Home

My Document - Support

1. STACCGTAACGAACGIA T CATTAAGAT TACTTGATCCACT GATT CAACGTACCGTAACGAACG TAT CAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTGCAACGACGAAAAGAAT GATAACAGTAACACACTTCTGTTAACCTT 7AAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGAT TACT TGATCCACTGATT CAACGTACCGTAAAGAT TACT TI GATCCACTGAT I GAACCTACCGTAACGAACGTAT CAME GAGACTAAATALTAASGIRCCATIAAGAGK TAGO CCAT TAAGAGCTACCGTGCAACAGTAACACACTTCTGT TAACCT TAAGAT TACTTGATCCACTGAT T CAACGTACCGTAACGAACGTAT CAATTGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGT GCAACGACGAAAAGAAT GATAA 3ATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTCTICTGTTAACCTTAAGAT TACTTGATCCACTGATTCAACG 2TTGATCCACTGAT TCAACGT TAAGAT TACTTGATCCACT GATTCAACGTACCGTAACGAACGTATCAAT TGAGCTTCTGT TAACCTTAAGAT TACTTGATCCACTGAT TCAACGTACCGTAACGAACGTAT CAAT T GAGAC TAGCAACGACGi Fee Ee oe eee eee eee eee eee eee eee oe ene eee ee ee OTARRA ATATEN AAE NAT AAEE EEN CATLIN MANGAN RTA AGT GTACCGTAACGAACGTATCAT TAAGATTACTTGATCCACTGAT TCAACGTACCGTAACGAACGTATCAATTGAGA Lee IY gy SCL Oe all eC AL ACCGTGCAACGACGAAAAGAATGATAACAG TAACACACTTCTGTTAACCTIA STTGATCCACTGATTCAACGT TAAGAT TACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGCTTCTGTTAACCTTAAGAT TACT TGATCCACTGATTCAACGTACCGTAACGAACGTATCAAT TGAGAC TAGCAACGACGi 37AAAAGAATGATAACAGTAACACACTTCTGT TAACCTTAAGAT TACTT GATCCACT GATT CAACGTACCGTAAAGAT TACTTGATCCACTGAT TCAACGTACCGTAACGAACGTAT CAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACC 3ATAACAGTAACACACTTCTGTTAACCTTAAGATTA E OU BAUL AALAGA AG IKA
2. Steps to Resuspend the MSA3 Plate 1 At the robot PC select MSA3 Tasks Resuspend MSA3 2 Other than Illumina LIMS Make sure the Use Barcodes check box is cleared In the Basic Run Parameters pane change the value for Number of MSA3 plates and Number of DNA samples per plate to indicate the number of samples being processed J NOTE If you are using Illumina LIMS you cannot change the number of DNA samples on this screen However the LIMS software processes the correct number of samples The robot PC updates the Required Run Items and the bed map to show the correct position of items on the robot bed All barcodes must face to the right 1 3 8 Part 15045738 Rev A Figure 91 Resuspend MSA3 Screen lib Iumina Automation Control File LIMS Log Help Robot Washes Sys Wash Flush W Flush L Wash S Robot Control i Sys Init Init LiHa Tips Up Procedure Control me pi DNA Quant Required Run Item s Basic Run Parameters a M z Parameter Illumina Automation Control Robot Task Value Number of RAT trough s b Make MSA3 Number of MSA3 plate s Gb Fragment MSA3 Eh Precip MSA3 a 7 amp Hyb Multi BC2 DB Access Use Barcodes Operator Server Name Number of MSA3 plate s Number of DNA samples per plate 96 Resuspend MSA3 Genesis1 Loading worktable ra
3. To ensure optimal performance place the tips against the top edge of the wells Use this technique for all subsequent dispensing steps Dispense 38 ul MSM into each well of the MSA3 plate containing sample Seal MSA3 plate with cap mat When you place the cap mat back on the plate be sure to match it to its original plate and orient it correctly Vortex the sealed MSA3 plate at 1600 rpm for 1 minute Pulse centrifuge to 280 x g Discard unused reagents in accordance with facility standards Proceed immediately to the next step Illumina Infinium HTS Assay Protocol Guide 3 D dwy 1d YNG Apidwiy Incubate DNA Post Amp This process incubates the MSA3 plate for 20 24 hours at 37 C in the Illumina Hybridization Oven The process uniformly amplifies the genomic DNA generating a sufficient quantity of each individual DNA sample to be used when in the Infinium HTS assay Figure 18 Incubating DNA to Amplify Manual Protocol Estimated Time Incubation time 20 24 hours Steps to Incubate the MSA3 Plate OVERNIGHT INCUBATION Y Incubate MSA3 plate in the Illumina Hybridization Oven for at least 20 hours but no more than 24 hours at 37 C 18 Record the start and stop times on the lab tracking form i NOTE To record information about your assay such as operator information start and stop times and barcodes use the lab tracking form provided at www illumina com documentation This form can be filled out and saved
4. sjuabeay pue sjenaze Nw juswdinba Manual Protocol 22 Item Aerosol filter pipette tips two separate stocks Disposable pipetting troughs Illumina Supplied Materials WG MSA3 barcode labels WG DNA barcode labels Illumina Supplied Reagents Catalog 20 ul 200 ul 1000 ul VWR catalog 21007 970 Table 6 Illumina Supplied Reagents Infinium HTS Assay Manual Protocol Item ATM Anti Stain Two Color Master Mix FMS Fragmentation solution MA1 Multi Sample Amplification 1 Mix MA2 Multi Sample Amplification 2 Mix MSM Multi Sample Amplification Master Mix PB1 Reagent used to prepare BeadChips for hybridization PB2 Humidifying buffer used during hybridization PM1 Precipitation solution RA1 Resuspension hybridization and wash solution SML Superior Two Color Master Mix Part 11208317 11203428 11202880 11203401 11203410 11191922 11191130 11203436 11222442 11288046 Part 15045738 Rev A Item EML Two Color Extension Master Mix LX1 XStain BeadChip solution 1 LX2 XStain BeadChip solution 2 XC3 XStain BeadChip solution 3 XC4 XStain BeadChip solution 4 Illumina Infinium HTS Assay Protocol Guide Part 11208309 11208288 11208296 11208421 11208430 23 sjuobeay pue sjeue1eyy juswdinba Manual Protocol Quantitate DNA Optional Pre Amp Ilumina recommends the Molecular Probes PicoGreen assay to quantitate dsDNA sa
5. 12 After the robot initializes the Make MSA3 screen appears after a moment 13 Do one of the following Select your current project The available batches appear in the Sample Batch ID pane Select a batch to see the associated DNA plate appear in the DNA Plates pane Figure 78 Make MSAS Screen with Project and Batch Selected Make MSA4 HUMANMETHYLATION450V1 Project Name Sample Batch ID double click batch number to add LASI Test Ihui Human610 Quadv1 11 29 10 SWA ME nG Methylation Methylation2 Methylation1 Platefs wWG8200012 BCD Selected Batches Search By x Search For Search Reset Use the Search box to search for a specific Batch ID or DNA Plate 14 lumina LIMS only Select the batch you want to run and then click OK 15 lumina LIMS only Click OK to confirm the required DNAs 1 1 8 Part 15045738 Rev A Figure 79 Confirm DNAs File BatchiD 7535 Run Time Information Requires the following DNAs WG8100903 cnt _ 1 16 When prompted enter the barcode of each WG DNA plate The robot bed map is updated with the WG DNA plate locations 17 Place the WG DNA plates on the robot bed according to the bed map and click OK The robot begins running when the plates are in place 18 Observe the robot run to make sure that there are no problems After the robot adds the 0 1N NaOH to the DNA in the MSA3 plate follow the instructions at the pro
6. PicoGreen DNA quantitation kit 24 103 Q quantitate dsDNA 24 103 R reagents auto protocol 102 manual protocol 22 Required Run Items 131 151 181 RNA 24 robot BeadChip alignment fixtures 144 149 150 bed map update 131 dispensing sample 153 reparing 125 129 137 149 180 equired Run Items 131 151 181 resuspend setup 138 scanning the barcode 152 Tip Alignment Guide 143 152 tube rack 182 XStain BeadChip setup 180 Robot Tip Alignment Guide 143 159 S Sample QDNA 27 106 Sample QDNA pee 25 29 30 104 sample sheet 1 SNPs per sample 2 Standard DNA plate 25 28 104 Standard QDNA 27 106 Standard QDNA plate 25 28 30 104 T Tecan Freedom Evo 14 Tecan GenePaint 14 Tecan Genesis 14 Part 15045738 Rev A Technical Assistance For technical assistance contact Illumina Technical Support Table 16 Illumina General Contact Information Illumina Website www illumina com Email techsupport illumina com Table 17 Illumina Customer Support Telephone Numbers Region Contact Number Region Contact Number North America 1 800 809 4566 Italy 800 874909 Austria 0800 296575 Netherlands 0800 0223859 Belgium 0800 81102 Norway 800 16836 Denmark 80882346 Spain 900 812168 Finland 0800 918363 Sweden 020790181 France 0800 911850 Switzerland 0800 563118 Germany 0800 180 8994 United Kingdom 0800 917 0041 Ireland 1 800 812949 Other countries 44 1799 534000 MSDSs Material safety data sheets MSDSs are available
7. 285 ml for 9 24 BeadChips XC4 310 ml for 1 8 Room Ilumina BeadChips temperature 285 ml for 9 24 BeadChips 1 TA Part 15045738 Rev A Item Quantity Storage Supplied By Alconox Powder Detergent As needed Room General lab temperature supplier EtOH As needed Room General lab temperature supplier 95 formamide 1 mM EDTA 15 ml for 1 8 15 C to 25 C General lab BeadChips supplier 17 ml for 9 16 BeadChips 25 ml for 17 24 BeadChips CAUTION y Pour out only the recommended reagent volume needed for the suggested number of beadchips listed in the consumables table of each section Some of the reagents are used later in the protocol NOTE It is important to use fresh RA1 for each protocol step in the assay where it is required RA1 that has been stored properly and has not been dispensed for use in either the XStain or Resuspension step is considered fresh RA1 After RA1 has been poured out into a reservoir and exposed to room temperature air for extended periods of time it is no longer fresh WARNING y This protocol uses an aliphatic amide that is a probable reproductive toxin Personal injury can occur through inhalation ingestion skin contact and eye contact For more information consult the material data safety sheet for this assay at www illumina com msds Dispose of containers and any unused contents in accordance with the governmental safety standards for your region Preparation RA1 is shipped frozen Gradually w
8. 80 C Store RA1 at 15 C to 25 C SAFE STOPPING POINT Now is a good stopping point in the process Illumina Infinium HTS Assay Protocol Guide 4 5 dwiy 1S0dq YNG puedsnsey Manual Protocol Hybridize to BeadChip Post Amp 46 In this process you dispense the fragmented and resuspended DNA samples onto BeadChips Place the DNA loaded BeadChips into the Hyb Chamber inserts and then place the inserts into the Hyb Chambers Incubate the Hyb Chambers in the Illumina Hybridization Oven for 16 24 hours at 48 C Figure 24 Hybridize Multi BeadChip gDNA identical probes per bead type 5 gDNA Estimated Time Hands on time 24x1 HTS BeadChip 16 minutes for 4 BeadChips 96 samples Incubation time 16 24 hours Consumables Item Quantity Storage Supplied By per 96 Samples PB2 1 tube Room Ilumina temperature BeadChips 4 Illumina Hyb Chambers 1 Illumina Hyb Chamber gaskets i Illumina Hyb Chamber inserts 4 Illumina Part 15045738 Rev A q CAUTION y Pour only the recommended reagent volume needed for the suggested number of samples listed in the Consumables table of each section Some reagents are used later in the protocol Preparation 1 If frozen thaw MSA3 plate to room temperature and then pulse centrifuge the MSA3 plate to 280 x g 2 Preheat the heat block to 95 C 3 Prepare the Illumina Hybridization Oven as follows a Preheat the oven to 48 C Press the F button one time to change the
9. C Room temperature Room temperature Room temperature Room temperature 15 C to 25 C Supplied By Ilumina Ilumina Ilumina Illumina Ilumina Illumina Illumina Ilumina General lab supplier General lab supplier General lab supplier 19 duuy js0d diyopeag ule sx ule S pue pua xa Manual Protocol 76 CAUTION y Pour only the recommended reagent volume needed for the suggested number of samples listed in the Consumables table of each section Some reagents are used later in the protocol NOTE It is important to use fresh RA1 for each protocol step in the assay where it is required RA1 that has been stored properly and has not been dispensed for use in either the XStain or Resuspension step is considered fresh RA1 After RA1 has been poured out into a reservoir and exposed to room temperature air for extended periods of time it is no longer fresh q WARNING y This protocol uses an aliphatic amide that is a probable reproductive toxin Personal injury can occur through inhalation ingestion skin contact and eye contact For more information consult the material data safety sheet for this assay at www illumina com msds Dispose of containers and any unused contents in accordance with the governmental safety standards for your region Preparation 1 RA1 is shipped and stored at 15C to 25 C Gradually warm the reagent to room temperature preferably in a 20C to 25 C water bath
10. F DNA Plate MIDI Steps to Make the MSA3 Plate 116 If you do not already have a WG DNA plate add DNA into one of the following MIDI plate 20 ul to each WG DNA plate well TCY plate 10 ul to each WG DNA plate well Apply a barcode label to the new WG DNA plate At the robot PC select MSA3 Tasks Make MSA3 In the Plate Selection dialog box click on the plate type you wish to use Roll the mouse pointer over each picture to see a description of the plate Figure 76 Selecting the Plate Type Please select a plate type J NOTE Do not mix plate types on the robot bed Other than Illumina LIMS Make sure that the Use Barcodes checkbox is cleared In the Basic Run Parameters pane enter the Number of DNA samples 48 or 96 that are in the plate This value must match the number of DNAs in the plate and the number of DNAs identified in the DNA manifest J NOTE If you are using Illumina LIMS you cannot change the number of DNA samples on this screen However the Illumina LIMS software processes the correct number of samples You can process up to 96 DNA samples per robot run The robot PC updates the Required Run Items and the bed map to show the correct position of items on the robot bed All barcodes must face to the right Part 15045738 Rev A NOTE If you are using Illumina LIMS then you must click Run and select batches before the robot bed map displays the correct layout for the WG DNA plates Fi
11. Gently mix to dissolve any crystals that can present 2 Place all reagent tubes in a rack in the order you plan to use them If frozen allow them to thaw to room temperature and then gently invert the reagent tubes at least 10 times to mix contents Part 15045738 Rev A Figure 53 XStain BeadChip Reagent Tubes and Bottles EML 95 Formamide 1mM EDTA SML ATM PB1 XC4 C TIDODINMOOWST 3 Dispense all bottled reagents into disposable reservoirs as they are needed 4 On the lab tracking form record Date Time Operator RAI barcode XC3 barcode LX1 barcodes LX2 barcodes EML barcodes Illumina Infinium HTS Assay Protocol Guide ll duy js0d diyopeag ule sx ule S pue pua xa Manual Protocol SML barcodes ATM barcodes PB1 barcode XC4 barcodes amp NOTE To record information about your assay such as operator information start and stop times and barcodes use the lab tracking form provided at www illumina com documentation This form can be filled out and saved online or printed and filled in by hand Set Up Chamber Rack igs 1 Make sure that the water circulator reservoir is filled with water to the appropriate level See the VWR Operator Manual VWR part 110 229 Turn on the water circulator and set it to a temperature that brings the chamber rack to 44 C at equilibrium This temperature can vary depending on facility ambient conditions Part 15045738 Rev A Figure 54 Water Cir
12. Illumina Infinium HTS Assay Protocol Guide x Part 15045738 Rev A Overview Introduction to Infinitum HTS assay c cece eee eee cece ceceeeeeeees 2 Audience and Purpose 2 00 cece eee cece eee cece cece eeeeeeeeeeeceeeeeeeeees 3 minum FERS ASSAY DAGAN cache een BAT NADAGANAN aeaa Sada cece 4 Illumina Infinium BeadChips 2 2 2 22 222 e cece cc ec ce ccccceeececeecececeeeeeeeeeees 9 Illumina Lab Protocols 1 7500 cs apa pna ve sceohedewencaevueeueacseteedes de LILA 10 Tracking OOS AA AA 11 Tecan GEMOR AIIM gt te ee pet hn AA Ses ratte aah BA 14 Imaging Systems eee e cece cece cece eee cee eeeeceeeeeeeeeceeeeeees 15 GenomeStudio Integrated Informatics Platform 222220 c cece eee cece cece ce eeeeee 16 A Illumina Infinium HTS Assay Protocol Guide 1 Lisjdeyo Overview Introduction to Infinium HTS assay The Illumina Infinium HTS assay is designed to maximize content flexibility with a High Throughput Screening HTS capacity for genotyping and CNV analysis Using Infinium I and Infinium II probe designs and a dual color channel approach the Infinium HTS assay enables the DNA analysis of up to 750 000 SNPs and CNV markers per sample The Illumina Infinium HTS Assay Protocol Guide accomplishes this unlimited multiplexing by combining whole genome amplification WGA sample preparation with direct array based capture and enzymatic scoring of the SNP loci L
13. The Sample ID of this sample s second parent O Your sample sheet header can contain whatever information you choose Your sample sheet can contain any number of columns you choose Your sample sheet must be in a comma delimited csv file format Commas in the sample sheet are not allowed Save the sample sheet under any name you wish for example the user defined experiment name Part 15045738 Rev A The following figure provides an example of the sample sheet format Product documentation includes an electronic read only sample sheet template file Sample Sheet Template csv that you can copy and use from www illumina com documentation Figure 10 Sample Sheet Example NY a Example HD Worksheet csv Microsoft Excel Header Investigator Name GenomeStudio User Project Name Experiment Name Date Manifests Data Sample ID Sample Name Sample Plate Sample Well SentrixBarcode_A SentrixPosition A Gender Sample Group Replicate Parentl Parent2 Sample1 S12345 WG1234567 DNA A01 4424636250 ROICOL Male Sample2 12346 WG1234567 DNA A02 4424636250 RO1CO2 Female Sample3 512347 WG1234567 DNA A03 4424636250 R02C01 Male Sample4 512348 WG1234567 DNA A04 4424636250 R02C02 Female Illumina Infinium HTS Assay Protocol Guide 1 3 sjoo Burjoes Overview Tecan GenePaint 14 The Infinium HTS assay uses the GenePaint automated slide processor on the Tecan to process BeadChips The GeneP
14. ame HK EU ED ED ED ED ED Lan 18 Holding the top of the staining rack in position gently remove the staining rack handle by grasping the handle between the thumb and forefinger Push the tab up with your thumb and push the handle away from you unlocking the handle then pull up the handle and remove O O Part 15045738 Rev A Figure 65 Removing Staining Rack Handle A Tab B Handle 19 Remove the remaining BeadChips to the tube rack with six BeadChips on top of the rack and two BeadChips on the bottom Make sure that the barcode ends are towards you and the BeadChips are completely horizontal h CAUTION y To prevent wicking and uneven drying do not allow the BeadChips to rest on the edge of the tube rack or to touch each other while drying duuy js0d diyopeag ule sx ule S pue pua xa 20 Place the tube rack in the vacuum desiccator Each desiccator can hold one tube rack 8 BeadChips h CAUTION y Make sure the vacuum valve is seated tightly and securely 21 Remove the red plug from the three way valve before applying vacuum pressure 22 Start the vacuum using at least 675 mm Hg 0 9 bar Illumina Infinium HTS Assay Protocol Guide 0 Manual Protocol 92 23 24 25 26 27 To make sure that the desiccator is properly sealed gently lift the lid of the vacuum desiccator It should not lift off the desiccator base Figure 66 Testing Vacuum Seal Dry under vacuum for 50 55 minutes Drying
15. x CAUTION y Do not touch the stripes with the wipe or allow EtOH to drip onto the stripes Clean the glass back plates For instructions see the Infinium Lab Setup and Procedures Guide Discard unused reagents in accordance with facility standards Do one of the following Proceed to Image BeadChip Store the BeadChips in the Illumina BeadChip Slide Storage Box inside a vacuum desiccator at room temperature Be sure to image the BeadChips within 72 hours Illumina Infinium HTS Assay Protocol Guide 1 Q D duy js0d diyopeag ule sx ule S pue pua xa Automated Protocol Image BeadChip Post Amp Follow the instructions in the iScan System User Guide or HiScan System User Guide to scan your BeadChips Use the Infinium LCG scan setting for your BeadChip 1 Q 6 Part 15045738 Rev A Illumina GenomeStudio The Illumina GenomeStudio Genotyping Module included with your Illumina Infinium Assay system is an application for extracting genotyping data from intensity data files idat files collected from systems such as the Illumina HiScan System For feature descriptions and instructions on using the GenomeStudio platform to visualize and analyze genotyping data see the GenomeStudio Framework User Guide and the GenomeStudio User Guide or online help Illumina Infinium HTS Assay Protocol Guide 1 O7 olpn s wousp CUILUNI 1 Q 8 Part 15045738 Rev A Index A arrays 9 assay overview 2 AutoLoader features 15 B
16. 7 Cover the Standard DNA plate with a cap mat Dilute PicoGreen The diluted PicoGreen is added to both the Standard QDNA and Sample QDNA plates to make the DNA fluoresce when read with the spectrofluorometer CAUTION Do not use glass containers for the PicoGreen reagent PicoGreen degrades quickly in the presence of light and can adhere to glass which lowers its effective concentration in solution and effects the upper response range accuracy Y Illumina Infinium HTS Assay Protocol Guide El F1 G1 HI Concentration ng ul 6 25 31125 1 5262 0 Serial Dilutions of Lambda DNA Standard DNA Plate Final Volume in Well ul 100 100 200 100 with Serial Dilutions of Stock Lambda DNA is 89090990595 duy a1d euondo YNA jeihueno Manual Protocol 2 Prepare a 1 200 dilution of PicoGreen into 1X TE using a sealed 100 ml or 250 ml Nalgene bottle wrapped in aluminum foil Refer to the following table to identify the volumes needed to produce diluted reagent for multiple 96 well QDNA plates For fewer than 96 DNA samples scale down the volumes Table 8 Volumes for PicoGreen Reagents ODNA Plates PicoGreen Volume 1X TE Volume ml ul 115 23 215 43 3 315 63 Cap the foil wrapped bottle and vortex to mix Create QDNA Standard Plate with Diluted PicoGreen In this process you transfer the serial dilutions from the Standard DNA plate into the Standard QDNA FLUOTRAC plate and add di
17. AE ATTACTT CUP Oe CA a SACTGATTCAACGTACCAAGATTACTT GATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT T GAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTCTTCTGT TAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGA AAAAGANTGATAACAGTAAGAGAGTIGTGY IAACCLTAAGATIACT TGATCGACT GAT GAACGTAGCG AAAGAT TACT IGATSCAG GAT ICAAGGTACCGTAACGAACGIATCAAI TGAGAG TAAATATTAACGTAGCATTAAGAGC TAGO e a GTIAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAA AA ae aa ene a GATTACTTGATCCACTGATTCAACG TGAGACTAAATAT TAACGTTGTTAACCTTAAGAT TACT TGATCCACTGATTCAACGTACCGTAACGAACGTAT CAAT TGAGACTAAATA LU ae aa GCTTCTGT TAACCTTAAGATTACT TGATCCACTGATTCAACGTACCGTA ATCAATTGAGA CTAANTALT AACGTACTTAACCTIAAGAT TACT TGATCCACTGAT T CAACGTACCGTAACGAACGTCTTCTGTTAACCTTAAGAT Ti KETIGMCCACIGATTCAACGT ACCGTAACGAACGTATCAAT TGAGACTAACGACGA SATAACAGTAACAGAG LT CTGLIAACG T TAAGA TACT GAT GOAGTGAT GAACGIAGGG TAAGGAAGG TAT GAAT TGAGAG AAATAT TAACG ACCA TAAGAGCTACGGCT TCT GTTAAGG TANGATIACT IGATCUACT GAT IGAACG GATAACAGTAACACACTT AACCTIAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTA TTCTG CCTTAAGATTACTTGATCCACTGA CCAT TAAGAGCTACCGTGCAACTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTGCAACGACGAACTTCTGTTAACCTTAAGATTACTTGAT STAGES TGCAACGAAAATAACC TTAAGATTACT IGATCCACTGAT ICAACGTAGTICTG TAAGGTTAAGATTACT IGATCCACT GAL CAACGACOGTAACGAACG TAI GAAT TGAGAG TAAGGAGCGIGCAACGACGAAAAGAATAT iAAAAGAAT GA PAG TARA Hahaa R AACCTTAAGATTACTT SAO VAS Uy PAA
18. Amt F Parameter 1 1 1 MSA3 Tasks Make MSA3 Number of PMI trough s Number of MSA3 plate s Sb Fragment MSA3 Number of MSA3 plate s Number of DMA samples per plate Number of 2 propanol trough s Eh Resuspend MSA3 _ i Hyb Multi BG DB Access Use Barcodes medwards jilmn limsdev1 Precip MSA3 Genasiel Londng wakinbie iack dwa Done System Initialized Genesis1 Illumina Infinium HTS Assay Protocol Guide 131 duy s0d YNG eyeldioed Automated Protocol 3 Remove the cap mat and place the MSA3 plate on the robot bed according to the bed map 4 Place a half reservoir in the reservoir frame according to the robot bed map and add PM1 as follows For 96 samples 1 tube 5 Place a full reservoir in the reservoir frame according to the robot bed map and add 2 propanol as follows For 96 samples 32 ml 6 In the lab tracking form record the plate positions on the robot bed 7 Make sure that all items are placed properly on the robot bed that all caps and seals have been removed and that all the barcodes face to the right Start the Robot 1 Other than Ilumina LIMS At the robot PC click Run 2 Illumina LIMS At the robot PC a Ensure the Use Barcodes check box is checked b Click Run to start the process Log in if prompted The robot PC sounds an alert and opens a message when the process is complete 3 When prompted remove the MSA3 plate from the robot bed Do not click OK i
19. BeadChip Post Amp 0 c cece cece cece ec cece ceeeeeeeeeeeeeeeeeees 46 Wash BeadChip Post Amp 0 aaa 62 Extend and Stain XStain BeadChip Post Amp 222ceeceeeeeeeeceeeeeeeees 74 Image BeadChip Post AMp ccceecccccceccecccceeeeececceceeeeeeccceeeeeeceeeceeees 94 Illumina GenomeStudio e cece ee eceeceeceeceececeeeeeeeeeeeeeseeeeeeeees 95 F K al f rs ee ee t fil e g r AAT GCCGcArtarggag reste o Illumina Infinium HTS Assay Protocol Guide 1 1 cg Jaydeyo Manual Protocol Introduction to Infinium HTS Manual Protocol This chapter describes pre and post amplification manual laboratory protocols for the Infinium HTS assay Follow the protocols in the order shown 1 8 Part 15045738 Rev A Infinium HTS Manual Workflow The following figure graphically represents the Infinium HTS assay manual workflow for use with the 24x1 HTS BeadChip These protocols describe the procedure for preparing 96 DNA samples Figure 11 Ilumina Infinium HTS Protocol Manual Workflow Day 1 Day 2 Day 3 Quantitate DNA Fragment DNA Wash BeadChip Optional AN aE Hands on 20 min Hands on 20 min plate tee rid 5 Bendchs Robot 20 min plate Incubation 1 hour Faogante Reagents Lambda DNA FMS Output PicoGreen dsDNA Output BeadChip 1XTE MSA3 Plate Output Sample QDNA Plate xStai with Quantitated DNA BeadChip 7 Hands on 2 hours 45 min 4 BeadChips my Dry Time 55 min 1
20. F9 ID aha 2 BES 93 3 PONG 299 93 BE 99999 IB 93 3 3 IB 33 33 9999 A pos By x CAUTION Do not over dry the pellet Pellets that are over dried are difficult to resuspend Poorly resuspended samples leads to poor data quality 17 Enter the start and stop times on the lab tracking form 18 Discard unused reagents in accordance with facility standards 19 Do one of the following Continue to the next step Resuspend DNA Post Amp If you do not plan to proceed to the next step immediately seal the MSA3 plate with a new cap mat and store it at 15 C to 25 C SAFE STOPPING POINT Now is a good stopping point in the process Part 15045738 Rev A Resuspend DNA Post Amp Add RAI to the MSA3 plate to resuspend the precipitated DNA samples Figure 23 Resuspending DNA Estimated Time Hands on time 30 minutes for 96 samples Incubation time 1 hour Consumables Item Quantity Storage Supplied By RA1 7 ml per 96 samples 15 C to 25 C Ilumina Y NOTE Pour out only the recommended volume of RA1 needed for the suggested number of samples listed in the consumables table Additional RA1 is used later in the XStain BeadChip step WARNING This protocol uses an aliphatic amide that is a probable reproductive toxin Personal injury can occur through inhalation ingestion skin contact and eye contact For more information consult the material data safety sheet for this assay
