Home
User Manual
Contents
1. ASBI System Biosciences Clone it Enzyme free Lentivectors Cat Cat Cat Cat Cat Cat Cat Cat ver 2 131008 LF520A 1 cDNA LF521A 1 cDNA LF522A 1 miRNA precursor LF522B 1 miRNA precursor LF523A 1 shRNA LF524A 1 shRNA LF527A 1 shRNA LF528A 1 Reporter User Manual Store kit at 20 C on receipt A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement contained in this user manual Contents l Introduction and Background A Purpose ofthisManual _ _ __s si i i B Advantages of the Lentivector Expression System _s_ C Features and Benefits of the Clone it Lentivectors _ D Mechanism of Clone it Lentivectors __ss E Ust of f Oom ponen L _ _ss l F Additional Required Materials __ fef l LL G Safety Guidelines ss see Il Protocols A Clone it cDNA miRNA Reporter Lentivectors _ _____ B Clone it shRNA Lentivectors _ i sr i sisrsir lll Troubleshooting oo IV References ss V Appendix A Map and Features of the Vectors Vi Clone it Enzyme free Lentivectors 888 266 5066 Toll Free 650 968 2200 outside US Oo owWNN N Page 1 System Biosciences SBI User Manual Introduction and Background A Purpose of this Manual This manual provides detailed information on how to buil
2. Cat 11668 027 For Packaging of Clone it Constructs in Pseudoviral Particles e In order to package your Clone it constructs into VSV G pseudotyped viral particles we recommend using the pPACKH Lentivector Packaging Kit SBI Cat LV500A 1 The protocols for packaging and transduction of packaged pseudoviral particles are provided in the Lentivector Expression System User Manual e 293 Producer Cell Line Recommended SBI 293TN Cell Line Cat LV900A 1 or ATCC 293 Cells Cat CRL 11268 e Transfection Reagent Recommended Invitrogen Lipofectamine Cat 18324 111 and Plus Reagent Cat 11514 015 G Safety Guidelines SBI s Expression lentivectors together with the pPACK packaging plasmids comprise the third generation lentiviral expression system The HlV based lentivectors are based on the vectors developed for gene therapy applications by Dr J G Sodroski US patent 5 665 577 and 5 981 276 Both FlV based and HIV based lentivector systems are designed to maximize their biosafety features which include e A deletion in the enhancer of the U3 region of 3 LTR ensures self inactivation of the lentiviral construct after transduction and integration into genomic DNA of the target cells e The RSV promoter in HIV based vectors and CMV promoter in FlV based vectors upstream of 5 LTR in the lentivector allow efficient Tat independent production of viral RNA reducing the number of genes from HIV 1 that are used
3. The oligos are then mixed heat and cooled to form the nicked cohesive ended shRNA insert Fig 5 Page 4 ver 2 131008 www systembio com Clone it Enzyme free Lentivectors Oligo 1 GAGGCAGCAGAGACCGGACTCCAGTGGTAATCTAC Oligo 2 TCTGACAGGAAGGTAGATTACCACTGGAGTC Sligo 3 CTTOCCOTGTCAGAGTAGATTACCACTGGAGTCEEEEE Oligo d CGAACAGAGAGAGACCGasaaaGACTCCAGTGGTAATCTAC J Cassette 1 GAGCCAGCAGAGACCGGACTCCAGTGGTAATCTAC CTGAGGTCACCATTAGAT GGAAGGACAGTCT Cassette 2 CTTCCTGTCAGAGTAGATTACCACTGGAGTCEttte CATCTAATGOTGACCTCAGaaaaaGCCAGAGAGAGACAAGG ShpSs3 insert GAGCGGCGCACCAGAGACCCOCACTCCACOCTCOCOCTAATCTACCTTCCTGOGTCACGACTACATTACCACTOGAGTCOCEEttt CTGAGGTCACCATTACGATGGAAGGACAGTCOCTCATCTAATGGTGACOTCAGaaaaaGCCAGAGAGAGACAAGG Fig 5 Outline of the Clone it procedure for generating the cohesive ends of the p53 shRNA insert Four desalted non phosphorylated oligos are synthesized mixed denatured and annealed by heating and cooling E List of Components All kits are shipped in dry ice and should be stored at 20 C upon receipt Properly stored kits are stable for 6 months from the date received 1 Clone it cDNA Cloning and Expression Lentivectors 1 pPS EF1 LCS T2A RFP Cat LF520A 1 2 pPS EF1 LCS T2A Puro Cat LF521A 1 2 Clone it microRNA Cloning and Expression Lentivectors 1 pPS EF1 copGFP LCS Cat LF522A 1 2 pPS EF1 RFP LCS Cat LF522B 1 oa microRNA _ Cloning Expression 3 Clone it shRNA
4. Cloning and Expression Lentivectors 1 pPS H1 LCS copGFP Cat LF523A 1 2 pPS H1 LCS Puro Cat LF524A 1 _it TM i i Clone it shRNA Cloning Expression 4 ng ul 20 ul Vector shp53 control primer1 20 uM 10 ul shp53 control primer2 20 uM 10 ul 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual shp53 control primer3 20 uM 10 ul shp53 control primer4 20 uM 10 ul 4 Clone it Reporter Lentivector 1 pPS LCS mCMV RFP Cat LF528A 1 F Additional Required Materials for Cloning e High Fidelity PCR Hot Start enzyme e g Phusion Hot Start from Finnzymes or Stratagene s PfuUltra Fusion HS DNA Polymerase e High efficiency competent E coli cells RecA Recommended Invitrogen One Shot OmniMAX 2 competent cells Cat C8540 03 e Petri plates containing LB Agar media with 50 ug ml Ampicillin For Screening Inserts and Sequencing e Taq DNA polymerase reaction buffer and dNTP mix Recommended Clontech Titanium Taq DNA polymerase Cat 639208 e PCR machine e 1 3 1X TAE Agarose gel For Purifying cDNA Constructs after Cloning e Plasmid purification kit Recommended QIAGEN Endotoxin free Plasmid Kit The following kit combinations can be used for Midi scale up to 200 g of plasmid DNA preparation of endotoxin free DNA For Transfection of Clone it Constructs into Target Cells e Transfection Reagent Recommended Invitrogen Lipofectamine 2000
