Home

Preprint Roma

1. N z a v k La pb WT TTT WT HHT moa nmr rmManwnnr moan ware Nomrmntrrteunvoonrnr ODD A colbecki shell length mm Fig 1 Comparison between the frequency of the A colbecki consumed shell length calculated from fish population structure model dotted line and the living population bars in Road Bay computed as average size structure from 1989 90 to 2012 13 Confronto tra la distribuzione di frequenza degli esemplari di A colbecki predati stimata dal modello di predazione da parte del pesce linea tratteggiata e della popolazione vivente istogrammi a Road Bay calcolata come media dal 1989 90 al 2012 2013 Conclusions Our model shows a strong impact of the predation of the fish 7 bernacchii on A colbecki size structure Impact is highest on medium A colbecki sizes and decreases towards larger as well as smaller sizes A low impact on larger Adamussium specimens is observed probably due to T bernacchii mouth gap and to the better ability of larger specimens to escape from predation On the opposite side small scallops are probably not attractive in a cost benefit ratio nor they stimulate the fish lateral line A colbecki can be preyed by other organisms like the seastar Odontaster validus and the gastropod Neobuccinum eatoni but most probably these species are far from having an effect on the scallop population size structure and no other fish have been found to feed on A colbecki only in
2. ZOPPINI A LUNGARINI S AMALFITANO S Biodegradazione della sostanza organica disciolta in aree costiere n Poster della Sessione Vari ABDELRHMAN K F A BACCI G MANCUSI C MENGONI A SERENA F UGOLINI A Indagini preliminari sul microbioma intestinale della tartaruga marina Caretta caretta Linnaeus 1758 ACQUAVIVA M L NARRACCI M STABILI L CAVALLO R A Analisi microbiologiche di un area costiera del Mar Grande di Taranto adibita ad acquacoltura ii CARACAPPA S REALE S COSENZA M GENTILE A PERSICHETTI M F ARCULEO M Variabilit del numero di piastre del carapace di Caretta caretta Linnaeus 1758 recuperate in Sicilia rain ie vecia eolie lai CAVALLARO M MONTALBANO G GUERRERA M C MADRIGRANO M AMMENDOLIA G Dati preliminari sulla struttura dei fotofori dell occhio lucente minore Diaphus holti T ning 1918 Famiglia MYGtophidae seus rire iena FERRANTI M P BETTI F BO M DE LA FUENTE MANCEBO G DI CAMILLO C G DI FRANCO A DI MARTINO E FAVA F GIACCONE T GIUSSANI V MATRONE M MUSSAT SARTOR R MUSCO L PICA D RAGAZZOLA F RENZI M SCINTO A SINAGRA A TAZIOLI S BERTOLINO M App Pinneggiando la tecnologia al servizio della biologia marina FIORENTINO F GANCITANO V GIUSTO G B MASSI D SINACORI G TITONE A VINCI A GAROFALO G Marine litter on trawlable bottoms of the Strait of
3. fish and shellfish commercial species analysed in the European Union Mediterranean waters The Authors evidenced a high interspecific spatial overlap between nursery areas mainly along the shelf break of many different sectors of the Northern Mediterranean indicating a high potential for the implementation of conservation measures Marine Protected Areas MPA and Fishery Restricted Areas FRA In MEDISEH project to answer the question up to what degree the identified critical and sensitive habitats are currently protected MPAs part of the NATURA 2000 Network parks reserves other designated types etc and FRAs were identified at the level of GSA along with information on the fishing restrictions applied in each area This revision work revealed the occurrence of 148 MPAs 336 proposed MPAs and SPAMIs Specially Protected Areas of Mediterranean Importance under the SPA BD Protocol of Barcelona Convention FRAs included EU and national gear specific closures e g for trawl purse seines and measures with a spatio temporal dimension aiming to protect marine species and habitats from fishing activities in the Mediterranean basin MEDISEH review highlighted the considerably larger extent of FRAs that mainly protect very deep grounds from trawling Fishing grounds In STOCKMED project geo referred information and data on the spatial and temporal distribution of fishing effort grounds in relation to the target species were collated and revie
4. 1200 900 l r loom b Ers 2 m 2400 j 1800 c r 1 km arina di 1200 oce San sla Ken ato Vito verde i 600 T 1100 21 2 ni o un si P m 700 l P x o i o J AP AR AU FF Fig 1 a Valori medi d s di n r 100 m grigio e n r km nero per i tratti di costa campionati b c valori medi d s di n r 100 m e di n r km per ciascuna tipologia costiera a Mean values s d of n r 100 m grey and n r km black for the ten coastal areas sampled b c mean values s d of n r 100 m and n r km for each coast type Conclusioni La divisione tipologica tra le aree costiere AU FF AP AR non sembra in grado di spiegare le variazioni nel numero di rifiuti osservate tra le spiagge pugliesi indagate tali differenze sono presumibilmente imputabili in modo pi sostanziale alle caratteristiche idrologiche correntometriche e ondametriche su scala locale e di bacino Queste ultime informazioni idrologiche dovrebbero essere dunque considerate a priori nella pianificazione del monitoraggio e nella scelta dei tratti di costa da investigare Infine se da un lato la carenza di una letteratura di riferimento rende difficoltoso stabilire in termini comparativi entit dell impatto dei rifiuti sulle spiagge pugliesi dall altro questo studio un utile punto di partenza per futuri approfondimenti anche alla luce delle richieste della MSFD Bibliografia GALGANI F HANKE G WERNE
5. Global phylogeography of the dolphinfish Coryphaena hippurus the influence of large effective population size and recent dispersal on the divergence of a marine pelagic cosmopolitan species Mol Phylogenet Evol 57 3 1209 1218 EXCOFFIER L LISCHER H E 2010 Arlequin suite ver 3 5 a new series of programs to perform population genetics analyses under Linux and Windows Mol Ecol Resour 10 3 564 567 LO BRUTTO S ARCULEO M PARRINELLO N 2004 Congruence in genetic markers used to describe Mediterranean and Atlantic populations of European hake Merluccius merluccius L 1758 J Appl Ichthyol 20 2 81 86 MAGGIO T LO BRUTTO S CANNAS R DEIANA A M ARCULEO M 2009 Environmental features of deep sea habitat linked to the genetic population structure of a crustacean species in the Mediterranean Sea Mar Ecol 30 3 354 365 PALKO B J BEARDSLEY G L RICHARDS W J 1982 Synopsis of the biological data on dolphinfishes Coryphaena hippurus and Coryphaena equiselis L FAO Fish Synopsis 130 1 28 Research realised with the financial support of RITMARE 207 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 S TROCCHIA D RABBITO A MADONNA F KH ABDEL GAWAD G GUERRIERO G CIARCIA Dipartimento di Biologia Universit di Napoli Federico II Via Mezzocannone 8 80134 Napoli Italia eclabsegreteria eclab unina it Cent
6. 24 312 318 HIMES A H 2007 Performance indicators in MPA management using questionnaires to analyze stakeholder preferences Ocean Coast Manage 50 329 351 This study is part of the EU FP7 program Monitoring and Evaluation of Spatially Managed Areas MESMA grant number 226661 www mesma org 31 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 D GRECH A CHIARORE S FIORETTI A KUMAR M MULAS M C BUIA F P PATTI Stazione Zoologica Anton Dohrn Integrative Marine Ecology P ta San Pietro 80077 Ischia NA Italy mariacristina buia szn it THE IMPORTANCE OF AN INTEGRATED APPROACH IN THE STUDY CONSERVATION AND RESTORATION OF FUCALES L IMPORTANZA DI UN APPROCCIO INTEGRATO NELLO STUDIO CONSERVAZIONE E RIPRISTINO DI FUCALES Abstract Mediterranean seascapes are changing and the reasons of the common decline experienced by engineering brown algae could be counteracted solely with a multidisciplinary approach in marine ecology Here we are presenting an integrated research programme developed for the Gulf of Naples where a long time series on the occurrence of macro algae testifies the Fucales decline Key words Cystoseira Sargassum conservation Gulf of Naples Introduction The absence of rigorous baselines can make it difficult to evaluate the current health of the marine ecosystems in particular for the shallowest subtidal habitats dominated
7. 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 XLVI La pianificazione spaziale marittima ruolo del biologo marino VOLUME DEI PRE PRINT 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 INDICE Tema La pianificazione spaziale marittima ruolo del biologo marino Relazione SCARDI M I biologi marini e la pianificazione dello spazio MATTING 2 sess lie laico alitalia Interventi Programmati BAVESTRELLO G BAVA S CANESE S CATTANEO VIETTI R CERASI S PROFETA A BO M Comunit coralligene e pesca professionale una sfida per la pianificazione territoriale marittima CALVO S LUZZU F TOMASELLO A L impiego di strumenti acustici ad alta risoluzione nella valutazione monitoraggio e gestione delle praterie di Posidonia oceanica iii FRANZESE P P RUSSO G F Contabilit ambientale e valutazione dei servizi ecosistemici strumenti per la pianificazione del territorio Marino totale piece iaia iaia leer MOSETTI R Il progetto ADRIPLAN verso una pianificazione dello spazio marittimo nella Macroregione Adriatico Ionica SPEDICATO M T Critical and Protected Habitats of the Mediterranean Sea knowledge from the MAREA Project and insights for the maritime spatial planning i Poster del Tema APPOLLONI L DI STEFANO F DONNARUMMA L ROMANO A S
8. D early auricularia E late auricularia Bar 100 um Conclusioni Il lavoro contribuisce all ampliamento delle conoscenze sulla biologia riproduttiva e dello sviluppo di questa specie Dal punto di vista applicativo il presente studio apre la strada all allevamento ex situ per la produzione massiva di giovanili da ripopolamento utilizzabili per il contenimento degli scarti di impianti di piscicoltura in gabbie galleggianti e per la produzione di biomasse a fini commerciali Bibliografia COULON P JAGOUX M 1993 Feeding rate and sediment reworking by the holothuroid Holothuria tubulosa Echinodermata in a Mediterranean seagrass bed off Ischia Island Italy Mar Ecol Progr Ser 92 201 204 KAZANIDIS G ANTONIADOU C LOLAS A P NEOFITOU N VAFIDIS D CHINTIROGLOU C NEOFITOU C 2010 Population dynamics and reproduction of Holothuria tubulosa Holothuroidea Echinodermata in the Aegean Sea J Mar Biol Assoc UK 90 5 895 901 SICURO B LEVINE J 2011 Sea cucumber in the Mediterranean a potential species for aquaculture in the Mediterranean Rev Fish Sci 19 3 299 304 TORTONESE E VADON C 1987 Oursins et Holothuries Echinodermes In Fischer W Bauchot M L Schneider M eds Fiches FAO d identification des esp ces pour les besoins de la p che R v 1 M diterran e et Mer Noire Zone de p che 37 Vol I V g taux et Invert br s FAO Rome 715 739 52 Volume pr
9. In the framework of the PROMETEOS project 64 seamounts were identified in Tyrrhenian Sea and specific morphological characteristics have been calculated for each seamount Random Forest regression technique have been applied to striped dolphin distribution aiming at assessing importance and effect of seamounts on this species Distance from seamounts together with other morphological features such as depth and distance from the coast resulted the most important variables affecting presence of striped dolphin Moreover results clearly showed that differences in the structures appeal are due to some specific seamounts characteristics slope and minimum peak depth allowing to rank mountains in terms of capacity to attract Stenella coeruleoalba and thus to possibly address management and conservation practices Key words cetacean Stenella coeruleoalba seamounts Tyrrhenian Sea Introduzione Le montagne sottomarine SM sono state recentemente riconosciute come importanti siti ecologici per la pesca la biodiversita e la conservazione in quanto sono in grado di sostenere ricchi ecosistemi e soprattutto sono hot spot di biodiversita pelagica Morato et al 2010 Ci dovuto alle interazioni delle montagne con le correnti che determinano una maggior produttivit e una particolare concentrazione di nutrienti nelle acque circostanti Questa loro caratteristica stata utilizzata per spiegare le grandi aggregazioni di diverse specie di pesci b
10. NOEL P 2002 Crustaceans decapods and stomatopods Vol 2 In Briand F ed CIESM Atlas of exotic species in the Mediterranean CIESM Monaco 192 pp GENNAIO R 2014 Diffusion of Percnon gibbesi H Milne Edwards 1853 Crustacea Decapoda Grapsidae along the South Salento Italy Thalassia Salentina 36 85 90 LICCHELLI C LICCHELLI D MOSCATELLO S DENITTO F 2011 On the occurrence of adult specimens of the crab Percnon gibbesi H Milne Edwards 1853 Decapoda Grapsidae in southern Apulia Ionian Sea Italy Thalassia Salentina 33 69 74 KATSANEVAKIS S ZENETOS A MACIC V BEQIRAJ S POURSANIDIS D KASHTA L 2011 Invading the Adriatic spatial patterns of marine alien species across the Ionian Adriatic boundary Aquat Biol 13 107 118 PIPITONE C BADALAMENTI F SPARROW A 2001 Contribution to the knowledge of Percnon gibbesi Decapoda Grapsidae an exotic species spreading rapidly in Sicilian waters Crustaceana 74 10 1009 1017 RELINI M ORSI L PUCCIO V AZZURRO E 2000 The exotic crab Percnon gibbesi H Milne Edwards 1853 Decapoda Grapsidae in the Central Mediterranean Sci Mar 64 3 337 340 97 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 G VALVASSORI A MASSA GALLUCCI M C GAMBI Stazione Zoologica Anton Dohrn Villa Comunale 81021 Napoli Italia giulia valvassori szn it REAPPRAISAL OF PLATY
11. 1 18 VAN SOEST R W M BOURY ESNAULT N HOOPER J N A RUTZLER K DE VOOGD NJ ALVAREZ DE GLASBY B HAJDU E PISERA A B MANCONI R SCHOENBERG C JANUSSEN D TABACHNICK K R KLAUTAU M PICTON B KELLY M VACELET J DOHRMANN M D AZ M C CARDENAS P 2015 World Porifera database Accessed at http www marinespecies org porifera on 2014 11 29 La ricerca stata supportata da AMP Isola dell Asinara Regione Autonoma Sardegna RAS CRP60215 Master amp Back RAS e Fondazione Banco di Sardegna 91 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 F RUBINO E CECERE A PETROCELLI A CASALE V CASALE S PASSARELLI C N R Istituto per l Ambiente Marino Costiero UOS Talassografico di Taranto Via Roma 3 74123 Taranto Italia rubino iamc cnr it Associazione ONLUS Mare per Sempre Taranto Italia RECENT OBSERVATIONS OF PINNA NOBILIS MOLLUSCA BIVALVIA IN THE MAR PICCOLO BASIN GULF OF TARANTO MEDITERRANEAN SEA RECENTI OSSERVAZIONI DI PINNA NOBILIS MOLLUSCA BIVALVIA NEL BACINO DEL MAR PICCOLO GOLFO DI TARANTO MAR MEDITERRANEO Abstract In December 2014 a first census of the population of the bivalve Pinna nobilis was carried out in Mar Piccolo of Taranto to document the new status in this enclosed sea of this mollusc that until the 60s represented an important resource heavily exploited by local fishermen During the last decades t
12. 10 12 giugno 2015 in relazione all eccezionale idrodinamismo del settore A nord nel tratto tra Punta Scorno e Punta dei Corvi sono presenti alcune concrezioni di un certo spessore su rocce granitiche Pinna nobilis mostra una densita da 0 03 ind 100 m a Fornelli e 0 6 ind 100 m a Trabuccato che sono al di sotto della media in Mediterraneo Combelles et al 1986 tale differenza pu essere dovuta sia a fenomeni naturali sia all azione di prelievo e da impatto da ancoraggio quest ultimo soprattutto all Isola Piana La variabilit intra sito della densit da 0 a 2 6 ind 100 m per Ponte Bianco e da 0 a 1 7 ind 100 m di Trabuccato pu dipendere dalla distribuzione aggregata tipica di questa specie Le analisi sulla classe di taglia hanno evidenziato una distribuzione unimodale ad indicare un buon reclutamento della popolazione La prateria a Posidonia oceanica mostra densit che in tutte le profondit esaminate indica una condizione di prateria molto disturbata Le densit di Cala d Oliva mostrano i valori pi elevati l Isola Piana presenta invece i valori pi bassi con le maggiori criticit nelle stazioni superficiali 4 10 m dove presente una evidente azione di disturbo da ancoraggio A Cala d Arena zona A e quindi in regime di tutela integrale non presente alcuna forma di frequentazione tuttavia i valori registrati risultano comunque modesti Conclusioni Le attivit di monitoraggio eseguite
