Home
MetaMorph Mutagenesis Kit
Contents
1. atttcaatcctagtatatagtacctagtattataggtacaagggcGAATTCGAATTTAAATCGGATTCC CTTAAGCTTAAATTTAGCCTAGG LEGEND PrimerA GCTAACTGAGCTAGCGAATTC Vector SEqUED CE epi Reaction A Insert sequence lower case PrimerB tgcccaaaattatggctaaatctttcagtctc Yellow EcoRI site R B His tttagccataattttgggcataaaagaactttttt Gray MiR145 Binding site eaction B pimerD GGATCCGATTTAAATTCGAATTC Deletion site gt PCR Reaction A Primers gt PCR Reaction B Primers 888 266 5066 Toll Free 650 968 2200 outside US Page 21 System Biosciences SBI User Manual D Sample Mutagenesis Results Single Multiple MWM Control Insertion Insertion Point oa o uh ae uh a uh uu we ee uita i a ee i g The yellow arrows indicate the bands that need to be extracted from the gel The PCR fragments are then combined with the cut vector and the 5x MetaMorph Solution to create the finished mutagenic construct The construct is then transformed into any kind of competent E coli strain More than 90 of the clones will contain the mutation 3kb Vkb 500 bp 100 bp gt Control and Mutated samples cut with Ndel and BamHl Control vector has only 1 Ndel and 1 BamHi restriction site The single insertion mutation adds a new Ndel site The double mutation insertion and point mutation adds Ndel and BamHI sites Page 22 ver 1 0110110 www systembio com MetaMorph Mutagenesis Kit IV Troubleshootin
2. o the right antibiotic media It is critical to remove any Incomplete uncut vector prior to use in linearization of the MetaMorph reaction If your vector necessary re digest your vector and gel purify 2 Large numbers of If you insert was amplified ter f TU colonies Contamin ti n of roma plasmid circular DNA contain no may have carried through cloning reaction POM insert D purification and contaminated with plasmid with the cloning reaction We the same na mea recommended gel purifying antibiotic oe your PCR product or linearizing the template DNA before performing PCR Page 24 ver 1 0110110 www systembio com MetaMorph Mutagenesis Kit Cat MC200 Series Problem Probable cause Solution 2 Large Plates are too old Make sure that your antibiotic numbers of or contained plates are fresh Check the colonies NONE incorrect antibiotic resistance of your contain no ei rs antibiotic fragment insert 3 Clones PCR products Optimize your PCR reaction contain contain non to improve the specificity incorrect specifically Screen more colonies for the insert amplified artifacts correct clones V Technical Support For more information about SBI products and to download manuals in PDF format please visit our web site http www systembio com For additional information or technical assistance please call or email us at Phone 650 968 2200 888 266 5066 T
3. Eie cccgaggacagcgtgatcttcaccgacaagatcatccgcagcaacgccaccgtggagcacctgcaccccatgggcgataacgtgctggtg ggcagcttcgcccgcaccttcagcctgcgcgacggcggctactacagcttcgtggtggacagccacatgcacttcaagGGATCCTCTAG CCTAGGAGATC AGTCGACCTGCAGGCATGCAAGCTTC TCAGCTGGAC LEGEND Vector sequence CAPS Insert sequence lower case Yellow Ndel site Primer cacttcggatcctaccccagcggctacgag Gray BamHI site Primer2 cggtagcatatgaagctcacgtgcagcacg Insertion Mutation site Point Mutation site gt PCR Reaction A Primers PCR Reaction B Primers p PCR Reaction C Primers Reaction A Primer1 GTACTGAGAGTGCACCATATG eactio ende ke rede N Reaction B Primer3 gtgagcttcatatgctaccgctacgaggccgg R ion eaction C Primer4 CAGGTCGACTCTAGAGGATCC Page 18 ver 1 0110110 www systembio com MetaMorph Mutagenesis Kit Cat MC200 Series PCR Reactions for Multiple Mutations PCR Reaction A H O 32 ul 5x PCR Buffer 10 ul 10mM dNTPs 1 ul Primer 1 10mM 2 5 ul Primer 5 10mM 2 5 ul Template DNA 0 2 ul DMSO 1 5 ul High Fidelity DNA polymerase 0 5 ul PCR Reaction B H O 32 ul 5x PCR Buffer 10 ul 10mM dNTPs 1 ul Primer 6 10mM 2 5 ul Primer 2 10mM 2 5 ul Template DNA 0 2 ul DMSO 1 5 ul High Fidelity DNA polymerase 0 5 ul PCR Reaction C H O 32 ul 5x PCR Buffer 10 ul 10mM dNTPs 1 ul Primer 3 10mM 2 5 ul Primer 4 10mM 2 5 ul Template DNA 0 2 ul DMSO 1 5 ul High Fidelity DNA polymerase 0 5 ul 888 266 5066 Toll Free 650 968 22