5. Pairs were Used for PCR or Annealing Make sure use the right pairs of primers or oligos for staggered PCR or shRNA cassette formation 2 Low Transformation Efficiency a Low quality or poor handling of competent cells Handle the competent cells gently Many cells do not allow re freezing cells after thawed Quality of competent cells may be tested by transforming a circular plasmid to determine cells competency Use competent cells with a transformation efficiency of 1x10 colonies ug of pUC19 plasmid b Wrong antibiotic or too much antibiotic in the media The plates used for cloning should contain 50 100 ug ml ampicillin in the media 3 Degradation of the Clone it Vectors Avoid repeated freezing and thawing of the vectors The vectors can be stable if stored at 4 C up to 2 weeks and at 20 C for 6 months B Nocorrect inserts 1 PCR Products Contain Non specifically Amplified Artifacts Optimize your PCR reaction to improve the specificity Screen more colonies for the correct clones C The Insert contains mutations 1 Primers oligos Contain Mutation Mutations can occur during primer oligo synthesis Screen more colonies for the correct clones 2 The Insert outside the Primer Sites Contain Mutations Screen more colonies for correct clones Alternatively use a PCR enzyme with higher fidelity or reduce the number of PCR cycles during amplification of the insert 3 The shRNA Insert Contains Mutations Screen mo
6. of each transduced target cell e PEG it Virus Precipitation Solution LV810A 1 LV825A 1 To easily concentrate Lenti and Retro viruses without ultracentrifugation C Technical Support For more information about SBI products to download manuals in PDF format or to obtain vector sequences please visit our web site http www systembio com For additional information or technical assistance please call or email us at System Biosciences SBI 1616 North Shoreline Blvd Mountain View CA 94043 Phone 650 968 2200 888 266 5066 Toll Free Fax 650 968 2277 E mail General Information info systembio com Technical Support tech systembio com Ordering Information orders systembio com VI Licensing and Warranty Statement Limited Use License Use of the Clone it Cloning Vectors e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms The purchaser of the Product is granted a limited license to use the Product under the following terms and conditions The Product shall be used by the purchaser for internal research purposes only The Product is expressly not designed intended or warranted for use in humans or for therapeutic or diagnostic use The Product may not be resold modifi
7. 0 200 bp flanking each side of the precursor miRNA for reporter it can be the whole promoter transcription responsive elements or any region of the promoter you want to characterize since the Clone it Reporter vector contains the minimum CMV promoter Once the cloning region is determined design primers 1 forward and 2 reverse with a Tm of around 55 C for amplification of the region Remember to exclude the stop codon in the reverse primer for cDNA cloning to allow for translation read through to include the C terminal T2A tag Primers 3 and 4 will be adaptor sequences GAGGCAGCAGAGACCG and CGAACAGAGAGAGACCG plus the sequence of primers 1 and 2 respectively Example 1 To clone the copGFP open reading frame Fig 6 into the Clone it cDNA cloning expression vectors the primers are as follows Primer 1 atggagagcgacgagagcgg Primer 2 gcgagatccggtggagccggg Primer 3 GAGGCAGCAGAGACCGatggagagcgacgagagcgg Primer 4 CGAACAGAGAGAGACCGgcgagatccggtggagccggg atgqgagagcgacgagageggcectgcccgccatggagatcgagtgecgcatcac eggcaccctgaacggcgtqgagttcgagctggtqggcgqgcggagagaqgcaccec a a A GOL Eee aC oer EE Ue LL CU CCANALE ecgcgctcagtcgtccaattctgcecgtgqgacggcaccgccggacceggetcca ceceggatctcgctaa Fig 6 Sequence of the copGFP open reading frame Red bold letters the forward primer binding site green bold letters the reverse primer binding site dotted line the other nucleotides of the open reading frame that are not shown in the figure Ex
8. ability is expressly limited to replacement of Product or a refund limited to the actual purchase price SBs liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2008 System Biosciences SBI 888 266 5066 Toll Free 650 968 2200 outside US Page 19
9. al practices which include Wear gloves and lab coat at all times when conducting the procedure Always work with pseudoviral particles in a Class Il laminar flow hood All procedures are performed carefully to minimize the creation of splashes or aerosols Work surfaces are decontaminated at least once a day and after any spill of viable material e All cultures stocks and other regulated wastes are decontaminated before disposal by an approved decontamination method such as autoclaving Materials to be decontaminated outside of the immediate laboratory area are to be placed in a durable leakproof properly marked biohazard infectious waste container and sealed for transportation from the laboratory e Please keep in mind that Clone it vectors can be integrated into genomic DNA and may have a risk of insertional mutagenesis 888 266 5066 Toll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual Il Protocols A Clone it cDNA miRNA Reporter Lentivectors 1 Primer design and synthesis Four primers should be designed for each insert to be cloned Desalted grade of the primers is adequate enough for the cloning and there is no need for the primers to be phosphorylated First of all determine the region of the gene you want to clone For cDNA this usually encompasses the open reading frame or any domain of the protein you want to express for miRNA precursors it is normally the genomic sequences with 10