13. 400 mm k 0 12 t 2 8 yr minori di quanto precedentemente riportato Conclusioni I risultati ottenuti sembrano mostrare una forte somiglianza con i dati biologici riportati per gli stock di boga di altre aree del Mediterraneo e g Bottari et al 2014 Quanto agli aspetti alieutici sembra ravvisarsi la necessit di monitorare lo sfruttamento della specie in modo da non infierire sullo stock nel suo momento di minimo per non correre il rischio di far collassare la risorsa Bibliografia ANONIMO 2012 International MEDITS handbook Rev 6 MEDITS Working Group 92 pp BAUCHOT M L HUREAU J C 1986 Sparidae In Whitehead P J P Bauchot M L Hureau J C Nielsen J Tortonese E eds Fishes of the North eastern Atlantic and the Mediterranean FNAM Unesco Paris 2 883 907 BOTTARI T MICALE V LIGUORI M RINELLI P BUSALACCHI B BONFIGLIO R RAGONESE S 2014 The reproductive biology of Boops boops Linnaeus 1758 Teleostei Sparidae in the southern Tyrrhenian Sea Central Mediterranean Cah Biol Mar 55 281 292 CANNIZZARO L BONO G VITALE S MILAZZO A 2001 Age determination and growth of bogue Boops boops Linnaeus 1758 in the Strait of Sicily 10 European Congress of Ichthyology Prague September 2001 DE SANTI A FIORENTINO F CAMILLERI M BIANCHINI M L RAGONESE S 2007 SEA TrIM software for exploratory analysis of trawl surveys information in the Mediterranean FAO MedSu
14. ARDIZZONE G D MESSINA A 1983 Feeding habits of Pagellus erythrinus L Pisces Sparidae from the middle Tyrrhenian Sea Rapp Comm Int Expl Sci Mer M dit 28 39 42 CARAGITSOU E PAPACONSTANTINOU C 1988 Feeding habits of red pandora Pagellus erythrinus off the western coast of Greece J Appl Ichthyol 4 14 22 FANELLI E BADALAMENTI F D ANNA G PIPITONE C RIGINELLA E AZZURRO E 2011 Food partitioning and diet temporal variation in two coexisting sparids Pagellus erythrinus and Pagellus acarne J Fish Biol 78 869 900 LARRANETA M G 1964 Sobre la biologia de Pagellus erythrinus L especialmente del de las costas de Castellon Invest Pesq 27 121 146 PINKAS L OLIPHANT M S IVERSON LL K 1971 Food habits of albacore bluefin tuna and bonito in California waters Calif Fish Game Fish Bull 152 1 105 ROSECCHI E 1983 R gime alimentaire du pageot Pagellus erythrinus Linn 1758 Pisces Sparidae dans le Golfe du Lion Cybium 7 17 29 SANTIC M PALADIN A RADA B 2011 Feeding habits of common pandora Pagellus erythrinus Sparidae from Eastern central Adriatic Sea Cybium 35 2 83 90 163 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 D VENTURA A BONIFAZI G D ARDIZZONE Dipartimento di Biologia Ambientale Universita di Roma La Sapienza Viale dell Universita 32 00185 Roma Italia daniele
15. CERDA M HAMPEL H 2005 Distribution and densities of the decapod crab Percnon gibbesi an invasive Grapsidae in western Mediterranean waters Mar Ecol Prog Ser 285 151 156 GARCIA L REVIRIEGO B 2000 Pres ncia del cranc subtropical Percnon gibbesi H Milne Edwards 1853 Crustacea Decapoda Grapsidae a les Illes Balears Primera cita a la Mediterrania occidental Boll Soc Hist Nat Balears 43 81 89 KATSANEVAKIS S POURSANIDIS D YOKES M B MACIC V BEQIRAJ S KASHTA L SGHAIER Y R ZAKHAMA SRAIEB R BENAMER I BITAR G BOUZAZA Z MAGNI P BIANCHI C N TSIAKKIROS L ZENETOS A 2011 Twelve years after the first report of the crab Percnon gibbesi H Milne Edwards 1853 in the Mediterranean current distribution and invasion rates J Biol Res 16 224 236 MORI M VACCHI M 2002 On a new occurrence of the alien flat crab Percnon gibbesi H Milne Edwards in the Southern Sicily Central Mediterranean Sea Ann Mus Civ Stor Nat Giacomo Doria 114 295 302 PUCCIO V RELINI M AZZURRO E 2003 Osservazioni sulla riproduzione di Percnon gibbesi H Milne Edwards 1853 nelle Isole Pelagie Sicilia Biol Mar Mediterr 10 2 267 272 RELINI M ORSI RELINI L PUCCIO V AZZURRO E 2000 The exotic crab Percnon gibbesi H Milne Edwards 1853 Decapoda Grapsidae in the Central Mediterranean Sci Mar 64 3 337 340 101 Volume pre print 46 Congresso della Societa
16. Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 calculated within and between clusters In addition the non parametric Kruskal Wallis test and a post hoc analysis non parametric Mann Whitney pairwise comparison test were applied using the software PAST 2 01 in order to detail significant differences in the group size related to time period of the day and behaviour Results Sightings of S coeruleoalba were grouped in 4 clusters corresponding to a percentage of similarity of 65 In particular cluster 1 and 2 included respectively 103 and 73 sightings exclusively occurring during morning 09 00 to 13 00 In addition cluster 1 was characterized by the highest value in size group median value 80 individuals with striped dolphins mostly in resting 67 0 socializing 27 2 or feeding 5 8 and absence of travelling Cluster 2 was characterized by the lowest value in group size median value 20 individuals with dolphins in feeding 31 5 resting 24 7 socializing 21 9 and travelling 21 9 A total of 61 sightings occurring in the early afternoon 13 01 to 16 00 were grouped in cluster 4 characterized by low values in group size with individuals in socializing 42 6 travelling 24 6 feeding 19 7 and resting 13 1 Only 17 sightings occurring during late afternoon 16 01 to 18 00 were grouped in cluster 3 characterized by intermediate values in group size median value 50 individuals with d
17. Le 5 boe hanno segnalato la presenza di specie ittiche sotto i FADs per 18 volte Tab 1 La maggior parte dei segnali stata registrata tra le ore 16 e 24 indicando una maggiore aggregazione di pesci nelle ore notturne I segnali trasmessi hanno rilevato la presenza di pesci tra 60 e 70 cm di taglia Il sistema usato essendo settato in tonnellate non ha mai indicato valori di biomassa Nelle 5 pescate controllo sono stati catturati esemplari di C hippurus in una sola verifica sono stati pescati alcuni esemplari di Naucrates ducato che costituivano una piccola parte delle catture Tab 1 Rilevi delle 5 FAD boe B1 B2 B3 B4 B5 nell arco delle 24 ore nei 5 giorni di studio Detections of 5 FAD buoys B1 B2 B3 B4 B5 over 24 hours for 5 study days 19 12 14 20 12 14 21 12 14 22 12 14 23 12 2014 E 10 12 PESSEEESESS z 14 16 16 18 fein Conclusioni L uso delle FADs boe oltre ad un rapido e sicuro ritrovamento dei cannizzi consentirebbe di diminuire il numero dei FADs lungo i filari e permetterebbe un rapido recupero dell attrezzatura diminuendo i costi legati al consumo di carburante riducendo cos l impatto ambientale Cos come avvenuto per ogni ausilio tecnologico storicamente usato nella pesca va considerato che l uso di questi strumenti potrebbe portare anche ad un aumento dello sforzo di pesca Lopeza et al 2014 x Questa possibilit per limitata dal fa
18. M P FERRANTI F BETTI M Bo G DE LA FUENTE MANCEBO C G DI CAMILLO A DI FRANCO E DI MARTINO F FAVA T GIACCONE V GIUSSANI M MATRONE R MUSSAT SARTOR L Musco D Pica F RAGAZZOLA M RENZI A SCINTO A SINAGRA S TAZIOLI M BERTOLINO Dipartimento di Scienze della Terra dell Ambiente e della Vita DISTAV Universita di Genova Corso Europa 26 16132 Genova Italia info pinneggiando it Dip di Scienze della Vita e dell Ambiente DISVA Universit Politecnica delle Marche Ancona Italia Universit N ice Sophia Antipolis Facult des Sciences EA 4228 ECOMERS Nice France Dip di Scienze Biologiche Geologiche e Ambientali Universit di Catania Italia Dip BiGeA Universita di Bologna Italia CNR IAMC UOS Messina Italia Laboratorio di Zoologia e Biologia Marina DBIOS Universita di Torino Italia CNR IAMC Castellammare del Golfo TP Italia Institute of Marine Sciences University of Portsmouth Portsmouth UK Facolta di Scienze e Tecnologie Universit di Napoli Parthenope Italia APP PINNEGGIANDO LA TECNOLOGIA AL SERVIZIO DELLA BIOLOGIA MARINA APP PINNEGGIANDO TECHNOLOGY AT THE SERVICE OF MARINE BIOLOGY Abstract Pinneggiando a free application for smartphone and tablet has been developed as a tool for science outreach addressing the interest of both experts and general public The app concerns the knowledge of biodiversity and dis
19. MEDITERRANEAN SEA MAPPATURA PRELIMINARE DELLA MACROALGA ALIENA HYPNEA CORNUTA RHODOPHYTA GIGARTINALES NEL MAR PICCOLO DI TARANTO ITALIA MAR MEDITERRANEO Abstract Hypnea cornuta distribution was assessed by the high resolution multispectral satellite remote sensing technique in the Mar Piccolo of Taranto on the basis of multi temporal in situ data acquired during the entire growth season Different in situ biomass values were recorded between two stations out of the four sampled in the same period These differences allowed us to properly calibrate the remotely sensed data Key words Mar Piccolo alien species Hypnea cornuta Satellite Remote Sensing Landsat 8 OLI Introduction The indo pacific alien seaweed Hypnea cornuta Kiitzing J Agardh was found for the first time in the Mar Piccolo of Taranto in December 2000 Nowadays it is established in the macroalgal populations of the basin where it reproduces only vegetatively Plants both attached and unattached are present from May to December with well developed thalli and overwinter through propagules buried in the sediment Cecere et al 2004 Petrocelli et al 2013 Recently remote sensing technique was applied in various projects for mapping and monitoring shallow beds of the seagrass Posidonia oceanica Linnaeus Delile Borfecchia et al 2013a b Similarly in this work the recent Landsat 8 OLI multispectral optical sensor was exploited to map the seabed distribution
20. RUSSO D GIARAMITA F T PARRINELLO N 2013 Gender differences in the immune system activities of sea urchin Paracentrotus lividus Comp Biochem Physiol A 164 447 455 COFFARO K A HINEGARDNER R T 1977 Immune response in the sea urchin Lytechinus pictus Science 197 1389 1390 SMITH L C DAVIDSON E H 1992 The echinoid immune system and the phylogenetic occurrence of immune mechanisms in deuterostomes Immunol Today 13 356 362 VAZZANA M SIRAGUSA T ARIZZA V BUSCAINO G CELI M 2015 Cellular responses and HSP70 expression during wound healing in Holothuria tubulosa Gmelin 1788 Fish Shellfish Immunol 42 306 315 215 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Workshop Progressi nella ricerca sui cetacei mediterranei 216 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 COMUNICAZIONI 217 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 A ARCANGELI M AZZOLIN I CAMPANA A CASTELLI C GIACOMA C LUPERINI L MARINI M PARABOSCHI G PELLEGRINO A RUVOLO M TRINGALI A VETRUGNO R CROSTI ISPRA Dip Difesa della Natura V Brancati 60 00144 Rome Italy Universita Roma Tre V Marconi 446 00146 Rome Italy antonella arcangeli isprambiente it Department of Life Sciences a
21. SFRISO A Interventi di ricolonizzazione di angiosperme acquatiche in laguna di Venezia risultati del primo anno di trapianti nell ambito del progetto LIFE SeResto LIFE12 NAT IT 000331 e 111 LA MARCA E C FRANZITTA G CAPRUZZI E MILAZZO M CHEMELLO R Bio geomorphological role of the vermetid reef in attenuating wave energy on the coast ii 113 MANZO C FABBROCINI A D ADAMO R Risposta della fauna ittica della laguna di Lesina al grado di connessione con il mare e ai cambiamenti delle strategie gestionali ceeceseceseeeeeeeeeeeeseeeneeeneeenees 115 MUSCO L ANDALORO F D ANNA G GIANGRANDE A LO BRUTTO S MIKAC B MIRTO S PIPITONE C SCUDERI D VEGA FERN NDEZ T BADALAMENTI F Impatto di Caulerpa taxifolia var distichophylla su macro e meiofauna associate a Posidonia oceanica sins ea 117 PICCIULIN M COLLA S PRANOVI F MALAVASI S Monitoraggio acustico passivo di Sciaena umbra in un allevamento di tili del nord Adriatic nn eea aa a 119 RICCATO F FIORIN R PICONE M NESTO N MOSCHINO V DA ROS L Primi dati sulla presenza di reti fantasma nelle aree di tegn a del Golfo di Venezia i 121 SCAPIN L FACCA C ZUCCHETTA M BONOMETTO A OSELLADORE F BOSCOLO R FRANZOI P SFRISO A First assessment of the ecological status in seagrass restoration sites of the northern Venice lagoon application of macrophyte macrozoobenthos and TIS
22. Su un totale di 96 individui in 10 esperimenti mediante l analisi delle gonadi sono stati determinati 42 maschi e 54 femmine Dai pesi in vivo e dall osservazione delle gonadi di entrambi i sessi emerge che nel sito in esame la specie risulta attiva dal punto di vista riproduttivo fino a met ottobre La cronologia dello sviluppo di H tubulosa riportata in Fig 1 Dopo pochi secondi dall introduzione dello sperma nei becker stata osservata la formazione della membrana di fecondazione e dopo pochi minuti la comparsa dei globuli polari La prima divisione si osservata dopo 2 h lo stadio di morula dopo 8 h e lo stadio di blastula si raggiunto entro le prime 12 h dalla fecondazione Dopo 24 h si avuta la formazione di una gastrula matura che si evoluta allo stadio di auricularia precoce al terzo giorno dopo la fecondazione In questa fase di sviluppo con la formazione dell apparato digerente stato somministrato fitoplancton vivo osservandone la concentrazione nello stomaco Lo stadio di auricularia avanzata caratterizzato da larghi processi laterali e la presenza di una distinta sfera ialina si osservata solo dopo il 5 6 giorno dalla fecondazione w E SIENA do ce as ene Fig 1 Fasi di sviluppo in H tubulosa A uovo fecondato B prima divisione C gastrula D auricularia precoce E auricularia avanzata Barra 100 um Developmental stages in H tubulosa A fertilized egg B two cell stage C gastrula stage
23. Tuttavia la copertura della macroalga nelle unit sperimentali di rimozione C risultata notevolmente inferiore 6 a quanto registrato in altri studi 38 condotti in zone non protette Piazzi et al 2003 Tali risultati cos come l assenza di differenze significative nelle composizioni dei popolamenti macroalgali tra unit di rimozione A e di controllo C suggeriscono che comunit in buono stato di conservazione con elevata diversit quali quelle dell AMP TPCC possono mostrare un alta resistenza all invasione ed una rapida ripresa in seguito a disturbi Stachowicz et al 2002 Questo lavoro dedicato al Dott Giuseppe Bernardi collega e amico prematuramente scomparso per l impegno e la passione dimostrata nella realizzazione di questo progetto di ricerca Bibliografia CECCHERELLI G PIAZZI L 1999 L effetto dell orientamento dei margini di Posidonia oceanica e della densit dei fasci sull alga introdotta Caulerpa racemosa Biol Mar Mediterr 6 1 365 367 DETHIER M N GRAHAM E S COHEN S TERA L M 1993 Visual versus random point percent cover estimations objective is not always better Mar Ecol Prog Ser 96 93 100 PIAZZI L CECCHERELLI G 2006 Persistence of biological invasion effects Recovery of macroalgal assemblages after removal of Caulerpa racemosa var cylindracea Est Coast Shelf Sci 68 455 461 PIAZZI L CECCHERELLI G BALATA D CINELLI F 2003
24. VICENTE N 1986 Contribution la connaissance de l cologie de la Pinna nobilis L mollusque Eulamellibranche Scientific Report of Port Cros National Park 12 29 43 COSSU A DE LUCA M 2014 Distribuzione di Patella Ferruginea Gmelin 1791 nelle No Entry Zone e nelle Zone di Fruizione Parziale dell AMP dell Isola dell Asinara Biol Mar Mediterr 21 1 154 158 GARC A MARCH J R KERSTING D K 2006 Preliminary data on the distribution and density of Pinna nobilis and Pinna rudis in the Columbretes Islands Marine Reserve Western Mediterranean Spain Org Divers Evol 6 Electronic Suppl 16 http www senckenberg de odes 06 16 Garcia March_and_Kersting_Pinna Distribution pdf Lavoro eseguito in collaborazione con il Parco Nazionale dell Isola dell Asinara 29 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 G D ANNA C PIPITONE T VEGA FERNANDEZ G GAROFALO F BADALAMENTI Istituto per l Ambiente Marino Costiero IAMC CNR Via Giovanni da Verrazzano 17 91026 Castellammare del Golfo TP Italia giovanni danna cnr it CNR IAMC Mazara del Vallo TP Italia STAKEHOLDER PERSPECTIVES ABOUT THE GOVERNANCE OF THE EGADI ISLANDS MARINE PROTECTED AREA W SICILY LA GOVERNANCE DELL AREA MARINA PROTETTA ISOLE EGADI SICILIA OCCIDENTALE SECONDO LA PROSPETTIVA DEGLI STAKEHOLDER Abstract A governance analysis has been conducte