21. GenePaint aoaaa aoaaa aoaaa aaa aLa ALALA DALALDALA LaLa anana 14 IMAGING Systems a a secs be aden s vedas oes EEES doe sg TEETER S ENS 15 GenomeStudio Integrated Informatics Platform 00 cee cece ee eee 16 Chapter 2 Manual Protocol 20 0 0 0 00 ccc ccceccccececeeeeesssesesseeceeeeeeeeees 17 Introduction to Infinitum HTS Manual Protocol 22222222222eee eee eeee 18 Infinium HTS Manual Workflow _ 22 2 222222 e eee ee cee cece cece eeeeeeeeeees 19 Equipment Materials and Reagents eee eeeeeeeeeeeeeeeceeeees 20 Quantitate DNA Optional Pre Amp 0 000000000000 n0100 24 Amplify DNA Pre Amp 22 0 2 222 e cece cece cece c cee ccceececeeeceeeeeeeeeees 32 Incubate DNA Post Amp aaa 36 Fragment DNA Post Amp 2 cc ceeec cece cece ccc eeeceeeeeceeeceeteeees 37 Precipitate DNA Post Amp 2 22 2 222222222 aaa 39 Resuspend DNA Post Amp ceccccceccccccceceeeecctteteteeeeeees 43 Hybridize to BeadChip Post Amp 222 c cece cece eeeeeceeeceeeeeees 46 Wash BeadChip Post Amp aa 62 Extend and Stain XStain BeadChip Post Amp 222222222222222 2 74 Image BeadChip Post Amp 2 222 eccece cece cece cece ecceeeeeceeeeeeeeeees 94 Illumina GenomeStudio eee eee cee ee aoaaa aana aLa aaa aLa nanna 95 Chapter 3 Automate
22. Guide 1 A duy js0d diyopeag 0 8ZIPLIqAH Automated Protocol 142 Item Quantity Storage Supplied By per 96 Samples Hyb chamber gaskets il Illumina Hyb chamber inserts 4 Illumina Robot BeadChip 4 Illumina alignment fixtures 2 Robot Tip Alignment Guide G 2 Ilumina one piece guide 1 aqueous Alconox solution As needed User NOTE Thaw all reagents completely at room temperature and allow to equilibrate After thawed gently invert each tube several times to mix the reagent thoroughly Pulse centrifuge each tube to 280 x g to eliminate bubbles and collect reagent at the bottom of the tube Preparation 1 If frozen thaw MSA3 plate to room temperature and then pulse centrifuge the MSA3 plate to 280 x g Preheat the heat block to 95 C Prepare the Illumina Hybridization Oven as follows a Preheat the oven to 48 C Press the F button one time to change the display to TSET Press the S button to enter the set temperature mode and then use the Increment Decrement dial to set the oven to 48 C Press the S button again to set 48 C as the temperature b Set the rocker speed to 5 Press the F button twice until SPd is indicated on the display Press the S button to enter the rocker speed mode Use the Increment Decrement dial to set the rocker speed to 5 Press the S button again Part 15045738 Rev A 4 Calibrate the Illumina Hybridization Oven with the Full Scale Plus digital thermometer sup
23. Lambda DNA in the wells of column 1 1 Add stock Lambda DNA to well A1 in the plate labeled Standard DNA and dilute it to 75 ng ul in a final volume of 233 3 ul Pipette up and down several times a Use the following formula to calculate the amount of stock Lambda DNA to add to Al 233 3 ul x 75 ng ul lof stock Lambda DNA to add to Al stock Lambda DNA concentration b Dilute the stock DNA in well Al using the following formula ul of 1X TE to add to Al 233 3 ul ul of stock Lambda DNA in well Al Add 66 7 ul 1X TE to well B1 Add 100 ul 1X TE to wells C D E F G and H of column 1 Illumina Infinium HTS Assay Protocol Guide 2 D duy a1d euondo YNA 9PPULeNO Figure 12 Dilution of Stock Lambda DNA Standard Manual Protocol 100 100 100 100 100 100 YIN Microtiter Plate 4 Transfer 133 3 ul of Lambda DNA from well A1 into well B1 Pipette up and down several times 5 Change tips Transfer 100 ul from well B1 into well C1 Pipette up and down several times 6 Repeat for wells D1 E1 Fl and G1 changing tips each time Do not transfer from well G1 to H1 Well H1 serves as the blank 0 ng ul Lambda DNA Table 7 Concentrations of Lambda DNA Row Column Concentration Final Volume in ng ul Well ul Al 75 100 B1 50 100 C1 25 100 D1 DES 100 O 6 Part 15045738 Rev A Row Column Figure 13 75 ng pl 50 ng ul 25 ng pl 12 5 ng pl 6 25 ng ul 3 125 ng pl 1 526 ng l O ng yl
24. Place each BeadChip on a tube rack with the barcode facing up and towards you Figure 132 BeadChips on Tube Rack PEREESSEE REE oes GASA o me ome ori 4 1 1 F on mn am Livia itt pu avg L Na NAP am sra a ae K acreage e an ap a ae TD ow am Tm eman 1 ame HK EU ED ED ED ED ED Lan 18 Holding the top of the staining rack in position gently remove the staining rack handle by grasping the handle between the thumb and forefinger Push the tab up with your thumb and push the handle away from you unlocking the handle then pull up the handle and remove 1 Q 2 Part 15045738 Rev A Figure 133 Removing Staining Rack Handle A Tab B Handle 19 Remove the remaining BeadChips to the tube rack with six BeadChips on top of the rack and two BeadChips on the bottom Make sure that the barcode ends are towards you and the BeadChips are completely horizontal h CAUTION y To prevent wicking and uneven drying do not allow the BeadChips to rest on the edge of the tube rack or to touch each other while drying duuy js0d diyopeag ule sx ule S pue pua xa 20 Place the tube rack in the vacuum desiccator Each desiccator can hold one tube rack 8 BeadChips h CAUTION y Make sure the vacuum valve is seated tightly and securely 21 Remove the red plug from the three way valve before applying vacuum pressure 22 Start the vacuum using at least 675 mm Hg 0 9 bar Illumina Infinium HTS Assay Prot
25. Precipitate DNA Reagents Hands on 30 min RAT 96 samples 95 Formamide Amp DNA Incubation Dry Time 1mMEDTA Hands on 1 hour a hota oa 96 samples Reagents ve Reagents 2 propanol EN 0 1N NaOH PMI KA MAI er MA2 MSA3 Plate xcs MSM pai Output MSA3 Plate 2 y BeadChip Incubate DNA Resuspend DNA Image BeadChip Incubation 20 24 hours Hands on 30 min HiScan System Scan Time Output NG sam 50 min BeadChip MSA3 Plate Manabor Ibong Scan Syrian Scan Tana riis 1 hour BeadChip X Image and le MSA3 Plate image Data Files Hyb to BeadChip Hands on 16 min 4BeadChips Incubation 16 24 hours PB2 Output BeadChip Y Illumina Infinium HTS Assay Protocol Guide MOJOM fenuey SILH WNluyu Manual Protocol 20 Equipment Materials and Reagents These materials are specific to the manual Infinium HTS For a list of other equipment materials and reagents needed in a lab performing Illumina Infinium assays see the Infinium Lab Setup and Procedures Guide User Supplied Equipment Table 3 User Supplied Equipment Infinium HTS Assay Manual Protocol Item Catalog Auto desiccator cabinet Optional allows VWR catalog 74950 342 scanning of BeadChips up to three days after processing Illumina Supplied Equipment Table 4 Illumina Supplied Equipment Infinitum HTS Assay Manual Protocol Item Catalog 218528 Multi Sample BeadChip Alignment Fixture User Supplied Materials Table 5 User Supplied Mate
26. WG EML SML ATMILX1 LX2 tube 2 Use Barcodes Operator Server Name Main IODNDOC 0000200000 a 0000002000 XStain LCG BeadChip Genesis Loading worktable tack data one cc CA System Initialized Genesis1 If you plan on imaging the BeadChip immediately after the staining process turn on the iScan or HiScan now to allow the lasers to stabilize Place a quarter reservoir in the reservoir frame according to the robot bed map and add 95 formamide 1 mM EDTA as follows 15 ml to process 8 BeadChips 17 ml to process 16 BeadChips 25 ml to process 24 BeadChips Place a half reservoir in the reservoir frame according to the robot bed map and add RA1 in the following volumes 10 ml to process 8 BeadChips Illumina Infinium HTS Assay Protocol Guide 1 81 dwy S0d diyopesg ule Sx ule S pue pua Xi Automated Protocol 20 ml to process 16 BeadChips 30 ml to process 24 BeadChips Place a full reservoir in the reservoir frame according to the robot bed map and add XC3 in the following volumes 50 ml to process 8 BeadChips 100 ml to process 16 BeadChips 150 ml to process 24 BeadChips Place each reagent tube LX1 LX2 EML SML ATM in the robot tube rack according to the bed map and remove their caps Make sure that all items are placed properly on the robot bed that all caps and seals have been removed and that all the barcodes fa
27. XC4 2 To indicate the fill volume before filling wash dishes with PB1 and XC4 pour 310 ml water into the wash dishes and mark the water level on the side Empty the water from the wash dish Marking the level enables you to pour reagent directly from the PB1 and XC4 bottles into the wash dishes minimizing contaminant transfer from labware to wash dishes Illumina Infinium HTS Assay Protocol Guide 8 3 duy js0d diyopeag ule sx ule S pue pua xa Manual Protocol Figure 57 PB1 and XC4 Wash Dishes with Staining Rack EN x A Wash Dishes B Staining Rack 3 Pour 310 ml PB1 into the wash dish labeled PB1 4 Submerge the unloaded staining rack into the wash dish with the locking arms and tab facing towards you This orients the staining rack so that you can safely remove the BeadChips Let the staining rack sit in the wash dish You will use it to carry the BeadChips after disassembling the flow through chambers 8 4 Part 15045738 Rev A Figure 58 Staining Rack Locking Arms and Tab gt Is A Locking Arms B Tab x y CAUTION If the staining rack handle is not correctly oriented the BeadChips can be damaged when you remove the staining rack handle before removing the BeadChips 5 Oneata time disassemble each flow through chamber a Use the dismantling tool to remove the two metal clamps N CAUTION It is important to use the dismantling tool to avoid chipping the glass back plates I
28. assembling the flow through chambers Refer to the following image for the correct flow through chamber components ili Standard Glass LCG Glass Standard Spacer LCG Spacer LCG Chamber Assembly 166 Part 15045738 Rev A 1 If you have not done so fill the Multi sample BeadChip Alignment Fixture with 150 ml PB1 If you plan to process more than 4 BeadChips this 150 ml of PB1 can be reused for an additional set of 4 BeadChips Use 150 ml of fresh PB1 for every additional set of 8 BeadChips 2 For each BeadChip to be processed place a black frame into the Multi Sample BeadChip Alignment Fixture pre filled with PB1 Figure 113 Placing Black Frames into Multi Sample BeadChip Alignment Fixture dwiy jsod diyopeeg ysem 3 Place each BeadChip to be processed into a black frame aligning its barcode with the ridges stamped onto the Alignment Fixture a NOTE Inspect the surface of each BeadChip for residue left by the seal Use a pipette tip to remove any residue under buffer and be careful not to scratch the bead area Illumina Infinium HTS Assay Protocol Guide 1 67 Automated Protocol 168 Figure 114 Placing BeadChip into Black Frame on Alignment Fixture 4 Place a clear LCG spacer onto the top of each BeadChip Use the alignment fixture grooves to guide the spacers into proper position J NOTE Be sure to use the clear plastic spacers not the white ones Figure 115 Placing C
29. display to TSET Press the S button to enter the set temperature mode and then use the Increment Decrement dial to set the oven to 48 C Press the S button again to set 48 C as the temperature b Set the rocker speed to 5 Press the F button twice until SPd is indicated on the display Press the S button to enter the rocker speed mode Use the Increment Decrement dial to set the rocker speed to 5 Press the S button again 4 Calibrate the Illumina Hybridization Oven with the Full Scale Plus digital thermometer supplied with your system 5 On the lab tracking form record Date Time Operator PB2 tube lot number NOTE 5 To record information about your assay such as operator information start and stop times and barcodes use the lab tracking form provided at www illumina com documentation This form can be filled out and saved online or printed and filled in by hand Illumina Infinium HTS Assay Protocol Guide A7 duy js0d diyopeag 0 8ZIPLIqAH Assemble the Hybridization Chambers 1 Place the resuspended MSA3 plate on the heat block to denature the samples at 95 C for 20 minutes 2 Remove the BeadChips from 2 C to 8 C storage leaving the BeadChips in their plastic bags and mylar packages until you are ready to begin hybridization 3 During the 20 minute incubation prepare the Hyb Chambers Place the following items on the benchtop for use in this procedure Manual Protocol Figure 25 BeadChip Hyb Chamber
30. eliminate bubbles and collect reagent at the bottom of the tube Preparation 1 In preparation for the Incubate DNA process preheat the Illumina Hybridization Oven in the post amp area to 37 C and allow the temperature to equilibrate a a W N In the Sample Sheet enter the Sample_Name and Sample_Plate for each Sample_Well Apply an MSA3 barcode label to a new MIDI Thaw MA1 MA2 and MSM tubes to room temperature Thaw DNA samples to room temperature On the Lab Tracking Form record the following Date Time Operator Robot Batch number Number of samples 48 or 96 DNA plate barcodes Part 15045738 Rev A MSA3 plate barcodes MAI tube barcodes MA2 tube barcodes MSM tube barcodes J NOTE To record information about your assay such as operator information start and stop times and barcodes use the lab tracking form provided at www illumina com documentation This form can be filled out and saved online or printed and filled in by hand Prepare Robot For instructions on preparing the robot for use in a protocol see the Infinium Assay Lab Setup and Procedures Guide Refer to the figure shown below throughout this protocol Note that all of the barcodes face to the right Figure 75 Eight Tip Robot Make MSAS Setup A GO MAI Tube MA Tube MSM Tube MSA3 Plate A B C D Illumina Infinium HTS Assay Protocol Guide 1 1 D dwy 1d YNG dwy Automated Protocol E NaOH in Quarter Reservoir
31. for preparing the robot before each use in the Infinium Lab Setup and Procedures Guide Thaw the sample DNA plates to room temperature Apply a QDNA barcode label to a new Fluotrac plate for each GS DNA plate to be quantified Hand label the microtiter plate Standard DNA Hand label one of the Fluotrac plates Standard QDNA In the sample sheet enter the Sample_Name optional and Sample_Plate for each Sample_Well Make a Standard DNA Plate In this process you create a Standard DNA plate with serial dilutions of stock Lambda DNA in the wells of column 1 1 104 Add stock Lambda DNA to well A1 in the plate labeled Standard DNA and dilute it to 75 ng ul in a final volume of 233 3 ul Pipette up and down several times a Use the following formula to calculate the amount of stock Lambda DNA to add to Al 233 3 ul x 75 ng ul tlof stock Lambda DNA to add to Al stock Lambda DNA concentration b Dilute the stock DNA in well Al using the following formula ul of 1X TE to add to Al 233 3 ul ul of stock Lambda DNA in well Al Add 66 7 ul 1X TE to well B1 Add 100 ul 1X TE to wells C D E F G and H of column 1 Part 15045738 Rev A Figure 68 Dilution of Stock Lambda DNA Standard 100 100 100 100 100 100 UZ INS Microtiter Plate 4 Transfer 133 3 ul of Lambda DNA from well A1 into well B1 Pipette up and down several times 5 Change tips Transfer 100 ul from well B1 into well C1
32. goods are those that are labeled or branded with a third party s name The warranty for third party goods if any is provided by the original manufacturer Upon written request Illumina will attempt to pass through any such warranty to Purchaser 9 Indemnification a Infringement Indemnification by Illumina Subject to these terms and conditions including without limitation the Exclusions to Illumina s Indemnification Obligations Section 9 b below the Conditions to Indemnification Obligations Section 9 d below Illumina shall i defend indemnify and hold harmless Purchaser against any third party claim or action alleging that this Product when used for research use purposes in accordance with these terms and conditions and in accordance with this Product s Documentation and Specifications infringes the valid and enforceable intellectual property rights of a third party and ii pay all settlements entered into and all final judgments and costs including reasonable attorneys fees awarded against Purchaser in connection with such infringement claim If this Product or any part thereof becomes or in Illumina s opinion may become the subject of an infringement claim Illumina shall have the right at its option to A procure for Purchaser the right to continue using this Product B modify or replace this Product with a substantially equivalent non infringing substitute or C require the return of this Product and terminate the rig
33. have been read click File Save to save the output data file pda When you have saved the pda file click File Import Export Export and export the file as a txt file You can open the txt file in Microsoft Excel for data analysis Do one of the following Proceed to Amplify DNA Pre Amp Store the quantitated DNA at 2 C to 8 C for up to one month SAFE STOPPING POINT Now is a good stopping point in the process Illumina Infinium HTS Assay Protocol Guide 31 duy a1d euondo YNG a1eihueno Manual Protocol Amplify DNA Pre Amp This process creates an MSA3 plate for DNA amplification MA1 is first added to the MSA3 plate followed by the DNA samples Next the 0 1N NaOH is added to denature the DNA samples The MA reagent neutralizes the sample Lastly Multi Sample Amplification Master Mix MSM is added to the plate Figure 16 Denaturing and Neutralizing BCD WETPU v it A Sy Estimated Time Hands on time 45 minutes for 48 samples 60 minutes for 96 samples Incubation time 20 24 hours Consumables Item Quantity Storage Supplied By MA1 1 tube 15 C to 25 C Illumina per 96 samples MA2 1 tube 15 C to 25 C Illumina per 96 samples 3 P Part 15045738 Rev A Item Quantity Storage Supplied By MSM 1 tube 15 C to 25 C Illumina per 96 samples 0 1N NaOH 15 ml PT OPC General lab per 96 samples supplier 96 well 0 8 ml microplate 1 plate General lab MIDI supplier WG D
34. is being used Figure 102 Robot Tip Alignment Guides on Robot Bed 1 5 2 Part 15045738 Rev A The robot dispenses sample to the BeadChips The robot PC sounds an alert and opens a message when the process is complete Click OK in the message box Carefully remove the Robot BeadChip alignment fixtures from the robot bed and visually inspect all sections of the BeadChips Make sure DNA sample covers all of the sections of each bead stripe Record any sections that are not completely covered Set up Multi BeadChip for Hybridization 1 Make sure the Illumina Hybridization Oven is set to 48 C 4 WARNING y Hyb Chambers should be at room temperature when you load the BeadChips They should not be preconditioned in the Illumina Hybridization Oven prior to loading the BeadChips Heating the PB2 and then opening the Hyb Chamber to add BeadChips causes some of the PB2 to evaporate leading to a change in the osmolality of PB2 and an imbalance in the vapor pressure between PB2 and RA1 sample hyb buffer q CAUTION y Hold the BeadChip by the ends with your thumb and forefinger thumb at the barcode end Do not hold the BeadChip by the sides near the sample inlets Avoid contacting the beadstripe area and sample inlets Carefully remove each BeadChip from the Robot BeadChip alignment fixtures when the robot finishes q CAUTION y For optimal performance take care to keep the Hyb Chamber inserts containing BeadChips steady and level
35. on the Illumina website at www illumina com msds Product Documentation Product documentation in PDF is available for download from the Illumina website Go to www illumina com support select a product then click Documentation amp Literature Illumina Infinium HTS Assay Protocol Guide PF 01 5JUB SISSY B2ILY2A 7 AAAAGAATGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACC 3ATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGTTGATCCACTGATTCAACGTACCGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTCTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGT PAGI GA T BANG 1 ANGAAGAT TAG ITEATESAGI GAL AAC STA TCRA GRAN STATE RAT IGAGAG MANEI TATE TACCA TANGO are CES IMEE IPAGAHAGT IPA TUYAKT GAT IG a Mead ee CAN 17AAAAGAATGATAACAGTAACACACTTCTGT TAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCAT TAAGAGCTACC 3ATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTCTTCTGTTAACCT TAAGATTACTTGATCCACTGATTCAACG TGAGACTAAATAT TAACGTTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTA ATCAAT TGAGACTAAATAT TAACGTACTTAACCTTAAGATTACT TGATCCACTGATT CAACGTACCGTAACGAACGTCTTCTGTTAACCT TAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAACGACGA 3ACTAAATATTAACGTACCAT TAAGAGCTACAACCTTAAGAT TA
36. one time To process subsequent BeadChips use a new clean wash dish with fresh XC4 15 Prepare one additional tube rack per 8 BeadChips Illumina provided from VWR catalog 60916 748 that fits the internal dimensions of vacuum desiccator 16 Remove the staining rack in one smooth rapid motion and place it directly on the prepared tube rack making sure the barcodes face up and the locking arms and tabs face down 8 8 Part 15045738 Rev A Figure 62 Staining Rack in Correct Orientation 3 a J PETO a N N To ensure uniform coating place the staining rack on the center of the tube rack avoiding the raised edges Figure 63 Moving the Staining Rack from XC4 to Tube Rack gt Ea 17 For each of the top four BeadChips working top to bottom Illumina Infinium HTS Assay Protocol Guide 89 duy js0d diyopeag ule sx ule S pue pua Xa Manual Protocol a Continuing to hold the staining rack handle carefully grip each BeadChip at its barcode end with self locking tweezers NOTE The XC4 coat is slippery and makes the BeadChips difficult to hold The self locking tweezers grip the BeadChip firmly and help prevent damage b Place each BeadChip on a tube rack with the barcode facing up and towards you Figure 64 BeadChips on Tube Rack PER EESSRE REE see o ome ome ori 4 1 1 F gon nt ammm aD a L Na NAP am sra a ae K acreage e an ap a ae TD ow am Tm eman 1
37. online or printed and filled in by hand 19 Proceed to the next step 3 6 Part 15045738 Rev A Fragment DNA Post Amp This process enzymatically fragments the amplified DNA samples An end point fragmentation is used to prevent over fragmentation Figure 19 Fragmenting DNA part 1 J tn PADA Estimated Time Hands on time 30 minutes for 96 samples Incubation time 1 hour Consumables Item Quantity Storage Supplied By FMS 1 tube per 96 15 C to 25 C Illumina samples Preparation 1 Preheat the heat block with the MIDI plate insert to 37 C 2 Thaw FMS tubes to room temperature 3 Gently invert the FMS tubes at least 10 times to mix contents Pulse centrifuge to 280 x g 4 Remove the MSA3 plate from the Illumina Hybridization Oven 5 On the lab tracking form record Date Time Illumina Infinium HTS Assay Protocol Guide 37 duy s0d YNG yuwe Manual Protocol Operator FMS tube barcodes NOTE To record information about your assay such as operator information start and stop times and barcodes use the lab tracking form provided at www ilumina com documentation This form can be filled out and saved online or printed and filled in by hand Steps to Fragment the MSA3 Plate 38 BR oO N a 5 6 7 8 9 Pulse centrifuge the plate to 50 x g Carefully remove the cap mat Add 25 ul FMS to each well containing sample Seal the MSA3 plate with the 96 well cap mat q CAUTION y Ori
38. protocol Figure 124 Tecan Eight Tip Robot XStain BeadChip Setup A P E DOM SML ATM XC3 in Full Reservoir RA1 in Half Reservoir 95 Formamide 1 mM EDTA in Quarter Reservoir 24 BeadChips in Chamber Rack Temperature Probe TIONTNMODOWST Single Base Extension and Stain CAUTION y The remaining steps must be performed without interruption 1 Slide the chamber rack into column 36 on the robot bed Make sure that it is seated properly 2 At the robot PC select XStain Tasks XStain LCG BeadChip 1 80 Part 15045738 Rev A In the Basic Run Parameters pane enter the number of BeadChips You can process up to 24 BeadChips in the XStain BeadChip process The robot PC updates the Required Run Items and the bed map to show the correct position of items on the robot bed All barcodes must face to the left i Illumina Automation Control Fie LIMSLog MCA Cmds Help Robot Washes Robot Control Procedure Control sawan ruw rust wens ayon mera tort rece sc a AMP5 Tasks Illumina Automation Control Robot Task a MSAI Tasks a MSA2 Tasks a MSA3 Tasks Required Run Item s Basic Run Parameters 5 Hi Maas Taske 3 Run Items Parameter Value MSA5 Tasks a Gl MSA6 Tasks Number of BeadChip s Number of BeadChip s 24 XStain Tasks Number of WG RALT half trough s fb XStain BC2 Number of Formamide quarter trough s in HD BeadC Number of WG XC3 full trough s Ci Number of
39. recommends a minimum concentration of 50 ng ul 1 Turn on the spectrofluorometer Illumina Infinium HTS Assay Protocol Guide 1 O Q dwy 1d euondo YNA 9ePULeNnO Automated Protocol 110 2 At the PC open the Ilumina Fluorometry Analysis program Figure 72 Illumina Fluorometry Analysis Main Screen illumina Fluorometry Control File LIMSLog Help gali DB Login Bd Head Quan a Open Dr Bk Robot QC I Use Barcodes Lats oc Operator Close Di Gawin eee Read QNT Plate Barcode Select Reader Tasks Read Quant Other than Illumina LIMS Clear the Use Barcodes checkbox Ilumina LIMS Make sure that the Use Barcodes checkbox is checked Click Read umina LIMS When prompted log in to the Illumina LIMS database When asked if you want to read a new Standard plate click Yes Oo DAN NTN O Fe W Remove the plate seal and load the Standard QDNA plate into the fluorometry tray Click OK The spectrofluorometer will read the plate data 10 Review the data from the Standard QDNA plate Either accept it and go on to the next step or reject it Rejecting the data will stop the Read Quant process 11 Remove the Standard QDNA place from the spectrofluorometer tray Part 15045738 Rev A 12 13 14 15 16 When prompted enter the number of plates you want to read 1 2 or 3 Do not include the Standard QDNA plate in this number Click OK When prompte
40. red error message appears at the top of the window Do not proceed with centrifugation Instead follow these steps to troubleshoot the problem a Click the Reports tab in the upper right corner b In the left sidebar click Tracking Reports Get Queue Status c Scan the plate barcode and click Go d Note what step the plate is queued for and proceed with that step For information about how to use Illumina LIMS see the Ilumina LIMS User Guide 1 3 O Part 15045738 Rev A Steps to Precipitate the MSA3 Plate 1 2 At the robot PC select MSA3 Tasks Precip MSA3 Other than Illumina LIMS Make sure the Use Barcodes check box is cleared In the Basic Run Parameters pane change the value for Number of MSA3 plates and Number of DNA samples per plate to indicate the number of samples being processed J NOTE If you are using Illumina LIMS you cannot change the number of DNA samples on this screen However the LIMS software processes the correct number of samples The robot PC updates the Required Run Items and the bed map to show the correct position of items on the robot bed All barcodes must face to the right Figure 86 Precip MSA3 Screen Robot Washes Robot Control Procedure Control Sys Wash Flush W Flush L Wash 5 Sys Init Init LiHa Tips Up E co DNA Quant Infinium Robot Task a AMP2 Tasks a CJ AMP3 Tasks a MSAI Tasks Required Run Item s Basic Run Parameters MSA2 Tasks Run tems