10. ample 2 To clone the primary miRNA gene of the human miRNA hsa mir 1 2 design the following primers to amplify the genomic sequence on chromosome 18 as shown in Fig 7 Primer 1 gcaaatgatttaccattgctctac Primer 2 tctgttcatgactaggttaatttac Primer 3 GAGGCAGCAGAGACCGgcaaatgatttaccattgctctac Primer 4 CGAACAGAGAGAGACCGicigttcatgactaggttaatttac hsa mir 1 2 precursor sequence a 5 ac ugaaece ccuscu aqgaqcuaecauscuucuuuaugu ccaua u PUEDE DEPEEDTDEDEDEEEED TEED FELN ggavugg vuuuvaugquaugeaegeaaugua gguau a e U gl cguyaac Genomic chr18 reverse strand goaaatgatt taccattgot ctacattagt aagctgaatg tttcactaac 17663096 S amp Steagasaa ALEASATALE CCAtGttttt acagctaaca acttagtaat 17663048 ACCTACTCAG AGTACATACT TCTTTATGTA CCCATATGAA CATACAATSC 17662998 TATGGAATGT AAAGAAGTAT GTATTTTTGG TAGGCaataa accaccaayg 17662948 GaIAACCARA CCYIAGOCARA AGAAGOLCtt gGottctttct acgtgaatya 17662893 cogtcatatyg gtaaattaac otagtcatga acaga Fig 7 Sequences of the precursor and primary miRNA of the human has mir 1 2 Purple letters the precursor miRNA red letters the forward primer binding site green letters the reverse primer binding site blue letter in the genomic sequence hsa mir 1 2 precursor sequence Example 3 To clone the promoter region Fig 8 of the mouse gene for brain derived neurotrophic factor BDNF into the reporter vector design the following primers to amplify the genomic sequence shown in Fig 8 Page 8 ver 2 131008 www systembio c
11. c DNA e SV40 origin for stable propagation of the Clone it plasmid in mammalian cells e pUC origin for high copy replication and maintenance of the plasmid in E coli cells e Ampicillin resistance gene for selection in E coli cells Page 14 ver 2 131008 www systembio com Clone it Enzyme free Lentivectors 2 Clone it miRNA Cloning Expression Lentivector RSV 5 LTR gag RRE cPPT pPS EF1 copGFP LCS cat LF522A 1 EFio 3 ALTR l WPRE e Elongation Factor 1 EF1 promoter promotes a high level expression of a single transcript encoding copGFP Zeocin resistence gene WPRE and the precursor miRNA you have cloned in a wide variety of cell lines e Ligase free Cloning Site LCS for cloning the precursor miRNA of your choice downstream of WPRE e WPRE element enhances stability and translation of the CMV driven transcripts e SV40 polyadenylation signal enables efficient termination of transcription and processing of recombinant transcripts e copGFP selection marker provides co expression of copGFP reporter with your precursor miRNA of interest under the control of the constitutive EF1 promoter for selection or FACS analysis of transduced cells e Hybrid RSV 5LTR promoter provides a high level of expression of the full length viral transcript in producer 293 cells e Genetic elements cPPT GAG LTRs necessary for packaging transducing and stably integrating the viral expression construct into ge
12. cells The transduced expression construct is integrated into the genome of target cells and provides stable and long term expression of the transgene SBI is offering a third generation of the most popular HIV 1 based lentivector expression system which consists of three main components 1 The lentiviral expression vectors e g PPS EF1 LCS T2A RFP 2 The lentiviral packaging plasmids e g PRPACKH1 Packaging Plasmid mix 3 A pseudoviral particle producer cell line e g 293TN cells The expression lentivector contains the genetic elements responsible for packaging transduction amp stable integration of the viral expression construct into genomic DNA with expression of the target gene sequence The packaging vector provides in trans all of the proteins essential for transcription and packaging of an RNA copy of the expression construct into recombinant viral particles To produce a high titer of viral particles expression and packaging vectors are transiently co transfected into producer mammalian cells e g HEK 293 cells For a detailed description of SBI s Lentivector expression system please refer to the Lentivector Expression System user manual C Features and Benefits of the Clone it Cloning Vector As outlined in Fig 1 for cloning your promoter cDNA microRNA and shRNA of interest with the Clone it Vectors you can implement the following features and benefits Clone any part of any gene into the vectors without
13. col provided with the competent cells Plate the transformed bacteria on LB Ampicillin agar plates 9 Identify Clones with the cDNA or miRNA Insert Since the Clone it vectors have been optimized for low background cloning a negative cloning control with the vector only is not necessary Sometimes due to non specific amplified PCR products you may encounter some clones with wrong inserts To identify the correct clones containing your insert you may pick 5 well isolated colonies for plasmid purification digestion and sequencing You can digest the candidate cDNA expression clones with Xbal and EcoRI and the miRNA expression clones with Acc65lI and Not l respectively For sequencing we recommend the use of the following primers which are not provided with the kit For cDNA clones 5 CTCCACGCTTTGCCTGACCCTGCTT 3 For miRNA clones 5 TGCTCGCCTGTGTTGCCACCTGG 3 For reporter clones 5 GATTGGGGGGTACAGTGCAG 3 Page 10 ver 2 131008 www systembio com Clone it Enzyme free Lentivectors B Clone it shRNA Cloning Expression Lentivectors 1 Primer design and synthesis Four short oligos should be designed for each shRNA insert to be cloned Desalted grade is adequate enough and phosphorylation of the oligos is not required Oligo 1 is the 5 adaptor GAGGCAGCAGAGACCG followed by the sense strand of your shRNA Oligo 2 is the reverse complementary loop followed by the anti sense strand sequence Oligo 3 is the loop sequ