25. cf ovata abundance determined by light microscopy and qPCR assays n 16 Spearman r 0 9808 p lt 0 0001 and n 15 Spearman r 0 9263 p lt 0 0001 for macroalgae and surface seawater samples respectively Genus Ostreopsis specific primers were used for the amplification of environmental samples collected in the eastern Mediterranean coastal areas and the results showed positive amplification of all samples Furthermore all the samples were analysed for the presence of Ostreopsis species Positive amplifications were obtained in all samples for Ostreopsis sp 2 Atlantic Mediterranean clade and only one sample showed the presence of O cf ovata while no O cf siamensis Schmidt 1901 was found Conclusions In this study new primer sets were applied for the identification of the genus Ostreopsis and Ostreopsis sp 2 Atlantic Mediterranean clade Moreover LSU rDNA gene was used to accurately quantify Ostreopsis spp abundance in natural samples by qPCR method This approach based on the generation of environmental site specific standard curves was validated in several Mediterranean coastal areas and its application allowed a rapid and correct quantification of O cf ovata in field assessing beach water quality during the survey activity of the study period Casabianca et al 2014 References CASABIANCA S PERINI F CASABIANCA A BATTOCCHI C GIUSSANI V CHIANTORE M PENNA A 2014 Monitoring toxic Ostreopsis cf ovata in recreational wa
26. che consente una grande versatilit metabolica verso i polimeri organici In particolare gli ambienti artici ospitano una flora microbica psicrofila o psicrotrofa capace di sintetizzare molecole bio attive a basse temperature e con potenzialit metaboliche ancora poco esplorate Il potenziale utilizzo biotecnologico giustifica l interesse rivolto allo studio quali e quantitativo della flora microbica di questi ambienti Nell ambito del progetto multidisciplinare SpongePOP INTERACT avente come obiettivo la caratterizzazione della flora microbica associata ai Poriferi che popolano i fiumi artici stata condotta una indagine stagionale su distribuzione composizione qualitativa e profili enzimatici della flora batterica eterotrofa presente nella zona di estuario del fiume Pasvik Norvegia artica comprendente i fiordi Bgkfjorden Korsfjorden e Langfjorden Materiali e metodi Durante due campagne di studio condotte in Artide maggio e luglio 2014 campioni di acqua e di sedimento sono stati prelevati in corrispondenza di 9 stazioni dislocate lungo il fiume Pasvik e la relativa area di estuario nei fiordi norvegesi Bgkfjorden Korsfjorden e Langfjorden Aliquote 100 pl di acqua o sedimento diluito in acqua sterile 1 10 p v sono state seminate su piastre di terreno Marine Agar 2216 e Plate Count Agar Difco incubate a 4 C per 14 giorni Le colonie cresciute sono state sottoposte a conteggio nei laboratori messi a disposizione dal centro
27. in the number of mucous and chloride cells and in the enzymatic activity Key words bisphenol A alkyphenols histopathology gills seabream Introduction A wide range of histological endpoints have been developed in fish and recommended as biomarkers for monitoring the effects of pollution Gill filaments and lamellae provide a very large surface area for direct and continuous contact with contaminants in water Gill histo and cyto pathology are suitable biomarkers to discriminate between differently polluted field sites and are therefore recommended as biomarkers of effect in environmental risk assessment Triebskorn et al 2008 Epithelial hyperplasia with lamellar fusion epithelial hypertrophy telangiectasia oedema with epithelial lifting mucous cell hyperplasia variation in chloride cell number and morphology are typical histopathological lesions of gills in response to a wide range of contaminants thus implying impairment of respiratory and osmoregulatory functions Au 2004 The gilthead seabream Sparus aurata Linnaeus 1758 is a common euryaline and eurythermal Mediterranean species It is very sensitive to any environmental change therefore it is very frequently used for toxicological research In this study histological endpoints and enzyme activity were successfully used as biomarkers of the effects on the branchial structure of juvenile gilthead seabream exposed via diet to environmental concentrations of nonylphen
28. origine di un potenziale disastro ambientale Per monitorare i popolamenti zooplanctonici nell area e nella colonna d acqua fino alla rimozione del relitto sono stati effettuati 5 surveys Nel presente lavoro sono presentati i dati sulla componente a Crostacei Copepodi delle prime 2 campagne di raccolta luglio 2012 e luglio 2013 I Copepodi oloplanctonici organismi chiave nelle dinamiche trofiche degli ecosistemi pelagici Taylor ef al 2002 svolgono il ruolo di biondicatori rispondendo anche su scala micro temporale alle variazioni delle condizioni ambientali Hays et al 2005 Materiali e metodi I surveys sono stati realizzati con retino standard WP 2 da 57 cm e vuoto di maglia di 200 um I punti di campionamento sono stati condizionati dalla posizione del relitto e dal fondo fortemente degradante complessivamente sono state effettuate 2 pescate orizzontali lungo le batimetriche di 50 m e 100 m e 10 verticali delle quali 8 con 2 controlli da 50 m alla superficie e 2 da 80 a 50 m Per la caratterizzazione chimico fisica delle acque si fa riferimento ai dati rilevati con continuit da ARPAT www arpat toscana it a partire dal naufragio Risultati Il numero di taxa identificati nel luglio 2013 Tab 1 superiore rispetto a quello del luglio 2012 58 vs 46 In entrambi i surveys il genere Clausocalanus dominante con le specie C pergens Farran 1926 e C furcatus Brady 1883 prevalenti Seguono con signific
29. seguita dai gobidi con 4 specie Gobius niger Knipowitschia panizzae Pomatoschistus marmoratus e Zosterisessor ophiocephalus dagli sparidi con 3 specie Diplodus annularis D vulgaris e Sparus aurata e dai signatidi con 2 specie Syngnatus abaster 115 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 e S typhle Il resto delle famiglie invece rappresentato da un unica specie Dal punto di vista funzionale la comunit ittica della laguna costituita da un alto numero di specie marine migratrici MM 13 specie spesso rappresentate da forme giovanili e specie estuarine ES 11 specie Sia i pesci catadromi C che quelli marini occasionali MS sono invece rappresentati da una sola specie Il gruppo ecologico dei pesci d acquadolce F rappresentato da 3 specie Carassius carassius Clarias gariepinus e Oreochromis niloticus tutte alloctone nella maggior parte dei casi rappresentate da individui giovani Entrambi gli studi sulla rimonta dei giovanili di specie marine ai canali di connessione con il mare indicano che il reclutamento nella laguna di Lesina ha luogo prevalentemente tra ottobre e febbraio con il picco pi alto registrato nel mese di gennaio In ambedue gli studi la famiglia dei mugilidi rappresenta il 99 delle catture L ramada la specie che rimonta con il maggior numero di individui nella laguna di Lesina seguita da L aurata M cephalus e L saliens
30. specific projects were funded by DGMARE Thus MAREA was a first time occasion to expand knowledge of the Mediterranean seascapes for an impressively wide range of sensitive critical and protected habitats It has been an extraordinary challenge that has allowed to collate and review existing occurrence data and historical information as well as modelling spatial and temporal distributions This was mostly achieved by the specific project MEDISEH Mediterranean Sensitive Habitats Giannoulaki ef al 20 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 2013 while the specific project STOCKMED Stock Units in the Mediterranean Fiorentino et al 2015 developed a methodological framework and identified using a holistic approach stock units and their boundaries for a remarkable number of commercially relevant species Interestingly this project also provided for the first time a paramount view on the main fishing grounds for several geographical sub areas in the European Mediterranean where spatial control is the one of the key pillars of an effort based management system Both projects shed light on main knowledge gaps Globally around 100 researchers from several scientific Institutions of the Mediterranean contributed to these projects All the maps from modelling are available in the MEDISEH and STOCKMED GIS viewer http mareaproject net medviewer a tool developed for the dissemination
31. unige it Dipartimento di Scienze della Terra e della Vita Universit Politecnica delle Marche Ancona Italia Dipartimento di Chimica Istituto Zooprofilattico Sperimentale del Mezzogiorno Portici NA Italia GILL HISTOPATHOLOGY AND ENZYMATIC ACTIVITY IN SEABREAM JUVENILES EXPOSED TO ALKYLPHENOLS AND BISPHENOL A CONTAMINED FEED ANALISI ISTOPATOLOGICHE ED ENZIMATICHE SULLE BRANCHIE DI GIOVANILI DI ORATA ALIMENTATI CON CIBO CONTAMINATO DA ALCHILFENOLI E BISFENOLO A Abstract Gills being in close contact with the external environment are particularly sensitive to changes in the quality of water and are considered the primary target organ of the contaminants Histo cytological and enzymatic responses are relatively easy to determine and can be related to health and fitness of individuals The aim of this study was to verify the possibility that the consumption of contamined feed can impact on the occurrence of branchial tissue alteration as well as after a direct exposure to environmental pollutants With this purpose we investigated the impact of feed contamination on morphological endpoints and glutathione S transferase GST and Catalase Cat activities in the gills of the gilthead seabream Sparus aurata Linnaeus 1758 juveniles exposed to increasing concentrations of nonylphenol NP and bisphenol A BPA and their mixture at environmental concentration Exposed fish showed significant alteration in the morphology of the gills
32. uomo e deliberatamente scaricato o intenzionalmente perso in mare o lungo le coste incluso il materiale trasportato dalla terra all ambiente marino tramite corsi d acqua dilavamento scarichi o vento UNEP 2009 In questo contesto ARPA Puglia ha effettuato per la prima volta una stima quantitativa dei rifiuti spiaggiati lungo le coste pugliesi adriatiche e ioniche nell ambito di attivit pianificate a livello nazionale e finanziate dal MATTM per sopperire ad una carenza iniziale delle informazioni richieste dalla MSFD per l argomento specifico Materiali e metodi I dati sui rifiuti spiaggiati sono stati raccolti in due distinte campagne di censimento svolte nell inverno e primavera 2014 in 10 aree costiere pugliesi di cui 6 situate sul Mar Adriatico e 4 sul Mar Ionio Fig 1a La metodologia utilizzata stata quella prevista dal protocollo OSPAR 2010 e coerentemente con lo stesso protocollo sono state prese in considerazione per ciascuna area due lunghezze di spiaggia corrispondenti a due unit di campionamento e a due diverse attivit di censimento 1 unit di lunghezza di 100 m per identificare tutti i rifiuti solidi presenti risultati espressi come numero di rifiuti o n r 100 m 2 unit di lunghezza di 1 km per identificare gli oggetti di dimensioni maggiori di 50 cm risultati espressi come n r km Al fine di valutare le ipotetiche fonti dei rifiuti spiaggiati le aree campionate sono state scelte tra 4 differe
33. 10 Campania Catania area Cilento area menaide menaide E encrasicolus E encrasicolus All year April June 28 19 115 57 145 20 20 5 mm 27 mm 280 m 425 m 48 0 kg day 37 0 kg day Target 91 5 By catch 8 1 Discard 0 4 Target 76 3 By catch 23 7 Discard 0 0 S pilchardus S pilchardus 5 6 GSA 10N Sicily S GSA 10 N Sicily S Agata Militello Agata Militello menaide ricciolara E encrasicolus S dumerili June August August October 7 3 15 6 20 40 20 mm 70 mm 500 m 900 m 88 0 kg day 16 0 kg day Target 93 7 Target 58 4 By catch 0 0 By catch 41 6 Discard 0 7 Discard 0 0 P erythrinus Not present p T mediterraneus 3 GSA 10 Liguria occhiatara O melanura May June 5 10 14 5 79 4 mm 413 m 88 3 kg day Target 69 5 By catch 29 8 Discard 0 7 S colias T mediterraneus 7 GSA 10 Campania Gulf of Naples ferrettara P saltatrix June October 2 4 70 88 mm 2400 m 48 0 kg day Target 89 0 By catch 11 0 Discard 0 0 T ovatus L amia 4 GSA 10 N Sicily sgomberara Scomber spp Trachurus spp All year 30 90 60 80 2 mm 921 m 142 0 kg day Target 1 6 By catch 98 4 Discard 0 0 A rochei 8 GSA 10 W Sicily Selinunte area menaide E enrasicolus S pilchardus May September 5 20 33 20 0 mm 202 m n a n a Conclusions This study shows that SSD currently used in Italy are species specific gears with
34. 10000 4 5000 286 114 229 172 0 6 7 8 9 10 ll 12 13 14 15 16 17 18 Shell Lenght mm nn Fig 1 Length frequency distribution of D semistriatus population and its statistical parameters Distribuzione lunghezza frequenza della popolazione di D semistriatus e parametri statistici Conclusions The finding of a dense population of D semistriatus on the sandy shallow seabed of the South Adriatic Sea updates the knowledge on the distribution of the species confirming the presence of such mollusc along the Apulian coasts On the contrary it seems that the species is replaced by the congeneric D trunculus along the Ionian coasts of Apulia Panetta personal communication while this latter was not found during the present study The length frequency analysis showed an asymmetric distribution of size characterized by a right tail confirming the relevant presence of juveniles in the population according to the size of juveniles lt 15 mm SL reported for other species of the Genus Donax Manca Zeichen et al 2002 This result could be related to the high fishing pressure affecting the area thanks to the presence of other species of commercial interest such as C gallina Collecting information about the presence and the distribution of such commercial species resulted essential mainly in order to provide an attempt of their sustainable management This should be even more important considering that the juvenile fraction of D s
35. 2014 Presenza di Ostreopsis cf ovata e altre microalghe bentoniche potenzialmente tossiche nelle acque costiere italiane In Funari E Manganelli M Testai E eds Ostreopsis cf ovata linee guida per la gestione delle fioriture negli ambienti marino costieri in relazione a balneazione e altre attivit ricreative Rapporti ISTISAN 14 19 Roma 13 16 BRESCIANINI C GRILLO C MELCHIORRE N BERTOLOTTO R FERRARI A VIVALDI B ICARDI G GRAMACCIONI L FUNARI E SCARDALA S 2006 Ostreopsis ovata algal blooms affecting human health in Genova Italy 2005 and 2006 Euro Surveill 11 36 3040 SANSONI G BORGHINI B CAMICI G CASOTTI M RIGHINI P RUSTIGHI C 2003 Fioriture algali di Ostreopsis ovata Gonyaulacales Dinophyceae un problema emergente Biologia Ambientale 17 17 23 UTERMOHL H 1958 Zur Vervolkommnung der quantitativen Phytoplankton Metodik Ver int Ver theor Angew Limol 9 1 38 182 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 A RAKAJ M SCARDI Dipartimento di Biologia Universit di Roma Tor Vergata Via Della Ricerca Scientifica 00133 Roma Italia arnoldrakaj gmail com EFFETTI DELLA CIRCOLAZIONE MARINA SULLA DINAMICA DEI POPOLAMENTI ZOOPLANCTONICI COSTIERI DELL ADRIATICO EFFECTS OF MARINE CIRCULATION ON THE DYNAMICS OF COASTAL ZOOPLANKTON ASSEMBLAGES OF THE ADRIATIC SEA Abstract Mesozooplankton assembl
36. 48 1 06 1 04 PO 0 72 reo Ts Td vox ro e ss ess 1362191 006x007 uso 1322041 382920 wss oss08 Peart 13 1800 LAP 030 38482000 LAPOAT Taszii9 0312005 Probabilita P lt 0 05 Probabilita P lt 0 01 Probability P lt 0 05 Probability P lt 0 01 T Temperatura S Salinit NO3 Nitrati PO4 Fosfati T Temperature S Salinity NO3 Nitrates PO4 Phosphates I tassi di LAP sono risultati compresi fra 0 008 e 25 60 nmol I h lungo il transetto l attivit ha descritto un andamento crescente verso la Sardegna prevalendo negli strati meso e bati pelagici L enzima AP valori minimo massimo 0 004 e 4 86 nmol I h ha presentato un andamento simile ma con maggiori valori a livello epipelagico cos come i batteri luminosi Differenze significative sono state riscontrate dal test ANOVA fra le zone estreme del transetto Sardegna e Stretto di Gibilterra sia per i valori enzimatici LAP F 7 507 AP F 5 346 P lt 0 01 che per MA F 4 35 P lt 0 05 Variazioni significative dei valori di temperatura e salinit sono state registrate fra gli strati epi e mesopelagico F 109 77 83 21 P lt 0 01 rispettivamente Conclusioni I risultati ottenuti evidenziano tassi di attivit enzimatica AP ed abbondanze batteriche MA e SWC in genere crescenti verso oriente e negli strati epipelagici in relazione ai substrati organici forniti dai processi produttivi tuttavia il rilevamento di s