41. steps to troubleshoot the problem a Click the Reports tab in the upper right corner b In the left sidebar click Tracking Reports Get Queue Status c Scan the BeadChip barcode that appeared in the error message and click Go d Note what step the BeadChip is queued for and proceed with that step For information about how to use Illumina LIMS see the Ilumina LIMS User Guide Wash and Coat 8 BeadChips Before starting the Wash and Coat process read these important notes 184 Take the utmost care to minimize the chance of lint or dust entering the wash dishes which could transfer to the BeadChips Place wash dish covers on wash dishes when stored or not in use Clean wash dishes with low pressure air to remove particulates before use In preparation for XC4 BeadChip coating wash the tube racks and wash dishes thoroughly before and after use Rinse with DI water Immediately following wash place racks and wash dishes upside down on a wash rack to dry Part 15045738 Rev A Place Kimwipes in three layers on the lab bench Place a tube rack on top of these Kimwipe layers Do not place on absorbent lab pads You will place the staining rack containing BeadChips on this tube rack after removing it from the XC4 wash dish Prepare an additional clean tube rack that fits the internal dimensions of vacuum desiccator for removal of the BeadChips Allow one rack per 8 BeadChips No Kimwipes are required under this tube rack Equipment
42. taking care not to shake the plate in any way until the cap mat is fully seated Invert the plate at least 10 times to mix contents thoroughly 10 Incubate at 4 C for 30 minutes Part 15045738 Rev A 11 Place the sealed MSA3 plate in the centrifuge opposite another plate of equal weight Figure 21 Sealed MSA3 Plate and Plate of Equal Balance in Centrifuge 12 Centrifuge to 3 000 x g at 4 C for 20 minutes Immediately remove the MSA3 plate from centrifuge CAUTION Perform the next step immediately to avoid dislodging the blue pellet If any delay occurs repeat the 20 minute centrifugation before proceeding 13 Remove the cap mat and discard it 14 Quickly invert the MSA3 plate and drain the liquid onto an absorbent pad to decant the supernatant Then smack the plate down on a dry area of the pad avoiding the liquid that was drained onto the pad 15 Tap firmly several times for 1 minute or until all wells are devoid of liquid x CAUTION Keep plate inverted To ensure optimal performance do not allow supernatant in wells to pour into other wells Illumina Infinium HTS Assay Protocol Guide A duy s0d YNG eyeldioed Manual Protocol 16 Leave the uncovered inverted plate on the tube rack for 1 hour at room temperature to air dry the pellet At this point blue pellets should be present at the bottoms of the wells Figure 22 Uncovered MSA3 Plate Inverted for Air Drying 3293232222 BE 9 9 99 9 P99
43. the proper and safe use of the product s described herein All of the contents of this document must be fully read and understood prior to using such product s FAILURE TO COMPLETELY READ AND EXPLICITLY FOLLOW ALL OF THE INSTRUCTIONS CONTAINED HEREIN MAY RESULT IN DAMAGE TO THE PRODUCT S INJURY TO PERSONS INCLUDING TO USERS OR OTHERS AND DAMAGE TO OTHER PROPERTY ILLUMINA DOES NOT ASSUME ANY LIABILITY ARISING OUT OF THE IMPROPER USE OF THE PRODUCT S DESCRIBED HEREIN INCLUDING PARTS THEREOF OR SOFTWARE OR ANY USE OF SUCH PRODUCT S OUTSIDE THE SCOPE OF THE EXPRESS WRITTEN LICENSES OR PERMISSIONS GRANTED BY ILLUMINA IN CONNECTION WITH CUSTOMER S ACQUISITION OF SUCH PRODUCT S FOR RESEARCH USE ONLY 2013 Illumina Inc All rights reserved Illumina IlluminaDx BaseSpace BeadArray BeadXpress cBot CSPro DASL DesignStudio Eco GAIIx Genetic Energy Genome Analyzer GenomeStudio GoldenGate HiScan HiSeq Infinium iSelect MiSeq Nextera NuPCR SeqMonitor Solexa TruSeq TruSight VeraCode the pumpkin orange color and the Genetic Energy streaming bases design are trademarks or registered trademarks of Illumina Inc All other brands and names contained herein are the property of their respective owners Read Before Using this Product This Product and its use and disposition is subject to the following terms and conditions If Purchaser does not agree to these terms and conditions then Purchaser is not authorized by Illumina
44. the cover seal over an absorbent cloth or paper towels preferably in a hood a Using powder free gloved hands hold the BeadChip securely and by the edges in one hand Avoid contact with the sample inlets Make sure that the barcode is facing up and closest to you and that the top side of the BeadChip is angled slightly away from you b Remove the entire seal in a single continuous motion Start with a corner on the barcode end and pull with a continuous upward motion away from you and towards the opposite corner on the top side of the BeadChip Figure 111 Removing the Cover Seal c Discard the cover seal A CAUTION Do not touch the arrays 5 Immediately and carefully slide each BeadChip into the wash rack one at a time making sure that the BeadChip is completely submerged in the PB1 1 64 Part 15045738 Rev A Figure 112 Submerging BeadChips in Wash Dish Containing PB1 dwiy jsod diyopeeg yseM 6 Repeat steps 4 through 5 until all BeadChips a maximum of 8 are transferred to the submerged wash rack NOTE 4 You can use the two 200 ml PB1 wash dishes for up to 24 BeadChips However use 150 ml of fresh PB1 for every 8 BeadChips in the Multi Sample BeadChip Alignment Fixture 7 After all BeadChips are in the wash rack move the wash rack up and down for 1 minute breaking the surface of the PB1 with gentle slow agitation 8 Move the wash rack to the other wash dish containing clean PB1 Make sure the BeadChips are c
45. the volumes needed to produce diluted reagent for multiple 96 well QDNA plates For fewer than 96 DNA samples scale down the volumes Table 14 Volumes for PicoGreen Reagents ODNA Plates PicoGreen Volume 1X TE Volume ml ul 1 115 23 215 43 3 315 63 2 Cap the foil wrapped bottle and vortex to mix Create QDNA Standard and Sample Plates In this process PicoGreen is distributed to Standard QDNA and Sample QDNA Fluotrac plates and mixed with aliquots of DNA from the respective DNA plates q CAUTION Do not run any other programs or applications while using the Tecan robot Your computer and the robot may lock up and stop a run 1 At the robot PC select DNA Quant Make Quant 2 In the DNA Plate Selection dialog box select the plate type of the Standard DNA and Sample DNA plates They should all be MIDI plates TCY plates or ABGN plates Roll the mouse pointer over each picture to see a description of the plate Figure 70 DNA Plate Selection Dialog Box Please select a plate type Illumina Infinium HTS Assay Protocol Guide 1 O7 dwy 1d euondo YNG PLNO Automated Protocol 108 o N A Aa A In the Basic Run Parameters pane enter the Number of DNA QDNA plates 1 2 or 3 pairs and the Number of DNA Samples The robot PC updates the Required Run Items and the bed map to show the correct position of items on the robot bed All barcodes must face to the right Figure 71 Make QDNA Screen Gag Illumina Automat
46. v baras ee a Incubate DNA Post Amp The denatured DNA is isothermally amplified in an overnight step The whole genome amplification uniformly increases the amount of the DNA sample by several thousand fold without significant amplification bias Figure 2 Incubating DNA to Amplify A Part 15045738 Rev A Fragment DNA Post Amp A controlled enzymatic process fragments the amplified product The process uses end point fragmentation to avoid over fragmenting the sample Figure 3 Fragmenting DNA ean a part Precipitate DNA Post Amp After an isopropanol precipitation centrifugation at 4 C collects the fragmented DNA Figure 4 Precipitating DNA Swe to AHRR I Illumina Infinium HTS Assay Protocol Guide Aesse SJH wuniuyuy Overview Resuspend DNA Post Amp The precipitated DNA is resuspended in hybridization buffer pa 5 Resuspending DNA 2 9 By e 9 Se e 5 9 6 Pa bgo OPLAN ee TAW AT RN ES Hybridize to BeadChip Post Amp Samples are applied to a BeadChip and separated by an IntelliHyb seal or gasket The loaded BeadChip is incubated overnight in the Illumina Hybridization Oven The amplified and fragmented DNA samples anneal to locus specific 50 mers during hybridization Figure 6 Hybridize to BeadChip gDNA eee identical probes per bead type aS gDNA 6 Part 15045738 Rev A Wash BeadChip Post Amp Unhybridized and non specifically hy
47. 0 8ZIPLIqAH Manual Protocol Figure 39 Two Hyb Chambers Correctly Placed in Hyb Oven lumina Figure 40 Incorrectly Placed Hyb Chamber 5 Optional Start the rocker setting the speed to 5 6 O Part 15045738 Rev A OVERNIGHT INCUBATION x y Incubate at 48 C for at least 16 hours but no more than 24 hours 6 Enter the start and stop times on the lab tracking form 7 Place RA1 into the freezer at 15 C to 25 C for use the next day Resuspend XC4 Reagent for XStain BeadChip Keep the XC4 in the bottle in which it was shipped until you are ready to use it In preparation for the XStain protocol follow these steps to resuspend the XC4 reagent 1 Add 330 ml 100 EtOH to the XC4 bottle The final volume will be 350 ml Each XC4 bottle has enough solution to process up to 24 BeadChips 2 Shake vigorously for 15 seconds 3 Leave the bottle upright on the lab bench overnight NOTE E If the XC4 was not left to resuspend overnight you can still proceed with the assay Add the EtOH and put the XC4 on its side on a rocker to resuspend Leave it there until the BeadChips are ready for coating 4 Shake the XC4 bottle vigorously to ensure complete resuspension If any coating is visible vortex at 1625 rpm until it is in complete suspension After it is resuspended use XC4 at room temperature Illumina Infinium HTS Assay Protocol Guide 61 duy js0d diyopeag 0 8ZIPLIqAH Manual Protocol Wash BeadChip Post Amp
48. 31 95 701 130 246 125 311 142 955 148 758 52 237 Successfully completed procedure Read Quant Elapsed run time 00 04 08 17 Microsoft Excel opens automatically at the same time and displays the quantitation data for the Sample QDNA plate There are three tabs in the file SQODNA STD Generates the standard curve by plotting the Relative Fluorescence RF values measured in the Standard QDNA plate against assumed concentrations in the Standard DNA Plate QDNA Plots the concentration ng ul of each well of the Sample QDNA Plate as derived from the standard curve Illumina Infinium HTS Assay Protocol Guide 111 duy a1d euondo YNG a1eihueno Automated Protocol 112 18 19 20 21 Data A readout of the raw data values for the Standard QDNA plate and the Sample QDNA Plate The Illumina Fluorometry Analysis software will prompt you to indicate whether you wish to save the QDNA data shown in an Excel file Select the option you prefer Click Yes to save lumina LIMS only The data will be sent to Ilumina LIMS In Illumina LIMS the QDNA plate moves into the Make Single Use DNA SUD Plate Pre PCR queue Click No to delete the quant data You can read the same plate for quant data repeatedly If you entered more than one Sample QDNA plate to read repeat steps 13 to 16 for each additional plate Discard the QDNA plates and reagents in accordance with facility requirements Do one of th
49. AACGANGS IAT GATIAAGATIACTIGATOCACTGATTCAACGTACCOTAAGGAACGTATCARLTGAGACTAAATATTAACCLACCATEAAGAGCTANCUSTGCAACGAGGANAAGANT GATAAGAGTAACACAC TT CTGTTAACCTTAAG NGABA NAG HA AACAGTAACACACTTCTGTTAACCT TAAGAT TACTTGAT CG RCIGRTTORANAD ACCGTAAAGATTACT TGATCCACTGATTCAACGT err Oc Gs ALOT IGA NAG IPASIALU Sere SE Cid Coe ton TRCCATPAAGAGCYACOGTGCAACAGTAACACACTICH GTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTGCAACGACGAAAAGAATGATAACA AIGA TAAGAGTAAGACAGT ICG TAAGCT IAAGAT IAG IGATOCAC GATT OAAGG TACCGTAAGGAACGIAI CAAT GAGAGTAAATATVAACGTACCAT IAAGAGG TACGGTCT TO GI TAAG TTAAGATTACTTGATCCACTGATTCAACGTA He UNS A ects AT TCAACGT TAA fait ee SAO a EL ACCGTAACGAACGTATCAATTGAGCTTCTG Weer AAGATTACTT alee a Ne GEN ACCGTAACGAACGTA ARTENA CT PAGANO tints TATCAATTGAGACTAAATAT TAACGTACCATTAAGAG AACCTIAAGAT TACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTGCAACGAAAAGAAT GATAACAGTAAC ACG TACCGIAACGAAUG TATCAT TAAGATTAG I GATCCAGT GAT TCAAGGTACCGTAACGAAGGTAT CAAT GAGACTAAATAT JAACGIACCAT AAGAGL AGGG I GGAACGACCAMAAGAAT GAT AACAGTAAGACAGTIGIGHTAAGSTIAAC Pe Cee NA ATTCAACGTTAAGA Ae OTCE T ATCA TOT NAIAN ITTGAGCTTCTGTTAACCTTAAGATTACTTGA SAC Nee UCU a aa WWE CAAT GAA BECASUE GUY ACGAAAAGAATGATAACAGTAACACACTTCTGTTAACCT TAAGATTACTT GATCCACTGATT CAACGTACCGTAAAGAT TACT TGATCCACTGAT TCAACGTACCGTAACGAACGTAT CAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGT SAT GATAACAGTAAGACACTICIGAACCT IRAGAN TACTIC GAICCACTGATIGAACGT
50. ACUGTAICART I GAGACTAAATATTAAGGTACCAT AAGAGGTACCGICTICTGTAAGCT TAAGAT IAG IGATECACT GAT IGAAGGTAGCG iTAA T PLATONI Went ACCETTAT TONCCACTOATTOANG SE ACCGTAACGAACGTATCAA aA GACT eens ACCATTAAGAGCTACCGTCTTCTGTTAACCT TAAGAT TACTTGATCCACTGATTCAACGTACCGTAACGAAC ACGAAAAGAATGATAACAGTAACACACTTCTGTTAACCTT ITTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGT AAO AG AG Si deal GITAAGCT IAAGATTACT I GATGGAGTGAT TCAAGGTAGOG IAACGAACGIATCAAT GAGACTAAATAT TAACGIAGCA TAAGAGC TAGOGTITCTGT IARGU IAAGATIAC GAT CAC GAT I CAAGGTA AAT TGAGACTAAATATTAACGTTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATAT TAACGTACCAT TAAGAGCT TCTGT TAACCT TAAGAT TACTT GATCCACTGAT TCAACGTACCGTAAC SGTATCAATIGAGA NGTKAATATT AACGTACTTAACCTTAAGATTACT TGATCCACTGATT CAACGTACCGTAACGAACGTCTTCTGTTAACCTTAAGA ANAN a GALA CGACGAAA GAGACTAAATAT TAACGTACCAT TAAGAGCTACAACCTTAAGAT TACTTGATCCACTGAT TCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTGCAACGACGAAAAGAAT GATAACAGTAACACACT Hee eee en ee ee ITO TOT TRACC oa eee ee GROTA eee aC AAG OL UGALI GAGAC TARTA TOA ATA TAA CAOT LC TL ae eka ee TOATCEACTOAT INAAGGIA GTACCAT TAAGAGCTACCGTGCAACTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAAT TGAGACTAAATATIAACGTACCATTIAAGAGCTACCGTGCAACGAC TTCTGTTAA AGA GIMO GAGCTACCGTGCAACGAAAATAACCTTAAGATTACTTGATCCACTGATTCAACGTACTTCTGTTAACCTTAAGATTACTTGATCCACTF GAAAAGAATGAT AEAT ACATAR AG AG TIG TAGA AGO OC GAT EOAG
51. AGATTACTT GAT Cay ACTGATTCAACGTACCGTAACGAACGTA ITTGAGACTAAATATTAACGTACCATTAAGAGCTACC 3ATAACAGTAACACACTTCTGT TAACCTTAAGATTACTTI PORT OCACTGALICAACGT AACCGTAACGAA KOO ITCAATTGAGACTAAATATTAACGT AC CATAAGAGCTACCGTOCAA AOGA OINA NGA TAACAGTAACACACTTCTGT1 CCATTAAGAGCTACEGT SC AACAGTAACAGACTTCTGT IAACCTTAAGATTACT GATCCAG GA ICAACGTACUS IAACGAACG IAT CAAT GAGAGTAAATAT TAACGTACGAI TAAGAGCTACCG I GCAACGACGARAAGAAT SATAN 3ATAACAGTAACACACTTCTGT TAACCTTAAGATTACT TGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTCTTCT PAAGATT BOT GAT RG an CHANG GTACCGT KAGSAAG OT ATCATTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTAT CAATT GAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTGCAACGA COKAKAGAA GAT TAACAGTAACACACTTCTGTTAACCTT STTGATOCAGT GAIT GAACG TTAAGATTACTTGATCCACTGATT GAACGTACCGTAACGAACGTATCAATT GAGCTTCTG HACC AAGAT TACT IGATCCAG TGA CAAGOTACCGTAACGAACG TA CARTTGAGACTAGGAACGACG 7AAAAGAATGATAACAGTAACACACTTCTGT TAACCT TAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATAT TAACGTACCAT TAAGAGCTACC Ilumina San Diego California 92122 U S A 1 800 809 ILMN 4566 1 858 202 4566 outside North America techsupport illumina com www illumina com
52. BeadChip alignment fixtures 144 149 150 description 9 imaging 8 single base extension 7 washing 7 Xstain auto protocol 180 Xstain manual protocol 80 82 C copy number variation 2 16 customer support 201 D data analysis 11 16 31 95 197 differential analysis 16 95 197 DNA 103 amplification bias 4 amplifying 4 annealing 6 captured and used as a template 7 denaturing 4 fragmenting 5 hybridizing 6 incubating 4 6 input required pa sample 2 mapping samples to BeadChips 11 neutralizing precipitating 5 preparing for amplification 4 preparing for staining extension 7 quantitating dsDNA 24 Illumina Infinium HTS Assay Protocol Guide XSpU resuspending 6 tracking samples 11 washing away 7 documentation 201 dsDNA 24 E equipment auto protocol 100 101 manual protocol 20 experienced user cards 11 flourosphore 8 FLUOTRAC plate 28 G oe analysis 16 95 197 enomeStudio 16 95 197 genotype calling for the sample 7 H help technical 201 HiScan 15 16 95 197 HiScan System 2 15 94 181 196 Infinium HTS assay overview 2 integrated informatics 16 95 197 intensity data files 16 iScan System 2 15 94 181 196 L lab setup and procedures 10 lab tracking form LTF 33 199 Index 200 technical assistance 201 M Tip Alignment Guide 143 152 materials xX auto protocol 101 102 manual protocol 20 22 XStain BeadChips multiplex 2 auto protocol 180 p manual protocol 80 82
53. CTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCAT TAAGAGCTACCGTGCAACGACGAAAAGAATGATAACAGTAACACA CCA CCTTAAGATTACTT C A TTGAGACTAAATAT TAACG A AAI CGAACTTCTGT TAA 3CTACCGTGCAACGAAAATAACCTTAAGATTACTTGATCCACTGATTCAACGTACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAGCTACCGTGCAACGACGAAAAGAATGAT AA ae NST ALAGA GTA PASO TRAGA NAL TI GATOGAN NATI SAAN A NOTANG AG GAN ALIBATA AGA MAGA PAGGANA PAGI NAGAGOTADE 3ATAACAGTAACACACTTCTGT TAACCTT NAGANA GE SA ARA PAPEL ANG ITCAATTGAGACT PAN NEGA AN Aa CGACGAAAAGAATGATAACAGTAACACACTTCTGTI1 CCAT TAAGAGCTACCGTGCAACAGTAACACACTTCTGT TAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGCTACCGTGCAACGACGAAAAGAAT GATAA 3ATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATAT TAACGTACCATTAAGAGCTACCGTCTTCTGT TAACCTTAAGATTACTTGATCCACTGATTCAACG STACCGT Lara aL RE ee og OE OE Ol UA EL TAN PATCAATTG AA a TTAAGAGCTACCGTGCAACGACGAAAAGAATGATAACAGTAACACACTTCTGTTAACCTTA gee Ne a Lae CGTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGCTTCTGTTAACCTT RAGATTAOT TGATGGACTOATTOAACOTACCGTAACGAACG TN TCAATTGAGACTAGCAACGACG PAMAGAAT MAACAGTAACACACT IGGL TRACE MARA ee ee eee ew UN roe NAG gla AN IGATCCACTON BMC ered ae GTAACGAACGTATCAAT TGAGACTAAATATIAACGTACCAT TAAGAGCTACC SATAA AC TRAGKGAS TTCTGTTAACCTTAAGAT TACT TGATCCACT GATT CAACGTACCG TAACGAACGTATCAAT T GAGACTAAA AN KAGAGC TACCGTCTTCTGTTAACCT TAAGATTACTTGA TAB AW GRADE
54. Components ike A BeadChip Hyb Chambers B Hyb Chamber Gaskets C Hyb Chamber Inserts 4 8 Part 15045738 Rev A NOTE To ensure optimal results from Hyb Chambers keep the Hyb Chamber lids and bases together Adopt a labeling convention that keeps each Hyb Chamber base paired with its original lid Check Hyb Chamber lid base pairs regularly to make sure that the fit remains secure Check hinges regularly for any signs of abnormal wear or loose fittings It is important that the hinges provide adequate clamping strength to ensure an airtight seal between the lid and the base Record the Hyb Chamber that was used for each BeadChip so that Hyb Chambers can be investigated and evaluated in the event of sample evaporation or other lab processing anomalies a Place the BeadChip Hyb Chamber gaskets into the BeadChip Hyb Chambers Match the wider edge of the Hyb Chamber Gasket to the barcode ridge side of the Hyb Chamber Figure 26 Hyb Chamber and Gasket Reservoirs Barcode Ridges Narrower Edges Wider Edges UOWST Lay the gasket into the Hyb Chamber and then press it down all around Illumina Infinium HTS Assay Protocol Guide A9 duuy js0d diyopeag 0 8ZIPLIqAH Manual Protocol DO Figure 27 Placing Gasket into Hyb Chamber Make sure the Hyb Chamber gaskets are properly seated Figure 28 Hyb Chamber with Gasket in Place illurhina b Dispense 400 ul PB2 into the humidifying buffer reservoir
55. Data tables for information management and manipulation Plotting and graphing tools Whole genome display of sample data in the IGV lumina Genome Viewer Data visualization of one or more samples in the ICB Illumina Chromosome Browser Data normalization Custom report file formats Genotype calling Clustering Detection of LOH loss of heterozygosity Analysis of structural variation including CNV copy number variation The GenomeStudio Genotyping Module can be fully integrated with the Illumina LIMS server For feature descriptions and instructions on using the GenomeStudio platform to visualize and analyze genotyping data see the GenomeStudio Framework User Guide and the GenomeStudio User Guide or online help 1 6 Part 15045738 Rev A Manual Protocol Introduction to Infinitum HTS Manual Protocol a 2 22 22 eee aaa 18 Infinitum HTS Manual Workflow 2 2 2 2 2222 e cece ecccccccccccceeceeceeeeeeeeceeeeeeees 19 Equipment Materials and Reagents c cece cee cee cece cece eeeeeeeeees 20 Quantitate DNA Optional Pre Amp 2 2 2 2 aaa 24 Amplify DNA Pre AMp 2 aaa 32 Incubate DNA Post Amp 2 22 2 2222 e eee e ence cece cececececeeeeeeeeeeeeeeeeeeeeeeeeees 36 Fragment DNA Post Amp c cece cece cece cece cece cece ceeeececeveceeecereeeeeees 37 Precipitate DNA Post Amp 2 2 22 aaa 39 Resuspend DNA Post Amp 22222000 0 0 aaa 43 Hybridize to
56. LX1 10 minutes 3 LX2 10 minutes 4 EML 15 minutes 5 Formamide EDTA 7 minutes 6 XC3 2 minutes 7 SML 10 minutes 8 XC3 7 minutes 9 ATM 10 minutes 10 XC3 7 minutes 11 SML 10 minutes 12 XC3 7 minutes 13 ATM 10 minutes 14 XC3 7 minutes 15 SML 10 minutes 16 XC3 7 minutes 11 When prompted remove the BeadChips from the chamber rack immediately and place them horizontally on the lab bench at room temperature Click OK in the message box Illumina Infinium HTS Assay Protocol Guide 1 8 3 duy js0d diyopeag ule sx ule S pue pua xa Automated Protocol 12 The robot PC sounds an alert and opens a message when the process is complete Click OK to finish the process Verify Reagents and BeadChips for Coating LIMS only 1 2 3 4 5 Scan the barcodes of the PB1 Scan the barcodes of the XC4 Scan the BeadChip barcodes Click Verify and then click Save If the reagents are correct and the BeadChips are queued for coating a blue confirmation message appears at the top of the window Proceed to Wash and Coat 8 BeadChips If any of the reagents are invalid check the reagent type before re scanning The reagent name e g PB1 appears at the end of the barcode Make sure to scan the correct reagent into each box If any of the BeadChips are not queued for coating a red error message appears at the top of the window The error message indicates the first incorrect barcode it finds Do not proceed with coating Instead follow these
57. MINA MAKES NO CLAIM REPRESENTATION OR WARRANTY OF ANY KIND AS TO THE UTILITY OF THIS PRODUCT FOR PURCHASER S INTENDED USES Product Warranty All warranties are personal to the Purchaser and may not be transferred or assigned to a third party including an affiliate of Purchaser All warranties are facility specific and do not transfer if the Product is moved to another facility of Purchaser unless Illumina conducts such move a Warranty for Consumables Illumina warrants that Consumables other than custom Consumables will conform to their Specifications until the later of i 3 months from the date of shipment from Illumina and ii any expiration date or the end of the shelf life pre printed on such Consumable by Illumina but in no event later than 12 months from the date of shipment With respect to custom Consumables i e Consumables made to specifications or designs made by Purchaser or provided to Illumina by or on behalf of Purchaser Illumina only warrants that the custom Consumables will be made and tested in accordance with Illumina s standard manufacturing and quality control processes Illumina makes no warranty that custom Consumables will work as intended by Purchaser or for Purchaser s intended uses b Warranty for Hardware Illumina warrants that Hardware other than Upgraded Components will conform to its Specifications for a period of 12 months after its shipment date from Illumina unless the Hardware includes Illumina provid
58. NA plate with 96 DNA 1 plate GT KO BSAC User samples 50 ng ul NOTE Thaw all reagents completely at room temperature and allow to equilibrate After thawed gently invert each tube several times to mix the reagent thoroughly Pulse centrifuge each tube to 280 x g to eliminate bubbles and collect reagent at the bottom of the tube Preparation In preparation for the Incubate MSA3 process preheat the Illumina Hybridization Oven in the post amp area to 37 C and allow the temperature to equilibrate 17 Apply an MSAS barcode label to a new 0 8 ml microplate MIDI 18 Thaw MA1 MA2 and MSM tubes to room temperature Gently invert at least 10 times to mix contents 19 Thaw DNA samples to room temperature In the sample sheet enter the Sample_Name and Sample_Plate for each Sample_Well On the lab tracking form record Date Time Operator DNA plate barcode MSA3 plate barcodes MAI tube barcodes MA2 tube barcodes MSM tube barcodes Illumina Infinium HTS Assay Protocol Guide 3 3 dwy 1d YNG Apidwiy Manual Protocol b NOTE Y To record information about your assay such as operator information start and stop times and barcodes use the lab tracking form provided at www illumina com documentation This form can be filled out and saved online or printed and filled in by hand Steps to Make MSA3 Plate 34 If you do not already have a WG DNA plate add DNA into one of the following e MIDI plate 20 ul to each WG DNA pla
59. Needed Place the following items on the bench 1 staining rack 1 vacuum desiccator 1 tube rack Self locking tweezers Large Kimwipes Vacuum hose Steps 1 Set up two top loading wash dishes labeled PB1 and XC4 2 To indicate the fill volume before filling wash dishes with PB1 and XC4 pour 310 ml water into the wash dishes and mark the water level on the side Empty the water from the wash dish Marking the level enables you to pour reagent directly from the PB1 and XC4 bottles into the wash dishes minimizing contaminant transfer from labware to wash dishes Illumina Infinium HTS Assay Protocol Guide 1 8 D duy js0d diyopeag ule sx ule S pue pua xa Automated Protocol Figure 125 PB1 and XC4 Wash Dishes with Staining Rack AN mS NN S SIT A Wash Dishes B Staining Rack 3 Pour 310 ml PB1 into the wash dish labeled PB1 4 Submerge the unloaded staining rack into the wash dish with the locking arms and tab facing towards you This orients the staining rack so that you can safely remove the BeadChips Let the staining rack sit in the wash dish You will use it to carry the BeadChips after disassembling the flow through chambers 1 36 Part 15045738 Rev A Figure 126 Staining Rack Locking Arms and Tab gt Is A Locking Arms B Tab x y CAUTION If the staining rack handle is not correctly oriented the BeadChips can be damaged when you remove the staining rack handle before r
60. Pipette up and down several times 6 Repeat for wells D1 E1 Fl and G1 changing tips each time Do not transfer from well G1 to H1 Well H1 serves as the blank 0 ng ul Lambda DNA Table 13 Concentrations of Lambda DNA Row Column Concentration Final Volume in ng ul Well ul Al 75 100 Bl 50 100 Cl 25 100 D1 125 100 Illumina Infinium HTS Assay Protocol Guide 1 O D duy 1d Ieuondo YNG apuenO Automated Protocol Row Column E1 F1 G1 H1 Concentration ng ul 6 25 3 125 1 5262 0 Figure 69 Serial Dilutions of Lambda DNA 75 ng pl 25 ng pl 12 5 ng pl 6 25 ng ul 3 125 ng pl 1 526 ng pl Ong pl 7 Cover the Standard DNA plate with a cap mat Dilute PicoGreen Standard DNA Plate with Serial Dilutions of Stock Lambda DNA 00000000000 om cocccccsose Final Volume in Well ul 100 100 200 100 The diluted PicoGreen is added to both the Standard QDNA and Sample QDNA plates to make the DNA fluoresce when read with the spectrofluorometer CAUTION y Do not use glass containers for the PicoGreen reagent PicoGreen degrades quickly in the presence of light and can adhere to glass which lowers its effective concentration in solution and effects the upper response range accuracy 106 Part 15045738 Rev A 1 Prepare a 1 200 dilution of PicoGreen into 1X TE using a sealed 100 ml or 250 ml Nalgene bottle wrapped in aluminum foil Refer to the following table to identify