14. d lentiviral constructs to characterize your promoters or to express your cDNA precursor microRNA or shRNA of interest using the easiest Heat n Mix Enzyme free cloning technology For new users of these vectors please read the entire manual before starting For packaging and transduction of your cloned constructs please refer to the user manual Lentivector Expression Systems Guide to Packaging and Transduction of Target Cells For concentrating and titering your packaged lentivirus please refer to the PEG t Virus Precipitation Solution and UltraRapid Lentiviral Titer Kit user manuals respectively All these manuals are available on the SBI website www systembio com B Advantages of the Lentivector Expression System Lentiviral expression vectors are the most effective vehicles for delivering your cDNA microRNA or shRNA of interest into almost all types of mammalian model organisms as well as both dividing and non dividing cells C A Machida 2003 M Federico 2003 W C Heiser 2004 As with standard plasmid vectors it is also possible to introduce lentivector expression constructs in the plasmid form into cells with low to medium efficiency using conventional transfection protocols However by packaging the lenti construct into viral particles you can obtain highly efficient transduction of your expression constructs even with the most difficult to transfect cells such as primary stem and differentiated
15. denylation signal enables efficient termination of transcription and processing of recombinant transcripts e RFP reporter for the functionality of your promoter or transcription response element of interest as well as for selection or FACS analysis of transduced cells e SV40 origin for stable propagation of the Clone it plasmid in mammalian cells e pUC origin for high copy replication and maintenance of the plasmid in E coli cells e Ampicillin resistance gene for selection in E coli cells 888 266 5066 Toll Free 650 968 2200 outside US Page 17 System Biosciences SBI User Manual B Related Products e pPACKH1 Lentivector Packaging Kit Cat LV500A 1 Unique lentiviral vectors that produce all the necessary HIV viral proteins and the VSV G envelope glycoprotein from vesicular stomatitis virus required to make active pseudoviral particles 293TN cells SBI Cat LV900A 1 transiently transfected with the pPACKH1 and a pCDH cDNA expression construct produce packaged viral particles containing a DCDH cDNA construct e UltraRapid Lentiviral Titering Kits Cat LV960A 1 LV960B 1 The easiest kits that allow you to rapidly and accurately determine the titers of infectious pseudoviral particles that are generated with SBI s FIV and HIV lentiviral vectors or libraries They are more accurate than all other titering kits on the market as they measure the copy numbers of integrated lentiviral constructs in the genomic DNA
16. eal the combined PCR products with linear vector to make your own RNAi provided in the kit 10 min Step 5 Transformation 5 to 45 min constructs Fig 1 Flow charts of the Clone it Enzyme free cloning systems D Mechanism of the Clone it Lentivectors All the Clone it Enzyme free Cloning vectors in the kit are provided as linearized with the cohesive ends shown in Fig 2a The complementary ends Fig 2b of the inserts to be cloned can be easily generated by users either through staggered PCR for promoter cDNA and miRNA expression vectors or via traditional oligo annealing for shRNA expression vectors which will be described in detail in the protocol section a The ends of the linearized vector a Be eer ee ern CECT TC ee tT LGA EEIE BRT RT yy yl Re oy FY b The ends of the insert to be cloned GAGGCAGCAGAGACCGNNNNNNNNNNNNN NNNNNNNNNNNNNGCCAGAGAGAGACAAGC Fig 2 The cohesive ends of the linearized Clone it Enzyme free lentivectors a and inserts b The dotted lines indicate the position of the stuffer fragment that was removed during linearization at SBI Your insert sequence should be generated using the procedures described in the protocol section for directional insertion between the overhangs After mixing the linearized vector with the insert to be cloned their cohesive ends anneal together due to complementary sequences giving rise to nicked hybrid plasmids Following transformation
17. ed for resale or used to manufacture commercial products without prior written consent of SBI This Product should be used in accordance with the NIH guidelines developed for recombinant DNA and genetic research HIV Vector System This Product or the use of this Product is covered by U S Patents Nos 5 665 577 and 5 981 276 and foreign equivalents owned by the Dana Farber Cancer Institute Inc and licensed by SBI This product is for non clinical research use only Use of this Product to produce products for resale or for any diagnostic therapeutic clinical veterinary or food purpose is prohibited In order to obtain a license to use this Product for these commercial purposes contact the Office of Research and Technology Ventures at the Dana Farber Cancer Institute Inc in Boston Massachusetts USA WPRE Technology System Biosciences SBI has a license to sell the Product containing WPRE under the terms described below Any use of the WPRE outside of SBI s Product or the Products intended use requires a license as detailed below Before using the Product containing WPRE please read the following license agreement If you do not agree to be bound by its terms contact SBI within 10 days for authorization to return the unused Product containing WPRE and to receive a full credit The WPRE technology is covered by patents issued to The Salk Institute for Biological Studies Page 18 ver 2 131008 www systembio com Clone it Enz