37. 60 mm Italian law 963 1965 and DPR 1639 1968 during the 12 months farming trial and their weight placed them both in the medium commercial size class 3 66 85 g which is sold at a market price of 9 60 for O edulis and 2 50 for C gigas FAO 2011 Pogoda et al 2011 This study therefore supports the working hypothesis that oysters can be farmed in the oligotrophic Ligurian Sea and profitably grown to a commercial size by using IMTA techniques based on finfish effluents References FAO 2011 Fisheries and Aquaculture Information and Statistics Service www fao org fishery aquaculture en accessed on 31 January 2015 POGODA B BUCK B H HAGEN W 2011 Growth performance and condition of oysters Crassostrea gigas and Ostrea edulis farmed in an offshore environment North Sea Germany Aquaculture 319 484 492 50 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 A RAKAJ P BONCAGNI A FIANCHINI M F GRAVINA Laboratorio di Ecologia Sperimentale ed Acquacoltura LESA Dipartimento di Biologia Universita di Roma Tor Vergata Via Cracovia 1 00133 Roma Italia arnoldrakaj gmail com RISULTATI PRELIMINARI SULLA RIPRODUZIONE ARTIFICIALE DI HOLOTHURIA TUBULOSA HOLOTHURIOIDEA ECHINODERMATA PRELIMINARY RESULTS ON THE ARTIFICIAL REPRODUCTION OF HOLOTHURIA TUBULOSA HOLOTHURIOIDEA ECHINODERMATA Abstract Holothuria tubulosa is a key species w
38. Abbate et al 2007 La significativit delle differenze di densit tra siti 3 livelli random stata testata mediante ANOVA Risultati La presenza di cellule vegetative della microalga stata osservata in tutti i campioni raccolti nei 3 siti di studio sebbene non siano stati individuati ammassi mucillaginosi n sul substrato n in sospensione nella colonna d acqua La densit media di C taylorii nei tre siti di studio risultata pari a 163 146 e 17 cellule ml rispettivamente a Capo Testa Cala Pischina e Rena Bianca Fig 1 Le analisi statistiche hanno confermato la significativit delle differenze di densit tra siti ANOVA F g 2612 66 P gt 0 01 107 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Densit di C taylorii 200 4 180 4 160 4 140 2 120 4 3 100 4 0 60 a 40 20 4 ae Cala Pischina Capo Testa Rena Bianca Sito Fig 1 Densit media ES delle cellule vegetative di C taylorii in ciascuno dei 3 campioni raccolti nei 3 siti di studio C taylorii mean densities ES in each of the 3 samples collected in the 3 study sites Conclusioni I dati raccolti nei tre siti di studio attestano la presenza di C taylorii anche lungo le coste settentrionali della Sardegna La densit della microalga risultata per notevolmente inferiore a quella registrata nello stesso periodo nella parte orientale
39. C 2003 Dynamics and control of a towed underwater vehicle system part I model development Ocean Eng 30 4 453 470 DI MAIDA G TOMASELLO A LUZZU F SCANNAVINO A PIRROTTA M ORESTANO C CALVO S 2011 Discriminating between Posidonia oceanica meadows and sand substratum using multibeam sonar ICES J Mar Sci 68 1 12 19 KOMATSU T IGARASHI C TATSUKAWA K SULTANA S MATSUOKA Y HARADA S 2003 Use of multi beam sonar to map seagrass beds in Otsuchi Bay on the Sanriku Coast of Japan Aquat Living Resour 16 223 230 KOSTYLEV V E TODD B J FADER G B J COURTNEY R C CAMERON G D M PICKRILL R A 2001 Benthic habitat mapping on the Scotian Shelf based on multibeam bathymetry surficial geology and sea floor photographs Mar Ecol Prog Ser 219 121 137 LE GONIDEC Y LAMARCHE G WRIGHT I C 2003 Inhomogeneous substrate analysis using EM300 backscatter imagery Mar Geophys Res 24 311 327 13 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 LO IACONO C MATEO M A GRACIA E GUASCH C CARBONELL R SERRANO L SERRANO O DAN J 2008 Very high resolution seismo acoustic imaging of seagrass meadows Mediterranean Sea Implications for carbon sink estimates Geophys Res Lett 35 L18601 doi 10 1029 2008GL034773 LUZZU F DI MAIDA G TOMASELLO A PIRROTTA M SCANNAVINO A BELLAVIA C BELLISSIMO G COSTANTINI C ORESTANO
40. C SCLAFANI G CALVO S 2014 Mapping Posidonia oceanica lower limit combining high resolution instruments SSS and MBS 5 Mediterranean Symposium on Marine Vegetation Portoro Slovenia LUZZU F TOMASELLO A CALVO S 2015 Detection and mapping of blue carbon reservoir storage in Posidonia oceanica dead matte in front of an extensive industrial area Mediterr Seagrass Workshop 120 MATEO M A CEBRIAN J DUNTON K MUTCHLER T 2006 Carbon flux in seagrass ecosystem In Larkum A W D Orth R J Duarte C M eds Seagrasses Biology Ecology and Conservation Springer The Netherland 7 159 192 MEINESZ A LAURENT R 1978 Cartographie et tat de la limite inf rieure de Posidonia oceanica dans les Alpes Maritimes France Campagne Poseidon 1976 Bot Marina 21 513 526 MONTEFALCONE M ROVERE A PARRAVICINI V ALBERTELLI G MORRI C BIANCHI C N 2013 Valuating change in seagrass meadows A time framed comparison of Side Scan Sonar maps Aquat Bot 104 204 212 PASQUALINI V CLABAUT P PERGENT G BENYOUSSEF L PERGENT MARTINI C 2000 Contribution of side scan sonar to the management of Mediterranean littoral ecosystems Int J Remote Sens 21 367 378 PERGENT MARTINI C LEONI V PASQUALINI V ARDIZZONE G D BALESTRI E BEDINI R BELLUSCIO A BELSHER T BORG J BOUDOURESQUE C F BOUMAZA S BOUQUEGNEAU J M BUIA M C CALVO S CEBRIAN J CHARBONNEL E CINELLI F COSSU A DI
41. C taylorii caratterizzate da 6 differenti morfologie Le classiche cellule vegetative della microalga 1 con una forma che richiama quella del frutto del 58 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 fico 35x15 um ovali allungate ristrette basalmente con un grande vacuolo centrale e cloroplasti addossati alla membrana nettamente distinguibile sono risultate abbondanti soprattutto nei primi mesi dopo l inoculo e sono state spesso ritrovate ancorate a filamenti simili ad ife dalla consistenza cotonosa intrecciati tra loro Dopo circa 2 mesi dall allestimento delle colture invece sono state osservate anche cellule della microalga 2 pi piccole 15x10 um e dalla forma pi arrotondata la cui organizzazione interna e g cloroplasti vacuolo era per molto simile a quella delle classiche cellule vegetative Con il passare dei mesi stato possibile individuare anche cellule 3 con forma pressoch sferica vacuolo ridotto in dimensione e organuli ben visibili alcune delle quali sono state osservate anche in divisione 4 due o pi cellule spesso di dimensione ineguale all interno di un unica membrana e cellule 5 allungate aperte ad una estremit da cui fuoriuscivano numerose cellule 6 pi piccole 7x5 um caratterizzate dalla presenza di due flagelli Conclusioni La presenza nelle colture di C taylorii di cellule pi piccole e rotondeggianti
42. Daily outputs of 3D fields of currents temperature salinity and other variables have been therefore produced to provide physical forcing fields for the dispersion model The larval release was initialized from the persistent spawning areas identified in Western and Southern Sardinia slope From May to September two releases per month have been planned and done accordingly with reproductive period Two scenarios have been simulated one with eggs and larvae passively advected by 3D currents PT without any buoyancy parameterization for eggs and the second where eggs account for a positive buoyancy inducing an initial vertical migration VM The total duration of eggs larval transport was set to 21 days before settlement Fernandez et al 2011 Simulated larvae are then frozen as proxy 150 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 for the settlement process The outputs of the 2 scenarios are analysed in terms of 3D distribution of the simulated larvae and their retention at local scale Results In the PT scenario the particles are mainly distributed in the deep layers 600 800 m Spatially the simulation shows two dense areas SW S of concentration due both to the coincidence with spawning areas as well as to the presence at SW of a quasi permanent anticyclonic eddy that contributes in the local retention and concentration of larvae through hydrodynamical convergence I
43. Early patterns of Caulerpa racemosa recovery in the Mediterranean Sea the influence of algal turfs J Mar Biol Ass UK 83 3857 1 3 STACHOWICZ J J FRIED H OSMAN R W WHITLATCH R B 2002 Biodiversity invasion resistance and marine ecosystem function reconciling pattern and process Ecology 83 9 2575 2590 106 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 S CARONNI M A DELARIA G MACRY I PESCI A OCCHIPINTI AMBROGI Dipartimento di Scienze della Terra e dell Ambiente DiSTA Universita di Pavia Via S Epifanio 14 27100 Pavia Italia sarah caronni unipv it Dipartimento di Scienze della Natura e del Territorio Universita di Sassari Sassari Italia Mac Pro e GIS Pavia Italia UNA NUOVA SEGNALAZIONE DELLA MICROALGA PRODUTTRICE DI MUCILLAGINE CHRYSOPHAEUM TAYLORII LUNGO LE COSTE DELLA SARDEGNA A NEW RECORD OF THE MUCILAGE FORMING MICROALGA CHRYSOPHAEUM TAYLORII ALONG THE SARDINIAN COASTS Abstract The benthic microalga Chrysophaeum taylorii Lewis amp Bryan Pelagophyceae was found in a new locality along the Northern Sardinian coasts Its quite low cell abundances and the loss of mucilage on the substratum in the investigates sites suggests its recent establishment in the area Key words phytobenthos algal blooms distribution density Introduzione Chrysophaeum taylorii Lewis amp Bryan una microalga bentonica le cui cel
44. G AZZARO M LAGAN P RAPPAZZO A C GRAZIANO M PAPALE M CONTE A LO GIUDICE A Indagine quanti e qualitativa sulla flora batterica eterotrofa aerobia nella zona d estuario del fiume Pasvik Norvegia artica 171 CARUSO G BORGHINI M GRAZIANO M PAPALE M RAPPAZZO A C RUGGERI G DE DOMENICO E Abbondanza batterica eterotrofa ed attivit enzimatiche microbiche in Mediterraneo occidentale Campagna Venus 2010 i 173 CASABIANCA S PERINI F PUGLIESE L CASABIANCA A GIUSSANI V PENNA A Monitoring toxic Ostreopsis cf ovata in recreational waters using a qPCR based assay i 175 CIBIC T CAROPPO C DI POI E KARUZA A ROGELJA M DEL NEGRO P Primary production and seasonal succession of different photoautotrophs pico nano and microplankton in the Mar Piccolo Of Tarantor n inir aaa iaia dela 177 KARUZA A GIANI M INGROSSO G DEL NEGRO P The extraordinary cold event 2012 how it affected microbial dynamics Im The AGH atic pits tizi ice enni ae 179 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 MANCA V MOCCI G A NIGRA C RUSSU C Ostreopsis cf ovata in tre aree del nord Sardegna eesceseceseceseceseeesceeeeeeeseeeneeeseeenaes RAKAJ A SCARDI M Effetti della circolazione marina sulla dinamica dei popolamenti zooplanctonici costieri dell Adriatico
45. GIL DE SOLA L PAPACONSTANTINOU C RELINI G SOUPLET A 2002 The general specifications of the Medits surveys Sci Mar 66 2 9 17 RELINI G 2000 La ricerca sulla pesca le risorse demersali Biol Mar Mediterr 7 4 13 45 RELINI G BIAGI F SERENA F BELLUSCIO A SPEDICATO M T RINELLI P FOLLESA M C PICCINETTI C UNGARO N SION L LEVI D 2000 I Selaci pescati con lo strascico nei mari italiani Biol Mar Mediterr 7 1 347 384 RELINI G CARPENTIERI P MURENU M EDs 2008 Manuale di Istruzioni Medits Medits Instruction Manual Biol Mar Mediterr 15 Suppl 2 1 78 RELINI G LANTERI L FRANCO A 2011 Gli Osteitti dei mari italiani biodiversit protezione e sfruttamento Biol Mar Mediterr 18 1 44 47 153 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 A SABATINI F ATZORI F PALMAS M SECCI P ADDIS Dipartimento di Scienze della Vita e dell Ambiente DSVA Universita di Cagliari Via T Fiorelli 1 09127 Cagliari Italia asabati unica it Area Marina Protetta Capo Carbonara Via Roma 60 09049 Villasimius CA Italia LA PESCA ARTIGIANALE NELL AREA MARINA PROTETTA CAPO CARBONARA ARTISANAL FISHERY IN THE MARINE PROTECTED AREA CAPO CARBONARA Abstract The aim of this study is a preliminary investigation on the activity of the local fishers in the MPA of Capo Carbonara Sardinia Ita
46. GSA per campagna anno di estremo interesse per descrivere nel tempo le fluttuazioni della biodiversit e questo pu essere un valore aggiunto delle campagne MEDITS Tab 1 Numero di specie di Osteitti ed Elasmobranchi ed indice di ricchezza specifica vedi testo Species number of Osteichthyes and Elasmobranchs and species richness index see text N Famiglie O S N E S E C O E Superficie Osteitti O Elasmobranchi E GSA km s 1 2 Sp 12753 1 54 29 0 23 0 83 70 13 5 Sp 12656 1 35 27 O21 osi wa 43 6 Sp 32506 0 67 26 0 08 0 32 78 12 7 8 Fr 18422 1 10 37 020 o4 7313 9 It 42410 0 49 29 007 0 24 76 13 10 it 20255 0 76 26 0 13 037 63 13 11 ip 26975 0 71 27 010 0 27 68 13 15 Ma 10580 1 43 37 0 35 0 84 64 14 16 It 48698 0 42 40 0 08 0 33 77 13 17 It SI Cr 92261 0 20 31 0 03 0 17 64 11 18 It Al Mo 29008 0 55 24 0 08 0 27 62 12 19 It 16347 1 10 26 0 16 0 37 73 15 20 Gr 16823 0 93 28 0 17 0 88 61 13 22 Gr 155674 0 14 38 0 02 0 26 76 15 23 Gr 7343 1 40 14 0 19 0 82 48 9 25 Cy 11106 1 43 29 0 26 1 12 67 11 Bibliografia BERTRAND J A GIL DE SOLA L PAPACONSTANTINOU C RELINI G SOUPLET A 2000 Contribution on the distribution of elasmobranchs in the Mediterranean from the Medits surveys Biol Mar Mediterr 7 1 385 399 BERTRAND J A
47. Ib vs C Fi 242 3 86 p 0 0579 L analisi SIMPER ha indicato che i taxa della macrofauna caratterizzanti Ia sono nell ordine Bittium reticulatum Modiolus barbatus Sabellaria spinulosa per Ib sono S spinulosa Tanidacea S alveolata e M barbatus infine per i controlli sono Pisidia cf longimana Hyale cf camptonyx Elasmopus cf brasiliensis e Harmothoe ind Conclusioni Caulerpa taxifolia var distichophylla ha prodotto sulla comunit bentonica associata al posidonieto un impatto che ha modificato la struttura dei popolamenti macro e meiobentonici con i primi sensibili gi a bassi livelli di disturbo L analisi del suo impatto su popolamenti di substrato mobile lungo le coste turche Cevik et al 2012 aveva mostrato un incremento di diversit facendo concludere che l alga aliena rappresenta un ingegnere ecosistemico poich ha creato un nuovo habitat ad alta diversit Lungo le coste della Sicilia la presenza dell alieno agisce modificando la struttura di comunit di un habitat naturalmente ricco favorendo policheti es Sabellaria spp e molluschi come B reticulatum specie dominante anche nell habitat invaso lungo le coste turche Cevik et al 2012 a scapito soprattutto dei crostacei Bibliografia BOX A MARTIN D DEUDERO S 2010 Changes in seagrass polychaete assemblages after invasion by Caulerpa racemosa var cylindracea Chlorophyta Caulerpales community structure trophic guilds and taxonom
48. In ambito Mediterraneo attualmente in corso un progetto volto a promuovere la pesca responsabile e la conservazione delle comunit bentoniche con un iniziativa di cooperazione transfrontaliera tra Spagna Italia e Tunisia cofinanziata dall Unione Europea ECOSAFIMED Uno dei presupposti generali del progetto che ancora esistano comunit bentoniche relativamente ben preservate in zone non sottoposte a pesca industriale e che queste zone possano essere mantenute laddove esiste una buona gestione della pesca artigianale locale Il progetto si propone quindi di valutare l impatto della pesca artigianale sul fondo e sulle comunit bentoniche attraverso campagne di pesca ed esplorazioni ROV allo scopo di quantificare il bycatch bentonico di attrezzi differenti e di mettere in evidenza le tracce di impatto sugli organismi bentonici applicando la metodologia della Direttiva quadro sulla strategia marina Tali dati saranno poi utilizzati sia per individuare di concerto con i pescatori aree di grande valore ecologico e naturalistico da proporre come aree marine protette sia per offrire alle flotte artigianali raccomandazioni su possibili pratiche di pesca che favoriscano la conservazione delle comunit bentoniche e di conseguenza del pescato che gravita attorno ad esse 10 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Bibliografia ANGIOLILLO M DI LORENZO B FARCOMENI A BO M B