61. Remove the cover seals from the BeadChips and wash the BeadChips in two separate PB1 reagent washes Then assemble the BeadChips into flow through chambers under the PB1 buffer Figure 41 Washing BeadChip o NA v Q Estimated Time 20 minutes for 4 BeadChips 30 minutes for 8 BeadChips 62 Part 15045738 Rev A Consumables Item Quantity Storage Supplied By PB1 550 ml for 1 to 8 Room Ilumina BeadChips temperature 700 ml for 9 to 16 BeadChips 850 ml for 17 to 24 BeadChips Multi sample BeadChip 1 per 8 BeadChips Illumina alignment fixture Te Flow LCG flow through 1 per BeadChip Ilumina chambers with black frames LCG spacers LCG glass back plates and clamps Wash dish 2 up to 8 BeadChips Illumina Wash rack 1 up to 8 BeadChips Ilumina y CAUTION Pour only the recommended reagent volume needed for the suggested number of samples listed in the Consumables table of each section Some reagents are used later in the protocol N WARNING y This protocol uses an aliphatic amide that is a probable reproductive toxin Personal injury can occur through inhalation ingestion skin contact and eye contact For more information consult the material data safety sheet for this assay at www illumina com msds Dispose of containers and any unused contents in accordance with the governmental safety standards for your region Illumina Infinium HTS Assay Protocol Guide 6 3 duy s0d diy9peeg yseMm Manual Protoco
62. Rev A illurina A BeadChip Hyb Chambers B Hyb Chamber Gaskets C Hyb Chamber Inserts NOTE To ensure optimal results from Hyb Chambers keep the Hyb Chamber lids and bases together Adopt a labeling convention that keeps each Hyb Chamber base paired with its original lid Check Hyb Chamber lid base pairs regularly to make sure that the fit remains secure Check hinges regularly for any signs of abnormal wear or loose fittings It is important that the hinges provide adequate clamping strength to ensure an airtight seal between the lid and the base Record the Hyb Chamber that was used for each BeadChip so that Hyb Chambers can be investigated and evaluated in the event of sample evaporation or other lab processing anomalies a Place the BeadChip Hyb Chamber gaskets into the BeadChip Hyb Chambers Match the wider edge of the Hyb Chamber Gasket to the barcode ridge side of the Hyb Chamber Figure 95 Hyb Chamber and Gasket A Reservoirs B Barcode Ridges C Narrower Edges D Wider Edges Lay the gasket into the Hyb Chamber and then press it down all around Illumina Infinium HTS Assay Protocol Guide 1 4 5 duuy js0d diyopeag 0 8ZIPLIqAH Automated Protocol 146 Figure 96 Placing Gasket into Hyb Chamber Make sure the Hyb Chamber gaskets are properly seated Figure 97 Hyb Chamber with Gasket in Place illurhina b Dispense 400 ul PB2 into the humidifying buffer reservoirs in the Hyb Cha
63. S BE LIABLE TO PURCHASER OR ANY THIRD PARTY FOR COSTS OF PROCUREMENT OF SUBSTITUTE PRODUCTS OR SERVICES LOST PROFITS DATA OR BUSINESS OR FOR ANY INDIRECT SPECIAL INCIDENTAL EXEMPLARY CONSEQUENTIAL OR PUNITIVE DAMAGES OF ANY KIND ARISING OUT OF OR IN CONNECTION WITH WITHOUT LIMITATION THE SALE OF THIS PRODUCT ITS USE ILLUMINA S PERFORMANCE HEREUNDER OR ANY OF THESE TERMS AND CONDITIONS HOWEVER ARISING OR CAUSED AND ON ANY THEORY OF LIABILITY WHETHER IN CONTRACT TORT INCLUDING NEGLIGENCE STRICT LIABILITY OR OTHERWISE 6 ILLUMINA S TOTAL AND CUMULATIVE LIABILITY TO PURCHASER OR ANY THIRD PARTY ARISING OUT OF OR IN CONNECTION WITH THESE TERMS AND CONDITIONS INCLUDING WITHOUT LIMITATION THIS PRODUCT INCLUDING USE THEREOF AND ILLUMINA S PERFORMANCE HEREUNDER WHETHER IN CONTRACT TORT INCLUDING NEGLIGENCE STRICT LIABILITY OR OTHERWISE SHALL IN NO EVENT EXCEED THE AMOUNT PAID TO ILLUMINA FOR THIS PRODUCT Illumina Infinium HTS Assay Protocol Guide Limitations on Illumina Provided Warranties TO THE EXTENT PERMITTED BY LAW AND SUBJECT TO THE EXPRESS PRODUCT WARRANTY MADE HEREIN ILLUMINA MAKES NO AND EXPRESSLY DISCLAIMS ALL WARRANTIES EXPRESS IMPLIED OR STATUTORY WITH RESPECT TO THIS PRODUCT INCLUDING WITHOUT LIMITATION ANY IMPLIED WARRANTY OF MERCHANTABILITY FITNESS FOR A PARTICULAR PURPOSE NONINFRINGEMENT OR ARISING FROM COURSE OF PERFORMANCE DEALING USAGE OR TRADE WITHOUT LIMITING THE GENERALITY OF THE FOREGOING ILLU
64. SLURS AUT ee ae GAGCTACCGTGCAACGAAAATAACCTI ENA E A TG aed ACTICTGTT PAGOTI PAAGATTACTTGATCCACTGATTCAA aCe ere CGTATCAATTGAGACTAAGCTACCGTGCAACGA AA GANAP AN GAT ACGAAAAGAATGATAACAGTAACACACTTCTGT TAACCTTAAGAT TACTTGATCCACTGATTCAACGTACCGTAAAGATTACTT GATCCACTGAT TCAACGTACCGTAACGAACGTAT CAAT T GAGACTAAATAT TAACGTAC CRTAAGAGCTACEGT sATGATAACAGTAAGACACTICIGIAACCT IAAGAT TACT IGATGGACT GAT CAACGTAGCGTAACGAAGGTAT CAAT GAGAGTARAIALTAACGTAGCAT TAAGAGG TAGUGIGCAACGACGAAAAGAAI GATAACAGTAACACACT TCG IAs GT EMG he reed toa nrg ATACA eT GTTAACCTTAAGAT T AALS aM St esl ACCGTAACGAACGTAT CAAT TGAGACTAAATAT TAACGT Pre Rae NCC IAC GG TSC nwa CGAAAAGAATGATAACA AATGATAACAGTAACACACTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATAT TAACGTACCA NTKAGAGC iCTACCGTCT TCTGT TAACCT TAAGATTACTTGATCCACTGATTCAACGTA ACG TACUGIAACGAAGG TATCATTAAGATTACTGATCCACT GATT CAACGTACOGTAACGAACGTAT CART GAGACTAAATAT TAAGGTACUAT AAGAGC TAGGGT GOSAGGAGGAAAAGAAT GATAAGAGTAACAGACTTCTGTIAAGG TANG A CCAR TG AT TCAACGT TAAGAT TACT T GATCCACTGATTCAACGTA COET aay GN ITTGAGCTTCTGTTAACCTTAAGATTACTTGATCCACT PALINANG S TA Und aa UA TEAT HAKA GA GUAN GG AN OHA ACGAAAAGAA AIPACAGIAACACAG TETE T AACO LAGA ACT GAT COAG IGA GARE Gy ALTE IGATESAGIGAT TRAAK TAG CGTAACGAACG ATCA TGAGACTSARUATTAA CG CEAI AGAR RACES AATGA YMCA TRAAG ACTTCTGTTAACCT TAAGAT TACT TGATCCACT GALI CAAGGTACCGTAAGGAA CGTATCAATTGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTCTTCTGTIAACCT TAAGA TIACTIGATCCACT GATTCAACGTA ACGTACCG T
65. Slowly move the staining rack up and down 10 times breaking the surface of the reagent Part 15045738 Rev A 10 11 12 NOTE t If the top edges of the BeadChips begin to touch during either PB1 or XC4 washes gently move the staining rack back and forth to separate the slides It is important for the solution to circulate freely between all BeadChips Figure 128 Washing BeadChips in PB1 Allow the BeadChips to soak for an additional 5 minutes CAUTION y Do not leave the BeadChips in the PB1 for more than 30 minutes Shake the XC4 bottle vigorously to ensure complete resuspension If necessary vortex until completely dissolved Pour 310 ml XC4 into the dish labeled XC4 and cover the dish to prevent any lint or dust from falling into the solution x CAUTION y Do not let the XC4 sit for longer than 10 minutes Remove the staining rack from the PB1 dish and place it directly into the wash dish containing XC4 For proper handling and coating The barcode labels on the BeadChips must face away from you the locking arms on the handle must face towards you Illumina Infinium HTS Assay Protocol Guide 1 8 Q dwy SO0d diyopeag ule sx uie s pue pua xa Automated Protocol 13 14 15 16 Figure 129 Moving Beask bia from PB1 to XC4 l T a NG dia Si Slowly move the staining rack up and down 10 times breaking the surface of the reagent NOTE 4 If the top edges of the BeadChips beg
66. T HATIAN ATAS Ce AAO TAG TIGANG KAGAGCTALUGT MATGATAACAGTAACACACTTCTGT TAACCTTAA CAN E E PA oe CGTATCAATTGAGACTA CACACTTCTGTTAA GTACCAT TAAGAGCTACCGTGCAACAGTAACACACTTCTGT TAACCTTAAGAT TACTT GATCCACTGAT TCAACGTACCGTAACGAF GAATGATAACA Eaa ERI I A ee eat eee eg ANN a 9 TAG AGANG ATO MAGAAN CT GATTCAACGTA ACGTACCGTAACGAACGTATCATTAAGATTACTT GATCCACT GATT CAACGTACCGTAACGAACGTAT CAAT T GAGACTAAATAT TAA CTGTTAACCT TAAG TACT TGATCCACTGATTCAACGTTAAGAT TACT TGATCCACT GATTCAACGTACCGTAACGAACGTATCAATTGAGCTTICTGTTAAC AGCAACGACGAA ACGAAAAGAATGATAACAGTAACACACTTCTGT TAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAAAGAT TACTTGATC AAGAGCTACCGT FOR RESEARCH USE ONLY ILLUMINA PROPRIETARY Part 15045738 Rev A October 2013 This document and its contents are proprietary to Illumina Inc and its affiliates Illumina and are intended solely for the contractual use of its customer in connection with the use of the product s described herein and for no other purpose This document and its contents shall not be used or distributed for any other purpose and or otherwise communicated disclosed or reproduced in any way whatsoever without the prior written consent of Illumina Illumina does not convey any license under its patent trademark copyright or common law rights nor similar rights of any third parties by this document The instructions in this document must be strictly and explicitly followed by qualified and properly trained personnel in order to ensure
67. abeled nucleotides into the extended primers 95 formamide 1 mM EDTA is added to remove the hybridized DNA After neutralization using the XC3 reagent the labeled extended primers undergo a multi layer staining process on the chamber rack Next you disassemble the flow through chambers and wash the BeadChips in the PB1 reagent coat them with XC4 and then dry them Figure 120 Extending and Staining BeadChip DNA gDNA Stain in red channel Stain in green channel Estimated Time Robot time 2 hours and 45 minutes for 8 BeadChips 3 hours for 16 BeadChips 3 hours and 10 minutes for 24 BeadChips Dry time 55 minutes Illumina Infinium HTS Assay Protocol Guide 1 F4 3 duuy js0d diyopeag ule sx ule S pue pua xa Automated Protocol Consumables Item Quantity Storage Supplied By RAI 10 ml for 1 8 15 C to 25 C Ilumina BeadChips 20 ml for 9 16 BeadChips 30 ml for 17 24 BeadChips LX1 2 tubes per 8 15 C to 25 C Illumina BeadChips LX2 2 tubes per 8 15 C to 25 C Illumina BeadChips EML 2 tubes per 8 15 C to 25 C Illumina BeadChips XC3 50 ml for 1 8 Room Ilumina BeadChips temperature 100 ml for 9 16 BeadChips 150 ml for 17 24 BeadChips SML Make sure that all SML 2 tubes per 8 15 C to 25 C Ilumina tubes indicate the same stain BeadChips temperature on the label ATM 2 tubes per 8 15 C to 25 C Illumina BeadChips PB1 310 ml for 1 8 Room Ilumina BeadChips temperature
68. ad the Standard QDNA and Sample QDNA plates The spectrofluorometer creates a standard curve from the known concentrations in the Standard QDNA plate which you use to determine the concentration of DNA in the Sample QDNA plates For the best performance Illumina recommends a minimum concentration of 50 ng ul 30 BON a i NOTE Depending on the software version that you are running the SoftMax Pro screens and menu options can vary Turn on the spectrofluorometer At the PC open the SoftMax Pro program Load the Illumina QDNA ppr file from the installation CD that came with your system Select Protocols GTS_QDNA Place the Standard QONA FLUOTRAC Plate into the spectrofluorometer loading rack with well Al in the upper left corner Click the blue arrow next to Ilumina QDNA SODNA STD Part 15045738 Rev A O ON Mm 11 12 13 14 15 16 Click Read When the software finishes reading the data remove the plate from the drawer Click the blue arrow next to Standard Curve to view the standard curve graph If the standard curve is acceptable continue with the sample plate Otherwise click Standard Curve again Place the first Sample QDNA plate in the spectrofluorometer with well Al in the upper left corner Click the blue arrow next to SQDNA and click Read When the software finishes reading the plate remove the plate from the drawer Repeat steps 10 through 12 to quantitate all Sample QDNA plates After all plates
69. age appears at the top of the window Proceed to Steps to Wash BeadChip 162 4 5 6 7 Part 15045738 Rev A 8 If any of the reagents are invalid check the reagent type before re scanning The reagent name e g PB1 appears at the end of the barcode Make sure to scan the correct reagent into each box 9 If any of the BeadChips are not queued for washing a red error message appears at the top of the window The error message indicates the first incorrect barcode it finds Do not proceed with washing Instead follow these steps to troubleshoot the problem a Click the Reports tab in the upper right corner b h the left sidebar click Tracking Reports Get Queue Status c Scan the BeadChip barcode that appeared in the error message and click Go d Note what step the BeadChip is queued for and proceed with that step For information about how to use Illumina LIMS see the Ilumina LIMS User Guide Steps to Wash BeadChip 1 Attach the wire handle to the rack and submerge the wash rack in the wash dish containing 200 ml PB1 Figure 110 Wash Rack in Wash Dish Containing PB1 2 Remove the Hyb Chamber inserts from the Hyb Chambers 3 Remove BeadChips from the Hyb Chamber inserts one at a time Illumina Infinium HTS Assay Protocol Guide 1 6 3 duy s0d diy9peeg yseMm Automated Protocol 4 Remove the cover seal from each BeadChip NOTE y To make sure that no solution splatters on you Illumina recommends removing
70. aint system employs a capillary gap flow through chamber to enable reagent entrapment and exchange over the active surface of the BeadChip Washing blocking extension and signal amplification are all performed by simple reagent additions to the flow cell Addition of a new reagent displaces the entrapped reagent from the flow cell For maximum flexibility these additions can be performed either manually or via the Tecan Genesis or Tecan Freedom Evo robots The optional automated robotic processing and single use reagent tube barcoding assure maximum consistency from slide to slide x CAUTION y Do not run any other programs or applications while using the Tecan robot Your computer and the robot can lock up and stop a run Part 15045738 Rev A Imaging Systems BeadChips are imaged using either the Illumina HiScan System or iScan System Both of these systems are two channel high resolution laser imagers that scan BeadChips at two wavelengths simultaneously and create an image file for each channel i e two per array The iScan Control Software determines intensity values for each bead type and creates data files for each channel GenomeStudio uses this data file with the oligo pool manifest file opa individual beadpool map bpm or manifest file bgx to analyze the data from the assay Loading and unloading the iScan System can be automated with the optional AutoLoader2 or AutoLoader 2x for the HiScan System All AutoLoaders s
71. al any residual sample in the MSAS plate with foil and store at 15 C to 25 C Store at 80 C if you do not plan to use the sample again within 24 hours Set up Multi BeadChip for Hybridization CAUTION y For optimal performance take care to keep the Hyb Chamber inserts containing BeadChips steady and level when lifting or moving Avoid shaking and keep parallel to the lab bench always Do not hold by the sides near the sample inlets Illumina Infinium HTS Assay Protocol Guide S7 duuy js0d diyopeag 0 8ZIPLIqAH Manual Protocol 58 1 Load the Hyb Chamber inserts containing BeadChips into the Illumina Hyb Chamber Position the barcode end over the ridges indicated on the Hyb Chamber WARNING y Keep Hyb Chambers at room temperature when you load the BeadChips Do not precondition the Hyb Chambers in the Illumina Hybridization Oven before loading the BeadChips If you heat the PB2 and then open the Hyb Chamber to add BeadChips some of the PB2 evaporates leading to a change in the osmolality of PB2 and an imbalance in the vapor pressure between PB2 and RA1 sample hybridization buffer Figure 36 Placing Hyb Chamber Inserts into the Hyb Chamber Place the back side of lid onto the Hyb Chamber and then slowly bring down the front end to avoid dislodging the Hyb Chamber inserts Figure 37 Seating Lid onto Hyb Chamber Close the clamps on both sides of the Hyb Chamber so that the lid is secure and even on the bas
72. arm the reagent to room temperature preferably in a 20 to 25 C water bath Gently mix to dissolve any crystals that may be present 1 Place all reagent tubes in a rack in the order in which they will be used If frozen allow them to thaw to room temperature and then gently invert the reagent tubes at least 10 times to mix contents Illumina Infinium HTS Assay Protocol Guide 1 F D duy js0d diyopeag ule sx ule S pue pua xa Automated Protocol Figure 121 XStain BeadChip Reagent Tubes and Bottles EML 95 Formamide 1mM EDTA SML ATM PB1 XC4 TIDODIMOOWST On the lab tracking form record e Date Time Operator Robot RA1 barcode XC3 barcode LX1 barcodes LX2 barcodes EML barcodes SML barcodes 1 T 6 Part 15045738 Rev A ATM barcodes PB1 barcode XC4 barcodes J NOTE To record information about your assay such as operator information start and stop times and barcodes use the lab tracking form provided at www illumina com documentation This form can be filled out and saved online or printed and filled in by hand Set Up Chamber Rack 1 Make sure that the water circulator reservoir is filled with water to the appropriate level See the VWR Operator Manual VWR part 110 229 2 Turn on the water circulator and set it to a temperature that brings the chamber rack to 44 C at equilibrium This temperature can vary depending on facility ambient conditions Illumina Infinium HTS Assay Protoco
73. at www illumina com msds Dispose of containers and any unused contents in accordance with the governmental safety standards for your region Illumina Infinium HTS Assay Protocol Guide 43 dwy S0d YNG puedsnsey Manual Protocol Preparation 1 If you stored the MSA3 plate at 15 C to 25 C thaw it to room temperature Remove the cap mat and discard it 2 Preheat the Illumina Hybridization Oven to 48 C 3 Turn on the heat sealer to preheat Allow 20 minutes 4 RAI is shipped frozen Gradually warm the reagent to room temperature preferably in a 20 C to 25 C water bath Gently mix to dissolve any crystals that can be present 5 On the lab tracking form record Date Time Operator RA1 bottle barcodes i NOTE To record information about your assay such as operator information start and stop times and barcodes use the lab tracking form provided at www illumina com documentation This form can be filled out and saved online or printed and filled in by hand Use Fresh RA1 Reagent for Each Step It is important to use fresh RA1 for each protocol step in the assay where it is required RAI that has been stored properly and has not been dispensed for use in either the XStain or Resuspension step is considered fresh RA1 After RA1 has been poured out into a reservoir and exposed to room temperature air for extended periods of time it is no longer fresh To make best use of RA1 only pour out the amount needed for the curren
74. ate WG 1123456789 MSA3 LULU ION M DN W SS Be ee 06 00 ee 06 006 1 2 Illumina Infinium HTS Assay Protocol Guide D D duuy js0d diyopeag 0 8ZIPLIqAH Manual Protocol 56 Figure 34 Distributing Sample to the BeadChips with an Adjustable Multichannel Pipette 1123456789 UO MN UOM BC 3 A7 C7 se I Ee ee 1123456789 CHE A 1123456789 UDP APAN BC 4 a Is a LET f a IT IB IE IE LT i 8 1123456789 Part 15045738 Rev A For Both Single Channel Pipette and Adjustable Spacer Multichannel Pipette 1 In the Sentrix ID column of the sample sheet record the sample ID and position on the BeadChip See the Sample Section Naming Diagram in the Lab Tracking Form 2 After loading all DNA onto the BeadChip wait for the sample to disperse over the entire surface 3 Inspect the loading port to see if a large bolus of liquid remains Excess sample volume in the BeadChip loading port helps prevent low intensity areas resulting from evaporation Figure 35 Bolus of Liquid at Loading Port HA a T HEN If no excess liquid is visible it is acceptable to add additional sample from the leftover volume in the amplification plate until there is a large bolus around the loading port NOTE Do not top off with RA1 sample hybridization buffer because RA1 dilutes the sample 4 Record the top off activity on the lab tracking form 5 Heat se
75. ation start and stop times and barcodes use the lab tracking form provided at www illumina com documentation This form can be filled out and saved online or printed and filled in by hand Use Fresh RA1 Reagent for Each Step It is important to use fresh RA1 for each protocol step in the assay where it is required RAI that has been stored properly and has not been dispensed for use in either the XStain or Resuspension step is considered fresh RA1 After RA1 has been poured out into a reservoir and exposed to room temperature air for extended periods of time it is no longer fresh To make best use of RA1 only pour out the amount needed for the current step If you plan to perform additional assay steps requiring RA1 that same day then leave the remaining thawed reagent in the original closed bottle at room temperature until it is needed Otherwise follow the standard RA1 storage procedures described in this assay guide for next day processing and prolonged storage conditions Prepare Robot For instructions on preparing the robot for use in a protocol see the Infinitum Assay Lab Setup and Procedures Guide Illumina Infinium HTS Assay Protocol Guide 1 37 dwy S0d YNG puedsnsey Automated Protocol Refer to the figure shown below throughout this protocol Note that all of the barcodes face to the right Figure 90 Tecan Eight Tip Robot Resuspend MSA3 Setup n a DUA ALO A RAl in Quarter Reservoir B MSA3 Plate
76. ators and development partners that contributed to the development of this Product and their respective officers directors representatives and employees against any claims liabilities damages fines penalties causes of action and losses of any and every kind including without limitation personal injury or death claims and infringement of a third party s intellectual property rights resulting from relating to or arising out of i Purchaser s breach of any of these terms and conditions ii Purchaser s use of this Product outside of the scope of research use purposes iii any use of this Product not in accordance with this Product s Specifications or Documentation or iv any Excluded Claim Conditions to Indemnification Obligations The parties indemnification obligations are conditioned upon the party seeking indemnification i promptly notifying the other party in writing of such claim or action ii giving the other party exclusive control and authority over the defense and settlement of such claim or action iii not admitting infringement of any intellectual property right without prior written consent of the other party iv not entering into any settlement or compromise of any such claim or action without the other party s prior written consent and v providing reasonable assistance to the other party in the defense of the claim or action provided that the party reimburses the indemnified party for its reasonable out of pocket e
77. ay Protocol Guide 1 3 3 duy s0d YNG e eldioed Automated Protocol 18 19 20 Quickly invert the MSA3 plate and drain the liquid onto an absorbent pad to decant the supernatant Then smack the plate down on a dry area of the pad avoiding the liquid that was drained onto the pad Tap firmly several times for 1 minute or until all wells are devoid of liquid y CAUTION Keep the plate inverted To ensure optimal performance do not allow supernatant in wells to pour into other wells Leave the uncovered inverted plate on the tube rack for 1 hour at room temperature to air dry the pellet At this point blue pellets should be present at the bottoms of the wells Figure 88 Uncovered MSA3 Plate Inverted for Air Drying CAUTION y Do not over dry the pellet Pellets that are over dried will be difficult to resuspend Poorly resuspended samples will lead to poor data quality 21 Record the start and stop times onthe lab tracking form 22 Discard unused reagents in accordance with facility standards 134 Part 15045738 Rev A 23 Do one of the following Proceed to Resuspend DNA Post Amp If you do not plan to proceed to the next step immediately seal the MSA3 plate with a new cap mat and store at 15 C to 25 C SAFE STOPPING POINT Now is a good stopping point in the process Illumina Infinium HTS Assay Protocol Guide 1 3 D duy s0d YNG eveldioed Automated Protocol Resuspend DNA Post A
78. benchtop at room temperature for 30 minutes After the 30 minute cool down pulse centrifuge the MSA3 plate to 280 x g Part 15045738 Rev A Prepare the Robot For instructions on preparing the robot for use in a protocol see the Infinium Assay Lab Setup and Procedures Guide Refer to the figure below throughout this protocol Note that all of the plate barcodes face to the right Figure 99 Placing Alignment Fixtures and MSA3 Plate onto Robot Bed A MSAS3 Plate B Robot BeadChip Alignment Fixtures Verify MSA3 and BeadChips for Hybridization LIMS only Optional 1 Scan the barcode of the MSA3 plate 2 Scan the barcodes of all the BeadChips you plan to hybridize with the plate You can scan up to 24 BeadChips r NOTE Only scan BeadChips that have been accessioned into the system The BeadChip type must match the type associated with this batch in Illumina LIMS Illumina Infinium HTS Assay Protocol Guide 1 A Q GWY 1SO 4 diy9peag 0 9ZIPuq H Automated Protocol 3 Click Verify 4 If the MSA3 plate and BeadChips are queued for hybridization a blue confirmation message appears at the top of the window Proceed to Load BeadChips If the MSA3 plate is not queued for hybridization if any of the BeadChips have not been accessioned into the system or if any of the BeadChips are the wrong type a red error message appears at the top of the window The error message indicates the first incorrect barcode it finds Do not proc
79. bles table of each section Some reagents are used later in the protocol Preparation 1 Do one of the following If you froze the MSA3 plate after fragmentation thaw it to room temperature then pulse centrifuge to 280 x g Illumina Infinium HTS Assay Protocol Guide 3 Q duy s0d YNG eyeldioed Manual Protocol If you proceeded immediately from Fragment the MSA3 Plate leave the plate in the 37 C heat block until setup is complete Preheat heat block to 37 C Thaw PM1 to room temperature Centrifuge to 280 x g for 1 minute Remove the 96 well cap mat On the lab tracking form record Date Time Operator PM1 tube barcodes 2 propanol lot number and date opened 4 NOTE To record information about your assay such as operator information start and stop times and barcodes use the lab tracking form provided at www ilumina com documentation This form can be filled out and saved online or printed and filled in by hand Steps to Precipitate the MSA3 Plate 40 a F WO N e 9 Add 50 ul PM1 to each MSA3 plate well containing sample Seal the plate with the cap mat Vortex the plate at 1600 rpm for 1 minute Incubate at 37 C for 5 minutes Pulse centrifuge to 280 x g for 1 minute 4 NOTE Set centrifuge to 4 C in preparation for the next centrifuge step Carefully remove the cap mat and discard it Add 155 ul 100 2 propanol to each well containing sample Carefully seal the MSA3 plate with a new dry cap mat
80. bridized DNA is washed away and the BeadChip is prepared for staining and extension Figure 7 Washing BeadChip pe om Q Extend and Stain XStain BeadChip Post Amp Single base extension of the oligos on the BeadChip using the captured DNA as a template incorporates detectable labels on the BeadChip and determines the genotype call for the sample XStain occurs in a capillary flow through chamber Figure 8 Extending and Staining BeadChip T2 a T c Stain in red channel gDNA gDNA Stain in green channel Illumina Infinium HTS Assay Protocol Guide T Aesse SIH wuniulju Overview Image BeadChip Post Amp The Illumina HiScan or iScan System scans the BeadChip using a laser to excite the fluorophore of the single base extension product on the beads The scanner records high resolution images of the light emitted from the fluorophores Figure 9 Imaging BeadChip 8 Part 15045738 Rev A lumina Infinium BeadChips Illumina Infinium BeadChips are sophisticated silicon based array devices An IntelliHyb seal separates the sample sections of the slide so that you can run multiple samples simultaneously Each individual sample section holds oligonucleotide probe sequences that are attached to beads assembled into the microwells of the BeadChip substrate Because the microwells outnumber the distinct bead types multiple copies of each bead type are present in the array This built in redundancy i