18. ence plus the anti sense strand and the H1 terminator five consecutive Ts Oligo 4 is the 3 adaptor CGAACAGAGAGAGACCG plus five As and the sense strand For example the oligos to clone the shRNA targeting the human p53 gene are shown in Fig 8 A 1 P Sense Loop Antisense Terminator GACTCCAGTGGTAATCTACcttcctgtcagaGTAGATTACCACTGGAGTCttttt CTGAGGTCACCATTAGATGgaaggacagtctCATCTAATGGTGACCTCAGaaaaa B Oligo 1 gaggcagcagagaccgGACT CCAGTGGTAATCTAC Oligo 2 tctgacaggaagG TAGAT TACCACT GGAGTC Oligo 3 cttcctgtcagaGTAGAT TACCACTGGAGTCttttt Oligo 4 CGAACAGAGAGAGACCGaaaaaGACT CCAGTGGTAAT CTAC Fig 9 Oligos for cloning the example shRNA targeting the human p53 Panel A depicts the overall schematic of the shRNA design with the sense loop antisense and terminator sequences labeled Panel B shows the individual oligos to be designed Lower case black letters 5 adaptor green letters sense strand blue lower case letters reverse complementary loop red letters antisense strand lower case italic letters loop sequence five consecutive t H1 terminator Capitalized balck letters 3 adaptor 2 Annealing of the oligos Dilute all oligos to 20 uM in 10 mM Tris pH 8 5 In a thin walled PCR tube mix 1 ul of oligo 1 with 1 ul of oligo 2 in 18 ul of 10 mM Tris pH 8 5 buffer In another thin walled PCR tube mix 1 ul of oligo 3 with 1 ul of oligo 4 in 18 ul of 10 mM Tris pH 8 5 buffer Heat the mixture
19. in this system e Number of lentiviral genes necessary for packaging replication and transduction is reduced to three gag pol rev and the corresponding proteins are expressed from different plasmids for HIV based packaging plasmids lacking packaging signals and share no significant homology to any of the expression lentivectors pVSV G expression vector or any other vector to prevent generation of recombinant replication competent virus e None of the HIV 1 genes gag pol rev will be present in the packaged viral genome as they are expressed from packaging plasmids lacking packaging signal therefore the lentiviral particles generated are replication incompetent Page 6 ver 2 131008 www systembio com Clone it Enzyme free Lentivectors e Pseudoviral particles will carry only a copy of your expression construct Despite the above safety features use of SBI s lentivectors falls within NIH Biosafety Level 2 criteria due to the potential biohazard risk of possible recombination with endogenous viral sequences to form self replicating virus or the possibility of insertional mutagenesis For a description of laboratory biosafety level criteria consult the Centers for Disease Control Office of Health and Safety Web site at http www cdc gov od ohs biosfty obmbl4 obmbl4s3 htm It is also important to check with the health and safety guidelines at your institution regarding the use of lentiviruses and always follow standard microbiologic
20. lone it cDNA Cloning Expression Lentivectors pPS EF1 LCS T2A RFP cat LF520A 1 Puro cat LF521A 1 e Elongation Factor 1 EF1 promoter promotes a high level of co expression of your gene of interest with either the RFP or the puromycin marker in a wide variety of cell lines e Ligase free Cloning Site LCS for cloning the gene of interest downstream of the EF1 promoter e WPRE element enhances stability and translation of the CMV driven transcripts e SV40 polyadenylation signal enables efficient termination of transcription and processing of recombinant transcripts e RFP or puromycin selection marker provides co expression of aRFP or puromycin resistance gene reporter with your gene of interest under the control of the constitutive EF1 promoter for selection or FACS analysis of transduced cells e Kozak sequence optimized bases and positions for efficient translation initiation e HA tag allows for detection or purification of the protein encoded by your gene of interest e T2A tag allows for translational cleavage of your gene of interest and the RFP Puro selection marker and detection or purification of the protein encoded by your gene of interest e Hybrid RSV 5LTR promoter provides a high level of expression of the full length viral transcript in producer 293 cells e Genetic elements cPPT GAG LTRs necessary for packaging transducing and stably integrating the viral expression construct into genomi
21. n of siRNA from plasmid and viral vectors In one approach the sense and antisense strands are transcribed separately from two independent promoters and form the siRNA duplex Lee 2002 Miyagishi 2002 The second approach as employed with the Clone it shRNA Cloning Expression Vectors uses a single stranded shRNA sequence with a fold back stem loop structure also known as a hairpin that is expressed from a single promoter Abbas Terki 2002 Qin 2003 Wiznerowicz 2003 This sequence is then converted into double stranded siRNA after intracellular processing cleaves the loop Brummelkamp 2002 Paddison 2002 In both approaches the siRNA molecules are transcribed from constitutive RNA polymerase Ill promoters e U6 and or H1 and terminated with TTTTT T5 sequences Tuschl 2002 The U6 and H1 promoters are different in size but contain the same conserved sequence elements Myslinski 2001 In the Clone it shRNA Cloning and Expression Vectors the RNA polymerase III H1 promoter is used to express the shRNA sequence The shRNA template oligonucleotides are cloned into the Ligase free Cloning Site LCS located just downstream of the H1 promoter Figure 1 The linearized vectors provided contain two unique 5 overhangs to facilitate directional cloning of shRNA template oligos Figure 4 When the shRNA construct is expressed from the constitutive H1 promoter and terminated with the TTTTT sequence the shRNA transcript folds into the hai