49. Italiana di Biologia Marina Roma 10 12 giugno 2015 POSTER COMITATO GESTIONE E VALORIZZAZIONE DELLA FASCIA COSTIERA 102 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 V ASNAGHI M ABBOUD ABI SAAB R BERTOLOTTO P CIMINIELLO R LEMEE V MANCA L MANGIALAJO E OTTAVIANI A PEDRONCINI C Russu V C SANGIORGI C Tottt S TURK M VASSALLI M VILA M CHIANTORE CoNISMa Piazzale Flaminio 9 00196 Roma Italia valentina asnaghi unige it 2DiSTAV Universit di Genova CNRS Lebanon ARPAL Universit di Napoli SLOV ARPA Sardegna Universit de Nice Sophia Antipolis OnAIR DHI Italia ARPA Lazio VINSTM CNR IBF ICM CSIC M3 HABS MONITORAGGIO MODELLAZIONE E MITIGAZIONE DEL RISCHIO ASSOCIATO ALLE FIORITURE DI MICROALGHE BENTONICHE TOSSICHE LUNGO LE COSTE MEDITERRANEE M3 HABS RISK MONITORING MODELLING AND MITIGATION OF BENTHIC MICROALGAL BLOOMS ACROSS MEDITERRANEAN REGION Abstract The project M3 HABs regarding monitoring of harmful algal blooms and in particular the benthic dinoflagellate Ostreopsis started in 2014 in the framework of the ENPI CBCMED Programme The objective of the project is to provide a common strategy for monitoring benthic toxic microalgae through the development of new more efficient and common procedures and protocols making the process mostly cost and time effective allowin
50. Le catture degli sparidi sono invece state piuttosto esigue e rappresentate principalmente da S aurata Conclusioni La comunit ittica della laguna di Lesina costituita prevalentemente da specie marine eurialine come nella maggior parte delle lagune del Mediterraneo La struttura della comunit caratterizzata dalla presenza di un alto numero di specie della famiglia dei mugilidi ma da poche specie di sparidi una famiglia che generalmente ben rappresentata nelle lagune mediterranee italiane Mariani 2006 I dati riguardanti la rimonta delle giovani reclute di specie marine mostrano un risultato analogo indicando un buon afflusso di forme giovanili in autunno inverno in concomitanza con il reclutamento dei mugilidi e un modesto afflusso di nuove reclute in primavera quando a rimontare in accordo con il periodo riproduttivo di ciascuna specie dovrebbero essere gli sparidi Questi risultati sembrano indicare una diminuzione della connettivit tra la laguna di Lesina e il mare nel periodo primaverile estivo Inoltre i dati sul reclutamento ai canali mostrano come il rapporto quantitativo tra le specie e le dinamiche temporali del reclutamento non siano sostanzialmente cambiate dopo gli interventi di rimaneggiamento dei canali Bibliografia COSTA M J CABRAL H N DRAKE P ECONOMOU A N FERNANDEZ DELGADO C GORDO L MARCHAND J THIEL R 2002 Recruitment and production of commercial species in estuaries In Elliott M Heming
51. MAIDA G DURAL B FRANCOUR P GOBERT S LEPOINT G MEINESZ A MOLENAAR H MANSOUR H M PANAYOTIDIS P PEIRANO A PERGENT G PIAZZI L PIRROTTA M RELINI G ROMERO J SANCHEZ LIZASO J L SEMROUD R SHEMBRI P SHILI A TOMASELLO A VELIMIROV B 2005 Descriptors of Posidonia oceanica meadows Use and application Ecol Indicators 5 213 230 SILVA T S F COSTA M P F MELACK J M NOVO E M L M 2008 Remote sensing of aquatic vegetation theory and applications Environ Monit Assess 140 131 145 TOMASELLO A LUZZU F DI MAIDA G ORESTANO C PIRROTTA M SCANNAVINO A CALVO S 2009 Detection and mapping of Posidonia oceanica dead matte by high resolution acoustic imaging Ital J Remote Sens 41 2 139 146 14 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 P P FRANZESE G F RUSSO Dipartimento di Scienze e Tecnologie Universita Parthenope di Napoli Centro Direzionale di Napoli Isola C4 80143 Napoli Italia pierpaolo franzese uniparthenope it CONTABILITA AMBIENTALE E VALUTAZIONE DEI SERVIZI ECOSISTEMICI STRUMENTI PER LA PIANIFICAZIONE DEL TERRITORIO MARINO ENVIRONMENTAL ACCOUNTING AND ECOSYSTEM SERVICES ASSESSMENT TOOLS FOR MARINE TERRITORY PLANNING 1 Biodiversit capitale naturale e servizi ecosistemici I rapporti tra biodiversit e funzionamento degli ecosistemi sono stati delucidati in modo definitivo nel contesto del Millenn
52. MILAZZO M Analisi preliminare delle risposte della comunit intertidale a variazioni di pCO e temperatura DONNARUMMA L APPOLLONI L DI STEFANO F SANDULLI R RUSSO G F Characterization of the vermetid bioconstructions at Licosa Island Santa Maria di Castellabate MPA FERRIGNO F APPOLLONI L SANDULLI R CASORIA P RUSSO G F Deep coralligenous assemblages off Punta Campanella Tyrrhenian Sea with special reference to some facies with fan corals FORERO MEJIA A BO M CANESE S BAVESTRELLO G I ceriantari del circalitorale profondo mediterraneo n FOTI A LEZZI M FIANCHINI A GIANGRANDE A GRAVINA M F Modalit di reclutamento su substrati artificiali in due impianti di acquacoltura nel Mar Mediterrane0 IACIOFANO D MUSCO L VEGA FERNANDEZ T LO BRUTTO S Crostacei anfipodi associati a reef di Sabellaria alveolata L Annelida dello Stretto di Sicilia Mar Mediterraneo LOI B FARINA S BRUNDU G GUALA I BAROLI M Reproductive cycle of Paracentrotus lividus at two Sardinian coastal Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 MASSI D TITONE A MANCUSO M GAROFALO G GANCITANO V BADALUCCO C GRISTINA M FIORENTINO F Neptunea contraria Linnaeus 1771 and Buccinum undatum Linnaeus 1758 Gastropoda Buccinidae thanatocoenosis in the S
53. OF BLACKMOUTH CATSHARK GALEUS MELASTOMUS IN THE FAO GFCM GSA 9 LIGURIAN AND NORTHERN CENTRAL TYRRHENIAN SEA AND IDENTIFICATION OF NURSERY GROUNDS ABBONDANZA DEL GATTUCCIO BOCCANERA GALEUS MELASTOMUS NELL AREA FAO GFCM GSA 9 MAR LIGURE E TIRRENO CENTRO SETTENTRIONALE E IDENTIFICAZIONE DELLE AREE DI NURSERY Abstract The spatio temporal distribution pattern of Galeus melastomus Rafinesque 1809 was investigated in the GSA 9 Results highlighted a cyclic pattern of the abundance and biomass indices and clearly persistent nursery areas Key words distribution Elasmobranchs Ligurian Sea Tyrrhenian Sea demersal species Introduction The blackmouth catshark Galeus melastomus is present on epi and meso bathyal soft bottoms of the Mediterranean except Central and northern Adriatic It is the most abundant Elasmobranch in the GSA 9 This work is aimed to study its abundance and distribution pattern with particular attention to the nursery areas Materials and methods Data came from MEDITS experimental trawl surveys years 1994 2013 Bertrand et al 2000 The temporal evolution of density and abundance indices was investigated with MAFA Minimum Maximum Autocorrelation Factor Analysis Solow 1994 cross correlation between density and biomass was computed to highlight significant trends Recruits were identified selecting the first modal component from the LFD of each year Bhattacharya 1967 The cut off size to single was th
54. PERMANOVA Fo 12 3 1795 P gt 0 05 I popolamenti sono risultati composti per lo pi da organismi appartenenti ai gruppi morfologici delle alghe 105 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 brune filamentose DFA da alghe rosse appartenenti al genere Liagora e dall alga bruna Padina pavonica Thivy Fig 1 Pip Lsp c c DFA P p f C A 455 404 il 354 304 254 204 154 104 54 0 T T T T T DFA PH Lsp Cic CE Fig 1 Percentuale media ES di copertura del substrato in T4 dei taxa pi abbondanti e di C cylindracea per ciascun trattamento P p P pavonica L sp Liagora sp C c C cylindracea Mean ES percentage cover of the substratum in T by the most abundant taxa and by C cylindracea for each treatment P p P pavonica L sp Liagora sp C c C cylindracea Copertura del sub strato DFA Lsp Cc At Relativamente a C cylindracea percentuali di ricoprimento del substrato assai simili sono state osservate al tempo T in tutte le unit sperimentali Fig 1 e P ANOVA test ha escluso l esistenza di differenze significative di ricoprimento tra trattamenti ANOVA Fo 12 1 30 P gt 0 05 Conclusioni L assenza di differenze significative nel ricoprimento di C cylindracea tra trattamenti in soli tre mesi conferma le sue notevoli capacit di insediamento e sviluppo Ceccherelli e Piazzi 1999
55. R and F test Finally the one two years forward predictions were also provided All the analyses were performed in R R Core Team 2014 Results and conclusions Bony fish showed a fluctuating pattern around about 350 kg km and 23000 n km An adequate model for both biomass R 0 49 and density index R 0 36 was a third degree polynomial Fig la b The one two years forecasts showed a marked decrease for both series The cartilaginous fish biomass index showed an increasing pattern up to year 2010 and then a decrease Such pattern was modeled by a third degree polynomial which fitted well R 0 86 while the corresponding density time series was fitted by a four degree polynomial R 0 87 Predictions for these models indicate a decrease in biomass for the years 2014 and 2015 and an increase in density in the same period Fig 1c d Cephalopods biomass index showed a significant linear trend beta 0 67 p 0 01 R 0 27 and a predicted increasing for the years 2014 2015 The corresponding density time series was fitted well by a four degree polynomial R 0 69 whose predictions for the years 2014 2015 142 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 showed a marked increase Fig le f In the case of crustaceans biomass index was fitted by a linear positive trend beta 1 46 p lt 0 0001 R 0 53 whereas density index was poorly fitted R 0 19 by a linear model wi
56. S 2009 Characteristics of a black coral meadow in the twilight zone of the central Mediterranean Sea Mar Ecol Prog Ser 397 53 61 75 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 A FORERO MEJIA M Bo S CANESE G BAVESTRELLO Dipartimento di Scienze della Terra dell Ambiente e della Vita DISTAV Universita di Genova Corso Europa 26 16132 Genova Italia annyforero gmail com Istituto Superiore per la Protezione e la Ricerca Ambientale Roma Italia ICERIANTARI DEL CIRCALITORALE PROFONDO MEDITERRANEO CERIANTHIDS OF THE DEEP MEDITERRANEAN CIRCALITTORAL Abstract Density and distribution of four species of cerianthids were recorded in three Mediterranean regions North West Sicily Gulfs of Naples and Salerno and western Ligurian Riviera Cerianthus membranaceus was recorded in all the studied regions with sparse polyps Pachycerianthus dohrni was recorded only in the southern regions while P solitarius only in the Ligurian Sea Arachnanthus oligopodus was recorded only in the Gulf of Naples where it may reach very high densities and it is the main element of the soft bottom assemblage Key words deep circalittoral zone benthic communities Ceriantharia distribution Introduzione Un punto di svolta nello studio delle comunit bentoniche del circalitorale profondo del Mediterraneo stato l utilizzo su ampia scala di veicoli filoguidati ROV Bo
57. SPANIER E 2002 An application of artificial reefs to reduce organic enrichment caused by net cage fish farming preliminary results ICES J Mar Sci 59 324 329 LICCIANO M STABILI L GIANGRANDE A CAVALLO R A 2007 Bacterial accumulation by Branchiomma luctuosum Annelida Polychaeta a tool for biomonitoring marine systems and restoring polluted waters Mar Environ Res 63 291 302 79 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 D IACIOFANO L Musco T VEGA FERNANDEZ S LO BRUTTO Sezione di Biologia Animale Dipartimento STeBiCeF Universita di Palermo Via Archirafi 18 90123 Palermo Italia sabrina lobrutto unipa it CNR IAMC Castellammare del Golfo TP Italia CROSTACEI ANFIPODI ASSOCIATI A REEF DI SABELLARIA ALVEOLATA L ANNELIDA DELLO STRETTO DI SICILIA MAR MEDITERRANEO AMPHIPOD CRUSTACEAN ASSEMBLAGES OF SABELLARIA ALVEOLATA L ANNELIDA REEFS IN THE SICILY STRAIT MEDITERRANEAN SEA Abstract We describe diversity and patterns of spatial distribution of the amphipod fauna associated with reefs of the polychaete Sabellaria alveolata L in the Sicily Strait Samples were collected in June 2013 at three localities Amphipod assemblages appeared homogeneous in the study area with variability increasing with decreasing spatial scale of observation Jassa ocia Bate and Gammaropsis ulrici Krapp Schickel amp Myers characterized the
58. Trieste northern Adriatic Sea and their ecosystem implications Aquat Microb Ecol 46 163 175 HANSEN H KOROLEFF F 1999 Determination of nutrients In Grasshoff K Kremling K Ehrhard M eds Methods of seawater analysis Wiley Weinheim 159 228 KARUZA A FONDA UMANI S DEL NEGRO P 2012 The un coupling between viruses and prokaryotes in the Gulf of Trieste Estuar Coast Shelf S 115 87 97 ZINGONE A TOTTI C SARNO D CABRINI M CAROPPO C GIACOBBE M G LUGLIE A NUCCIO C SOCAL G 2010 Fitoplancton metodiche di analisi quali quantitativa In Socal G Buttino I Cabrini M Mangoni O Penna A Totti C eds Metodologie di studio del plancton marino ISPRA Manuali e Linee Guida 56 213 237 178 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 A KARUZA M GIANI G INGROSSO P DEL NEGRO OGS Istituto Nazionale di Oceanografia e Geofisica Sperimentale Sezione Oceanografia Via A Piccard 54 34151 Trieste Italy akaruza ogs trieste it THE EXTRAORDINARY COLD EVENT 2012 HOW IT AFFECTED MICROBIAL DYNAMICS IN THE ADRIATIC PITS L EVENTO DI FREDDO ECCEZIONALE 2012 COME HA INFLUENZATO LE DINAMICHE MICROBICHE NELLE FOSSE ADRIATICHE Abstract In order to define the microbial dynamics associated with the presence of different water masses two Adriatic pits has been explored in March 2013 The presence of the hyper dense water t
59. a un finanziamento da parte della Societ Italiana di Biologia Marina SIBM 197 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 F FIORENTINO V GANCITANO G B GIUSTO D MASSI G SINACORI A TITONE A VINCI G GAROFALO Istituto di Ricerche sulle Risorse Marine e 1 Ambiente IAMC CNR UOS di Mazara del Vallo Via L Vaccara 61 91026 Mazara del Vallo TP Italia fabio fiorentino iamc cnr it MARINE LITTER ON TRAWLABLE BOTTOMS OF THE STRAIT OF SICILY RIFIUTI ANTROPICI MARINI SUI FONDI STRASCICABILI DELLO STRETTO DI SICILIA Abstract Quantitative data on marine litter were collected during the MEDITS survey carried out in the Strait of Sicily in 2013 A total of 619 items 66 N km were collected being Plastic the most common category A comparison with estimates of marine litter occurrence carried out in 1994 allowed to observe a general increase of pollution by solid waste of the trawlable grounds of the Strait of Sicily Key words marine litter trawl surveys Strait of Sicily Mediterranean Sea Introduction Marine litter has become a relevant concern around the world and is included among descriptors for evaluating the Good Environmental Status of the sea in the framework of the Marine Strategy Framework Directive Directive 2008 56 EC The present study investigates amount composition and distribution of marine litter on the trawlable bottoms of the Str
60. activities We present the results of the studies of the POR FESR Sardinia 2007 2013 made in according to the MSP indications project regarding habitats and species of the SIC and ZPS Key words Spatial Planning Asinara Island SIC Introduzione La Pianificazione Spaziale Marittima PSM costituisce lo strumento dell attuale programmazione comunitaria per integrare e ottimalizzare le azioni di gestione sostenibile delle risorse naturali e culturali e della prevenzione dei rischi in ambito marino e costiero Si espongono le attivita di monitoraggio del 2013 del progetto dell Unione Europea P O R FESR Sardegna 2007 2013 relativo allo studio degli habitat e delle specie delle Direttive Habitat e uccelli interessanti il SIC e le ZPS dell Isola dell Asinara L Isola insieme al Parco Regionale e Area Marina Protetta di Porto Conte il Parco Nazionale dell Arcipelago di La Maddalena e all Office de l Environnement de la Corse fa parte della Rete Transfrontaliera di Parchi realizzata nell ambito P O Marittimo 2007 2013 dove vengono impiegati approcci ecosistemici integrati coordinati e transfrontalieri secondo le indicazioni PSM Materiali e metodi Per Lithophyllum byssoides Lamarck Foslie si rilevata presenza assenza del tratto di costa posizione lunghezza larghezza delle cornici Per Pinna nobilis L su 15 transetti di 110 m distanti 50 m due subacquei in immersione ARA Garcia March e Kersting 2006 hanno rilevato la
