for 2min add 250ul SOC recovery at 370C Eco Cloning of pEco T7 nGST product manual Page 5 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com shaking for 1 hour Plate 10 to 100ul onto LB plates containing 100ug ml ampicillin Grow colonies at 370C incubator for overnight e Propagation Pick one clone grow in LB medium with ampicillin at 370C shaking overnight Add overnight culture into appropriate amount of LB medium containing 100ug ml of ampicillin by making 1 40 dilution keep medium volume at 20 of flask volume for better aeration vigorously shake at 300C 300rpm e Induction measure growth OD600 at the time when OD600 0 5 add an appropriate amoun
4. a T7 Promoter 20 39 EER RBS 87 92 GST 100 771 GOI cloning ends 777 778 T7 term 793 922 F1 ori 993 1448 Ampicillin 1579 2439 pUC19 ori 3257 2584 7 Troubleshooting Problems Solution No colony Be sure to set up a positive control transformation using the provided positive PCR insert1 which should give you 10 100 colonies Spread all of the transformation mixture onto the plate Background Be sure to set up a background control plate in which no colonies PCR product was added to the cells It should generate 0 5 colonies or less than 10 compared to plates with the insert Note in the absence of a PCR insert cells force vector self ligation resulting in a few background colonies Make sure that the PCR s template does not cause background colonies If it does clean PCR products by gel isolation or treatment with DPNI Plate less transformation mixture onto the plate Be sure to use the right amount of antibiotics in the LB plate and make fresh LB plates if necessary Use carbenicillin instead of ampicillin if applicable pa Satellite colonies Do not incubate plates longer than 16 hours Try to avoid picking the tiny satellite colonies Eco Cloning of pEco T7 nGST product manual Page 7 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Ema
5. alian or E Coli expression systems A proprietary process for making ready to use E Coli cells with built in vectors ensures low background and a positive cloning rate of greater than 90 Eco Cloning of pEco T7 nGST product manual Page 1 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Target PCR Add PCR to cells ee e ap 4 _ Transformation I et ee A In vivo cloning Oe pEco T7 nGST cloning cells was built in with a pET based T7 expression vector PCR insert will be cloned in framed with a N terminal GST tag 3 Key Features e The easiest and most cost effective PCR cloning method available Simply add iul of PCR insert into provided cells for transformation regardless of the insert s size and concentration e No need to buy vectors and no tedious bench work preparing a vector backbone e No need to buy cloning competent cells e No need for any enzymes or any tube reactions e Precisely directional cloning of PCR products with an in frame GST tag at N term e Flexibility to allow addition of any cleavage site for removal of the nGST tag if desired e Compatibility with any PCR product with or without a 3 A overhang the extra A overhang if it exists will be removed in the cloning step e Can be used with PCR products of va
6. gn To design the primer pair for the following gene sequence atggcctctgtgaaggaaaatccactctagtccctacctgcatttctcagccttgct tacctgttgccaacattgggccaacccgaattcttcccaatctttatcttggctgcca gcgagatgtcctcaacaaggagctgatgcagcagaatgggattggttatgtgtta aatgccagcaatacctgtccaaagcctgacttttta The PCR primer for vector pEco T7 nGST will be Fwd 5 atcggatctggttccgcgtgaattcatgecctctgtgaaggaaaa Rev 5 ttgttagcaggttaacacgcgtctaaaagtcaggctttggacagg If inserting a protein cleavage site the foward primer will be Eco Cloning of pEco T7 nGST product manual Page 3 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Fwd 5 atcggatctggttccgcgtgaattctNNNNNNecctctgtgaaggaaaatcc where the NNNNNN is the in framed codon sequence of cleavage site Notes 1 GenTarget s cloning kits with the same terminal tags share PCR insert sites The three Eco cloning kits with N terminal tags Cat IC 1001 IC 1002 and IC 1003 can share the same PCR insert and the two cloning kits with C terminal tags Cat IC 1006 and IC 1007 can share the same PCR insert 2 A stop codon does not need to be included in the PCR reverse primer since a stop codon is already built in immediately after the PCR insert 2 Target amplification by PCR Amplify your target using any PCR amplification protocol that works for you To