81. ccessories or peripherals Illumina means Illumina Inc or an Illumina affiliate as applicable Product means the product that this document accompanies e g Hardware Consumables or Software Purchaser is the person or entity that rightfully and legally acquires this Product from Illumina or an Illumina authorized dealer Software means Illumina branded software e g Hardware operating software data analysis software All Software is licensed and not sold and may be subject to additional terms found in the Software s end user license agreement Specifications means Illumina s written specifications for this Product in effect on the date that the Product ships from Illumina Part 15045738 Rev A 2 Research Use Only Rights Subject to these terms and conditions and unless otherwise agreed upon in writing by an officer of Illumina Purchaser is granted only a non exclusive non transferable personal non sublicensable right under Illumina s Core IP in existence on the date that this Product ships from Illumina solely to use this Product in Purchaser s facility for Purchaser s internal research purposes which includes research services provided to third parties and solely in accordance with this Product s Documentation but specifically excluding any use that a would require rights or a license from Illumina to Application Specific IP b is a re use of a previously used Consumable c is the disassembling reverse engineering re
82. ce to the right Start Robot 182 Other than Illumina LIMS At the robot PC click Run Ilumina LIMS At the robot PC a Ensure that the Use Barcodes check box is checked b In the Basic Run Parameters pane change the value for Number of BeadChips to indicate the number of BeadChips being processed c Click Run to start the process Log in if prompted When prompted enter the stain temperature indicated on the SML tube NOTE If you are using Illumina LIMS you will not be prompted to enter the staining temperature Illumina LIMS will automatically set the correct temperature based on the SML tube barcodes When the prompt appears wait for the Chamber Rack to reach 44 C Do not load the BeadChips or click OK yet Once the temperature probe registers 44 C click OK When prompted load the BeadChips and click OK Place each assembled flow through chamber in the first row of the chamber rack Refer to the robot bed map for the correct layout Ensure each flow through chamber is properly seated on its rack to allow adequate heat exchange between the rack and the chamber Part 15045738 Rev A 9 On the lab tracking form record the chamber rack position associated with each BeadChip 10 Click OK A series of reactions begins each with a wait time Message boxes on the robot PC tell you which reaction is occurring and how long the wait time is Table 15 List of Reactions Reagent Wait Time 1 RA1 3 minutes 2
83. cece ccccceececcccecccceecceeeceseeeees 11 Table 2 AutoLoader2 and AutoLoader2x Features 22222 e eee cece e cece cece eee eee 15 Table 3 User Supplied Equipment Infinitum HTS Assay Manual Protocol 20 Table 4 Illumina Supplied Equipment Infinium HTS Assay Manual Protocol 20 Table 5 User Supplied Materials Infinium HTS Assay Manual Protocol 20 Table 6 Illumina Supplied Reagents Infinium HTS Assay Manual Protocol 22 Table 7 Concentrations of Lambda DNA 22222222 2 cece eee eee ccceeeeeeeees 26 Table 8 Volumes for PicoGreen Reagents 0c cece eee eee cece e eee 28 Table 9 User Supplied Equipment Infinitum HTS Assay Automated Protocol 100 Table 10 Illumina Supplied Materials Infinitum HTS Assay Automated 101 Table 11 User Supplied Materials Infinitum HTSAssay Automated Protocol 101 Table 12 Illumina Supplied Reagents Infinitum HTS Assay Automated Protocol 102 Table 13 Concentrations of Lambda DNA 2 22 2 2222 eee cece cece cece ee ceeee 105 Table 14 Volumes for PicoGreen Reagents c eee eee cece cece cece eeeeeeeee 107 Table 15 List of Reactions 2 0 2 2 2 cece cece cece cece aoaaa a annona rarnana 183 Table 16 Illumina General Contact Information 2 2 0 0 0 000000 cc ccccccccccccccccceeeeees 201 Table 17 Illumina Customer Support Telephone Numbers
84. ck data Done System initialized Genesis 3 Place the MSA3 plate on the robot bed according to the bed map A add RA1 as follows 7 ml for 96 samples Place a quarter reservoir in the reservoir frame according to the robot bed map and 5 h the lab tracking form record the plate positions on the robot bed and RA1 barcodes 6 Make sure that all items are placed properly on the robot bed that all caps and seals have been removed and that all the barcodes face to the right Start the Robot 1 Other than Ilumina LIMS At the robot PC click Run 2 Ilumina LIMS At the robot PC Illumina Infinium HTS Assay Protocol Guide 139 dwy S0d YNG puedsnsey Automated Protocol 9 a Ensure the Use Barcodes check box is checked b Click Run to start the process Log in if prompted The robot PC sounds an alert and opens a message when the process is complete Click OK in the message box Remove the MSA3 plate from the robot bed Apply a foil seal to the MSA3 plate by firmly holding the heat sealer block down for 5 full seconds Place the sealed plate in the Illumina Hybridization Oven and incubate for 1 hour at 48 C In the lab tracking form record the start and stop times Vortex the plate at 1800 rpm for 1 minute Pulse centrifuge to 280 x g NOTE If you stored the DNA pellets at 15 C to 25 C for more than 72 hours you may need to re vortex and centrifuge until the pellets are c
85. commercial diagnostic or otherwise This Product is labeled For Research Use Only Purchaser must ensure it has any regulatory approvals that are necessary for Purchaser s intended uses of this Product 4 Unauthorized Uses Purchaser agrees a to use each Consumable only one time and b to use only Illumina consumables reagents with Illumina Hardware The limitations in a b do not apply if the Documentation or Specifications for this Product state otherwise Purchaser agrees not to nor authorize any third party to engage in any of the following activities i disassemble reverse engineer reverse compile or reverse assemble the Product ii separate extract or isolate components of this Product or subject this Product or components thereof to any analysis not expressly authorized in this Product s Documentation iii gain access to or attempt to determine the methods of operation of this Product or iv transfer to a third party or grant a sublicense to any Software or any third party software Purchaser further agrees that the contents of and methods of operation of this Product are proprietary to lumina and this Product contains or embodies trade secrets of Illumina The conditions and restrictions found in these terms and conditions are bargained for conditions of sale and therefore control the sale of and use of this Product by Purchaser 5 Limited Liability TO THE EXTENT PERMITTED BY LAW IN NO EVENT SHALL ILLUMINA OR ITS SUPPLIER
86. culator Connected to Chamber Rack A Chamber Rack B Water Circulator with Programmable Temperature Controls C Reservoir Cover 3 The temperature displayed on the water circulator LCD screen may differ from the actual temperature on the chamber rack Confirm the actual temperature using the temperature probe for the chamber rack 4 Make sure that you remove bubbles trapped in the chamber rack each time you run this process Follow instructions in the Te Flow Tecan Flow Through Module Operating Manual Tecan Doc ID 391584 5 Use the Illumina Temperature Probe in several locations to make sure that the chamber rack is at 44 C Make sure that all locations are at 44 C 0 5 C Illumina Infinium HTS Assay Protocol Guide T Q duy js0d diyopeag ule sx ule S pue pua xa Manual Protocol NOTE Do not leave the temperature probe in the first three rows of the chamber rack Reserve this space for BeadChips Figure 55 Ilumina Temperature Probe and Temperature Probe in Chamber Rack For accurate temperature measurement ensure the Illumina Temperature Probe is touching the base of the chamber rack Single Base Extension SO x CAUTION The remaining steps must be performed without interruption f NOTE If you are processing more than 8 BeadChips complete the reagent dispensing step for each reagent for the first set of 8 BeadChips Then continue the same reagent dispensing steps for the second set of 8 BeadChips F
87. d hand scan the Sample QDNA plate barcode Click OK When prompted remove the plate seal from the Sample QDNA plate and load it into the spectrofluorometer tray with well A1 at the upper left corner Click OK The spectrofluorometer will read the plate data Remove the Standard QDNA plate from the spectrofluorometer tray When prompted click Yes to review the raw Sample QDNA plate data Figure 73 Sample QDNA Data illumina Fluorometry Control BEGI File LIMSLog Help o Reader Tasks amp Read Quant E Robot GC Read QNT Index 01 2 DB Login T Use Barcodes Operator Server Name 03 5 06 07 08 o 10 na 12 A 109 986 53 762 78 122 78 078 31 923 65 631 62 332 98 662 97 386 64 782 77 755 78 275 56 506 72 087 54 109 55 846 86 639 81 328 48 808 77 324 74 072 100 190 90 108 58 381 87 972 71 074 56 321 84 341 69 935 82 523 72 893 95 563 37 740 44 373 73 823 1 836 49 999 92 392 47 027 98 032 58 986 85 217 57 230 61 958 71 742 25 795 56 525 69 188 PlateBarcode iT 59 564 74 908 52 543 91 516 39 596 50 323 49 487 59 364 105 795 41 352 52 354 28 879 90 452 12 566 62 623 81 855 58 045 30 936 29 819 111 245 58 236 61 255 35 501 33 680 65 290 81 944 59 105 46 436 26 842 57 128 55 730 92 185 111 854 42 114 99 113 108 011 71 746 107 547 132 712 56 394 112 313 97 3
88. d Protocol 10070210X X X X nanaon 97 Introduction to Infinium HTS Automated Protocol 22222 22222 98 Infinitum HTS Automated Workflow _ 2 2 222 c eee eee eee ceeeccceeceseeeeess 99 Equipment Materials and Reagents cece e ee eee cence ee 100 Quantitate DNA Optional Pre Amp 103 Illumina Infinium HTS Assay Protocol Guide Vi Amplify DNA Pre Amp 0 2 0 ccc cece cece cece cece ccceceeeeeeeceeeeeeees 113 Incubate DNA Post Amp c cc ccceecccccccceceeeceeeeeeeeeeeeeeeeeeess 121 Fragment DNA Post Amp 00ccccceeeccccccececcccccceeccccccceeeeecccceaes 123 Precipitate DNA Post Amp 222222 222222 e cece eeeccecececcccceeeeeeeeeeees 128 Resuspend DNA Post Amp aaa 136 Hybridize to BeadChip Post Amp 2 2c cecc cece cece ce ceceeeeeeees 141 Wash BeadChip Post Amp cccccccccccccccececeeeteetttetteeteees 160 Extend and Stain XStain BeadChip Post Amp 2202 22e0eee eee 173 Image BeadChip Post Amp 22 0cccce cece cece cece ce ceececeeeeeeeeeeeees 196 IIlumina GenomeStudio 2 2 2 eee ccc aLL LLADD ALLAD aLaaa 197 POOE NE Uban a AA ABG a ORR EES AG 199 Debora nibAaEssapartat rong kirsenys leet tt bees strana ect ki naga NY 201 Part 15045738 Rev A List of Tables Tablet Sample Sheet Guidelines 2c cee ec
89. e no gaps It is best to close the clamps in a kitty corner fashion closing first the top left clamp then the bottom right then the top right followed by the bottom left Part 15045738 Rev A NOTE Keep the Hyb Chamber steady and level when moving it or transferring it to the Illumina Hybridization Oven 4 Place the Hyb Chamber in the 48 C Illumina Hybridization Oven so that the clamps of the Hyb Chamber face the left and right side of the oven and the Illumina logo on top of the Hyb Chamber is facing you CAUTION y After loading the BeadChips into the Hyb Chambers place the Hyb Chambers into the Illumina Hybridization Oven immediately Do not modify the hybridization environment by adding additional fixtures or humidifying elements Leave the Hyb Chambers in the oven at the correct orientation and temperature until hybridization is complete Changes to the hybridization environment can have unexpected effects on data quality Figure 38 Hyb Chamber Correctly Placed in Hyb Oven ilumina NOTE 4 If you are stacking multiple Hyb Chambers in the Illumina Hybridization Oven make sure the feet of the top Hyb Chamber fit into the matching indents on top of the bottom Hyb Chamber This holds the Hyb Chambers in place while they are rocking You can stack up to 3 Hyb Chambers per row for a maximum of 6 Hyb Chambers total in the Illumina Hybridization Oven Illumina Infinium HTS Assay Protocol Guide D Q duuy js0d diyopeag
90. e following Proceed to Amplify DNA Post Amp Store the Sample QDNA plate at 2 to 8 C for up to one month SAFE STOPPING POINT Now is a good stopping point in the process Part 15045738 Rev A Amplify DNA Pre Amp This process creates an MSA3 plate for amplification MA1 is first added to the MSA3 plate followed by the samples 0 1N NaOH is added to denature the samples The MA2 reagent neutralizes the sample Multi Sample Amplification Master Mix MSM is then added to the samples Figure 74 Denaturing and Neutralizing BCD DXI vT Bag A NG ci Estimated Time Robot time 30 minutes for 48 samples 1 hour or 96 samples Incubation time 20 24 hours Consumables Item Quantity Storage MAI 1 tube Room per 96 samples temperature Illumina Infinium HTS Assay Protocol Guide Supplied By Ilumina 113 dwy 1d YNG dwy Automated Protocol 114 Item Quantity Storage Supplied By MA2 1 tube 15 C to 25 C Illumina per 96 samples MSM 1 tube 15 C to 25 C Illumina per 96 samples 0 1N NaOH 15 ml DC 1 XC General lab per 96 samples supplier 96 well 0 8 ml microplate 1 plate General lab MIDI supplier WG DNA plate with 48 or 96 1 plate GT KO BSAC User DNA samples 50 ng ul i NOTE Thaw all reagents completely at room temperature and allow to equilibrate After thawed gently invert each tube several times to mix the reagent thoroughly Pulse centrifuge each tube to 280 x g to
91. e surface of the PB1 with gentle slow agitation 10 When you remove the BeadChips from the wash rack inspect them for remaining residue j NOTE Residue that can adversely affect results is sometimes left on BeadChips after seals are removed If there is residue left on the BeadChips after the second PB1 wash use a 200 ul pipette tip for each BeadChip and slowly and carefully scrape off the residues outward away from the bead sections under PB1 Use a new pipette tip for each BeadChip Then continue with the protocol 11 If you are processing more than 8 BeadChips a Assemble the flow through chambers for the first 8 BeadChips as described in the next section and place them on the lab bench in a horizontal position NOTE Keep the flow through chambers in a horizontal position on the lab bench until all assembled flow through chambers are ready to be loaded into the chamber rack Do not place the flow through chambers in the chamber rack until all BeadChips are prepared in flow through chambers b Return to this procedure and follow the steps described above to wash the next set of 8 BeadChips c Repeat for each remaining set of 8 BeadChips Assemble Flow Through Chambers 1 NOTE Confirm that you are using the correct Infinium LCG glass back plates and spacers before assembling the flow through chambers Refer to the following image for the correct flow through chamber components Illumina Infinium HTS Assay Protoc
92. eadChip Post Amp Store the BeadChips in the Illumina BeadChip Slide Storage Box at room temperature Image the BeadChips within 72 hours Illumina Infinium HTS Assay Protocol Guide Q 3 duy js0d diyopeag ule sx ule S pue pua xa Manual Protocol Image BeadChip Post Amp Follow the instructions in the iScan System User Guide or HiScan System User Guide to scan your BeadChips Use the Infinium LCG scan setting for your BeadChip Q 4 Part 15045738 Rev A Illumina GenomeStudio The Illumina GenomeStudio Genotyping Module included with your Illumina Infinium Assay system is an application for extracting genotyping data from intensity data files idat files collected from systems such as the Illumina HiScan System For feature descriptions and instructions on using the GenomeStudio platform to visualize and analyze genotyping data see the GenomeStudio Framework User Guide and the GenomeStudio User Guide or online help Illumina Infinium HTS Assay Protocol Guide Q 5 OlDN GEeWOUsY CUILUNI 96 Part 15045738 Rev A Automated Protocol Introduction to Infinitum HTS Automated Protocol aa 98 Infinitum HTS Automated Workflow 00 0000 aaa 99 Equipment Materials and Reagents c cece ccc cece cece cece eeeeeeeeee 100 Quantitate DNA Optional Pre Amp 22 2 2 aaa 103 Amplify DNA Pre AMp 2 2 aa 113 Incubate DNA Post Amp 22 222 222 2 cece c
93. ece cece cece ec eeceeeeceeceeceeeeeeeceeeeeeeeeteees 121 Fragment DNA Post Amp 2 200000 cece ccc cece cece cece eee ee cece aaao aiana 123 Precipitate DNA Post Amp 22 2 aaa 128 Resuspend DNA Post Amp 2222220000 0 aaa 136 Hybridize to BeadChip Post Amp 141 Wash BeadChip Post Amp 2 0 aaa 160 Extend and Stain XStain BeadChip Post Amp aaa 173 Image BeadChip Post Amp 22 0 ccc cececccceeeccccccecececcccceeeeeccceeeeeeeescceeeees 196 lllumina GenomeStudio eee eee eee eee eee e cece eeeeeeeeeee 197 7 r ee eal atl e g m NATGCAGCATTA a Gag7c61CA Nag Illumina Infinium HTS Assay Protocol Guide O7 eJajdeyo Automated Protocol Introduction to Infinium HTS Automated Protocol 98 This chapter describes pre and post amplification automated laboratory protocols for the Infinium HTS assay Follow the protocols in the order shown Some of the tasks in this chapter make reference to Illumina LIMS Laboratory Information Management System If you are not running Illumina LIMS disregard those instructions For information about how to use Illumina LIMS see the Ilumina LIMS User Guide Part 15045738 Rev A Infinium HTS Automated Workflow The following figure graphically represents the Infinium HTS assay automated workflow for 4 BeadChips These protocols describe the procedure for preparing 96 DNA samples Figure 67 Illumi
94. ed installation in which case the warranty period begins on the date of installation or 30 days after the date it was delivered whichever occurs first Base Hardware Warranty Upgraded Components means Illumina provided components modifications or enhancements to Hardware that was previously acquired by Purchaser Illumina warrants that Upgraded Components will conform to their Specifications for a period of 90 days from the date the Upgraded Components are installed Upgraded Components do not extend the warranty for the Hardware unless the upgrade was conducted by Illumina at Illumina s facilities in which case the upgraded Hardware shipped to Purchaser comes with a Base Hardware Warranty c Exclusions from Warranty Coverage The foregoing warranties do not apply to the extent a non conformance is due to i abuse misuse neglect negligence accident improper storage or use contrary to the Documentation or Specifications ii improper handling installation maintenance or repair other than if performed by Illumina s personnel iii unauthorized alterations iv Force Majeure events or v use with a third party s good not provided by Illumina unless the Product s Documentation or Specifications expressly state such third party s good is for use with the Product d Procedure for Warranty Coverage In order to be eligible for repair or replacement under this warranty Purchaser must i promptly contact Illumina s support department to rep
95. eed with hybridization complete the following steps instead a Click the Reports tab in the upper right corner b In the left sidebar click Tracking Get Queue Status c Scan the plate barcode and click Go d If the plate is queued for another step proceed with that step 5 If one of the BeadChips is not accessioned into the system accession it and then repeat the verification step 6 If one of the BeadChips is not the right type for this batch accession one that is the right type and repeat the verification step 7 When the verification is successful proceed to Load BeadChips Load BeadChips 1 Remove all BeadChips from their plastic bags and mylar packages CAUTION Hold the BeadChip by the ends with your thumb and forefinger thumb at the barcode end Do not hold the BeadChip by the sides near the sample inlets Avoid contacting the beadstripe area and sample inlets 2 Place BeadChips into the Robot BeadChip alignment fixtures with the barcode end aligned to the ridges on the fixture 1 5 O Part 15045738 Rev A 3 4 5 Figure 100 Placing BeadChips in Robot BeadChip Alignment Fixture Stack the Robot BeadChip alignment fixtures and carry them to the robot Figure 101 Stacked Robot BeadChip Alignment Fixtures 9374160039 24x1 GR TT Choose the appropriate BeadChip from the BeadChip Selection dialog box Other than Illumina LIMS In the Basic Run Parameters pane change the value for Number of MSA3 plat
96. embly Slip scissors up over the barcode to trim the other end Illumina Infinium HTS Assay Protocol Guide 1 71 dwy Sod diyopeeg yseM Automated Protocol 172 Figure 119 Trimming Spacer Ends from Flow Through Chamber Assembly A A Trim Spacer at Non Barcode End of Flow Through Chamber B Trim Spacer at Barcode End of Flow Through Chamber 9 Immediately wash the Hyb Chamber reservoirs with DiH O and scrub them with a small cleaning brush ensuring that no PB2 remains in the Hyb Chamber reservoir Yy CAUTION It is important to wash the Hybridization Chamber reservoirs immediately and thoroughly to ensure that no traces of PB2 remain in the wells 10 Discard unused reagents in accordance with facility standards 11 Proceed to Extend and Stain X Stain BeadChip Post Amp Y CAUTION Place all assembled flow through chambers on the lab bench in a horizontal position while you perform the preparation steps for the XStain BeadChip Do not place the flow through chambers in the chamber rack until the preparation is complete Part 15045738 Rev A Extend and Stain XStain BeadChip Post Amp In this process you use RA1 reagent to wash away unhybridized and non specifically hybridized DNA sample LX1 and LX2 are added to condition the BeadChip surface for the extension reaction Dispense EML reagent into the flow through chambers to extend the primers hybridized to DNA on the BeadChip This reaction incorporates l
97. emoving the BeadChips 5 Oneata time disassemble each flow through chamber a Use the dismantling tool to remove the two metal clamps N CAUTION It is important to use the dismantling tool to avoid chipping the glass back plates Illumina Infinium HTS Assay Protocol Guide 1 87 duy js0d diyopeag ule sx ule S pue pua xa Automated Protocol 188 Figure 127 Removing the Metal Clamps from Flow Through Chamber b Remove the glass back plate c Set the glass back plate aside When you finish the XStain BeadChip protocol clean the glass back plates as described in the Infinium Lab Setup and Procedures Guide d Remove the spacer To avoid damaging the stripes on the BeadChip pull the spacer out so that the long sides slide along the sides of the BeadChip e Remove the BeadChip q y CAUTION Do not touch the face of the BeadChips Handle them by the barcode end or by the edges Place the BeadChips in the staining rack while it is submerged in PB1 Put four BeadChips above the staining rack handle and four below Make sure that the BeadChip barcodes face away from you and that the locking arms on the handle face towards you If necessary briefly lift the staining rack out of the wash dish to seat the BeadChip Replace it immediately after inserting each BeadChip Make sure that the BeadChips are completely submerged CAUTION Do not allow the BeadChips to dry Submerge each BeadChip in the wash dish as soon as possible
98. ent the cap mat so that A1 on the cap matches A1 on the plate To prevent evaporation and spills which could lead to assay variability and cross contamination make sure that all 96 caps are securely seated in the wells Vortex the plate at 1600 rpm for 1 minute Centrifuge the plate to 50 x g at 22 C for 1 minute Place the sealed plate on the 37 C heat block for 1 hour Record the start and stop times on the lab tracking form Discard unused reagents in accordance with facility standards 10 Do one of the following Continue to the next step Precipitate the DNA Post Amp Leave plate in 37 C heat block until setup is complete Do not leave the plate in the 37 C heat block for longer than 2 hours If you do not plan to proceed to the next step immediately store the sealed WG DNA plate at 15 C to 25 C SAFE STOPPING POINT Now is a good stopping point in the process Part 15045738 Rev A Precipitate DNA Post Amp Add PM1 and 2 propanol to the MSA3 plate to precipitate the DNA samples Figure 20 Precipitating DNA BETAU Estimated Time Hands on time 30 minutes for 96 samples Incubation and dry time 2 hours Consumables Item Quantity Storage Supplied By PM1 1 tube per 96 samples 2 C to 8 C Ilumina 100 2 propanol 30 ml per 96 samples Room General lab temperature supplier q CAUTION y Pour only the recommended reagent volume needed for the suggested number of samples listed in the Consuma
99. er the overnight incubation Resuspend XC4 Reagent for XStain BeadChip 158 Keep the XC4 in the bottle in which it was shipped until you are ready to use it In preparation for the XStain protocol follow these steps to resuspend the XC4 reagent 1 Add 330 ml 100 EtOH to the XC4 bottle The final volume will be 350 ml Each XC4 bottle has enough solution to process up to 24 BeadChips 2 Shake vigorously for 15 seconds 3 Leave the bottle upright on the lab bench overnight NOTE a If the XC4 was not left to resuspend overnight you can still proceed with the assay Add the EtOH and put the XC4 on its side on a rocker to resuspend Leave it there until the BeadChips are ready for coating 4 Shake the XC4 bottle vigorously to ensure complete resuspension If any coating is visible vortex at 1625 rpm until it is in complete suspension After it is resuspended use XC4 at room temperature Part 15045738 Rev A Wash the Robot Tip Alignment Guide For optimal performance wash and dry the Robot Tip Alignment Guides after every run 1 Soak the tip guide inserts in a 1 aqueous Alconox solution one part Alconox to 99 parts water using a 400 ml Pyrex beaker for 5 minutes amp NOTE Do not use bleach or ethanol to clean the tip guide inserts 2 After the 5 minute soak in the 1 Alconox solution thoroughly rinse the tip guides with DiH O at least three times to remove any residual detergent 3 Dry the Robot Tip Alignment Guide usi
100. es and Number of DNA samples per plate to indicate the number of samples being processed Y NOTE If you are using Illumina LIMS you cannot change the number of DNA samples on this screen However the LIMS software processes the correct number of samples The robot PC updates the Required Run Items and the bed map to show the correct position of items on the robot bed All barcodes must face to the right Illumina Infinium HTS Assay Protocol Guide 1 D 1 duuy js0d diyopeag 0 8ZIPLIqAH Automated Protocol 6 Place the Robot BeadChip Alignment Fixtures onto the robot bed according to the bed map 7 On the lab tracking form record the plate position on the robot bed BeadChip serial numbers and BeadChip positions 8 Pulse centrifuge the MSA3 plate to 280 x g 9 Place the MSAS plate onto the robot bed according to the bed map Remove the foil seal Start the Robot 1 Other than Ilumina LIMS At the robot PC click Run 2 Ilumina LIMS At the robot PC a Make sure the Use Barcodes check box is checked b Click Run to start the process Log in if prompted The robot scans the barcodes on the BeadChips to confirm the correct BeadChips are loaded Once the correct BeadChips are confirmed the robot pauses 3 At the robot PC click OK to confirm you have placed the Robot Tip Alignment Guide on top of the Robot BeadChip alignment fixture The robot scans the barcode on the Robot Tip Alignment Guide to confirm the correct tip guide