4. other required reagents for the PCR reaction The resulting PCR reactions create 2 fragments of the mutated gene of interest One is a 5 region of the mutated gene the other is a 3 region of the mutated gene The fragments have approximately 20 base pairs of overlap 20 bp overlap PCR Reaction A PCR Reaction B 2 Multiple Mutations In a multiple mutation reaction the number of PCR reactions equals one more than the number of mutations R n 1 For example if you are designing a construct with 2 mutations R 2 1 3 PCR reactions must be set up If you are designing a construct with 3 mutations 4 PCR reactions must be set up These can be set up and run simultaneously Each reaction should contain a forward primer either the forward vector primer or mutagenic primer and a corresponding reverse primer either the reverse vector or mutagenic primer Gene 4 te lt _ 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual The resulting PCR reactions create n 1 fragments of the mutated gene of interest The most 5 reaction contains the 5 region of the mutated gene the last reaction contains a 3 region of the mutated gene Each fragment has approximately 20 base pairs of overlap with the neighboring fragment 20 bp overlap 20 bp overlap PCR Reaction A PCR Reaction C PCR Reaction B 3 Other Information about PCR Conditions e When using
5. 00 outside US Page 19 System Biosciences SBI User Manual PCR Conditions for Multiple Mutations Cycle Step Temperature Initial denaturation 98 C Denaturation 98 C 30s Annealing 30s 55 C 30 Extension 20s 72 C 1 Final Extension 72 C 10 min Hold 4 C Linearize the control vector H O 40 ul 10x Buffer 2 5 ul Control vector 0 5ug ul 4 ul Nde 1 0 5 ul BamH1 0 5 ul Positive control MetaMorph reaction for multiple mutations Control vector 2ug cut with Nde1 BamH1 1 ul PCR mutation fragment A 1 ul PCR mutation fragment B 1 ul PCR mutation fragment C 1 ul dH20 4 ul 5x MetaMorph Solution 2 ul total 10 ul Page 20 ver 1 0110110 www systembio com MetaMorph Mutagenesis Kit Cat MC200 Series C Example Deletion Mutation No positive control for deletions included in the MetaMorph kit Example Deletion Mutation Deletion in a UTR for miR 145 binding site GCTAACTGAGCTAGCGAATTC AGATGGGGGAGGCTAACTGAGCTAGCGAATTCgcccttagctcatttctgaagaggacttgttgcggaaacgacgagaa cagttgaaacacaaacttgaacagctacggaactcttgtgcgtaaggaaaagtaaggaaaacgattccttctaacagaaatgtectgag tttagccat caatcacctatgaacttgtttcaaatgcatgatcaaatgcaacctcacaaccttggctgagtcttgagactgaaagatttagccat ctc t gacttt ctaaatcggta aat tttgggcataaaagaactttttt aatgtaaactgcctcaaattggactttgggcataaaagaacttttttatgcttaccatcttttttttttctttaacagatttgtatttaagaattg tta aaacccgt tttttaaaaaattttaagatttacacaatgtttctctgtaaatattgccattaaatgtaaataactttaataaaacgtttatagcagttacacaga
6. SSB er System Biosciences Mutagenesis Kit Beautiful modifications made simple MetaMorph Mutagenesis Kit Cat MC200 Series User Manual Store competent cells at 80 C Store enzymes at 20 C A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement ver 1 110110 contained in this user manual MetaMorph Mutagenesis Kit Cat MC200 Series Contents Introduction cde ee 2 A Key Features ooo sisie ee esse ee ees ieai 2 B List of Components sss 3 Ge oet ARE EER ge Hm o ttd ds 3 D Other Needed Reagents iii ie ss se ee RA Ge AA ee ee 4 E Overview of Protocol esses 4 F One day Protocol 5 IE Protocols oreet ee eet 5 A Brimer Design zer Gee Eg oe PERE gee Deeg 5 B PCR Reactions and Vector Linearization 8 C MetaMorph ReactionS iii is se ee AA Ge AA ee ee 13 Ds Transformationts EE EE Ds epe Die 14 Il Exampl6S N rein eter te etie elect 15 A Positive Contol for Insertions iese ee ee ee AA Ge AR ee 15 B Positive Control for Multiple Mutations 18 C Example Deletion Mutation seseeseeeeee 21 D Sample Mutagenesis Results sss 22 IV Troubleshooting sess 23 Vs Technical Support eiae et 25 VI L