7. il Orders gentarget com References 1 Oliner et al 1993 Nucleic Acids Res 1 5192 97 2 Aslanidis et al 1994 Genome Res 4 172 177 3 Kaluz et al Nucl Acids Res 1992 20 4369 4370 Related Products Cat Product Name Amount Application PCR cloning kit with a built in vector T7 promoter based in provided cloning cells kit for E Coli expression of N term His tagged IC 1001 PCR cloning kit protein PCR cloning kit with a built in mammalian expression vector with neomycin selection F marker in provided cloning cells The vector PCR cloning kit kit containing an engineered super CMV promoter for high yield mammalian IC 1002 expression of N term His tagged protein PCR cloning kit with a built in vector non T7 promoter based in provided cloning cells for E Coli expression of C term His N tagged protein specially designed for toxic IC 1003 PCR cloning kit kit proteins PCR cloning kit with a built in vector T7 promoter based in provided cloning cells for E Coli expression of C term His tagged tein IC 1006 PCR cloning kit kit P e PCR cloning kit with a built in mammalian expression vector with Neomycin selection marker in provided cloning cells for mammalian expression of C term His IC 1007 PCR cloning kit kit tagged protein Eco Cloning of pEco T7 nGST product manual Page 8 of 8 www gentarget com GenTarget Inc Copyrights 2015
8. lls usually form background colonies the no insert negative control also generates a few colonies In the presence of PCR insert however gt 90 colonies are positive Colony number varies depending on the quality and quantity of the PCR products The concentration of purified PCR product can be from 20 ng l to 150 ng ul with sizes ranging from 200 bp to 10 kb For simplicity and particularly for high throughput cloning we recommend adding 1 2 ul of PCR product into the cloning cells Regardless of the PCR product s concentration and size it will generate enough colonies 5 100 colonies in general for downstream work 4 Save glycerol stocks for later expression and verification of positive clones Pick 2 5 colonies propagate in LB Amp and incubate at 37 C overnight Save an aliquot of each clone in LB Glycerol medium containing 100 ug ml ampicillin at a final concentration of 15 Glycerol Isolate the plasmid DNAs using a DNA miniprep kit Confirm the positive by restriction digestion PCR inset can be cut out by EcoRI HpaI Run 1 2 agarose the positive clones will show two bands 3 4 kb backbone the PCR insert or multiple bands when the cut exist within the PCR insert Final sequencing verification Use the provided sequencing primer pair The sequencing primer comes in a ready to use dilution use 1ul for each sequencing reaction with 500ng plasmid in 20ul volume Cat Vector Forward primer Reverse
9. rying sizes from 200 bp to 10 kb The same PCR product can be used to construct multiple different expression vectors e Engineered E Coli expression vectors for high protein yields e Great for high throughput cloning 4 Protocol Outline Eco Cloning of pEco T7 nGST product manual Page 2 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Produce and clean PCR products v Add 1 2 ul of PCR product into the cloning cells provided briefly mix and immediately proceed to transformation v Pick colonies save glycerol stocks and isolate plasmids by miniprep to verify the positive clones v Express protein from the saved glycerol stock 5 Detailed Protocol 1 PCR primer design PCR primers used for generating inserts for Eco Cloning must contain a 20 25bp homologous sequence corresponding to the built in vector Design your primer pair as follows Fwd 5 atcggatctggttccgcgtgaattc 20bp of 5 end gene specific forward sequence Rev 5 ttgttagcaggttaacacgcgtcta 20bp of 3 end gene specific reverse sequence A protein cleavage site may be included in the forward primer to allow excision of the N term tag if desired Its codon sequences must be in frame and set between the homologous leader and the 20bp gene specific sequence An example of PCR primer desi
10. t of IPTG continue grow for 17 24 hours with vigorously shaking at 300C 300rpm e Harvest cells by centrifugation e QC Cell pellet was lysed using lysis reagent Following the lysis protocols run protein gel for analysis e Purification use your favorite protocols and reagent to purify the expression GST tagged protein by GST tag affinity column e Purity and function analysis of the expressed protein using your favorite protocols 6 Vector maps The figure below summarizes the vector map of pEco T7 nGST The complete nucleotide sequence is available for downloading from our Website at Support page www gentarget com To make your clone map simply paste your gene sequence not included the flanking sequences of both ends in the Red highlighted position replacing the NNNN NN In most case the pasted sequence is ATG to last codon Cloning site for pEco T7 nGST vector ECOR GST PCR insert MluI HpaI 751 GAATTCNNN NNNNNNTAGA CGCGTGTTAA CTTAAGNNN NNNNNNATCT GCGCACAATT Hpal CCTGCTAACA AAGCCCGAAA GGAAGCTGAG TTGGCTGCTG CCACCGCTGA GGACGATTGT TTCGGGCTTT CCTTCGACTC AACCGACGAC GGTGGCGACT Eco Cloning of pEco T7 nGST product manual Page 6 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el orgel ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Map of pEco T7 nGST vector pUC19 ori pEco T7 nGST
Download Pdf Manuals
Related Search
Related Contents
Un peu désuète, l`image du détective en imper qui s 取扱説明書 User`s Manual ZERO SS ANO/ WT キャタ User Manual User Manual - EnGenius Technologies, Inc. Manual del Usuario QS Manual Cuba-Ultrassom Soothes and softens hands, elbows, feet, and more Copyright © All rights reserved.
Failed to retrieve file