101. for 1 minute Repeat twice Wait 5 minutes 3 Immediately remove the flow through chambers from the chamber rack and place horizontally on a lab bench at room temperature Wash and Coat 8 BeadChips Before starting the Wash and Coat process read these important notes Take the utmost care to minimize the chance of lint or dust entering the wash dishes which could transfer to the BeadChips Place wash dish covers on wash dishes when 82 Part 15045738 Rev A stored or not in use Clean wash dishes with low pressure air to remove particulates before use In preparation for XC4 BeadChip coating wash the tube racks and wash dishes thoroughly before and after use Rinse with DI water Immediately following wash place racks and wash dishes upside down on a wash rack to dry Place Kimwipes in three layers on the lab bench Place a tube rack on top of these Kimwipe layers Do not place on absorbent lab pads You will place the staining rack containing BeadChips on this tube rack after removing it from the XC4 wash dish Prepare an additional clean tube rack that fits the internal dimensions of vacuum desiccator for removal of the BeadChips Allow one rack per 8 BeadChips No Kimwipes are required under this tube rack Equipment Needed Place the following items on the bench 1 staining rack 1 vacuum desiccator 1 tube rack Self locking tweezers Large Kimwipes Vacuum hose Steps 1 Set up two top loading wash dishes labeled PB1 and
102. g Spacer Ends from Flow Through Chamber Assembly dwiy sod diyopeeg yseM A Trim Spacer at Non Barcode End of Flow Through Chamber B Trim Spacer at Barcode End of Flow Through Chamber 9 Immediately wash the Hyb Chamber reservoirs with DiH O and scrub them with a small cleaning brush ensuring that no PB2 remains in the Hyb Chamber reservoir q CAUTION It is important to wash the Hybridization Chamber reservoirs immediately and thoroughly to make sure that no traces of PB2 remain in the wells 10 Discard unused reagents in accordance with facility standards 11 Proceed to the next step h CAUTION Place all assembled flow through chambers on the lab bench in a horizontal position while you perform the preparation steps for XStain BeadChip Do not place the flow through chambers in the chamber rack until all necessary steps are completed Illumina Infinium HTS Assay Protocol Guide F4 3 Manual Protocol Extend and Stain XStain BeadChip Post Amp In this process you use RA1 reagent to wash away unhybridized and non specifically hybridized DNA sample LX1 and LX2 are added to condition the BeadChip surface for the extension reaction Dispense EML reagent into the flow through chambers to extend the primers hybridized to DNA on the BeadChip This reaction incorporates labeled nucleotides into the extended primers 95 formamide 1 mM EDTA is added to remove the hybridized DNA After neutralization using the XC3 reagent the labeled e
103. gure 77 Make MSA3 Screen obot Washes Robot Control Procedure Control Sys Wash Flush W Flush L Wash S Sys Init Init LiHa Tips Up E cso CI DNA Quant Infinium Robot Task a CJ AMP2 Tasks CJ AMP3 Tasks a amp MSAI Tasks Required Run hem s Basic Run Parameters a MSA2 Tasks Amt Parameter 1 1 1 MSA3 Tasks Run tems Number of MAIMAZ MSM tube s Number of DNA samples Number of DINAMSA3 plate s Number of Na OH trough s O Use Bags pem Main 0009309020920099 090020020020090 090030020020020 Make MSA3 System Initialized Genesis1 5 Remove caps from MA1 MA2 and MSM tubes then place the tubes in the robot standoff tube rack according to the bed map 6 Add 15 ml 0 1 N NaOH to the quarter reservoir then place the reservoir on the robot bed according to the bed map 7 Place the WG DNA and MSA3 plates on the robot bed according to the bed map 8 In the Lab Tracking Form record the plate positions on the robot bed 9 Make sure that all items are placed properly on the robot bed that all caps and seals have been removed and that all the barcodes face to the right 10 Other than Ilumina LIMS At the robot PC click Run Illumina Infinium HTS Assay Protocol Guide 1 1 T dwy 1d YNG dwy Automated Protocol 11 lumina LIMS At the robot PC a Make sure that the Use Barcodes checkbox is cleared b Click Run to start the process Log in if prompted
104. he top left clamp then the bottom right then the top right followed by the bottom left wW NOTE i Keep the Hyb Chamber steady and level when moving it or transferring it to the Illumina Hybridization Oven Place the Hyb Chamber in the 48 C Illumina Hybridization Oven so that the clamps of the Hyb Chamber face the left and right side of the oven and the Illumina logo on top of the Hyb Chamber is facing you Illumina Infinium HTS Assay Protocol Guide 1 D D duuy js0d diyopeag 0 8ZIPLIqAH Automated Protocol 156 Figure 106 Hyb Chamber Correctly Placed in Hyb Oven NOTE If you are stacking multiple Hyb Chambers in the Illumina Hybridization Oven make sure the feet of the top Hyb Chamber fit into the matching indents on top of the bottom Hyb Chamber This will hold the Hyb Chambers in place while they are rocking You can stack up to 3 Hyb Chambers per row for a maximum of 6 Hyb Chambers total in the Ilumina Hybridization Oven Part 15045738 Rev A Figure 107 Two Hyb Chambers Correctly Placed in Hyb Oven Figure 108 Incorrectly Placed Hyb Chamber 12 Optional Start the rocker setting the speed to 5 Illumina Infinium HTS Assay Protocol Guide tor duuy js0d diyopeag 0 8ZIPLIqAH Automated Protocol OVERNIGHT INCUBATION hi J Incubate at 48 C for at least 16 hours but no more than 24 hours 13 Record the start and stop times on the lab tracking form 14 Proceed to Wash BeadChip Post Amp aft
105. hts license and any other permissions provided to Purchaser with respect this Product and refund to Purchaser the depreciated value as shown in Purchaser s official records of the returned Product at the time of such return provided that no refund will be given for used up or expired Consumables This Section states the entire liability of Illumina for any infringement of third party intellectual property rights Exclusions to Illumina Indemnification Obligations Illumina has no obligation to defend indemnify or hold harmless Purchaser for any Illumina Infringement Claim to the extent such infringement arises from i the use of this Product in any manner or for any purpose outside the scope of research use purposes ii the use of this Product in any manner not in accordance with its Specifications its Documentation the rights expressly granted to Purchaser hereunder or any breach by Purchaser of these terms and conditions iii the use of this Product in combination with any other products materials or services not supplied by Illumina iv the use of this Product to perform any assay or other process not supplied by Illumina or v Illumina s compliance with specifications or instructions for this Product furnished by or on behalf of Purchaser each of i v is referred to as an Excluded Claim Indemnification by Purchaser Purchaser shall defend indemnify and hold harmless Illumina its affiliates their non affiliate collabor
106. illumina Infinium HTS Assay Protocol Guide rrer enre rse ees eee SA E BUST ee e e a e E Ula pe AMEN AUTEM i a SKE IG e ntar I ap IN SOPA RAE UG Ap NG ATGATAACAGTAACACACTTCTGTI AA TA GT SOLO PACTGNTIG AGO TAG CGTATCAAT TGAGACTAAATAT TAACGTACCAT TAAGAGCTACCGTCTTCTGTTAACCTTAAGATTACTTGATCCACTGATTCAACGTACCGTAA IT CCACTGAT TCAACGTACCAA GATIACTIGATCCACT GATT CAACUTACUGTAACGAACGTA TCAATTGAGACT NUNAN ACCAT TAAGAGCTACCGTCTTCTGTT KAGUTIAA CATIASTIGATCOACIGATICAAUGT ACC TA ARCGAA C AD NAAN eaer a y e NG e a e ar a aaepe Na aA A ay p ae es E p a eee aE eee AT RR ANE ACTTCTG AAGATTIACTTGATCCACTGATTCAACGTACCGTAACGAACGT PANS ACTAAATATTAACGTACC Aer ACCGTCTTCT egg es GATTACTTGATCCACTGATTCAACGTA TTGAGACTAAATATTAACGTT GT Ty TIAAGCTIAA GATTACTTGATCCACTGATTCAACGT ACCGTAACGAACGIA TCAATTGAGAC TAAATATTAACGL ACCATTAAGAGCTTCTGT TAACCT TAAGATTACTT GATCCACTGAT TCAACGTACCGTAAC EGTATCAATTGAGAGTAAATATAACGTACLIAACG TAAGATTAGT GAT CCAGT GAT GAAGGIACCG IAACGAAGGICTICTG TAAUGT IAAGAT ACT GATCOAGTGAT TCAACGTACOGTAAGGAACGTATCAATT GAGAGTAACGACGAAA GAGACTAAATAT TAACGTACCAT TAAGAGCTACAACCT TAAGAT TACTTGATCCACTGATTCAA BO hear ALON ee TAA BAGAY AAATAT TAACGTACCATTAAGAGC TACCGTGCAACGACGAAAAGAAT GAT PAGASIPACACAKI JAT GATAACAGTAACACACTTCTGT TAACCT TAAGATTACT TGATCCACTGATTCAACGTACCGTAACGAACGTATCAATTGAGACTAAATATTAACGTACCATTAAGAGC CA CCGTCTTCTGTTAACCTTAAGAT TACT TGATCCACTGAT TCAACGTA GTACCATTAAGAGC TACCGTGCAACTTAACCTTAAGAT TAC UGE ENG STE SU GS pp E IL ON AA ANNE LE Sa LC an Sy PLR ARSE
107. in to touch during either PB1 or XC4 washes gently move the staining rack back and forth to separate the slides It is important for the solution to circulate freely between all BeadChips Allow the BeadChips to soak for an additional 5 minutes y CAUTION y Use XC4 only one time To process subsequent BeadChips use a new clean wash dish with fresh XC4 Prepare one additional tube rack per 8 BeadChips Illumina provided from VWR catalog 60916 748 that fits the internal dimensions of vacuum desiccator Remove the staining rack in one smooth rapid motion and place it directly on the prepared tube rack making sure the barcodes face up and the locking arms and tabs face down Part 15045738 Rev A Figure 130 Staining Rack in Correct Orientation 3 Aa J PETO a N N To ensure uniform coating place the staining rack on the center of the tube rack avoiding the raised edges Figure 131 Moving the Staining Rack from XC4 to Tube Rack gt Ea ee a 17 For each of the top four BeadChips working top to bottom Illumina Infinium HTS Assay Protocol Guide 1 0 duy js0d diyopeag ule sx ule S pue pua Xa Automated Protocol a Continuing to hold the staining rack handle carefully grip each BeadChip at its barcode end with self locking tweezers NOTE A The XC4 coat is slippery and makes the BeadChips difficult to hold The self locking tweezers grip the BeadChip firmly and help prevent damage b
108. ina Infinium HTS Assay Protocol Guide 81 duuy js0d diyopeag ule sx ule S pue pua xa Manual Protocol f 5 h Incubate 5 minutes Begin ramping the chamber rack temperature to the temperature indicated on the SML tube 250 ul XC3 Incubate for 1 minute Repeat twice 6 Wait until the chamber rack reaches the correct temperature Stain BeadChip d NOTE If you are processing more than 8 BeadChips complete the reagent dispensing step for each reagent for the first set of 8 BeadChips Then continue the same reagent dispensing steps for the second set of 8 BeadChips Finally move to the last set of 8 BeadChips before you start the incubation time Steps marked with an asterisk indicate when to follow this reagent dispensing method 1 If you plan to image the BeadChip immediately after the staining process turn on the scanner now to allow the lasers to stabilize 2 Into the reservoir of each flow through chamber dispense stra HO Ao T DN m j 250 ul SML Incubate for 10 minutes 250 ul XC3 Incubate for 1 minute Repeat twice Wait 5 minutes 250 ul ATM Incubate for 10 minutes 250 ul XC3 Incubate for 1 minute Repeat twice Wait 5 minutes 250 ul SML Incubate for 10 minutes 250 ul XC3 Incubate for 1 minute Repeat twice Wait 5 minutes 250 ul ATM Incubate for 10 minutes 250 ul XC3 Incubate for 1 minute Repeat twice Wait 5 minutes 250 ul SML Incubate for 10 minutes 250 ul XC3 Incubate
109. inally move to the last set of 8 BeadChips before you start the incubation time Steps marked with an asterisk indicate when to follow this reagent dispensing method When the chamber rack reaches 44 C quickly place each flow through chamber assembly into the chamber rack For 4 BeadChips place the flow through chambers in every other position starting at 1 in the first row of the chamber rack For larger numbers of BeadChips fill all positions in the first row then the second and third Part 15045738 Rev A 2 Make sure that each flow through chamber is properly seated on its rack to allow adequate heat exchange between the rack and the chamber 3 On the lab tracking form record the chamber rack position for each BeadChip 4 Shake the XC4 bottle vigorously to ensure complete resuspension If necessary vortex until completely dissolved N CAUTION Do not allow pipette tips to contact BeadChip surface Touch off in the reservoir of the glass back plate 5 Into the reservoir of each flow through chamber dispense a 150 ul RA1 Incubate for 30 seconds Repeat 5 times Figure 56 Dispensing RA1 into Each Flow Through Chamber x CAUTION Pipette tip must not contact BeadChip surface 225 ul LX1 Repeat one time Incubate for 10 minutes 225 ul LX2 Repeat one time Incubate for 10 minutes 300 ul EML Incubate for 15 minutes 250 ul 95 formamide 1 mM EDTA Incubate for 1 minute Repeat twice cand Illum
110. ing rack back and forth to separate the slides It is important for the solution to circulate freely between all BeadChips Figure 60 Washing BeadChips in PB1 Allow the BeadChips to soak for an additional 5 minutes CAUTION y Do not leave the BeadChips in the PB1 for more than 30 minutes Shake the XC4 bottle vigorously to ensure complete resuspension If necessary vortex until completely dissolved Pour 310 ml XC4 into the dish labeled XC4 and cover the dish to prevent any lint or dust from falling into the solution x CAUTION y Do not let the XC4 sit for longer than 10 minutes Remove the staining rack from the PB1 dish and place it directly into the wash dish containing XC4 For proper handling and coating The barcode labels on the BeadChips must face away from you the locking arms on the handle must face towards you Illumina Infinium HTS Assay Protocol Guide 87 dwy SO0d diyopeag ule sx uie s pue pua xa Manual Protocol Figure 61 Moving BeadChips from PB1 to XC4 l a NG dia Si 13 Slowly move the staining rack up and down 10 times breaking the surface of the reagent NOTE 4 If the top edges of the BeadChips begin to touch during either PB1 or XC4 washes gently move the staining rack back and forth to separate the slides It is important for the solution to circulate freely between all BeadChips 14 Allow the BeadChips to soak for an additional 5 minutes y CAUTION y Use XC4 only
111. inute Centrifuge to 50 x g for 1 minute at 22 C Place the sealed plate on the 37 C heat block for 1 hour On the lab tracking form record the start and stop times Discard unused reagents in accordance with facility standards 10 Do one of the following Proceed to Precipitate the MSA3 Plate Leave plate in 37 C heat block until you have completed the preparatory steps Do not leave the plate in the 37 C heat block for longer than 2 hours If you do not plan to proceed to the next step immediately store the sealed MSA3 plate at 15 C to 25 C SAFE STOPPING POINT Now is a good stopping point in the process Illumina Infinium HTS Assay Protocol Guide 1 2 F duy s0d YNG yuwe Automated Protocol Precipitate DNA Post Amp PM1 and 2 propanol are added to the MSA3 plate to precipitate the DNA samples Figure 84 Precipitating DNA BOB Ge 00 99 pap ATT SER 88 B08 n8 IS A Estimated Time Robot time 10 minutes for 48 samples 20 minutes for 96 samples Incubation and dry time 2 hours Consumables Item Quantity Storage Supplied By PM1 1 tube per 2 C to 8 C Ilumina 96 samples 100 2 propanol 32 ml per Room General lab 96 samples temperature supplier J NOTE Thaw all reagents completely at room temperature and allow to equilibrate After thawed gently invert each tube several times to mix the reagent thoroughly Pulse centrifuge each tube to 280 x g to eliminate bubbles and collect reagent at the bot
112. ion Control File LIMSLog MCACmds Help Robot Washes Robot Control p Procedure Control Sys Wash Flush W Flush L Wash S Sys Init Init LiHa Tips Up RB csc Ilumina Automation Control Robot Task Required Run Item s Basic Run Parameters Run Items Parameter Number of GSMWGHDNAVQNT QDNA Plat Number of DNA QNT QDNA platels Number of SDNA SONT Plate 5 Total samples in DNA Number of FicoGreen Trough s DB Access O Use Barcodes 123 45 6 T1 BF 1D 11 12 13 10 15 16 17 18 19 20 2f 22 23 26 25 26 2 25 29 2G 3 X2 IN IS I5 I7 IG 9 MO Of 42 sus A PicoGreen si ystem Initialized Vortex the GS DNA Sample plate at 1450 rpm for 1 minute Centrifuge the GS DNA Sample plate to 280 x g for 1 minute Vortex the Standard DNA plate at 1450 rpm for 1 minute Centrifuge the Standard DNA plate to 280 x g for 1 minute Place the GS DNA Sample Standard DNA Standard QDNA and QDNA Sample plates on the robot bed according to the robot bed map Place well A1 at the top left comer of its robot bed carrier Remove any plate seals Pour the PicoGreen dilution into half reservoir A and place it on the robot bed Part 15045738 Rev A 10 11 12 13 14 15 16 17 18 19 Make sure that all items are placed properly on the robot bed that all seals have been removed and that all the barcodes face to the right On the lab tracking form record the position of the plates on the robot bed Clear the Use Barcode
113. l Prepar ation 1 Remove each Hyb Chamber from the Illumina Hybridization Oven Let cool on the benchtop for 30 minutes before opening 2 Have ready on the lab bench a b c d Two wash dishes Containing 200 ml PB1 and labeled as such Multi Sample BeadChip Alignment Fixture Using a graduated cylinder fill with 150 ml PB1 Black frames LCG spacers separated for ease of handling Clean LCG glass back plates as directed in the Infinium Lab Setup and Procedures Guide Clamps 3 On the lab tracking form record Date Time Operator PB1 bottle barcode NOTE To record information about your assay such as operator information start and stop times and barcodes use the lab tracking form provided at www illumina com documentation This form can be filled out and saved online or printed and filled in by hand Steps to Wash BeadChip 1 Attach the wire handle to the rack and submerge the wash rack in the wash dish Con 64 taining 200 ml PB1 Part 15045738 Rev A Figure 42 Wash Rack in Wash Dish Containing PB1 2 Remove the Hyb Chamber inserts from the Hyb Chambers 3 Remove BeadChips from the Hyb Chamber inserts one at a time 4 Remove the cover seal from each BeadChip NOTE To make sure that no solution splatters on you Illumina recommends removing the cover seal over an absorbent cloth or paper towels preferably in a hood a Using powder free gloved hands hold the BeadChip securely and by
114. l Guide 1 tf duuy js0d diyopeag ule sx ule S pue pua xa Automated Protocol Figure 122 Water Circulator Connected to Chamber Rack A Chamber Rack B Water Circulator with Programmable Temperature Controls C Reservoir Cover 3 The temperature displayed on the water circulator LCD screen may differ from the actual temperature on the chamber rack Confirm the actual temperature using the temperature probe for the chamber rack 4 Make sure that you remove bubbles trapped in the chamber rack each time you run this process Follow instructions in the Te Flow Tecan Flow Through Module Operating Manual Tecan Doc ID 391584 5 Use the Illumina Temperature Probe in several locations to make sure that the chamber rack is at 44 C Make sure that all locations are at 44 C 0 5 C 1 T 8 Part 15045738 Rev A NOTE Do not leave the temperature probe in the first three rows of the chamber rack Reserve this space for BeadChips Figure 123 Illumina Temperature Probe and Temperature Probe in Chamber Rack 6 For accurate temperature measurement ensure the Illumina Temperature Probe is touching the base of the chamber rack duuy js0d diyopeag ule sx ule S pue pua xa Illumina Infinium HTS Assay Protocol Guide 1 F Q Automated Protocol Prepare Robot For instructions on preparing the robot for use in a protocol see the Infinium Assay Lab Setup and Procedures Guide Refer to the figure shown below throughout this
115. laboratory technicians running the Infinium HTS assay The guide documents the laboratory protocols associated with the assay Follow all of the protocols in the order shown Chapter 2 Manual Protocol explains how to run the assay manually in the lab Chapter 3 Automated Protocol explains how to automate the protocol with the aid of the Tecan eight tip robot Important Note Before following any of the procedures in this guide read the Infinium Lab Setup and Procedures Guide which explains how to equip and run an Infinium HTS assay laboratory The guide includes important information on the following topics Prevention of amplification product contamination Safety precautions Equipment materials and reagents Standard lab procedures Robot use BeadChip imaging System maintenance GenomeStudio controls Troubleshooting The instructions apply equally to all Infinium BeadChips provided by Illumina All of the Infinitum HTS documentation assumes that you have already set up the laboratory space and are familiar with the standard procedures and safety precautions Illumina Infinium HTS Assay Protocol Guide 3 sod Ng pue sousipny Infinium HTS assay This section describes and illustrates the assay protocol The assay requires 200 ng of original DNA sample as input Overview Amplify DNA Pre Amp The DNA samples are denatured and neutralized to prepare them for amplification Figure 1 Denaturing and Neutralizing DNA XIM
116. lear Plastic Spacer onto BeadChip p z Part 15045738 Rev A 5 Place the alignment bar onto the alignment fixture The groove in the alignment bar fits over the tab on the alignment fixture Figure 116 Placing Alignment Bar onto Alignment Fixture dwiy jsod diyopeeg yseM 6 Place a clean LCG glass back plate on top of the clear spacer covering each BeadChip The plate reservoir is at the barcode end of the BeadChip facing inward to create a reservoir against the BeadChip surface Illumina Infinium HTS Assay Protocol Guide 1 6 Q Automated Protocol Figure 117 Placing Glass Back Plate onto BeadChip A Reservoir at Barcode End of Glass Back Plate B Glass Back Plate in Position 7 Attach the metal clamps to the flow through chambers as follows a Gently push the glass back plate up against the alignment bar with one finger b Place the first metal clamp around the flow through chamber so that the clamp is approximately 5 mm from the top edge c Place the second metal clamp around the flow through chamber at the barcode end approximately 5 mm from the reagent reservoir 1 F O Part 15045738 Rev A Figure 118 Securing Flow Through Chamber Assembly with Metal Clamps A One Stripe Shows Between First Clamp and Alignment Bar B Glass Back Plate Pressed Against Alignment Bar C No Stripes Show Between Second Clamp and Barcode 8 Using scissors trim the ends of the clear plastic spacers from the flow through chamber ass
117. llumina Infinium HTS Assay Protocol Guide 8 D duy js0d diyopeag ule sx ule S pue pua xa Manual Protocol 86 Figure 59 Removing the Metal Clamps from Flow Through Chamber b Remove the glass back plate c Set the glass back plate aside When you finish the XStain BeadChip protocol clean the glass back plates as described in the Infinium Lab Setup and Procedures Guide d Remove the spacer To avoid damaging the stripes on the BeadChip pull the spacer out so that the long sides slide along the sides of the BeadChip e Remove the BeadChip x CAUTION y Do not touch the face of the BeadChips Handle them by the barcode end or by the edges Place the BeadChips in the staining rack while it is submerged in PB1 Put four BeadChips above the staining rack handle and four below Make sure that the BeadChip barcodes face away from you and that the locking arms on the handle face towards you If necessary briefly lift the staining rack out of the wash dish to seat the BeadChip Replace it immediately after inserting each BeadChip Make sure that the BeadChips are completely submerged CAUTION Do not allow the BeadChips to dry Submerge each BeadChip in the wash dish as soon as possible Slowly move the staining rack up and down 10 times breaking the surface of the reagent Part 15045738 Rev A 10 11 12 NOTE t If the top edges of the BeadChips begin to touch during either PB1 or XC4 washes gently move the stain
118. luted PicoGreen 1 2 28 Pour the PicoGreen 1X TE dilution into a clean reagent reservoir Using a multichannel pipette transfer 195 ul PicoGreen 1X TE dilution into each well of columns 1 and 2 of the FLUOTRAC plate labeled Standard QDNA Add 2 ul of each stock Lambda DNA dilution from the Standard DNA plate to columns 1 and 2 of the Standard QDNA FLUOTRAC plate Part 15045738 Rev A Figure 14 Standard QDNA Plate with PicoGreen Standard QDNA Plate with PicoGreen 195 ul Picogreen 1X TE Dilution 2 ul Lambda DNA Serial Dilutions 4 Immediately cover the plate with an adhesive aluminum seal Prepare QDNA Sample Plate with PicoGreen and DNA In this process you create a new Sample QDNA plate that contains DNA sample and PicoGreen duy a1d euondo YNG a1eihueno 1 Using a multichannel pipette transfer 195 ul PicoGreen 1xTE dilution into each well of the FLUOTRAC plate labeled Sample QNT for each well that will contain sample 2 Add2 ul of DNA sample to each well containing PicoGreen 1xTE Illumina Infinium HTS Assay Protocol Guide J Q Manual Protocol 3 Figure 15 Sample QDNA Plate with PicoGreen Sample QDNA Plate with PicoGreen OOo PRR RR Re NY YN NN SSOCOO OOO SOOOOOCSSOO6 C 195 ul PicoGreen 1X TE Dilution 2 ul Sample DNA Immediately cover the plate with an adhesive aluminum seal Read QDNA Plate In this process you use the Gemini XS or XPS spectrofluorometer to re
119. ly must fit internal dimensions of vacuum desiccator Vacuum source greater than 508 mm Hg 0 68 bar Vacuum gauge for vacuum desiccator recommended Illumina Infinium HTS Assay Protocol Guide 1 01 sjuabeay pue sjeue ze juswdinba Automated Protocol 102 Illumina Supplied Materials MSA3 barcode labels WG ONT barcode labels Illumina Supplied Reagents Table 12 Illumina Supplied Reagents Infinium HTS Assay Automated Protocol Item ATM Anti Stain Two Color Master Mix FMS Fragmentation solution MA1 Multi Sample Amplification 1 Mix MA2 Multi Sample Amplification 2 Mix MSM Multi Sample Amplification Master Mix PB1 Reagent used to prepare BeadChips for hybridization PB2 Humidifying buffer used during hybridization PM1 Precipitation solution RA1 Resuspension hybridization and wash solution SML Superior Two Color Master Mix EML Two Color Extension Master Mix LX1 XStain BeadChip solution 1 LX2 XStain BeadChip solution 2 XC3 XStain BeadChip solution 3 XC4 XStain BeadChip solution 4 Part 11208317 11203428 11202880 11203401 11203410 11291245 11191130 11292436 11292441 11288046 11208309 11208288 11208296 11208392 11208430 Part 15045738 Rev A Quantitate DNA Optional Pre Amp This process uses the PicoGreen dsDNA quantitation reagent to quantitate double stranded DNA samples You can quantitate up to three plates each containing
120. mbers Part 15045738 Rev A Figure 98 Dispensing PB2 into Hyb Chamber Reservoir y WARNING Do not replace PB2 in the Hyb Chamber with RA1 RA1 decreases the stringency and can negatively affect sample call rates and logRdev PB2 is formulated to produce the appropriate amount of humidity within the Hyb Chamber environment to prevent sample from evaporating during hybridization c After you fill the Hyb Chamber reservoirs with PB2 place the lid on the Hyb Chamber right away to prevent evaporation It is not necessary to lock down the lid d Leave the closed Hyb Chambers on the bench at room temperature until the BeadChips are loaded with DNA sample Load BeadChips into the Hyb Chamber within one hour wW NOTE d You can also prepare the hyb chambers later during the 30 minute cool down 2 Place the hyb chamber inserts into the hyb chambers Illumina Infinium HTS Assay Protocol Guide 1 A7 duuy js0d diyopeag 0 8ZIPLIqAH Automated Protocol 148 Remove the BeadChips from 2 C to 8 C storage but do not unpackage lumina LIMS only In the Illumina LIMS left sidebar click Infinitum HTS Confirm BeadChips for Hyb Scan the barcode of the MSA3 plate and all the BeadChips you plan to hybridize with the plate Click Verify Place the resuspended MSA3 plate on the heat block to denature the samples at 95 C for 20 minutes After the 20 minute incubation remove the MSA3 plate from the heat block and place it on the