7. ains the mutagenic bases Melting Temperature of Primers for Point Mutations and Insertion Mutations The Tm for primers for point mutations and insertion mutations should be calculated using only the 20 bases that are 3 of the mutagenic site The mutagenic base s and the 10 bp that are 5 of the mutation site should not be included in the calculation for Tm 2 Generating Deletion Mutations Forward and Reverse Vector Primer Design The forward vector primer in red should be generated to the positive strand of DNA and should contain 20 bases corresponding to the vector sequence leading up to the restriction site where the gene of interest has been inserted The reverse vector primer in blue should be generated to the negative strand of DNA and should also contain 20 bases complimentary to the vector sequence leading up to the restriction site where the gene of interest has been inserted Page 6 ver 1 0110110 www systembio com MetaMorph Mutagenesis Kit Cat MC200 Series I0bp 20 bp EN Gene 20 bp 10 bp Mutagenic Primers The reverse mutagenic primer in red should be generated to the negative strand of DNA and should contain 10 bases 5 of the mutation remove the bases you wish to delete and then 20 bases 3 of the mutation site The forward mutagenic primer in blue should be generated to the positive strand of DNA and should contain 10 bases 5 of the mutation remove the bases you wish to delet
8. e and then 20 bases 3 of the mutation site The forward and reverse mutagenic primers therefore have a region of 20 bases that is entirely complimentary and do not contain the bases intended for deletion Melting Temperature for Deletion Mutation Primers The T of the primers for deletion mutations should be calculated using the 20 base pairs of homology in the 3 region The 10 base pairs that are homologous to the 5 region will not affect the Tm 3 Generating Multiple Mutations Forward and Reverse Vector Primer Design The forward vector primer in red should be generated to the positive strand of DNA and should contain 20 bases corresponding to the vector sequence leading up to the restriction site where the gene of interest has been inserted The reverse vector primer in green should be generated to the negative strand of DNA and should also contain 20 bases complimentary to the vector sequence leading up to the restriction site where the gene of interest has been inserted 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual Le m Gene y se lt t d Mutagenic Primers The reverse mutagenic primer 1 in red should be generated to the negative strand of DNA and should contain 10 bases 5 of the mutation the mutation base substitution or deletion and then 20 bases 3 of the mutation site The forward mutagenic primer 1 in blue s