61. ambientali che possano aiutare a meglio comprendere l impatto degli impianti di allevamento sull ambiente Un elemento di criticit ambientale l immissione nei corpi idrici di sostanze potenzialmente inquinanti antibiotici disinfettanti pseudofeci residui di mangimi ecc da cui possono derivare impatti sulla biodiversit la salute umana e degli ecosistemi naturali La nostra ricerca ha avuto come obiettivo l analisi di alcuni parametri microbiologici in corpi idrici quali recettori di reflui di impianti di acquacoltura Sono state individuate due aree del Mar Grande di Taranto in cui sono presenti allevamenti di mitili e di pesci Materiali e metodi I campionamenti sono stati effettuati stagionalmente in due stazioni localizzate nel Mar Grande di Taranto stazioni P e C Nelle matrici acqua superficiale e sedimento sono stati ricercati microrganismi potenzialmente patogeni Vibrionaceae e indicatori di contaminazione fecale Gli indicatori di contaminazione fecale sia nell acqua che nel sedimento sono stati determinati con il metodo Most Probable Number MPN American Public Health Association 1992 Per la ricerca dei batteri appartenenti al genere Vibrio le aliquote dei campioni sono state filtrate su membrane sterili 0 45 um seminate su piastre di Thiosulphate Citrate Bile Salt Agar TCBS addizionato del 2 di NaCl Dopo incubazione le colonie cresciute sono state isolate ed identificate sino a livello di specie secondo g
62. annue la maggior parte sbarcate in Sicilia Irepa 2009 Tuttavia al contrario di altre aree cfr Bottari et al 2014 poche informazioni sono disponibili per la Sicilia meridionale et e crescita Cannizzaro et al 2001 Scopo di questa nota di descrivere l evoluzione di questa risorsa negli anni recenti e di stimarne alcuni aspetti biologici quali la sex ratio l et di prima maturit la relazione peso lunghezza i parametri di crescita Materiali e metodi Nel corso delle campagne sperimentali di pesca a strascico MEDITS Anonimo 2012 condotte dall IAMC CNR nella GSA 16 South of Sicily negli anni 1994 2009 in primavera sono state calcolate le densit per km in numero DI e peso BI di B boops A partire dal 2006 sono anche state rilevate le misure individuali di lunghezza totale mm peso g sesso e stadio di maturit scala a 8 stadi Anonimo 2012 di 477 femmine e 572 maschi Per l elaborazione dei dati e la stima dei parametri stato utilizzato il programma SEA TrIM De Santi et al 2007 Risultati B boops risultata presente in 678 su 1301 cale valide con catture quasi esclusivamente sulla piattaforma senza mostrare discontinuit orizzontale Gli indici BI Fig 1 ed in modo simile anche i DI e la percentuale di cale positive mostrano oscillazioni progressivo calo e repentino sbalzo pressappoco quinquennali fluttuazioni che sembrano presenti anche esaminando dati storici 1950 1990 Fio
63. based on site specific environmental standard curves Casabianca ef al 2014 Moreover as new strains were isolated from the eastern area of the Mediterranean Sea and their sequences were different from O cf ovata new primer sets were designed for the identification of the genus Ostreopsis spp and Ostreopsis sp from eastern Mediterranean Sea Materials and methods A total of 18 macroalgae and 16 seawater samples were collected during the summer of 2011 2012 and 2013 at different Mediterranean beaches Llavaneres Spain Civitavecchia Trieste Passetto Portonovo Genova Bari and Taormina Italy Samples were fixed immediately lysed to obtain crude extracts containing genomic DNA or stored at 4 C until molecular analyses A total of seven site specific LSU rDNA environmental standard curves LSU STD of ten fold serial dilution in the 8 to 0 0008 cellular range were constructed amplifying the 204 bp fragment Furthermore new primer sets were designed and validated for the identification of the genus Ostreopsis based on mitochondrial COI and cob genes Penna et al 2014 and another primer set based on ITS sequences of Ostreopsis sp strains from Cyprus and Lebanon representing the Ostreopsis sp 2 Atlantic Mediterranean clade David et al 2013 Penna et al 2014 Results The O cf ovata LSU rDNA copy numbers per cell in environmental samples were different at each of the seven sampled Mediterranean coastal sites Thus for the q
64. by engineering brown algae such as Fucales To explain their decline in the Mediterranean where they previously formed dense populations in shallow and deep waters several causes have been brought forward habitat destruction overgrazing competition invasive species turbidity pollution climate changes and ocean acidification Thibaut et al 2005 The biological traits of these species long life spans low recruitment levels low growth rates have been mentioned as responsible for the low resilience of the most sensitive species but researches on their responses to various pressures are poorly quantified Thanks to Funk s algal baseline 1927 1955 a recent reassessment of historical occurrence of habitat forming species in the Gulf of Naples has been elaborated and a decline of Cystoseira and Sargassum spp has been recorded in shallow waters Buia et al 2013 In order to better manage the conservation of these species and the functioning of their systems an integrated scientific approach has been developed engaging local stakeholders and citizens too Preliminary results are presented here Materials and methods The occurrence of Cystoseira and Sargassum spp all around the Gulf of Naples including those sites for which no data was previously available has been monitored to provide a new baseline of their current state In order to evaluate the correspondence between algal decline and coastal landscape transformation images fro
65. cirrosa e 140 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Liza saliens che rappresentano il 69 della biomassa totale Il pescato totale del tremaglio infine risulta composto da 37 specie di cui 5 target Psetta maxima S officinalis Scophthalmus rhombus Platichthys flesus e Dicentrarchus labrax che rappresentano il 74 della biomassa totale Considerando la composizione totale del pescato in termini di gruppo di affinit climatica le specie fredde rappresentano la maggior parte del pescato con un contributo del 64 02 della biomassa totale le specie temperate contribuisco per il 31 25 mentre il rimanente 3 31 0 98 0 29 e 0 15 dato rispettivamente da specie ubiquitarie calde temperato fredde e temperato calde Osservando il pescato per singola tecnica di pesca possiamo riscontrare che le nasse e i nassini essendo altamente specie selettivi mostrano una cattura composta solo da una specie fredda ed una temperata rispettivamente Nelle reti ad imbrocco e nel tremaglio le principali catture sono rappresentate da specie fredde mentre le catture rimanenti sono costituite da specie temperate ubiquitarie calde temperato fredde e temperato calde Tab 1 Tab 1 Percentuali in termini di biomassa totale del pescato per singolo attrezzo in relazione alle classi di affinit termica delle singole specie Total catch biomass percentage per single gear in relation
66. coralligeni impattando indirettamente le comunit presenti con un aumento della torbidit dell acqua e della sedimentazione Talvolta a causa di manovre sbagliate impatti diretti sono dovuti al contatto con la rete o con i divergenti che producono danni meccanici soprattutto alle forme coloniali a scheletro carbonatico Anche gli attrezzi da posta tramagli palamiti da fondo generalmente considerati poco impattanti possono produrre gravi danni sugli organismi arborescenti Bavestrello et al 1997 Le reti e o i cavi occasionalmente persi o volontariamente abbandonati dai pescatori perch obsoleti rimangono facilmente impigliati nelle formazioni coralligene e soffocando l intera comunit Bo et al 2014 Angiolillo et al 2015 Recentemente stato anche dimostrato che l ingegno per la raccolta del corallo rosso sebbene bandito dall Unione Europea fin dal 1994 ancora frequentemente utilizzato almeno nel Canale di Sicilia Cattaneo Vietti ef al in stampa La tutela Le comunita coralligene sono ambienti caratterizzati da un intrinseca fragilita strutturale e funzionale e tale caratteristica deve essere presa in considerazione per trovare un giusto equilibrio tra le esigenze di conservazione e l uso ricreativo ed economico di questi ambienti Lungo le coste italiane una piccola frazione degli ambienti coralligeni oggi compresa all interno delle AMP mentre altri banchi sono inclusi in Siti di Interesse Comunitar
67. dei Pleuronettiformi la sogliola Solea solea nella maggioranza dei casi e segnalare alcuni episodi di frode per sostituzione sia nel congelato sia nel filetto della sogliola con il rombo giallo Lepidorhombus whiffiagonis 12 o con la linguattola Citharus linguatula 20 L analisi filogenetica 208 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 comparativa dei campioni in esame ha permesso inoltre di stimarne le distanze genetiche Fig 1B Tab 1 Catalogazione campioni esaminati Cataloging examined samples SIGLA STATO UNIT So fresco 25 SoC congelato 25 SoF filetto 25 A B bp Lepidorhombus whiffiagonis 0 612132 650 500 Solea solea 0 120312 0 61213 Citharus linguatula p 0 118192 Fig 1 A PCR del frammento mitocondriale CO1 rRNA per gli esemplari considerati M marker O Gene Ruler 100 bp Fermentas 1 COI So 2 COI SoC 3 COI SoF B Albero filogenetico delle specie analizzate con relative distanze genetiche A PCR of the mitochondrial gene fragment COI rRNA in considered specimens M marker O Gene Ruler 100 bp Fermentas1 COI So 2 COI SoC 3 COI SoF B Phylogenetic tree of the species analyzed with relative genetic distances Conclusioni In conclusione in questo lavoro dimostriamo l efficacia dell analisi della variabilit del COI nel campo applicativo tracciabilit e sicurezza alimentare cos come nella ricerca d
68. densit delle megalope di P gibbesi in Mediterraneo Le CPUE sono risultate differenti fra le localit e in relazione alla distanza dalla costa L alta variabilit fra le localit ed i siti potrebbe essere imputabile alle diverse condizioni oceanografiche che caratterizzano in particolare AM situata nella parte centrale di un golfo rispetto alle altre localit Inoltre la distanza dalla costa potrebbe essere un fattore che influenza la durata della fase pelagica e la transizione al dominio bentonico per molti organismi marini caratteristici delle aree costiere Gli alti valori di CPUE registrati nei siti pi lontani dalla costa D5 D4 evidenziano una maggiore disponibilit di megalope in fase pelagica La presenza di siti idonei al reclutamento in prossimit della costa invece potrebbe aver influenzato le catture nei siti pi vicini alla costa D2 D1 In conclusione ci si auspica di continuare le indagini per capire quali siano i fattori oltre alla distanza che determinino la variabilit trovata tra le localit Inoltre importante sottolineare l efficacia delle trappole di luce nella cattura di fasi larvali di crostacei decapodi Bibliografia AGNETTA D BACCARELLA A GIANGUZZA P BADALAMENTI F PIPITONE C 2013 First estimates of density and distribution of the alien crab Percnon gibbesi Decapoda Percnidae in the Capo Gallo Isola delle Femmine MPA Biol Mar Mediterr 20 1 114 115 DEUDERO S FRAU A
69. densit ed effettuato le misure biometriche La prateria a Posidonia oceanica L Delile stata monitorata nelle quattro aree destinate a campi boa Le prospezioni Side Scan Sonar son state eseguite in alta definizione a 500 MHz La densit stata rilevata mediante un quadrato di 40 cm di lato su 10 repliche La percentuale di copertura stata determinata dalla media del rilevamento diretto di due operatori subacquei La compattezza della matte stata stimata mediante un penetrometro Per la popolazione di Patella ferruginea Gmelin 1791 si fa riferimento a Cossu e De Luca 2014 Risultati Patella ferruginea endemica del Mediterraneo occidentale attualmente considerata l invertebrato pi a rischio di estinzione di tutto il bacino si rimarca come gli oltre 8500 individui presenti pongono la popolazione tra le pi importanti del Mediterraneo dovuta al limitato prelievo derivante dalla attuale e pregressa storia dell Isola L byssoides mostra le maggiori concrezioni di dimensioni di oltre 50 60 cm di larghezza nel settore sud ovest dell isola il tratto tra Punta Salippi e Punta Tumbarino soggetto a notevoli correnti ed costituito da un substrato scistoso dove anfratti spaccature e scogli costituiscono un fronte frangiflutti idoneo allo sviluppo dell alga L estensione pi contenuta dei popolamenti del settore nord ovest da porre 28 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma
70. detected with evident hot spots evidenced to the south of Elba Island Fig 2b Recruits are also abundant to the north of Elba but in this area they are more homogeneously distributed and do not form recurrent aggregations 800 45 1 5 700 a S 35 1 0 30 3 50 E 0 5 S 3 jeg 5 40 w 24 00 Fot Z 5 50 05 200 10 10 100 5 0 0 15 T TI T 1994 1996 1998 2000 2002 2004 2006 2008 2010 2012 1994 1996 1998 2000 2002 2004 2006 2008 2010 2012 Biomass index Density index Year Fig 1 Density and biomass indices MEDITS 1994 2013 left trends computed by MAFA right Indici di densit e biomassa MEDITS 1994 2013 sin trend calcolato con MAFA destra Fig 2 a Spatial distribution of the species year 2007 b persistency map of nursery areas a Distribuzione spaziale della specie anno 2007 b mappa di persistenza aree di nursery Conclusions The high persistency of the nursery and spawning areas is linked to the presence of muddy bottoms of the continental slope particularly abundant in the southern part of the investigated area The present results provide useful information to implement a spatially based fishery management References BERTRAND J DE SOLA G PAPACONSTANTINOU C RELINI G SOUPLET A 2000 An international bottom trawl survey in the Mediterranean the MEDITS programme Actes Colloq 26 76 93 BHATTACHARYA C G 1967 A simple
71. developments in the use of probioties for disease control in aquaculture Aquaculture 431 1 11 La presente ricerca stata svolta con i contributi del progetto PON INNOVAQUA 02_3362185 e del Programma Scienze per la DIPLOMAzia 40 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 M CAVALLARO F GIARRATANA D MUSCOLINO A DANZE E NAVARRA Dipartimento di Scienze Veterinarie Universita di Messina Polo Universitario dell Annunziata 98168 Messina Italia mcavallaro unime it Associazione Kurma Via Andria 8 98121 Messina Italia PRIMA ESPERIENZA DI RIPRODUZIONE IN CATTIVIT DEL TRITONE MEDITERRANEO CHARONIA LAMPAS LAMPAS GASTROPODA CAENOGASTROPODA MEDITERRANEAN TRITON CHARONIA LAMPAS LAMPAS GASTROPODA CAENOGASTROPODA FIRST REPORT ON CAPTIVE BREEDING Abstract Two female and a male triton of Charonia lampas lampas Linnaeus 1758 were collected in different periods from March 2010 to September 2012 in S Raineri Peninsula in Messina Sicily Italy They were reared in a tank at the Aquarium of Messina Mussels starfish and holothurians were provided as feed for the triton Spawning occurred in November 2012 lasted for 15 days yielding a total number of 500 egg capsules with approximately 2 0 3 0x103 eggs capsule The snail did not eat during the month in which spawned Spawning behaviour and larval development of the triton was described Key word
72. di 10x10x10 cm sono state raccolte nel giugno 2013 in due siti distanti decine di metri da tre localit dello Stretto di Sicilia distanti decine di km Donnalucata DL Triscina TR Eraclea Minoa EM In ogni sito sono state raccolte 4 repliche tra 1 5 e 3 m di profondit distanti tra loro alcuni metri La fauna ad anfipodi stata identificata al livello di specie per quanto possibile usando la letteratura di riferimento Il disegno sperimentale ha previsto un fattore Localit Loc random 3 livelli e un fattore Sito si gerarchizzato in Loc Sono state condotte analisi uni e multivariate ANOVA MANOVA SIMPER Risultati Sono stati raccolti 1055 individui di anfipodi appartenenti a 28 taxa di cui 21 specie L ANOVA non ha riscontrato differenze significative di abbondanza tra localit Loc F 3 3 52 p 0 7192 ma variabilit a livello della scala spaziale del sito 80 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 si Loc F3 18 7 44 p 0 0013 con ampie oscillazioni tra siti all interno della stessa localit in particolare a TR ed EM valore massimo nel sito TRI media 96 5 15 5 DS minimo in EM2 media 19 25 17 1 DS Il numero medio di taxa risultato variabile tra un minimo di 4 0 8 DS a EM2 ed un massimo di 8 5 1 3 DS a TRI senza far tuttavia registrare significative differenze tra localit e siti Loc Fz 3 3 51 p 0 1677 si Loc F3