22. ng for a proprietary fluorescent protein s intended to be used for research purposes only Any use of the proprietary nucleic acids other than for research use is strictly prohibited USE IN ANY OTHER APPLICATION REQUIRES A LICENSE FROM EVROGEN To obtain such a license please contact Evrogen at license evrogen com SBI has pending patent applications on various features and components of the Product For information concerning licenses for commercial use contact SBI Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein Limited Warranty SBI warrants that the Product meets the specifications described in the accompanying Product Analysis Certificate If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with a refund This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s li
23. nomic DNA e SV40 origin for stable propagation of the Clone it plasmid in mammalian cells e pUC origin for high copy replication and maintenance of the plasmid in E coli cells e Ampicillin resistance gene for selection in E coli cells 888 266 5066 Toll Free 650 968 2200 outside US Page 15 System Biosciences SBI User Manual 3 Clone it shRNA Cloning Expression Lentivectors RSV 5 LTR pPS H1 LCS copGFP cat LF523A 1 Puro cat LF524A 1 pUC ORI SV40 ORI p SV40 poly A 3 ALTR HL WE e H1 expression cassette provides constitutive and efficient RNA polymerase lll dependent transcription of shRNA transcripts in a wide range of cell lines e CMV promoter promotes high level expression of copGFP or puromycin N acetyl transferase drug selectable marker for detection and selection of transduced cells e Hybrid RSV 5 LTR promoter provides a high level expression of the full length viral construct in 293 cells e Genetic elements cPPT GAG LTRs necessary for packaging transducing and stable integration of the viral expression construct into genomic DNA e WPRE element enhances stability and translation of the CMV driven transcripts e Ligase free Cloning Site LCS for cloning the shRNA of interest downstream of the human H1 promoter e SV40 polyadenylation signal enables efficient termination of transcription and processing of recombinant transcripts e copGFP or puromycin
24. of the mixture into competent E coli cells the nicks of the plasmids are then ligated by cellular enzymes 1 Clone it Promoter cDNA and miRNA Lentivectors e Promoter cat LF528A 1 e cDNA cat LF520A 1 LF521A 1 e miRNA cat LF522A 1 LF522B 1 The cohesive ends of either promoter cDNA or miRNA sequences to be cloned are generated through staggered PCR de Jong et al 2006 Tillett and Neilan 1999 as outlined in Fig 3 and described in detail in the protocol section Basically two pairs of primers are designed for each template The two pairs of primers are identical except that the second pair contains either the 16 or the 17 nt tail shown in Fig 2b on their 5 ends Two PCR reactions are performed separately either using the un tailed forward primer and the tailed reverse primer or using the tailed forward primer and the un tailed reverse primer These two PCR products then create fragments containing the overhangs shown in Fig 2b after they are mixed purified through PCR clean up columns denatured and re annealed 888 266 5066 Toll Free 650 968 2200 outside US Page 3 System Biosciences SBI User Manual tag PCR t A _ OH PCR2 ee GAGGC AGC AGAGACEG GC CAG AG AGAGAC RAGC Fig 3 Inserts with cohesive ends complementary to the ends of the linearized Clone it vectors generated by staggered PCR 2 Clone it shRNA Cloning Expression Vectors Two approaches have been developed for in vivo expressio
25. om Clone it Enzyme free Lentivectors Primer 1 caaagcatgcaatgccctgg Primer 2 cacctttttcagtcactacttgtc Primer 3 GAGGCAGCAGAGACCGcaaagcatgcaatgccctgg Primer 4 CGAACAGAGAGAGACCGcaccittttcagtcactacttgtc CAAAGCATGCAATGCCCTGGAACGCAATICTICTAAT AAAAGATGCTATCATI TTAAATGCGC GGAATICTGATT CTGGTAATTCGT GCACTAGAGTGICTATTITICGASCCAGAGCAGGCTAT CATAT GACAGCTICAC GTICAAGGCAGCG TCCGAGCCCCTCTC CIGGACTCCC ACCCACTTICCCATT CACC CACGAGAGC ZAC TCCTC GCCOCTCCCICTCCCO CC ACCCACCCCCGGCGAGC TAGCATGAAATCTCCCAGTC TCTGC CTAGA TCAAATGGAG CTTCTCACTGAAGGC GT GOCGAGTATTACC TCCGCCATGC AATTTCCACTATCAATAATT TAACT TCTTTGCTGAAGAAC AGGACTACAT AT CGCCCAC CAAAGACTCGCCCCCCTCCCCCTTITAACT GAACAGAAGG CGAAATATATAGTAAGAGIC TAGAACC TIGGGGACCGSTICTICCCCAGAGCAGC TGCCTTGATOTITAC TTTGACAAGT AGT GAC GAA AAACGTG Fig 8 Sequences of the promoter region of the mouse gene for brain derived neurotrophic factor BDNF to be cloned Red letters the forward primer binding site green letters the reverse primer binding site Example 4 To clone the transcription response element consensus sequence cctttgatcttaccagctaac that responds to transcriptional activation by TCF LEF1 into the reporter vector design the following oligos Oligo 1 GAGGCAGCAGAGACCGcctittgatcttaccagctaac Oligo 2 CGAACAGAGAGAGACCGoattagctggtaagatcaaagg where the red letters are the consensus TCF LEF1 transcription response element sequence and the green letters are its reverse complementary sequence 2 Amplification of