9. ences SBI User Manual e After completion of the PCR reaction gel purify the appropriate band to remove any extra primers or primer dimmers that will inhibit the reaction We recommend the QlAquick PCR Purification Kit Cat 28106 Qiagen 4 Linearize the Vector While the PCR reactions are running the vector containing the wild type gene of interest should be linearized with restriction enzyme s to release the gene of interest and should then be gel purified We recommend using 2 ug of plasmid in a 50 ul reaction volume for the restriction digest Page 12 ver 1 0110110 www systembio com MetaMorph Mutagenesis Kit Cat MC200 Series C MetaMorph Reactions Set up the following reactions in a 1 5 ml sterile reaction tube by mixing the following reagents gently Spin down briefly to collect the reagents at the bottom of the tube 1 Mutagenesis Reaction Linearized destination vector 10 100ng ul 1u PCR insert s 20 200ng ul for each PCR Product 1ul dH O yl 5x MetaMorph Solution 2ul total 10ul 2 Negative Control Control vector 2ug cut with Nde1 BamH1 1ul dH O 7ul 5x MetaMorph Solution 2ul total 10ul A 2 1 or 1 1 molar ratio of insert vector works well in the MetaMorph reaction For reactions with larger volumes of vector and insert gt 8ul of vector 4 insert double the amount of reaction buffer and enzyme and add dH 0 for a total volume of 20ul When using the MetaMorph Mutagenesis Kit for the fir
10. es B List of Components 10 Kit Component Reactions High Fidelity DNA Polymerase 5 yl 5x PCR Buffer 100 ul Control primer 1 10 uM 25 ul Control Primer 2 10 uM 25 yl Control Primer 3 10 pM 25 ul Control Primer 4 10 uM 25 yl Control Primer 5 10 pM 25 ul Control Primer 6 10 uM 25 ul Control Plasmid 0 5 mg ml 10 ul dNTP mix 10mM 10 ul 5x MetaMorph Solution 20 ul Competent Cells 10 vials C Storage 80 C for competent cells 20 C for the enzyme 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual D Other Needed Reagents e Gene specific primers e DMSO e QlAquick PCR Purification Kit Cat 4 28106 Qiagen e QlAquick Gel Extraction kit Cat 28704 Qiagen e SOC or LB Broth for transformation of bacteria e LB Antibiotic plates depending upon your specific plasmid E Overview of Protocol D Primer Design s wk Gene E e PCR Amplification of Mutation Fragments 20 bp overlap PCR Reaction A PCR Reaction B Cut Original Vector at the Restriction Site Gene insert will be cut out Gene e Fusion of Mutated PCR Products and Vector es Vector LEGEND yt Mutation site Single Restriction Site Forward Primers Reverse Primers Page 4 ver 1 0110110 www systembio com MetaMorph Mutagenesis Kit Cat MC200 Series F One day Protocol 9 00 am 1 00 pm PCR Amplification of mutations and restrictio
11. g Cat MC200 Series transformation reaction Problem Probable cause Solution Check primer sequences to Primer ensure that they follow the sequences are incorrect rules of primer design as described in the manual Optimize your PCR amplification reactions so Suboptimal PCR that you generate pure PCR product products Use a different method to i Nooriew purify your PCR product colonies Low DNA It is imperative to obtain as E from concentration in high a DNA concentration as e possible in your reaction Inhibitory contaminants from PCR product or linearized vector Both the PCR products and the linearized vector should be purified Transform with too much reaction mixture Do not add more than 104 of reaction mixture to 504 of competent cells Too much reaction mixture inhibits the transformation 888 266 5066 Toll Free 650 968 2200 outside US Page 23 System Biosciences SBI User Manual Problem Probable cause Solution Handle competent cells gently Do not re freeze cells after thawing L i Quality of competent cells Ow nd n or may be tested by poor hand on transforming a circular competent Cells plasmid to determine cells competency Competent cells with a transformation efficiency of 2 1x10 cfu ug are recommended W ibioti Tg eoo Choose plates with the or too much Mar appropriate concentration of antibiotic in the