121. mp RA1 is added to the MSA3 plate to resuspend the precipitated DNA samples Figure 89 Resuspending DNA Estimated Time Robot time 15 minutes for 96 samples Incubation time 1 hour Consumables Item Quantity Storage Supplied By RA1 7 ml per 96 samples 15 C to 25 C Ilumina J NOTE Pour out only the recommended volume of RA1 needed for the suggested number of samples listed in the consumables table Additional RA1 is used later in the XStain BeadChip step x WARNING y This protocol uses an aliphatic amide that is a probable reproductive toxin Personal injury can occur through inhalation ingestion skin contact and eye contact For more information consult the material data safety sheet for this assay at www illumina com msds Dispose of containers and any unused contents in accordance with the governmental safety standards for your region 1 3 6 Part 15045738 Rev A Preparation 1 RAL is shipped frozen Gradually warm the reagent to room temperature preferably in a 20C to 25 C water bath Gently mix to dissolve any crystals that may be present 1 If you stored the MSAS3 plate at 15 C to 25 C thaw it to room temperature Remove the cap mat and discard it 2 Preheat the Illumina Hybridization Oven to 48 C 3 Preheat the heat sealer Allow 20 minutes On the lab tracking form record Date Time Operator Robot RAI bottle barcodes NOTE 4 To record information about your assay such as operator inform
122. mples The PicoGreen assay can quantitate small DNA volumes and measures DNA directly Other techniques can pick up contamination such as RNA and proteins Illumina recommends using a spectrofluorometer because fluorometry provides DNA specific quantification Spectrophotometry might also measure RNA and yield values that are too high Estimated Time Hands on time 20 minutes per plate plus 10 minutes to prepare the PicoGreen Spectrofluorometer read time 5 minutes per plate Consumables Item PicoGreen dsDNA quantitation reagent IDS Te Lambda DNA 96 well 0 65 ml microplate FLUOTRAC 200 96 well flat bottom plate 24 Quantity See Instructions See Instructions See Instructions 1 per 96 samples 1 per Standard DNA plate 1 per Sample DNA plate Storage 2 to 8 C Room temperature 2 to 8 C Supplied By User General lab supplier User General lab supplier General lab supplier Part 15045738 Rev A Preparation Thaw PicoGreen to room temperature for 60 minutes in a light impermeable container Hand label the microplate Standard DNA Hand label one of the FLUOTRAC plates Standard QDNA Hand label the other FLUOTRAC plate Sample QDNA This plate is for the quantitated DNA In the sample sheet enter the Sample_Name optional and Sample_Plate for each Sample_Well Make a Standard DNA Plate In this process you create a Standard DNA plate with serial dilutions of stock
123. mproves robustness and measurement precision The BeadChip manufacturing process includes hybridization based quality controls of each array feature allowing consistent production of high quality reproducible arrays Illumina Infinium HTS Assay Protocol Guide Q sdiy9peag Luniuljuy CUILUN Overview Ilumina Lab Protocols TO Ilumina lab protocols are designed to promote efficiency and minimize the risk of contamination The Infinium Lab Setup and Procedures Guide documents standard operating procedures and tools for an Infinium Assay lab and explains how to set up and maintain separate pre and post amplification areas Familiarize yourself with this guide before performing any Infinium assays Chapter2 Manual Protocol and Chapter 3 Automated Protocol show how to perform the assay protocol with clearly divided pre and post amplification processes using a manual and automated process respectively Part 15045738 Rev A Tracking Tools Ilumina provides the following tools for sample tracking and guidance in the lab Experienced User Cards to guide you through the protocols There are separate sets of cards for the manual and automated processes Lab Tracking Form to map DNA samples to BeadChips and record the barcode of each reagent and plate used in the protocol Sample sheet template to record information about your samples for later use in data analysis All of these documents are available for printing and reference at ww
124. mpt 19 Seal the plate with a cap mat 20 Vortex the sealed MSA3 plate at 1600 rpm for 1 minute 21 Centrifuge to 280 x g at 22 C for 1 minute 22 Remove the cap mat NOTE When you remove a cap mat set it aside upside down in a safe location for use later in the protocol When you place the cap mat back on the plate be sure to match it to its original plate and orient it correctly 23 Place the MSA3 plate back on the robot bed in its original position and then click OK The Wait for reaction time message appears The wait time for this reaction is 10 minutes The robot PC sounds an alert and opens a message when the process is complete 24 Click OK in the message box 25 Remove the MSA3 plate from the robot bed and seal with the 96 well cap mat Illumina Infinium HTS Assay Protocol Guide 1 1 Q dwy 1d YNG dwy Automated Protocol 120 26 27 28 29 30 Centrifuge to 280 x g for 1 minute lumina LIMS In the Illumina LIMS left pane click Infinium HTS Incubate MSA3 Scan the barcode of the MSA3 plate click Verify and then click Save Discard unused reagents in accordance with facility standards Proceed immediately to the next step Part 15045738 Rev A Incubate DNA Post Amp This process incubates the MSA3 plate for 20 24 hours at 37 C in the Illumina Hybridization Oven The process uniformly amplifies the genomic DNA generating a sufficient quantity of each individual DNA sample to be used
125. n the message box yet 4 Seal the MSA3 plate with the same cap mat removed earlier 5 Vortex the sealed plate at 1600 rpm for 1 minute 6 Incubate at 37 C for 5 minutes 7 Centrifuge to 50 x g at room temperature for 1 minute 4 NOTE Set centrifuge to 4 C in preparation for the next centrifuge step 8 Remove the cap mat and discard it 9 Place the MSA3 plate back on the robot bed according to the bed map 10 Click OK in the message box 132 The robot PC sounds an alert and opens a message when the process is complete Part 15045738 Rev A 11 Click OK in the message box Remove the MSA3 plate from the robot bed and carefully seal with a new dry cap mat taking care not to shake the plate in any way until the cap mat is fully seated 12 Invert the plate at least 10 times to mix contents thoroughly 13 Incubate at 4 C for 30 minutes 14 lumina LIMS In the Illumina LIMS left sidebar click Infinitum HTS Spin MSA3 At the robot PC click Run 15 Place the sealed MSA3 plate in the centrifuge opposite another plate of equal weight Figure 87 Sealed MSA3 Plate and Plate of Equal Balance in Centrifuge 16 Centrifuge to 3 000 x g at 4 C for 20 minutes Immediately remove the MSA3 plate from centrifuge N CAUTION Perform the next step immediately to avoid dislodging the blue pellet If any delay occurs repeat the 20 minute centrifugation before proceeding 17 Remove the cap mat and discard it Illumina Infinium HTS Ass
126. na Infinium HTS Automated Workflow Day 1 Day 2 Quantitate DNA Fragment DNA feast Robot 10 min 96 samples Hands on 20 min plate Incubation 1 hour Robot 20 min plate Reagents Reagents FMS Lambda DNA PicoGreen dsDNA AX TE Output Sample QDNA Plate with Quantitated DNA Precipitate DNA Robot 20 min 96 samples Incubation Dry Time 2hours Amp DNA Robot 1 hour 96 samples Reagents 2 propanol R PM1 eagents Output Resuspend DNA Incubate DNA Robot 15 min 96 samples Incubation 1 hour RAI Hyb to BeadChip Robot 25 min 4 BeadChips Hands on 16 min Incubation 16 24 hours Reagents PB2 Output BeadChip Illumina Infinium HTS Assay Protocol Guide Day 3 HiScan System Scan Time 50 min BeadChip iScan System Scan Time 1 hour BeadChip Output Image and Data Files 99 MO PJOM pa gwo ny SLH Wnluyu Automated Protocol Equipment Materials and Reagents These materials are specifically required for the automated Illumina Infinium HTS Assay Protocol Guide For a list of other equipment materials and reagents needed in an Illumina Infinitum HTS Assay Protocol Guide lab see the Infinium Assay Lab Setup and Procedures Guide User Supplied Equipment Table 9 User Supplied Equipment Infinium HTS Assay Automated Protocol Item Vacuum desiccator 1 per 8 BeadChips processed simultaneously Vacuum tubing 2 Tecan eight tip robots one for pre and one for post amplification proce
127. ng a Kimwipe or lint free paper towels Use a laboratory air gun to dry Be sure to inspect the tip guide channels including the top and bottom Tip guides should be completely dry and free of any residual contaminates before next use Illumina Infinium HTS Assay Protocol Guide 1 D Q duy js0d diyopeag 0 8zIpuqgAH Automated Protocol Wash BeadChip Post Amp Remove the cover seals from the BeadChips and wash the BeadChips in two separate PB1 reagent washes Then assemble the BeadChips into flow through chambers under the PB1 buffer Figure 109 Washing BeadChip alt om v Q Estimated Time 20 minutes for 4 BeadChips e 30 minutes for 8 BeadChips 160 Part 15045738 Rev A Consumables Item Quantity Storage Supplied By PB1 550 ml for 1 to 8 Room Ilumina BeadChips temperature 700 ml for 9 to 16 BeadChips 850 ml for 17 to 24 BeadChips Multi sample BeadChip 1 per 8 BeadChips Illumina alignment fixture Te Flow LCG flow through 1 per BeadChip Ilumina chambers with black frames LCG spacers LCG glass back plates and clamps Wash dish 2 up to 8 BeadChips Illumina Wash rack 1 up to 8 BeadChips Ilumina y CAUTION Pour only the recommended reagent volume needed for the suggested number of samples listed in the Consumables table of each section Some reagents are used later in the protocol N WARNING y This protocol uses an aliphatic amide that is a probable reproductive toxin Personal injury can occur th
128. ocol Guide 1 Q 3 Automated Protocol 194 23 24 25 26 27 To make sure that the desiccator is properly sealed gently lift the lid of the vacuum desiccator It should not lift off the desiccator base Figure 134 Testing Vacuum Seal Dry under vacuum for 50 55 minutes Drying times can vary according to room temperature and humidity Release the vacuum by turning the handle very slowly q WARNING y Make sure that air enters the desiccator very slowly to avoid disturbing the contents Improper use of the vacuum desiccator can result in damage to the BeadChips especially if you remove the valve plug while a vacuum is applied For detailed vacuum desiccator instructions see the documentation included with the desiccator Store the desiccator with the red valve plug in the three way valve of the desiccator to stop accumulation of dust and lint within the valve port Touch the borders of the chips do not touch the stripes to make sure that the etched barcoded side of the BeadChips are dry to the touch Part 15045738 Rev A 28 29 30 31 If the underside feels tacky manually clean the underside of the BeadChip to remove any excess XC4 The bottom two BeadChips are most likely to have some excess a Hold the BeadChip at a downward angle to prevent excess EtOH from dripping from the wipe onto the stripes b Wipe along the underside of the BeadChip five or six times until the surface is clean and smooth
129. ocol Guide D 3 duuy js0d diyopeag 0 8ZIPLIqAH Manual Protocol 54 Figure 32 Distributing Sample to the BeadChips with a Single Channel Pipette BCH BC 2 N2 Sz G qo m 3 amp R 2 g z 2 2 2 c1 D1 m K I I Q 8 z N z 1123456789 1123456789 Part 15045738 Rev A For the MultiChannel Pipette Using an adjustable spacer multichannel precision pipette dispense 14 ul of each DNA sample onto the appropriate BeadChip section Make sure that the pipette tip is in the sample inlet before dispensing Follow the color coded sections shown in the chart on the following page for sample loading assistance Load samples A1 A6 from the MSA3 plate into sample inlet ports A1 A6 on the left side of the BeadChip in every other inlet port Make sure that the pipette tip is in the sample inlet before dispensing gt Load samples B1 B6 from the MSA3 plate into sample inlet ports B1 B6 on the left side of the BeadChip in every other inlet port gt Load samples C1 C6 from the MSA3 plate into sample inlet ports C1 C6 on the right side of the BeadChip in every other inlet port gt Load samples D1 D6 from the MSA3 plate into sample inlet ports D1 D6 on the right side of the BeadChip in every other inlet port gt Continue in this manner using the color coded chart until all samples are loaded Figure 33 Distributing Sample from the MSA3 Plate with an Adjustable Multi Channel Pipette MSA3 Pl
130. ocumentation This form can be filled out and saved online or printed and filled in by hand 2 Proceed to the next step 1 2 P Part 15045738 Rev A Fragment DNA Post Amp This process enzymatically fragments the amplified DNA samples An end point fragmentation is used to prevent over fragmentation Figure 81 Fragmenting DNA DADA li J Dn PAIDA N pod Estimated Time Robot time 5 minutes for 48 samples 10 minutes for 96 samples Incubation time 1 hour Consumables Item Quantity Storage Supplied By FMS 1 tube per 96 15 C to 25 C Illumina samples J NOTE Thaw all reagents completely at room temperature and allow to equilibrate After thawed gently invert each tube several times to mix the reagent thoroughly Pulse centrifuge each tube to 280 x g to eliminate bubbles and collect reagent at the bottom of the tube Illumina Infinium HTS Assay Protocol Guide 1 2 3 duy s0d YNG jus ube Automated Protocol 124 Preparation N oO FF WO N e Preheat the heat block with the MIDI plate insert to 37 C Thaw FMS tubes to room temperature Gently invert at least 10 times to mix contents Pulse centrifuge to 280 x g Remove the MSA3 plate from the Illumina Hybridization Oven Remove the cap mat If you plan to Resuspend the MSA3 plate today remove the RA1 from the freezer to thaw On the lab tracking form record Date Time Operator Robot FMS tube barcodes di NOTE To record information about
131. ocus discrimination or copy number variation CNV determination comes from a combination of high beadtype representation per feature sequence specific hybridization capture and array based single base primer extension In the case of the Infinium II probe design the 3 end of the primer is positioned directly adjacent to the SNP site or if a non polymorphic probe directly adjacent to the non polymorphic site With the Infinium I probe design the 3 end of the primer overlaps with the SNP site If there is a perfect match extension occurs and signal is generated If there is a mismatch extension does not occur and no signal is generated Allele specific single base extension of the primer incorporates a biotin nucleotide or a dinitrophenyl labeled nucleotide C and G nucleotides are biotin labeled A and T nucleotides are dinitrophenyl labeled Signal amplification of the incorporated label further improves the overall signal to noise ratio of the assay The Infinium HTS assay offers High multiplexing High call rate and accuracy Unlimited genome wide marker selection Single tube amplification single chip no PCR Minimal risk of carryover contamination Low DNA input 200 ng per sample Walkaway automation using Tecan Genesis or Freedom Evo Robots and Tecan GenePaint system Compatibility with both Illumina iScan and HiScan Systems Multiple sample BeadChip format Part 15045738 Rev A Audience and Purpose This guide is for
132. ol Guide 67 duy js0d diy9peeg yseMm Manual Protocol 68 Standard Glass LCG Glass Standard Spacer LCG Spacer LCG Chamber Assembly 1 If you have not done so fill the Multi sample BeadChip Alignment Fixture with 150 ml PB If you plan to process more than 4 BeadChips this 150 ml of PB1 can be reused for an additional set of 4 BeadChips Use 150 ml of fresh PB1 for every additional set of 8 BeadChips 2 For each BeadChip to be processed place a black frame into the Multi Sample BeadChip Alignment Fixture pre filled with PB1 Figure 45 Placing Black Frames into Multi Sample BeadChip Alignment Fixture 3 Place each BeadChip to be processed into a black frame aligning its barcode with the ridges stamped onto the Alignment Fixture Part 15045738 Rev A NOTE f Inspect the surface of each BeadChip for residue left by the seal Use a pipette tip to remove any residue under buffer and be careful not to scratch the bead area Figure 46 Placing BeadChip into Black Frame on Alignment Fixture Vid duy s0d diy9peeg yseMm 4 Place a clear LCG spacer onto the top of each BeadChip Use the alignment fixture grooves to guide the spacers into proper position J NOTE Be sure to use the clear plastic spacers not the white ones Illumina Infinium HTS Assay Protocol Guide 6 Q Manual Protocol Figure 47 Placing Clear Plastic Spacer onto BeadChip 5 Place the alignment bar on
133. ompletely resuspended Discard unused reagents in accordance with facility standards 10 Do one of the following Proceed to Hybridize to BeadChip Post Amp If you plan to do so immediately it is safe to leave the RA1 at room temperature If you do not plan to proceed to the next step immediately store the sealed MSA3 plate at 15 C to 25 C for no more than 24 hours Store at 80 C if storing for more than 24 hours Store RA1 at 15 C to 25 C SAFE STOPPING POINT Now is a good stopping point in the process Part 15045738 Rev A Hybridize to BeadChip Post Amp In this process the fragmented and resuspended DNA samples are dispensed onto the BeadChips DNA loaded BeadChips are placed into Hyb Chamber Inserts that are placed inside the Hyb Chambers Once the DNA samples are loaded into the flow through chambers incubate the chambers for 16 24 hours at 48 C in the Illumina Hybridization Oven Hybridization occurs during the incubation period Each sample will be hybridized to an individual section of the BeadChip Figure 92 Hybridizing DNA to BeadChip 5 gDNA identical probes per bead type S gDNA Estimated Time Robot time 24x1 HTS BeadChip 25 minutes for 4 BeadChips 96 samples Incubation time 16 24 hours Consumables Item Quantity Storage Supplied By per 96 Samples PB2 1 tube Room Ilumina temperature BeadChips 4 Illumina Hyb chambers 1 Illumina Illumina Infinium HTS Assay Protocol
134. ompletely submerged 9 Move the wash rack up and down for 1 minute breaking the surface of the PB1 with gentle slow agitation 10 When you remove the BeadChips from the wash rack inspect them for remaining residue Illumina Infinium HTS Assay Protocol Guide 1 6 D Automated Protocol NOTE Residue that can adversely affect results is sometimes left on BeadChips after seals are removed If there is residue left on the BeadChips after the second PB1 wash use a 200 ul pipette tip for each BeadChip and slowly and carefully scrape off the residues outward away from the bead sections under PB1 Use a new pipette tip for each BeadChip Then continue with the protocol 11 If you are processing more than 8 BeadChips a Assemble the flow through chambers for the first 8 BeadChips as described in the next section and place them on the lab bench in a horizontal position K NOTE Keep the flow through chambers in a horizontal position on the lab bench until all assembled flow through chambers are ready to be loaded into the chamber rack Do not place the flow through chambers in the chamber rack until all BeadChips are prepared in flow through chambers b Return to this procedure and follow the steps described above to wash the next set c of 8 BeadChips Repeat for each remaining set of 8 BeadChips Assemble Flow Through Chambers K NOTE Confirm that you are using the correct Infinium LCG glass back plates and spacers before
135. ontacting the beadstripe area and sample inlets 2 Place each BeadChip in a Hyb Chamber insert orienting the barcode end so that it matches the barcode symbol on the Hyb Chamber insert 3 Usea single channel pipette or an adjustable spacer multichannel pipette to load HTS BeadChips Do not use a standard multichannel pipette because the spacing is not compatible with the HTS BeadChip Figure 30 Placing BeadChips into Hyb Chamber Inserts 5 2 Part 15045738 Rev A For the Single Channel Pipette Using a single channel precision pipette dispense 14 ul of each DNA sample onto the appropriate BeadChip section Make sure that the pipette tip is in the sample inlet before dispensing Follow the color coded sections shown in the chart on the following page for sample loading assistance gt b b b Load sample Al from the MSA3 plate into sample inlet Al of the BeadChip Make sure that the pipette tip is in the sample inlet before dispensing Load sample B1 from the MSA3 plate into sample inlet B1 of the BeadChip Load sample C1 from the MSA3 plate into sample inlet C1 of the BeadChip Load sample D1 from the MSA3 plate into sample inlet D1 of the BeadChip Continue in this manner using the color coded chart until all samples are loaded Figure 31 Distributing Sample from the MSA3 Plate with a Single Channel Pipette MSA3 Plate 3 5 8 3 ION MON W SS 6 7 8 9 1011 12 Illumina Infinium HTS Assay Prot
136. ort the non conformance ii cooperate with Illumina in confirming or diagnosing the non conformance and iii return this Product transportation charges prepaid to Illumina following Illumina s instructions or if agreed by Illumina and Purchaser grant Illumina s authorized repair personnel access to this Product in order to confirm the non conformance and make repairs e Sole Remedy under Warranty Illumina will at its option repair or replace non conforming Product that it confirms is covered by this warranty Repaired or replaced Consumables come with a 30 day warranty Hardware may be repaired or replaced with functionally equivalent reconditioned or new Hardware or components if only a component of Hardware is non conforming If the Hardware is replaced in its entirety the warranty period for the replacement is 90 days from the date of shipment or the remaining period on the original Hardware warranty whichever is shorter If only a component is being repaired or replaced the warranty period for such component is 90 days from the date of shipment or the remaining period on the original Hardware warranty whichever ends later IV Part 15045738 Rev A The preceding states Purchaser s sole remedy and Illumina s sole obligations under the warranty provided hereunder Third Party Goods and Warranty Illumina has no warranty obligations with respect to any goods originating from a third party and supplied to Purchaser hereunder Third party
137. plied with your system 5 On the lab tracking form record Date Time Operator PB2 tube lot number NOTE d To record information about your assay such as operator information start and stop times and barcodes use the lab tracking form provided at www ilumina com documentation This form can be filled out and saved online or printed and filled in by hand Prepare the Robot Tip Alignment Guide 1 Make sure that you have the correct Robot Tip Alignment Guide for the Infinium assay you are running The barcode says Guide G Figure 93 Guide G Robot Tip Alignment Guide Jo EN i 000000000O00OO 000000000000 0080009000000 910191019191919191019 2 Wash and dry the entire one piece Robot Tip Alignment Guide See Wash Robot Tip Alignment Guide at the end of the Hybridize Multi BeadChip steps for washing instructions 3 Place the assembled Robot Tip Alignment Guides on the lab bench until it is time to place them on the robot bed Illumina Infinium HTS Assay Protocol Guide 1 A 3 duy js0d diyopeag 0 8zIpugAH Automated Protocol Assemble the Hybridization Chambers 1 Prepare the hyb chambers Place the following items on the bench top per 96 samples o For the 24 x 1 HTS BeadChip BeadChip hyb chambers 1 Hyb chamber gaskets 1 Robot BeadChip alignment fixtures 2 BeadChip hyb chamber inserts 4 Figure 94 BeadChip Hyb Chamber Components ike 1 A4 Part 15045738
138. rials Infinium HTS Assay Manual Protocol Item Catalog Tube vortexer General lab supplier Tube rack VWR Combination optical tachometer stroboscope Cole Parmer catalog A 87700 06 Part 15045738 Rev A Item Microplate centrifuge with g force range 8 3000 x g for dedicated pre and post amp use Adapter for centrifuge plates and tubes Pipettes two separate sets Eight channel precision pipette two separate sets Adjustable spacer multichannel pipette recommended Stop watch timer Forceps Powder free gloves two separate stocks Lab coats separate pre PCR and post PCR Safety glasses two separate stocks 15 ml conical tubes 96 well 0 2 ml skirted microplates 0 8 ml storage plate MIDI plate conical well bottom Heat sealing foil sheets Thermo Seal 96 well cap mats pierceable non autoclavable Absorbent pads Kimwipes Mild detergent such as Alconox Powder Detergent Illumina Infinium HTS Assay Protocol Guide Catalog General lab supplier General lab supplier 2 each of P 20 P 200 and P 1000 50 ul to 300 ul Rainin LA8 50XLS www mt com General lab supplier VWR catalog 25601 008 General lab supplier General lab supplier General lab supplier General lab supplier MJ Research catalog MSP 9601 Abgene catalog AB 0765 Abgene catalog AB 0559 Abgene catalog AB 0566 General lab supplier General lab supplier VWR catalog 21835 032 General lab supplier 21
139. robot bed All barcodes must face to the right Figure 83 Fragment MSA3 Screen i lumina Automation Control File LIMSLog Help Robot Washes Robot Control Sys Wash Flush W Flush L Wash S Sys Init Init LiHa Tips Up Required Run Item s Basic Run Parameters Run items Parameter Value 3 Number of FMS tube s Number of MSA3 plate s 1 3 Number of MSA3 plate s Number of DNA samples per plate 96 a Fra ASA3 Es Precip MSA3 E Resuspend MSA3 _ Bb Hyb Multi BC2 DB Access w Use Barcodes Operator Server Name Main EC Genesis1 Loading worktable rack data Done System Initialized Genesis1 Place the MSA3 plate on the robot bed according to the bed map Remove the plate seal Place FMS tubes in the robot tube rack according to the bed map Remove the cap On the lab tracking form record the plate positions on the robot bed Part 15045738 Rev A Start the Robot 3 4 5 6 7 8 9 Other than Illumina LIMS At the robot PC click Run Ilumina LIMS At the robot PC a Make sure the Use Barcodes check box is checked b Click Run to start the process Log in if prompted The robot PC sounds an alert and displays a message when the process is done When the robot finishes click OK in the message box Remove the MSA3 plate from the robot bed and seal it with a cap mat Vortex at 1600 rpm for 1 m