73. di favorire la proliferazione delle praterie nel SIC IT3250031 intervenendo con piccoli trapianti di zolle e rizomi a basso costo e impatto svolti da pescatori e cacciatori appositamente formati per queste attivit Contestualmente ai trapianti vengono svolte attivit di monitoraggio degli accrescimenti e dello stato ecologico Sfriso et al in stampa Scapin et al in stampa Materiali e metodi Il progetto prevede trapianti in 35 stazioni Fig la in due anni Nella primavera 2014 sono stati effettuati manualmente i primi trapianti in 17 stazioni secondo lo schema in Fig 1b Le zolle sono state prelevate da praterie ben strutturate nelle Valli da pesca limitrofe alle aree d intervento In tutti i siti sono state trapiantate almeno 3 zolle di Nanozostera noltii Hornemann Tomlinson amp Posluszny che tipicamente colonizza gli ambienti barenicoli fanghi fini e profondit di 50 100 cm In alcuni siti sono state fatte prove con Ruppia cirrhosa Petagna Grande o 111 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Cymodocea nodosa Ucria Ascherson previa verifica delle condizioni ottimali per queste specie Negli altri casi stata trapiantata Zostera marina Linnaeus sitesin lst year environmental monitoring sitesin lst year O sitesin 2st year Fig 1 a Area d intervento b schema di impianto delle zolle a
74. di ricerca Bioforsk Svanhovd Norvegia ed all arrivo in Italia CNR IAMC un totale di 187 ceppi batterici sono stati isolati af random ed identificati in via preliminare in base a caratteristiche fenotipiche colorazione di Gram morfologia fermentazione del glucosio ossidasi bioluminescenza Sono state inoltre saggiate le attivit proteolitica lipolitica fosfatasica emolitica alfa e beta glucosidasica Kim e Hoppe 1986 Garcia Moreno e Landgraf 1998 171 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Risultati La salinita rilevata nelle singole stazioni presentava valori tipici degli ambienti salmastri compresi tra 0 e 30 nelle stazioni site pi a nord Stazioni 3 4 6 e 7 rappresentative dell area di transizione fluviale marina Le concentrazioni batteriche determinate nelle due campagne variavano tra 7 5x10 e 4 9x10 CFU ml nell acqua e tra 1 2x10 e 1 0x107 CFU g nel sedimento La composizione qualitativa dei ceppi isolati sulla base della preliminare indagine fenotipica risultava caratterizzata sia nell acqua che nel sedimento da una prevalenza dei generi Neisseria Photobacterium Staphylococcus Pseudomonas Enterobacter ed in minore incidenza anche da Micrococcus e Bacillus spp In luglio si osservava una riduzione della percentuale di Neisseria Photobacterium e Pseudomonas nell acqua mentre nello stesso periodo stagionale nel sedimento si regist
75. diterran e Rec Trav Stat Mar Endoume 31 47 137 pp 85 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 C MUNARI N BOCCHI M BORAZIO M MISTRI Dipartimento di Scienze della Vita e Biotecnologie Universita di Ferrara Via L Borsari 46 44121 Ferrara Italia msm unife it EPIFAUNA ASSOCIATA A ULVA RIGIDA IN UNA LAGUNA DEL DELTA DEL PO EPIFAUNA ASSOCIATED TO ULVA RIGIDA IN A PO DELTA LAGOON Abstract The macrofauna associated with the native Chlorophyta Ulva rigida C Agardh 1822 has been investigated along a 5 years study period in a lagoon of the Po River Delta N W Adriatic Sea Numerically dominant species were the amphipod Gammarus aequicauda and the non indigenous mytilid Arcuatula senhousia Comparison with the fauna associated to the invasive Gracilaria vermiculophylla Ohmi Papenfuss present in the same lagoon showed that U rigida had lower richness and diversity Key words macrobenthos Ulva rigida Adriatic Sea Introduzione Ulva rigida C Agardh 1822 una clorofita estremamente comune nelle lagune costiere del Delta del Po ciononostante sono pochi gli studi relativi alla macrofauna associata ai suoi talli in tali ambienti In questo lavoro vengono riportati i risultati di uno studio riguardante la composizione abbondanza e diversit delle comunit macrobentoniche epifitiche associate ai talli di U rigida in una laguna nord adriatica Lag
76. e di potenziale recupero delle popolazioni naturali Nell ambito del progetto FP7 Capacities ResUrch http resurchproject com finalizzato a ridurre il tempo necessario alla crescita a taglia commerciale dei giovanili di riccio di mare uno degli obiettivi testare differenti diete per verificarne le performance in sistemi di allevamento a terra A tale scopo sono stati testati tre differenti mangimi forniti da altrettanti partners del progetto il mangime A a base di farine vegetali B a base di macroalghe C Nofima diet mangime estruso a base di mangime per pesci e macroalghe Azad et al 2011 Materiali e metodi La stabilit dei mangimi utilizzati stata testata misurando ad intervalli prestabiliti il peso secco di un aliquota fissa immersa in acqua di mare a 19 e 24 C Ogni trattamento stato replicato 6 volte a 24 C e 3 volte a 19 C I pesi secchi sono stati standardizzati rispetto al peso iniziale per ogni tempo di campionamento e le curve di dissoluzione rappresentate sono state calcolate tramite curve di loess I 51 ricci necessari all esperimento sono stati raccolti da un habitat subtidale caratterizzato da popolamenti macroalgali ben vegetati e tenuti digiuni per 2 settimane Sono stati poi selezionati casualmente 6 esemplari di cui sono stati misurati il diametro totale il peso totale e il peso delle gonadi in seguito a dissezione Diametro e peso totale dei rimanenti 45 ricci sono stati misurati ed i ricci sono
77. eosina di Carazzi e tricromica di Masson Risultati Il sistema fotogeno della specie D holti piuttosto articolato Esso conta infatti 35 fotofori distribuiti su tutta la superficie corporea dell animale Caratteristici della specie sono un fotoforo dorso nasale ben separato da quello ventro nasale 4 5 anali anteriori e 4 5 anali posteriori Tortonese 1957 Carattere tassonomico distintivo della specie rappresentato dal primo fotoforo della serie anale che allineato ai successivi invece di trovarsi pi in alto rispetto alla specie congenere D rafinesquii Cocco 1838 Non esiste diversit strutturale tra i fotofori dislocati nei vari distretti corporei della specie ad esclusione di quelli della testa L organo costituito da una camera fotogena all interno della quale si trovano i fotociti e da una serie di annessi diottrici Questi ultimi sono rappresentati dalla lente dal corpo gelatinoso e dallo strato 194 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 pigmentato La camera fotogena si presenta piuttosto voluminosa ed i fotociti di forma poliedrica sono ordinatamente disposti lungo il margine della camera stessa ed organizzati in cordoni disposti radialmente verso il lume posto in posizione centrale La lente costituita da un doppio corredo cellulare il primo costituito da cellule di forma bastoncellare ammassate e adese ventralmente alla camera fotogena a co
78. et al 2012 Tramite questo mezzo stata ottenuta una notevole quantit di informazioni sulle foreste di coralli profondi i cui principali componenti sono gorgonie antipatari e sclerattinie Molto pi scarse invece sono le informazioni ROV riguardanti il megabenthos di fondo molle di cui i ceriantari sono un importante esponente poich sulle vaste piane fangose gli organismi tendono a non aggregarsi e sono pi difficili da individuare I ceriantari sono antozoi che vivono all interno di un tubo costituito da filamenti di pticocisti in grado di trattenere granelli di sedimento e rivestito sul lato interno da uno strato mucoso Mariscal et al 1977 Per il Mediterraneo sono note sette specie appartenenti a tre famiglie Cerianthidae Botrucnidiferiidae e Arachnactidae La prima famiglia include 4 specie Cerianthus membranaceus Spallanzani 1784 Cerianthus lloydii Gosse 1859 Pachycerianthus solitarius Rapp 1829 e Pachycerianthus dohrni van Beneden 1923 La seconda famiglia rappresentata da un unica specie conosciuta solo allo stato larvale Cerianthula mediterranea van Beneden 1897 mentre l ultima famiglia comprende due specie Arachnactis albida Sarsi 1846 conosciuta solo come larva e Arachnanthus oligopodus Cerfontaine 1891 P dohrni e A oligopodus sono considerati endemismi mediterranei mentre le altre specie hanno una distribuzione Atlanto mediterranea Lo scopo di questo lavoro fornire dati sulla dist
79. giugno 2015 POSTER COMITATO PLANCTON 166 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 M BATTUELLO R MUSSAT SARTOR N NURRA G D ARDIZZONE A M DE Biast D PESSANI Dip Scienze della Vita e Biologia dei Sistemi Universita di Torino Via Accademia Albertina 13 10123 Torino Italia Pelagosphera Cooperativa di servizi in ambiente acquatico Portoferraio LD Italia marco battuello unito it info pelagosphera com Dipartimento di Biologia Ambientale Universit La Sapienza Roma Italia CIBM Centro Interuniversitario di Biologia Marina ed Ecologia Applicata G Bacci Livorno Italia I COPEPODI COME BIOINDICATORI AMBIENTALI RISULTATI PRELIMINARI RELATIVI ALLE ACQUE INTERESSATE DAL RELITTO DELLA COSTA CONCORDIA COPEPODS AS INDICATOR OF ENVIRONMENTAL HEALTH PRELIMINARY RESULTS ABOUT COSTA CONCORDIA WRECK Abstract Copepods assemblages were studied in the waters surrounding the Costa Concordia wreck Giglio Island Italy in two periods one year far from each other to assess possible contamination events and environmental impact Key words Giglio Island zooplankton Tuscan Archipelago environmental risk assessment Introduzione Il 13 gennaio 2012 la nave da crociera Costa Concordia naufragata in prossimit della costa dell Isola del Giglio Il relitto e i conseguenti sversamenti a mare hanno rappresentato l
80. high density values have been recorded in all bio concretion samples Although they are not primary builders these calcareous tube worms have a pivotal role in secondary construction and in enhancing biodiversity Key words calcareous tube worms Annelida coralligenous assemblages biodiversity Mediterranean Sea Introduzione I policheti Serpulidae sono un gruppo ubiquitario di vermi tubicoli calcarei in grado di colonizzare ambienti molto diversi Nechama Ben Eliahu e Ten Hove 1992 Bianchi e Morri 2001 ma le grotte sottomarine il coralligeno ed i fondi detritici circalitorali sono tra gli ambienti dove possibile apprezzarne una maggiore ricchezza specifica ed abbondanza Il coralligeno si caratterizza come un habitat di grande valore patrimoniale per l eccezionale diversit in specie che ospita e per il complesso sistema di relazioni che si sviluppano tra di esse Questo insieme di comunit rappresenta inoltre l unica formazione biogenica di origine vegetale del Mediterraneo prodotta principalmente dall accumulo di Rodoficee calcaree incrostanti ed in secondo luogo da taxa animali Ballesteros 2006 Materiali e metodi Il sito di studio si trova a Punta Lazzaretto poche centinaia di metri a nord di Giglio Porto Isola del Giglio Toscana Durante l estate del 2014 sono state prelevate porzioni di biocostruzione in 3 repliche 10x10 cm di superficie e volume compreso tra i 170 ed i 350 cm alle profondit di 10 2
81. hl method Uterm hl 1958 Zingone er al 2010 Counting was performed along transects 1 4 or in random fields 30 60 in addition the half of the Uterm hl chamber was also examined at a magnification of 200x to obtain a more correct evaluation of less abundant microphytoplankton taxa Nanophytoplankton size 2 20 um were counted in 15 randomly selected fields with a magnifications of 630x 169 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Results Phytoplankton abundance widely ranged between 6 7 and 436 3x10 cells L Considerably higher abundances were detected in April 2014 177 9 111 3x10 cells L with respect to the other surveys when the mean value of 20 2 9 9x10 cells L was obtained From a qualitative point of view phytoflagellates mainly the nano sized fraction were the most copious component of the population 53 1 21 7 Diatoms and dinoflagellates represented 24 1 18 0 and 16 8 13 3 of the total abundance respectively Coccolithophorids mainly represented by Emiliania huxleyi Lohmann Hay amp Mohler 1967 were monitored at background levels Results evidenced the occurrence throughout the sampling period of the harmful dinoflagellates Akashiwo sanguinea Hirasaka Hansen amp Moestrup 2000 Alexandrium minutum Halim 1960 Alexandrium spp Halim 1960 Dinophysis sacculus Stein 1883 D caudata Saville Kent 1881 and Gonyaulax spp Diesing 1866
82. il Canale d Otranto Inoltre questa nuova segnalazione insieme alle altre gi riportate in letteratura o da osservazioni personali pu aiutare a comprendere le 96 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 dinamiche temporali e spaziali di distribuzione della specie Fig 1 in previsione di altri alieni che potrebbero seguire lo stesso modello Crocetta e Colamonaco 2010 Katsanevakis et al 2011 2014 presente lavoro 2010 Katsanevakis et al 2011 2012 osservazioni personali 2007 Crocetta e Colamonico 2008 j 2007 Licchelli et al 2011 2003 Faccia e Bianchi 2007 Fig 1 Diffusione recente di Percon gibbesi nel bacino Adriatico Ionico Percon gibbesi recent spreading in the Adriatic Ionic basin Bibliografia CROCETTA F COLAMONACO G 2010 Percnon gibbesi Crustacea Decapoda and Aplysia dactylomela Mollusca Gastropoda in the Taranto Gulf Italy Ionian Sea new populations incoming Mar Biodiv Rec 3 e88 doi 10 1017 S1755267209990765 FACCIA I BIANCHI C N 2007 Prima segnalazione del granchio Percnon gibbesi Milne H Edwards 1853 nella Calabria Ionica Thalassia Salentina 30 39 43 FROGLIA C MARCHINI A 2014 Considerazioni sulla diffusione di crostacei decapodi alieni nei mari italiani Biol Mar Mediterr 21 1 34 36 GALIL B FROGLIA C
83. il porifero Sarcotragus fasciculatus stato segnalato nel settore 2 Inoltre l alga Caulerpa taxifolia var distichophylla settori 4 e 5 l ascidia Pseudodistoma crucigaster settori 2 e 3 e Oscarella microlobata settore 2 risultano nuove segnalazioni per 1 mari italiani Conclusioni Alla luce dei positivi risultati ottenuti nel primo anno sono in fase di realizzazione I un database online accessibile mediante servizi web II una applicazione mobile per 10S e un portale internet per rendere fruibile in maniera semplice ed accattivante le informazioni acquisite tramite Pinneggiando allo scopo di far conoscere ad un pubblico sempre pi vasto l ambiente marino mediterraneo Pinneggiando un progetto scientifico ideato per il censimento e la catalogazione delle specie marine ma che al tempo stesso pu rappresentare un importante strumento per la condivisione e divulgazione delle conoscenze sulla biodiversit marina anche in ambiti non prettamente accademici Bibliografia BIANCHI C N 2004 Proposta di suddivisione dei mari italiani in settori biogeografici Notiziario SIBM 46 57 59 RELINI G ED 2008 Checklist della flora e della fauna dei mari italiani Parte I Biol Mar Mediterr 15 Suppl 1 1 385 RELINI G ED 2010 Checklist della flora e della fauna dei mari italiani Parte II Biol Mar Mediterr 17 Suppl 1 387 828 Il miglioramento dell App Pinneggiando stato reso possibile grazie
84. il succitato procedimento stato poi assegnato un colore ed uno score Le informazioni cos ottenute sono state inserite nel prototipo GIS dell AMP realizzato 34 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 caricando in un file di progetto del software Quantum GIS versione 2 0 1 Dufour la cartografia tematica dell area marina Macri et al 2014 Risultati Sulla base dei dati disponibili sono stati individuati 4 intervalli di densita della microalga corrispondenti alle 4 principali fasi delle sue fioriture A ciascuna di esse stato attribuito uno score compreso tra 1 assenza di fioritura nel caso di densit cellulari comprese tra 1 e 100 cellule ml e 4 fioritura massiccia con densita cellulari superiori alle 4000 cellule ml In assenza di cellule della microalga sul substrato stato invece assegnato uno score pari a 0 Tab 1 Tab 1 Gli intervalli in cui stata suddivisa la densit media di C taylorii sul substrato con le rispettive fasi della fioritura ed i colori e gli score ad essi associati The intervals which the average density of C taylorii on the substratum was divided in with the respective phases of its bloom and the associated colors and scores Densit media Fase di fioritura Mucillagine Colore Score 0 verde 0 1 100 cellule ml Nessuna fioritura Nessuna produzione azzurro 1 100 1000 cellule F