12. hould be generated to the positive strand of DNA and should contain 10 bases 5 of the mutation the mutation base substitution or deletion and then 20 bases 3 of the mutation site The reverse mutagenic primer 2 in blue should be generated to the negative strand of DNA and should contain 10 bases 5 of the second mutation the mutation base substitution or deletion and then 20 bases 3 of the second mutation The forward mutagenic primer 2 in green should be generated to the positive strand of DNA and should contain 10 bases 5 of the second mutation the mutation base substitution or deletion and then 20 bases 3 of the second mutation The sets forward and reverse mutagenic primers therefore have a region of 20 bases that is entirely complimentary and contain the desired respective mutations B PCR Reactions and Vector Linearization 1 Single Point Insertion and Deletion Mutations In a single mutation reaction 2 PCR reactions must be set up You can set them up and run them simultaneously Page 8 ver 1 0110110 www systembio com MetaMorph Mutagenesis Kit Cat MC200 Series PCR Reaction A This reaction should contain the forward vector primer and the reverse mutagenic primer in addition to the template DNA and other required reagents for the PCR reaction PCR Reaction B This reaction should contain the forward mutagenic primer and the reverse vector primer in addition to the template DNA and
13. icensing and Warranty sse 26 888 266 5066 Toll Free 650 968 2200 outside US Page 1 System Biosciences SBI User Manual Introduction The MetaMorph Mutagenesis Kit is a simple rapid and highly efficient PCR based mutagenesis kit It allows you to create single and multiple point mutations deletions or insertions using an easy one day protocol Mutagenic PCR fragments are generated with a high fidelity DNA polymerase mutagenic primers and vector primers The mutagenic primers are designed to incorporate the mutation insertion or deletion Vector primers are designed to have 20bp homology to the linearized vector ends The mutagenic PCR fragments fuse to create the final mutated gene of interest The kit is so robust that multiple mutagenic DNA fragments can be assembled simultaneously and cloned into one construct in a single step The system is highly efficient with more than 9096 efficiency for single mutations without unwanted mutations being introduced A Key Features e Effective for both single and multiple mutation sites e Introduce point mutations deletions or insertions e Complete mutagenesis within one day e Only one transformation step required e May be used with any vector e Methylation independent e Compatible with all strains of competent E coli cells e Unwanted additional mutations are minimized Page 2 ver 1 0110110 www systembio com MetaMorph Mutagenesis Kit Cat MC200 Seri
14. n digest of vector 1 00 2 00 pm Run gel gel purify PCR products and linearized vector 2 00 2 30 pm Reaction Incubation 2 30 4 00 pm Transformation Protocols A Primer Design 1 Generating Single Point Mutations or Insertion Mutations Forward and Reverse Vector Primer Design The forward vector primer in red should be generated to the positive strand of DNA and should contain 20 bases corresponding to the vector sequence leading up to the restriction site where the gene of interest has been inserted The reverse vector primer in blue should be generated to the negative strand of DNA and should also contain 20 bases complimentary to the vector sequence leading up to the restriction site where the gene of interest has been inserted 8 Gene 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual Mutagenic Primers The reverse mutagenic primer in red should be generated to the negative strand of DNA and should contain 10 bases 5 of the mutation the mutagenic bases and then 20 bases 3 of the mutation site The forward mutagenic primer in blue should be generated to the positive strand of DNA and should contain 10 bases 5 of the mutation the mutagenic or inserted bases and then 20 bases 3 of the mutation site The forward and reverse mutagenic primers therefore have a region of 20 bases that is entirely complimentary and that cont