140. rough inhalation ingestion skin contact and eye contact For more information consult the material data safety sheet for this assay at www illumina com msds Dispose of containers and any unused contents in accordance with the governmental safety standards for your region Illumina Infinium HTS Assay Protocol Guide 1 61 duy s0d diy9peeg yseMm Automated Protocol Preparation 1 Remove each Hyb Chamber from the Illumina Hybridization Oven Let cool on the benchtop for 30 minutes before opening Have ready on the lab bench a b c d Two wash dishes Containing 200 ml PB1 and labeled as such Multi Sample BeadChip Alignment Fixture Using a graduated cylinder fill with 150 ml PB1 Black frames LCG spacers separated for ease of handling Clean LCG glass back plates as directed in the Infinium Lab Setup and Procedures Guide Clamps 3 On the lab tracking form record L Date Time Operator PB1 bottle barcode Robot NOTE To record information about your assay such as operator information start and stop times and barcodes use the lab tracking form provided at www ilumina com documentation This form can be filled out and saved online or printed and filled in by hand Verify Reagents and BeadChips for Washing LIMS only Scan the barcodes of the PB1 Scan the BeadChip barcodes Click Verify and then click Save If the reagents are correct and the BeadChips are queued for washing a blue confirmation mess
141. s checkbox Click Run Observe the beginning of the robot run to ensure there are no problems The robot transfers 195 ul of diluted PicoGreen to all Fluotrac plates then transfers 2 ul aliquots of DNA from Standard DNA plate to Standard QDNA plate and from GS DNA plate to sample QDNA plates The robot PC sounds an alert and opens a message when the process is complete Click OK in the message box On the lab tracking form record Date Time Operator Robot The QDNA barcode that corresponds to each GS DNA barcode The Standard QDNA plate that corresponds to each Standard DNA plate After the robot finishes immediately seal all plates a Place foil adhesive seals over Sample QDNA and Standard QDNA plates b Place cap mats on GS DNA Sample and Standard DNA plates Discard unused reagents in accordance with facility requirements Store the GS DNA and Standard DNA plates at 2 to 8 C or 15 to 25 C Centrifuge the Sample QDNA Plate and Standard QDNA plates to 280 x g for 1 minute Read the QDNA Plate In this process you use the Gemini XS or XPS Spectrofluorometer along with the Illumina Fluorometry Analysis software to read the Standard QDNA and Sample QDNA plates You use the software to create a standard curve based on the quantities of Standard DNA with PicoGreen Then you read the Sample QDNA plates to compare their data against the standard curve to obtain the concentration of sample DNA For the best performance Ilumina
142. s in the Hyb Chambers Part 15045738 Rev A Figure 29 Dispensing PB2 into Hyb Chamber Reservoir y WARNING Do not replace PB2 in the Hyb Chamber with RA1 RA1 decreases the stringency and can negatively affect sample call rates and logRdev PB2 is formulated to produce the appropriate amount of humidity within the Hyb Chamber environment to prevent sample from evaporating during hybridization c After you fill the Hyb Chamber reservoirs with PB2 place the lid on the Hyb Chamber right away to prevent evaporation It is not necessary to lock down the lid d Leave the closed Hyb Chambers on the bench at room temperature until the BeadChips are loaded with DNA sample Load BeadChips into the Hyb Chamber within one hour iy NOTE 4 You can also prepare the Hyb Chambers later during the 30 minute cool down Illumina Infinium HTS Assay Protocol Guide 51 duuy js0d diyopeag 0 8ZIPLIqAH Manual Protocol 4 After the 20 minute incubation remove the MSA3 plate from the heat block and place it on the benchtop at room temperature for 30 minutes 5 After the 30 minute cool down pulse centrifuge the MSA3 plate to 280 x g Remove the foil seal Load BeadChip 1 Just before loading DNA samples remove all BeadChips from their plastic bags and mylar packages CAUTION y Hold the BeadChip by the ends with your thumb and forefinger thumb at the barcode end Do not hold the BeadChip by the sides near the sample inlets Avoid c
143. sses Auto desiccator cabinet Optional allows scanning of BeadChips up to three days after processing 100 Suggested Vendor VWR catalog 24988 197 VWR catalog 62995 335 LIMS other than Illumina customers e SC 30 401 110V North America and Japan e SC 30 402 220V EU and Asia Pacific Except Japan Illumina LIMS customers e 5C 30 403 110V North America and Japan e SC 30 404 220V EU and Asia Pacific Except Japan VWR catalog 74950 342 Part 15045738 Rev A Illumina Supplied Equipment Table 10 Illumina Supplied Materials Infinium HTS Assay Automated Item Catalog or Part Multi Sam ple BeadChip 218528 alignment fixture Robot BeadChip Alignment 222691 Fixture 6 Robot Tip Alignment Guide G One piece catalog SE 104 1015 Part 15044220 User Supplied Materials Table 11 User Supplied Materials Infinitum HTSAssay Automated Protocol Item Suggested Vendor 96 well black flat bottom Fluotrac 200 plates Greiner catalog 655076 Forceps VWR catalog 25601 008 Aluminum foil Foil adhesive seals Microseal F MJ Research catalog MSF 1001 Reservoir full 150 ml Beckman Coulter catalog 372784 Reservoir half 75 ml Beckman Coulter catalog 372786 Reservoir quarter 40 ml Beckman Coulter catalog 372790 Reservoir frame Beckman Coulter catalog 372795 Tube racks for vacuum desiccator 1 for every 8 VWR catalog 66023 526 BeadChips to be processed simultaneous
144. t step If you plan to perform additional assay steps requiring RA1 that same day then leave the remaining thawed reagent in the original closed bottle at room temperature until it is needed Otherwise follow the standard RA1 storage procedures described in this assay guide for next day processing and prolonged storage conditions Steps to Resuspend the MSA3 Plate 1 Add 23 ul RAI to each well of the MSA3 plate containing a DNA pellet Reserve any leftover reagent for XStain BeadChip 4 4 Part 15045738 Rev A Apply a foil heat seal to the MSA3 plate by firmly and evenly holding the heat sealer sealing block down for 5 seconds Place the sealed plate in the Illumina Hybridization Oven and incubate for 1 hour at 48 C Vortex the plate at 1800 rpm for 1 minute Pulse centrifuge to 280 x g NOTE 4 If you store the pellets at 15 to 25 C for extended periods of time after the precipitate process you might need to repeat the vortexing and centrifugation in the previous steps until the pellets are completely resuspended Discard unused reagents in accordance with facility standards Do one of the following Continue to the next step Hybridize Multi BeadChip If you plan to do so immediately it is safe to leave the MSA3 plate at room temperature for up to 1 hour If you do not plan to proceed to the next step immediately store the sealed MSA3 plate at 15 C to 25 C for no more than 24 hours For more than 24 hours store at
145. te well e TCY plate 10 ul to each WG DNA plate well Apply a barcode label to the new WG DNA plate Dispense 20 ul MA1 into the MSA3 plate wells Transfer 4 ul of the DNA sample from the WG DNA plate to the corresponding wells in the MSA3 plate Record the location of the original DNA sample ID for each well in the MSA3 plate Dispense 4 ul 0 1N NaOH into each well of the MSA3 plate that contains MA1 and sample Refer to the following figure throughout the Make MSA3 process Figure 17 Distributing Sample to Wells MSA3 Plate 866002 00 LLAI 6 6880608206 H e0 5678 9 23 4 1 2 3 4 10 11 12 1 LTOnNMmMOJ DO WS NOTE y To ensure optimal performance exchange tips between DNA samples and use aerosol filter tips when pipetting DNA Seal the MSA3 plate with the 96 well cap mat Part 15045738 Rev A 10 11 12 13 14 15 16 17 q CAUTION y Orient the cap mat so that A1 on the cap matches A1 on the plate To prevent evaporation and spills which could lead to assay variability and cross contamination make sure that all 96 caps are securely seated Vortex the plate at 1600 rpm for 1 minute Centrifuge to 280 x g for 1 minute Incubate for 10 minutes at room temperature Carefully remove the cap mat When you remove a cap mat set it aside upside down in a safe location for use later in the protocol Dispense 34 ul MA2 into each well of the MSA3 plate containing sample NOTE
146. the edges in one hand Avoid contact with the sample inlets Make sure that the barcode is facing up and closest to you and that the top side of the BeadChip is angled slightly away from you b Remove the entire seal in a single continuous motion Start with a corner on the barcode end and pull with a continuous upward motion away from you and towards the opposite corner on the top side of the BeadChip Illumina Infinium HTS Assay Protocol Guide 6 D dwy Sod diyopeeg yseM Figure 43 Removing the Cover Seal Manual Protocol c Discard the cover seal q CAUTION Do not touch the arrays 5 Immediately and carefully slide each BeadChip into the wash rack one at a time making sure that the BeadChip is completely submerged in the PB1 Figure 44 Submerging BeadChips in Wash Dish Containing PB1 6 Repeat steps 4 through 5 until all BeadChips a maximum of 8 are transferred to the submerged wash rack 6 6 Part 15045738 Rev A lay NOTE You can use the two 200 ml PB1 wash dishes for up to 24 BeadChips However use 150 ml of fresh PB1 for every 8 BeadChips in the Multi Sample BeadChip Alignment Fixture 7 After all BeadChips are in the wash rack move the wash rack up and down for 1 minute breaking the surface of the PB1 with gentle slow agitation 8 Move the wash rack to the other wash dish containing clean PB1 Make sure the BeadChips are completely submerged 9 Move the wash rack up and down for 1 minute breaking th
147. times can vary according to room temperature and humidity Release the vacuum by turning the handle very slowly q WARNING y Make sure that air enters the desiccator very slowly to avoid disturbing the contents Improper use of the vacuum desiccator can result in damage to the BeadChips especially if you remove the valve plug while a vacuum is applied For detailed vacuum desiccator instructions see the documentation included with the desiccator Store the desiccator with the red valve plug in the three way valve of the desiccator to stop accumulation of dust and lint within the valve port Touch the borders of the chips do not touch the stripes to make sure that the etched barcoded side of the BeadChips are dry to the touch Part 15045738 Rev A 28 29 30 31 If the underside feels tacky manually clean the underside of the BeadChip to remove any excess XC4 The bottom two BeadChips are most likely to have some excess a Hold the BeadChip at a downward angle to prevent excess EtOH from dripping from the wipe onto the stripes b Wipe along the underside of the BeadChip five or six times until the surface is clean and smooth x CAUTION y Do not touch the stripes with the wipe or allow EtOH to drip onto the stripes Clean the glass back plates For instructions see the Infinium Lab Setup and Procedures Guide Discard unused reagents in accordance with facility standards Do one of the following Proceed to Image B
148. to the alignment fixture The groove in the alignment bar fits over the tab on the alignment fixture Figure 48 Placing Alignment Bar onto Alignment Fixture T O Part 15045738 Rev A 6 Place a clean LCG glass back plate on top of the clear spacer covering each BeadChip The plate reservoir is at the barcode end of the BeadChip facing inward to create a reservoir against the BeadChip surface Figure 49 Placing Glass Back Plate onto BeadChip A Reservoir at Barcode End of Glass Back Plate B Glass Back Plate in Position 7 Attach the metal clamps to the flow through chambers as follows a Gently push the glass back plate up against the alignment bar with one finger b Place the first metal clamp around the flow through chamber so that the clamp is approximately 5 mm from the top edge c Place the second metal clamp around the flow through chamber at the barcode end approximately 5 mm from the reagent reservoir Illumina Infinium HTS Assay Protocol Guide 71 duy s0d diy9peag ysem Figure 50 Securing Flow Through Chamber Assembly with Metal Clamps Manual Protocol A One Stripe Shows Between First Clamp and Alignment Bar B Glass Back Plate Pressed Against Alignment Bar C No Stripes Show Between Second Clamp and Barcode 8 Using scissors trim the ends of the clear plastic spacers from the flow through chamber assembly Slip scissors up over the barcode to trim the other end T 2 Part 15045738 Rev A Figure 51 Trimmin
149. to use this Product and Purchaser must not use this Product 1 Definitions Application Specific IP means Illumina owned or controlled intellectual property rights that pertain to this Product and use thereof only with regard to specific field s or specific application s Application Specific IP excludes all Illumina owned or controlled intellectual property that cover aspects or features of this Product or use thereof that are common to this Product in all possible applications and all possible fields of use the Core IP Application Specific IP and Core IP are separate non overlapping subsets of all Illumina owned or controlled intellectual property By way of non limiting example Illumina intellectual property rights for specific diagnostic methods for specific forensic methods or for specific nucleic acid biomarkers sequences or combinations of biomarkers or sequences are examples of Application Specific IP Consumable s means Illumina branded reagents and consumable items that are intended by Illumina for use with and are to be consumed through the use of Hardware Documentation means Illumina s user manual for this Product including without limitation package inserts and any other documentation that accompany this Product or that are referenced by the Product or in the packaging for the Product in effect on the date of shipment from Illumina Documentation includes this document Hardware means Illumina branded instruments a
150. tom of the tube 1 2 8 Part 15045738 Rev A Preparation 1 Preheat the heat block to 37 C 2 If you froze the MSA3 plate thaw it to room temperature then pulse centrifuge to 50 x g 3 Thaw PM1 to room temperature Centrifuge to 280 x g for 1 minute On the lab tracking form record Date Time Operator Robot PM1 tube barcodes 2 propanol lot number and date opened NOTE 4 To record information about your assay such as operator information start and stop times and barcodes use the lab tracking form provided at www illumina com documentation This form can be filled out and saved online or printed and filled in by hand Prepare Robot For instructions on preparing the robot for use in a protocol see the Infinium Assay Lab Setup and Procedures Guide Refer to the figure shown below throughout this protocol Note that barcodes face to the right Illumina Infinium HTS Assay Protocol Guide 1 2 Q dwiy 1s0d YNG 2PPAdd Automated Protocol Figure 85 Tecan Eight Tip Robot Precip MSA3 Setup A PMI in Half Reservoir B 2 propanol in full Reservoir CG MSA3 Plate Verify MSA3 for Centrifugation LIMS only 1 In the Illumina LIMS left sidebar click Infinium HTS Spin MSA3 2 Scan the barcodes of the MSA3 plates and click Verify then click Save 3 If the MSA3 plate is queued for centrifugation a blue confirmation message appears at the top of the window 4 If the MSAS3 plate is not queued for centrifugation a
151. up to 96 samples If you already know the concentration proceed to Amplify DNA Pre Amp Ilumina recommends the Molecular Probes PicoGreen assay to quantitate dsDNA samples The PicoGreen assay can quantitate small DNA volumes and measures DNA directly Other techniques may pick up contamination such as RNA and proteins lumina recommends using a spectrofluorometer because fluorometry provides DNA specific quantification Spectrophotometry might also measure RNA and yield values that are too high Hands on time 20 minutes per plate Robot 20 minutes per plate Consumables Item Quantity Storage Supplied By PicoGreen dsDNA quantitation See Instructions 15 C to 25 C User reagent 1X TE 10 mM Tris HCl pH8 0 See Instructions Room General lab 1 mM EDTA TE temperature supplier Lambda DNA See Instructions 2 C to 8 C User 96 well 0 65 ml microtiter plate 1 per 96 samples General lab supplier Fluotrac 200 96 well flat 1 per Standard DNA General lab bottom plate plate supplier 1 per Sample DNA plate 4 NOTE PicoGreen is susceptible to differential contaminants False positives may occur for whole genome amplification Therefore it is important to quantitate the input into the whole genome amplification reaction Illumina Infinium HTS Assay Protocol Guide 1 O 3 duy a1d euondo YNG eyepJUeNH Automated Protocol Preparation Thaw PicoGreen to room temperature in a light impermeable container Follow the instructions
152. upport unattended processing by placing BeadChip carriers in the tray of the imaging system so that it can scan the BeadChips AutoLoader features include those items listed in the table Table 2 AutoLoader2 and AutoLoader2x Features Feature AutoLoader2 AutoLoader2x Integrated with iScan Control Software Integrated with Illumina LIMS o Email alert system Single reader or dual reader configuration o o Number of BeadChips supported per carrier 4 4 Number of carriers processed at a time 48 48 Illumina Infinium HTS Assay Protocol Guide 1 D swa sAs buibew Overview GenomesStudio Integrated Informatics Platform Ilumina GenomeStudio is an integrated data analysis software platform that provides a common environment for analyzing data obtained from Illumina microarray and sequencing technologies Within this common environment or framework the Illumina GenomeStudio software modules allow you to perform application specific analyses The Illumina GenomeStudio Genotyping Module included with your Illumina Infinium Assay system is an application for extracting genotyping data from intensity data files idat files collected from systems such as the Illumina HiScan System For information on the latest software offerings including software for applications such as cytogenetics visit www illumina com Data analysis features of the GenomeStudio Genotyping Module include Choice of assay analysis within a single application
153. verse compiling or reverse assembling of this Product d is the separation extraction or isolation of components of this Product or other unauthorized analysis of this Product e gains access to or determines the methods of operation of this Product f is the use of non Illumina reagent consumables with Illumina s Hardware does not apply if the Specifications or Documentation state otherwise or g is the transfer to a third party of or sub licensing of Software or any third party software All Software whether provided separately installed on or embedded in a Product is licensed to Purchaser and not sold Except as expressly stated in this Section no right or license under any of Illumina s intellectual property rights is or are granted expressly by implication or by estoppel Purchaser is solely responsible for determining whether Purchaser has all intellectual property rights that are necessary for Purchaser s intended uses of this Product including without limitation any rights from third parties or rights to Application Specific IP Illumina makes no guarantee or warranty that purchaser s specific intended uses will not infringe the intellectual property rights of a third party or Application Specific IP 3 Regulatory This Product has not been approved cleared or licensed by the United States Food and Drug Administration or any other regulatory entity whether foreign or domestic for any specific intended use whether research
154. w illumina com documentation Sample Sheet Ilumina recommends that you create a sample sheet to track your samples and assay effectively The GenomeStudio application uses the sample sheet later for data analysis For instructions on data analysis see the GenomeStudio User Guide or online help Create your sample sheet according to the guidelines provided in the table Table 1 Sample Sheet Guidelines Column Heading Description Optional O or Required R Sample_ID Unique identifier for the sample Sample Name Name of the sample Used only for display in the table O Sample Plate The barcode of the sample plate for this sample Used O only for display in the table Sample Well The sample plate well for this sample Used only for O display in the table SentrixBarcode A The barcode of the array product BeadChip to which R this sample was hybridized for Manifest A Illumina Infinium HTS Assay Protocol Guide 1 1 sjoo Bulyoes Overview Column Heading SentrixPostion_A Gender Sample_Group Replicate Parent1 Parent2 Notes 12 Description Optional O or Required R The position within the array product to which this R sample was hybridized for the manifests in your project Male Female or Unknown A group if any to which this sample belongs The Sample_ID of a replicate to this sample Used in O reproducibility error calculations The Sample ID of this sample s first parent O
155. when in the Infinium HTS assay Figure 80 Incubating DNA to Amplify Estimated Time Incubation time 20 24 hours Verify MSA3 for Incubation LIMS only 1 In the Illumina LIMS left sidebar click Infinitum HTS Incubate MSA3 2 Scan the barcode of the MSA3 plate click Verify and then click Save 3 If the MSA3 plate is queued for incubation a blue confirmation message appears at the top of the window Proceed to Steps to Incubate the MSA3 Plate 4 If the MSAS3 plate is not queued for incubation a red error message appears at the top of the window Do not proceed with incubation Instead follow these steps to troubleshoot the problem a Click the Reports tab in the upper right corner b In the left sidebar click Tracking Reports Get Queue Status c Scan the plate barcode and click Go Illumina Infinium HTS Assay Protocol Guide 1 2 1 duy s0d YNG eveqnou Automated Protocol d Note what step the plate is queued for and proceed with that step For information about how to use Illumina LIMS see the Ilumina LIMS User Guide Steps to Incubate MSA3 Plate OVERNIGHT INCUBATION h Incubate MSA3 plate in the Illumina Hybridization Oven for at least 20 hours but no more than 24 hours at 37 C 1 Record the start and stop times on the lab tracking form 4 NOTE To record information about your assay such as operator information start and stop times and barcodes use the lab tracking form provided at www illumina com d
156. when lifting or moving Avoid shaking and keep parallel to the lab bench at all times Do not hold by the sides near the sample inlets Calibrate the Illumina Hybridization Oven with the Full Scale Plus digital thermometer supplied with your system Carefully place each BeadChip in a Hyb Chamber insert orienting the barcode end so that it matches the barcode symbol on the insert Illumina Infinium HTS Assay Protocol Guide 1 D 3 duy js0d diyopeag 0 8zIpugAH Automated Protocol Figure 103 Matching the Barcode End to the Insert Fixture 5 Load the Hyb Chamber inserts containing loaded BeadChips inside the Illumina Hyb Chamber Position the barcode over the ridges indicated on the Hyb Chamber Figure 104 Placing Hyb Chamber Inserts into Hyb Chamber 6 Ensure Hyb Chamber inserts are seated properly 7 lumina LIMS In the Illumina LIMS left sidebar click Infinium HTS Infinium Prepare Hyb Chamber 8 Scan the barcodes of the PB2 tubes and scan the BeadChip barcodes Click Verify and then click Save 9 Position the lid onto the Hyb Chamber by applying the backside of the lid first and then slowly bringing down the front end to avoid dislodging the Hyb Chamber inserts 1 5A Part 15045738 Rev A 10 11 Figure 105 Seating Lid onto Hyb Chamber Close the clamps on both sides of the Hyb Chamber so that the lid is secure and even on the base no gaps It is best to close them in a kitty corner fashion closing first t
157. xpenses incurred in providing such assistance Third Party Goods and Indemnification Illumina has no indemnification obligations with respect to any goods originating from a third party and supplied to Purchaser Third party goods are those that are labeled or branded Illumina Infinium HTS Assay Protocol Guide V with a third party s name Purchaser s indemnification rights if any with respect to third party goods shall be pursuant to the original manufacturer s or licensor s indemnity Upon written request Illumina will attempt to pass through such indemnity if any to Purchaser Part 15045738 Rev A Revision History Part Revision Date 15045738 Illumina Infinium HTS Assay Protocol Guide Description of Change Initial release AJO SIH UOISIABY Table of Contents Revision History 1 2 0 0 aaa vii Table of Contents 2 22 22 2 2 occ eee cece cece cece aa LaLa LLALLA aoa a anaana viii GUSto Tcl So ere e Ta EP A ER xX Chapter 1 Overview cee 1 Introduction to Infinium HTS assay 0000 e cece cece cece cece eee 2 Audience and Purpose 2 2 e cece cece eeeceeeceeeeeeees 3 Infinitum HTS assay e eee cee cece cece cece cece ee aaa aaao anaoa 4 Illumina Infinium BeadChips 02222 cece ec cc cece cece cc ccceeeeees 9 lllumina Lab Protocols 2 0 2 2 cece cece cc cece ccc n ccc ccecccccecccccucccccucceceeceeees 10 Tracking Tools sese neer aa eaeoe e cece cece aE SE a 11 Tecan
158. xtended primers undergo a multi layer staining process on the chamber rack Next you disassemble the flow through chambers and wash the BeadChips in the PB1 reagent coat them with XC4 and then dry them Figure 52 Extending and Staining BeadChip 2a q bi e Stain in red channel gDNA gDNA Stain in green channel Estimated Time Hands on time 2 hours and 45 minutes for 8 BeadChips Dry time 55 minutes Consumables Item Quantity Storage Supplied By RA1 10 ml for 1 8 15 C to 25 C Illumina BeadChips 20 ml for 9 16 BeadChips 30 ml for 17 24 BeadChips F 4 Part 15045738 Rev A Item LX1 LX2 EML XC3 SML Make sure that all SML tubes indicate the same stain temperature on the label ATM PB1 XC4 Alconox Powder Detergent EtOH 95 formamide 1 mM EDTA Illumina Infinium HTS Assay Protocol Guide Quantity 2 tubes per 8 BeadChips 2 tubes per 8 BeadChips 2 tubes per 8 BeadChips 50 ml for 1 8 BeadChips 100 ml for 9 16 BeadChips 150 ml for 17 24 BeadChips 2 tubes per 8 BeadChips 2 tubes per 8 BeadChips 310 ml for 1 8 BeadChips 285 ml for 9 24 BeadChips 310 ml for 1 8 BeadChips 285 ml for 9 24 BeadChips As needed As needed 15 ml for 1 8 BeadChips 17 ml for 9 16 BeadChips 25 ml for 17 24 BeadChips Storage 15 C to 25 C 15 C to 25 C 15 C to 25 C Room temperature 15 C to 25 C 15 C to 25
159. your assay such as operator information start and stop times and barcodes use the lab tracking form provided at www illumina com documentation This form can be filled out and saved online or printed and filled in by hand Part 15045738 Rev A Prepare Robot For instructions on preparing the robot for use in a protocol see the Infinium Assay Lab Setup and Procedures Guide J CAUTION Do not run any other programs or applications while using the Tecan robot Your computer and the robot may lock up and stop a run Refer to the figure shown below throughout this protocol Figure 82 Tecan Eight Tip Robot Fragment MSA3 Setup A FMS tubes B MSA3 plate Steps to Fragment the MSA3 Plate 1 Centrifuge the MSA3 plate to 50 x g for 1 minute 2 At the robot PC select MSA3 Tasks Fragment MSA3 3 Other than Illumina LIMS Make sure that the Use Barcodes checkbox is cleared In the Basic Run Parameters pane change the value for Number of MSA3 plates and Illumina Infinium HTS Assay Protocol Guide 1 2 D duy s0d YNG jus ube Automated Protocol 126 N GD OF HS Number of DNA samples per plate to indicate the number of samples being processed J NOTE If you are using Illumina LIMS you cannot change the number of DNA samples on this screen However the LIMS software processes the correct number of samples The robot PC updates the Required Run Items and the bed map to show the correct position of items on the

My Document - Support

Contents

Download Pdf Manuals

Related Search

Related Contents