26. plate is either genomic DNA cDNA or a plasmid lacking the ampicillin resistance gene skip this step 888 266 5066 Toll Free 650 968 2200 outside US Page 9 System Biosciences SBI User Manual 4 Check the success of PCR amplification Run 5 ul of each PCR reaction on an agarose gel to ensure that your insert of interest is specifically amplified 5 Cleaning the PCR products Combine the two successfully amplified PCR products for each insert and clean the mixture with a PCR Cleaning Kit Elute with 30 ul of 10 mM Tris pH 8 5 6 Annealing For transcription response element cloning mix 1 ul of 10 uM Oligo1 and Oligo2 in 18 ul of 10 mM Tris pH 8 5 Heat the mixture at 95 C for 5 and let it cool down to room temperature in the PCR machine gradually over 20 For promoter cDNA miRNA cloning heat the cleaned PCR mixture at 95 C for 5 and let it cool down to room temperature in the PCR machine gradually over 20 7 Mix the vector and insert to be cloned Mix 1 ul of the 4 ng ul linear Clone it cDNA miRNA or reporter vector of your choice with 2 ul of the above annealed PCR products or oligo mixture from step 6 Heat in a PCR machine at 55 C for 2 Incubate the tube at room temperature for 5 and then place on ice for at least 2 8 Transformation Transform competent cells with a transformation efficiency of at least 1x10 colonies g pUC19 with the whole mixture 3 ul from step 7 following the proto
27. re colonies for correct clones Always adhere to the recommended temperatures for denaturing annealing the oligos and for incubation of the annealed oligo vector mixture If the problem cannot be solved by these measures check the oligo design and re synthesize the oligos Page 12 ver 2 131008 www systembio com Clone it Enzyme free Lentivectors IV References de Jong RN et al Enzyme Free Cloning for high throughput gene cloning and expression 2006 J Struct Funct Genomics 7 109 118 Tillett D and Neilan BA Enzyme free cloning a rapid method to clone PCR products independent of vector restriction enzyme sites 1999 Nucleic Acids Research 27 e26 e26 Viral vectors for gene therapy Methods and Protocols Eds C A Machida 2003 Humana Press Methods in Molecular Biology Volume 246 Gene delivery to mammalian cells Volume 2 Viral Gene transfer techniques Ed by W C Heiser 2004 Humana Press Methods in Molecular Biology Volume 229 Lentivirus gene engineering protocols Ed by M Federico 2003 Humana Press Li MJ Rossi JJ Lentiviral vector delivery of recombinant small interfering RNA expression cassettes Methods Enzymol 2005 392 218 26 Davidson BL Harper SQ Viral delivery of recombinant short hairpin RNAs Methods Enzymol 2005 392 145 73 888 266 5066 Toll Free 650 968 2200 outside US Page 13 System Biosciences SBI User Manual V Appendix A Maps and Features of the Vectors 1 C
28. rpin structure which is recognized by the DICER enzyme cleaved to form a functional double stranded siRNA and transferred to a RISC complex for selective digestion of complementary target mRNAs Figure 4 Reverse 1 f Sica P Sense Loop Antisense Terminator GACTCCAGTGGTAATCTACcttcctgtcagaGTAGATTACCACTGGAGTCttttt CTGAGGTCACCATTAGATGgaaggacagtctCATCTAATGGTGACCTCAGaaaaa Transcription ttc 5 GACUCCAGUGGUAAUCUAC t shRNA transcript 3 uuCUGAGGUCACCAUUAGAUG 9 Tac Fig 4 Example shRNA construct targeting the p53 gene The nucleotides for the specific siRNA sequence targeting the p53 gene are shown in capital letters The shRNA sense and antisense sequences flank the region coding for the loop structure In addition the terminator sequence ttttt for the RNA polymerase Ill is included after the antisense portion The Forward and Reverse arrows refer to the PCR primers contained in the vector to confirm positive clones After transcription a stem loop stem shRNA molecule is produced This molecule is processed by the DICER enzyme to generate a double stranded siRNA effector In order to clone such an shRNA expression cassette into the Clone it shRNA expression vectors instead of synthesizing two 65 nt oligos required for the conventional ligase dependent method we recommend the design and synthesis of four short oligos as depicted in Fig 5 This approach is more cost effective and is more accurate and efficient
29. s at 95 C for 2 and then let the mixture cool down to room temperature in the PCR machine gradually over 20 3 Combining the vector and annealed oligo mixtures to be cloned Mix 1 ul of the 4 ng ul linear Clone it shRNA expression vector of your choice with 1 ul each of the above annealed oligo Heat the vector oligo mixture in a PCR machine at 40 C for 2 Incubate the tube at room temperature for 5 and then on ice for at least 2 4 Transformation Transform competent cells with a transformation efficiency of at least 1x10 colonies ug pUC19 with the whole mixture 3 ul from step 3 following the protocol provided with the competent cells Plate the transformed bacteria on LB Ampicillin agar plates 5 Identifying Clones with the shRNA Insert Since the Clone it vectors have been optimized for low background cloning a negative cloning control with the vector only is not necessary To identify the correct clones containing your insert you may pick 4 6 well isolated colonies for plasmid purification digestion and sequencing For double digestion of the candidate shRNA expression clones use BamHI and EcoR I For sequencing we recommend the following primer which is not provided with the kit 5 TGCATGTCGCTATGTGTTCTGGGA 3 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual lll Troubleshooting A Noor low number of colonies on plates 1 Wrong Primer oligo