15. ngle Mutations insertion Denaturation Annealing Extension Final Extension Linearize the Control Vector H O 40 ul 10x Buffer 2 5 ul Control vector 0 5ug ul 4 ul Nde 1 0 5 ul BamH1 0 5 ul Positive control MetaMorph reaction for single mutations Control vector cut with Nde1 BamH1 1 ul PCR mutation fragment A 1ul PCR mutation fragmentB Tul dH20 5 ul 5x MetaMorph Solution 2 ul Total 10 ul 888 266 5066 Toll Free 650 968 2200 outside US Page 17 System Biosciences SBI User Manual B Positive Control for Multiple Mutations Positive Control for Multiple Mutation 1 Point mutation changes 2 bases and introduces a BamHI restriction site 2 Insertion adds 3 bases and introduces a new Ndel restriction site GTACTGAGAGTGCACCATATG CAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCA GGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCC AGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGT TGTAAAACGACGGCCAGTGAAT TCatggagagcgacgagagcggcctgcccgccatggagatcgagtgccgcatcaccggca ccctgaacggcgtggagttcgagctggtgggcggcggagagggcacccccaagcagggccgcatgaccaacaagatgaagagcacca cacttcgg at cctaccccagcggctacgag aaggcgccctgaccttcagccectacctgetgagecacgtgatgggctacggcttctaccac ttcgg a cctaccccageggctacgagaac gatgccgaagatggtgaagcc ta ggatggg gtgagcttca tat gctaccgctacgaggccgg cecttectegtgergcacgtyagettca JN gctaccgctacgaggecggecgegtgatcggcgacttcaaggtggt ggcaccggette
16. oll Free Fax 650 968 2277 E mail General Information info systembio com Technical Support tech systembio com Ordering Information orders systembio com System Biosciences SBI 1616 North Shoreline Blvd Mountain View CA 94043 888 266 5066 Toll Free 650 968 2200 outside US Page 25 VI System Biosciences SBI User Manual Licensing and Warranty Limited Use License Use of the MetaMorph Mutagenesis Kit i e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein SBI has pending patent applications related to the Product For information concerning licenses for commercial use contact SBI Limited Warranty SBI warrants that the Product meets the specifications described in the accompan
17. st time we strongly recommend that you perform the positive and negative control reactions in parallel with your experimental samples The specific reaction conditions are found in Section Ill of this manual 3 MetaMorph Reaction Incubation 1 10 minutes at room temperature 2 10 minutes one ice 888 266 5066 Toll Free 650 968 2200 outside US Page 13 System Biosciences SBI User Manual Transformation Add 50ul competent cells to the cloning mixture Incubate on ice for 20 minutes Heat shock at 42 C for 50 seconds Transfer on ice for 2 minutes Add 250ul S O C medium or LB broth Incubate at 37 C for an hour Take 100ul culture spread on pre warmed 37 C culture plate containing the appropriate antibiotic for your plasmid 8 Incubate the plate at 37 C overnight DOO Bi p Page 14 ver 1 0110110 www systembio com MetaMorph Mutagenesis Kit Cat MC200 Series Ill Examples A Positive Contol for Insertions Positive Control for Insertion Introduces a new Ndel restriction site GTACTGAGAGTGCACCATATG CAGATTGTACTGAGAGTGCACCATATGCGGTGTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCA GGCGCCATTCGCCATTCAGGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCTTCGCTATTACGCC AGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAGTTGGGTAACGCCAGGGTTTTCCCAGTCACGACGT TGTAAAACGACGGCCAGTGAAT TCatggagaqgcgacgagagcggcctgcccgccatggagatcgagtgccgcatcaccggca ccctgaacggcgtggagttcgagctggtgggcggcggagagggcacccccaagcagggccgcatgaccaacaagatgaagagcacca aaggcgccctgaccttcagcccctacctgc