30. selection marker provides expression of copGFP or puromycin resistance gene reporter under the control of the constitutive CMV promoter for selection or FACS analysis of transduced cells e SV40 origin for stable propagation of the Clone it plasmid in mammalian cells e pUC origin for high copy replication and maintenance of the plasmid in E coli cells e Ampicillin resistance gene for selection in E coli cells Page 16 ver 2 131008 www systembio com Clone it Enzyme free Lentivectors 4 Clone it Reporter Lentivectors RSV 5 LTR cPPT LCS mCMV reporter pUC ORI 6780bp mcMV cat LF528A 1 SV40 ORI RFP SV40 poly A 3 ALTR WPRE e MCMV promoter minimum CMV promotes high level expression of RFP for detection and selection of transduced cells only if a functional promoter or transcription response element is cloned at the LCS of the vector and the correspondent transcription factor is expressed in the cells e Hybrid RSV 5 LTR promoter provides a high level expression of the full length viral construct in 293 cells e Genetic elements cPPT GAG LTRs necessary for packaging transducing and stable integration of the viral expression construct into genomic DNA e WPRE element enhances stability and translation of the CMV driven transcripts e Ligase free Cloning Site LCS for cloning the promoter or transcription response element of interest upstream of the mCMV promoter e SV40 polya
31. the insert to be cloned For transcription response element cloning skip this step and proceed to step 6 Annealing of this protocol Set up two PCR reactions for each insert to be cloned using the conditions suitable for the high fidelity PCR polymerases of your choice IMPORTANT Use only proof reading enzymes which generate blunt end PCR products The following sample conditions are optimized with the Stratagene PfuUltra Fusion HS DNA Polymerase to clone the control copGFP open reading frame into the vectors Master Mixture ul reaction Water 19 2 10x PfuUltra II buffer 2 5 DMSO 0 7 10 mM dNTP 0 6 PfuUltra Il polymerase 0 5 PCR reaction 1 23 5 ul Master Mixture 0 5 ul 10 uM primer 1 0 5 ul 10 uM primer 4 0 5 ul template containing 10 ng of plasmid 50 500 ng of cDNA or 200 ng of genomic DNA PCR reaction 2 23 5 ul Master Mixture 0 5 ul 10 uM primer 2 0 5 ul 10 uM primer 3 0 5 ul of template the same template used in PCR reaction 1 containing 10 ng of plasmid 50 500 ng of cDNA or 200 of ng genomic DNA Program 1X 95 C 2 25 32 X 95 C 20 55 C 20 72 C 2 Extension times may vary depending on the size of the insert and the PCR enzyme you use 1X 72 C 3 3 Degradation of template plasmid If the template used is a plasmid containing an ampicillin resistant gene add 0 25 ul Dpnl into each PCR reaction Incubate at 37 C for 1 hour Otherwise if the tem
32. the need for checking restricting cutting sites Eliminate the need for restriction digestion ligation or topoisomerase reactions for cloning Totally enzyme free when cloning shRNAs Nearly 100 cloning efficiency Directional and in frame with tag s and selection marker s built into the vectors Simplest procedure just involving standardized heating and mixing No optimization is needed if protocols in this manual are strictly followed Short hands on time and amenable to high throughput cloning No recombination errors The constructs created are ready to be used directly for transfection or lentiviral packaging Except for the use of Dpnl to remove template DNA if plasmid is used in the PCR Page 2 ver 2 131008 www systembio com Clone it Enzyme free Lentivectors Cloning of cDNA or microRNA Cloning of short hairpin RNA Step Amplify the inserts to be cloned Step Generate inserts containing using staggered PCR cohesive ends by mixing heating and cooling down the four oligos for each insert to be cloned 30 min Step 2 Confirm the success of PCR on agarose gel 20 min y Step 2 Mix and anneal the oligos with the linear vector provided in Step 3 Generate inserts containing the kit 10 min cohesive ends by combining cleaning heating and cooling f down the two PCR products of each insert to be cloned 30 Step 3 Transformation 5 to 45 min min The easist and fastest method Step 4 Mix and ann
33. yme free Lentivectors SBI grants you a non exclusive license to use the enclosed Product containing WPRE in its entirety for its intended use The Product containing WPRE is being transferred to you in furtherance of and reliance on such license Any use of WPRE outside of SBI s Product or the Product s intended use requires a license from the Salk Institute for Biological Studies This license agreement is effective until terminated You may terminate it at any time by destroying all Products containing WPRE in your control It will also terminate automatically if you fail to comply with the terms and conditions of the license agreement You shall upon termination of the license agreement destroy all Products containing WPRE in you control and so notify SBI in writing This License shall be governed in its interpretation and enforcement by the laws of California Contact for WPRE Licensing The Salk Institute for Biological Studies 10010 North Torrey Pines Road La Jolla CA 92037 Attn Office for Technology Management Phone 858 435 4100 extension 1275 Fax 858 450 0509 CMV Promoter The CMV promoter is covered under U S Patents 5 168 062 and 5 385 839 and its use is permitted for research purposes only Any other use of the CMV promoter requires a license from the University of lowa Research Foundation 214 Technology Innovation Center lowa City IA 52242 CopGFP Reporter This product contains a proprietary nucleic acid codi
Download Pdf Manuals
Related Search
Related Contents
Netgear WGR826V User's Manual NucleoBond® Xtra BAC - MACHEREY Eizo S2411W-U User's Manual こちらからダウンロードください。 remboursés Downloading - MEDION USA Manual de Instrução Severin FR 2419 deep fryer Manual de insatalación L`imprimante laser monochrome multifonction Dell 2355dn Copyright © All rights reserved.
Failed to retrieve file