18. tgagccacgtgatgggctacggcttctaccacttcggcacctaccccagcggctacgagaac gtgagcttca tat gctaccgctacgaggccgg cecttectegtgercacgtyagcttca JN gctaccactacgaggecggecgegtgatcggcgacttcaaggtogtaggcaceggette gcacgacgtgcactcgaagt ata cgatggc cccgaggacagcgtgatcttcaccgacaagatcatccgcagcaacgccaccgtggagcacctgcaccccatgggcgataacgtgctggtg ggcagcttcgcccgcaccttcagcctgcgcgacggcggctactacagcttcgtggtggacagccacatgcacttcaagGGATCCTCTAG CCTAGGAGATC AGTCGACCTGCAGGCATGCAAGCTTC TCAGCTGGAC LEGEND Primer1 GTACTGAGAGTGCACCATATG Vector sequence CAPS Insert sequence lower case Primer2 cggtagcatatgaagctcacgtgcagcacg Yellow Ndel site Reaction A Reaction B Primer3 gtgagcttcatatgctaccgctacgaggccgg Mutation site Primer4 CAGGTCGACTCTAGAGGATCC gt PCR Reaction A Primers PCR Reaction B Primers 888 266 5066 Toll Free 650 968 2200 outside US Page 15 System Biosciences SBI User Manual PCR Reactions Single Mutations insertion PCR Reaction A H O 5x PCR Buffer 10mM dNTPs Primer 1 10mM Primer 2 10mM Template DNA DMSO High Fidelity DNA polymerase PCR Reaction B H O 5x PCR Buffer 10mM dNTPs Primer 3 10mM Primer 4 10mM Template DNA DMSO High Fidelity DNA polymerase Page 16 32 ul 10 ul 1 ul 2 5 ul 2 5 ul 0 2 ul 1 5 ul 0 5 ul 32 ul 10 ul 1 ul 2 5 ul 2 5 ul 0 2 ul 1 5 ul 0 5 ul ver 1 0110110 www systembio com MetaMorph Mutagenesis Kit Cat MC200 Series PCR Conditions Si
19. the MetaMorph Mutagenesis Kit for the first time we strongly recommend that you perform the positive control reactions in parallel with your experimental samples The PCR reactions and conditions for the positive controls can be found in Section IIl of this manual e The PCR fragments for the mutated cDNA of interest should be generated with the high fidelity DNA polymerase that is included in the kit Use of a substituted DNA polymerase will decrease the efficiency of the MetaMorph Mutagenesis kit e Specific PCR reaction conditions should be optimized for the CDNA of interest Page 10 ver 1 0110110 www systembio com MetaMorph Mutagenesis Kit Cat MC200 Series Recommended PCR conditions for a 50 pl reaction Component H2O 5x PCR Buffer dNTPs 10 mM Primer A 10 uM Primer B 10 uM Template DNA DMSO High Fidelity DNA polymerase from kit Volume Add to 50 ul 10 ul 1 ul x ul x ul x ul 1 5 ul Recommended PCR Program 0 5 ul Cycle Step Temperature Time Cycles Initial denaturation 98 C 3 min 1 Denaturation 98 C 30s 30 Annealing ee 10 30s Extension 72 C 15 30s kb Final Extension 72 10 min 1 4 C Hold For primers with 20nt anneal for 10 30s at 3 C plus the Tm of lower primer For primerss 20nt use an annealing temperature equal to the Tm of the lower primer 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosci
20. ying Product Analysis Certificate If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with a refund This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose Page 26 ver 1 0110110 www systembio com MetaMorph Mutagenesis Kit Cat MC200 Series SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2010 System Biosciences SBI All Rights Reserved 888 266 5066 Toll Free 650 968 2200 outside US Page 27
Download Pdf Manuals
Related Search
Related Contents
Des études à l`emploi - Arts - Université Paris 1 Panthéon Manual LED dashboard Ficha técnica Lanzarote ceniza Ficha Técnica TABLAROCA® Normal 取扱説明書 Windows NT4.0編 ÿþM icrosoft W ord - ×e0‡. doc Les réseaux, tisser son réseau : mode d`emploi. Copyright Notice: Disclaimer: inscription vide-grenier par courrier Copyright © All rights reserved.
Failed to retrieve file