85. in case of morphological identification of species leading to confusion Landi et al 2014 we used DNA barcoding to correctly delimiting the studied species thus providing a tool to avoid future misidentification of Sabellaria species in the Mediterranean area Materials and methods Twenty four core samples of Sabellaria reefs were collected in June 2013 at 3 Sicilian locations Donnalucata Eraclea Minoa Triscina at 1 5 3 m depth The specimens of Sabellaria were counted and identified to species level A 610 base pairs bp fragment of the COI gene and a 308 bp of the nuclear 28S rDNA region were sequenced for S alveolata S spinulosa and S cf alcocki The sequences were deposited in GenBank and compared with a public COI sequence of S spinulosa A N KF808174 collected in the eastern Atlantic Measuring of COI genetic distances was 94 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 based on K2P model A Neighbor Joining tree was built its nodes are supported by a high proportion gt 90 of replicates in the bootstrap analysis Results As a whole 17361 Sabellaria specimens were collected S alveolata was dominant at each station followed by S spinulosa Donnalucata 3724 vs 42 Triscina 10167 vs 65 Eraclea Minoa 3350 vs 13 individuals respectively Though rare specimens per station were identified as S cf alcocki the COI sequences of S spinulosa and S cf alcock
86. investigated in the Northern Adriatic Sea in the Area of the Po river mouth The ultrafiltration technique was utilised to obtain different molecular weight classes of DOC by using membranes with pore size of 10 and I kDa The most abundant molecular weight class was represented by the Low Molecular Weight LMW fraction lt 1 kDa 51 followed by the High Molecular Weight HMW 10 1 kDa 23 and Very High Molecular Weight VHMW 0 7 um 10 kDa 26 fractions Based on respiration rates during 72h incubation the HMW fractions showed the highest turnover time two weeks followed by VHMW and LMW fractions 1 week Overall the nutrient addition speeded up the mineralization rates lowering the turnover time of about 30 These preliminary results show that i the DOC pool was composed by organic substances which contribute differently to the C circulation and ii the C removal rates can be speeded up under balanced nutrient conditions Key words coastal water dissolved organic matter DOM microbial degradation C cycling Introduzione Nei sistemi marini la sostanza organica disciolta DOM rappresenta una delle pi grandi riserve di carbonio organico ridotto sulla terra Carlson e Hansell 2015 La composizione della DOM in acque marine costiere significativamente arricchita da materiali organici e nutrienti di origine terrigena introdotti dagli apporti fluviali Diversi fattori fisico chimici entrano in gioco nel determinare il desti
87. known to date FAO Fisheries Synopsis 125 1 81 OLIVER G 2014 Variabilit et malformations de l caillure de la Caouanne Caretta caretta L 1758 Reptilia Cheloniidae sur les c tes fran aises de M diterran e Bull Soc Herp Fr 150 9 23 TURKOZAN O ILGAZ C SAK S 2001 Carapacial scute variation in loggerhead turtle Caretta caretta Zoology in the Middle East 24 137 142 193 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 M CAVALLARO G MONTALBANO M C GUERRERA M MADRIGRANO G AMMENDOLIA Dipartimento di Scienze Veterinarie Universita di Messina Polo Universitario dell Annunziata 98168 Messina Italia mcavallaro unime it Coop Sicilianella Via Consolare Pompea 3 98168 Messina Italia DATI PRELIMINARI SULLA STRUTTURA DEI FOTOFORI DELL OCCHIO LUCENTE MINORE DIAPHUS HOLTI TANING 1918 FAMIGLIA MYCTOPHIDAE PRELIMINARY DATA ON THE STRUCTURE OF THE SMALL LANTERN FISH PHOTOPHORES DIAPHUS HOLTI TANING 1918 FAMILY MYCTOPHIDAE Abstract A contribution to the knowledge of the photophore structure of the mesopelagic fish Diaphus holti Myctophidae from the central Mediterranean Sea Strait of Messina is given by means of a structural study to describe the component structures of these luminescent organs Key words photophores structure small lantern fish Introduzione I fotofori sono organi luminosi di probabile deriva
88. larval distribution for the decapod red shrimps Methodologically this study clearly shows the benefits of a 3D lagrangian approach also suggesting that the vertical component should not be neglected for future modeling attempts References CARBONELL A DOS SANTOS A ALEMANY F VELEZ BELCHI P 2010 Larvae of the red shrimp Aristeus antennatus Decapoda Dendrobranchiata Aristeidae in the Balearic Sea new occurrences fifty years later Mar Biodiv Rec 3 doi 10 1017 S1755267210000758 FERNANDEZ M V MALTAGLIATI F PANNACCIULLI F G ROLDAN MI 2011 Analysis of genetic variabilita in Aristaeomorpha foliacea Crustacea Aristeidae using DNA ISSR Inter Simple Sequences Repeats markers C R Biologies 334 705 712 LETT C VERLEY P MULLON C PARADA C BROCHIER T PEVEND P BLANKE B 2008 A Lagrangian tool for modelling ichthyoplankton dynamics Env Model Softw 23 1210 1214 OLITA A IERMANO I FAZIOLI L RIBOTTI A TEDESCO C PESSINI F SORGENTE R 2015 Impact of currents on surface fluxes computation and their feedback on coastal dynamics Ocean Sci Discuss 12 1 30 ORSI RELINI L MANNINI A RELINI G 2012 Updating knowledge on growth population dynamics and ecology of the blue and red shrimp Aristeus antennatus Risso 1816 on the basis of the study of its instars Mar Ecol 34 1 90 102 PALMAS F ADDIS P CABIDDU S CUCCU D FOLLESA M C MURA M OLITA A PESCI P SABAT
89. lungo termine vanno innanzitutto evidenziati i benefici ottenibili da azioni di ripopolamento e gestione della risorsa P lividus in termini di qualit ambientale dato l importante ruolo ecologico rivestito da questa specie Bulleri et al 1999 Pais et al 2007 sarebbe inoltre possibile favorire la ripresa di quella economia locale basata sulla pesca artigianale e la commercializzazione diretta degli esemplari oggi in grave sofferenza a causa non solo della riduzione del quantitativo pescato ma soprattutto del suo deprezzamento conseguente alla notevole riduzione di taglia una proposta di gestione integrata e sostenibile quindi come previsto dalla Marine Strategy Framework Directive Bibliografia BULLERI F BENEDETTI CECCHI L CINELLI F 1999 Grazing by the sea urchins A lixula L and P lividus Lam in the North western Mediterranean J Exp Mar Biol Ecol 241 81 95 FABBROCINI A D ADAMO R 2010 Gamete maturation and gonad growth in fed and starved sea urchin Paracentrotus lividus Lamarck 1816 J Shell Res 29 4 1051 1059 FABBROCINI A D ADAMO R 2011 Gamete and embryos of sea urchins P lividus Lmk 1816 reared in confined conditions their use in toxicity bioassays Chem Ecol 27 2 105 115 GROSJEAN P SPIRLET C GOSSELIN P VAITILINGON D JANGOUX M 1998 Land based closed cycle echiniculture of Paracentrotus lividus Lamarck Echinoidea Echinodermata a long term experiment at a pilo
90. management small scale fisheries Mediterranean Sea Introduction Small Scale Driftnets SSD hereinafter of limited length lt 2 km and mesh size lt 100 mm have been historically used in Mediterranean without major environmental concerns Problems started in the 70s 80s the introduction of driftnets with larger meshes and much greater length targeting swordfish and tuna created environmental concern due to the incidence of unwanted catches The current regulation prohibits driftnets longer than 2 5 km and used to catch large pelagics and sharks EC 1992 2007 In May 2014 the EC announced the intention of a moratorium on driftnets fishing In this context a specific study was realised to characterize the SSD in Mediterranean Sartor 2014 This note reports the first results for Italy Materials and methods From March to October 2013 in 23 harbours information on fishing capacity and activity gear characteristics catch composition was collected by means of 96 interviews 254 logbooks and 55 embarks on professional vessels Results According to the EU Fleet Register in 2013 a total of 467 vessels could potentially use SSD in Italy but only 99 effectively used these gears in the period investigated they were distributed in eight fisheries especially in southern Italy Tab 1 These fisheries are strictly seasonal except the menaide of eastern Sicily active all year round The majority of the vessels were lt 12 m length
91. massima abbondanza nell acqua in primavera e nei sedimenti in estate Nella stazione P si evidenziata una maggiore abbondanza di specie potenzialmente patogene in entrambe le matrici analizzate Tra queste V alginolyticus stata quella pi abbondante nei sedimenti V parahaemolyticus nell acqua per entrambe le matrici la massima abbondanza si riscontrata in primavera Conclusioni I risultati ottenuti hanno evidenziato la presenza di specie batteriche potenzialmente patogene sia per l uomo che per gli animali Nell ambito della ricerca volta a limitare l impatto degli impianti di allevamento sull ambiente diventa perci necessario ed auspicabile programmare monitoraggi microbiologici routinari Ci importante per meglio definire le strategie di sopravvivenza la distribuzione delle specie potenzialmente patogene e la loro abbondanza parametri determinanti nella trasmissione di infezioni e prevedere l introduzione di nuovi parametri di valutazione relativi alla qualit dell ambiente e alla tutela della salute umana Bibliografia ALSINA M BLANCH A R 1994 A set of keys for biochemical identification of environmental Vibrio species J Appl Bacteriol 76 79 85 AMERICAN PUBLIC HEALTH ASSOCIATION 1992 Standard Methods for the Examination of Water and Wastewater 18 ed Washington D C BAUMAN P SCHUBERT R H W 1984 Vibrionaceae In Krieg N R Holt J G eds Bergey s Manual of Systematic B
92. may be needed for macrozoobenthic and fish communities to change as a result of seagrass restoration Bell et al 2008 The results presented here provide a first assessment of ecological status at newly restored seagrass sites The future application of these indices may allow to detect the faunal response to the ongoing habitat recovery process as well as to assess the overall effectiveness of the Life restoration project References BELL S S TEWFIK A HALL M O FONSECA M S 2008 Evaluation of seagrass planting and monitoring techniques Implications for assessing restoration success and habitat equivalency Restor Ecol 16 407 416 FACCA C BONOMETTO A BOSCOLO R BUOSI A CENTANNI E PARRAVICINI M PONIS E RAMPAZZO F SFRISO A in press Interventi di ricolonizzazione di angiosperme acquatiche risultati del primo anno di trapianti nell ambito del progetto Life SeResto LIFE12 NAT IT 000331 Biol Mar Mediterr 22 1 FRANCO A FRANZOI P MALAVASI S RICCATO F TORRICELLI P MAINARDI D 2006 Use of shallow water habitats by fish assemblages in a Mediterranean coastal lagoon Estuar Coast Shelf Sci 66 67 83 ISPRA 2008 Protocolli per il campionamento e la determinazione degli elementi di qualita biologica e fisico chimica nell ambito dei programmi di monitoraggio ex 2000 60 CE delle acque di transizione Documenti tecnici ISPRA Roma 37 pp MUXIKA I BORJA A BALD J 2007 Using historical d
93. method of resolution of a distribution into Gaussian components Biometrics 23 115 135 CRESSIE N 1993 Statistics for Spatial Data Rev ed Wiley New York HASTIE T J TIBSHIRANI R J 1990 Generalized Additive Models Chapman amp Hall CRC 335 PP MARTINO S RUE H 2008 Implementing approximate Bayesian inference for latent Gaussian models using integrated nested Laplace approximations a manual for the INLA program Technical Report 2 Dept Math Sci Norwegian University of Science and Technology Trondheim SOLOW A R 1994 Detecting changes in the composition of a multispecies community Biometrics 50 556 565 159 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 E SPERONE V CIRCOSTA A LEONE G GIGLIO S TRIPEPI P MICARELL Department of Biology Ecology and Earth Sciences University of Calabria Via P Bucci 87036 Arcavacata di Rende CS Italy Centro Studi Squali Aquarium Mondo Marino Loc Valpiana Massa Marittima GR Italy centrostudisquali aquariummondomarino com Lab GenoDREAM BiGeA University of Bologna Bologna Italy PRELIMINARY OBSERVATIONS ON GREAT WHITE SHARK CARCHARODON CARCHARIAS SURFACE PREDATORY ACTIVITY OSSERVAZIONI PRELIMINARI SULLE ATTIVITA DI PREDAZIONE DI SUPERFICIE DI SQUALO BIANCO CARCHARODON CARCHARIAS Abstract The aim of the present study was to gather information on the behaviour of g
94. methods A total of 84 skin samples of S coeruleoalba were collected during a systematic one day dolphin watching cruises across an investigated area of about 125 square miles in the Gulf of Taranto Northern Ionian Sea Central Mediterranean Sea The data were undertaken aboard TARAS a 39 ft catamaran full equipped for cetaceans research Prot CITES n 2591 It was used an efficient and non invasive method to collect sloughed skin by means of the scrub pad Farro et al 2008 In laboratory the skin adhered in the scrub pad was removed and DNAs were extracted using the Chelex resin Then DNA was purified by a standard phenol chloroform method and quantified by spectrophotometer Nano Drop 1000 DNA amplifications were performed using primer pairs for cytochrome B and nuclear DNA through microsatellite and sex markers All primers and PCR conditions are listed in Tab 1 Results Genome sequences of S coeruleoalba and T truncatus show a very high percentage 99 of DNA similarity The availability in public databases of the 7 truncatus genome sequences allowed us to design PCR primers to use on S coeruleoalba genomic DNA protocols All PCR experiments were initially tested on 7 truncatus peripheral blood samples that were kindly supplied by the Acquatic Park 233 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Zoomarine Rome Hence we performed PCR experiments in the same condi
95. ml d Protein concentration ug ml c Fig 1 Anti RE a c and anti SE b d cytotoxic activity of coelomocytes a b and CLS c d of H tubulosa The assay were performed in ISO Ca C and ISO EDTA MI Data are expressed as mean value SD p lt 0 01 p lt 0 01 Attivit citotossica dei celomociti a b e del CLS c d di H tubulosa contro RE a eSE b Il saggio stato eseguito sia in ISO Ca e sia in ISO EDTA MA I dati sono espressi come media dei valori SD p lt 0 01 p lt 0 01 Conclusions The coelomocytes constitute the basics of echinoderm immunity playing different rules in the immunological defense mechanisms Coffaro and Hinegardner 1977 Smith and Davidson 1992 The data obtained in this work showed that coelomocytes are able to exert cytotoxic activity against different cellular targets as rabbit or sheep erythrocytes The cytotoxic activity present in this species occurs both in the presence and absence of calcium Moreover the coelomocytes lysate supernatant showed lytic activity against both target cells Further studies are necessary for better identification of cell types responsible for cytotoxic activity in this holothurian species References ARIZZA V GIARAMITA F T PARRINELLO D CAMMARATA M PARRINELLO N 2007 Cell cooperation in coelomocyte cytotoxic activity of Paracentrotus lividus coelomocytes Comp Biochem Physiol A 147 389 394 ARIZZA V VAZZANA M SCHILLACI D
96. n B rispetto agli individui del tempo 0 p 0 41 eJ tarved asi A B G 0 8 0 6 Gonad wet weight 9 Standardized feed weight 0 4 Total diameter mm Time of submersion h Fig 2 Peso delle gonadi g rispetto al diametro totale mm per ricci nutriti per 4 mesi con le diete A B e C e ricci del tempo 0 Gonad weight g relative to the total diameter mm per urchins feed A B and C for 4 months and time 0 specimens Fig 1 Peso secco standardizzato dei mangimi A B e C da 0 a 72h a 19 e 24 C Le curve rappresentate sono curve di loess Standardized dry weight of feed A B and C from 0 to 72h at 19 and 24 C Curves are loess curve fits Conclusioni I risultati mostrano un ottima performance delle diete artificiali a base di componenti non macroalgali caratterizzati da elevata stabilit fino ad ora testata solo alle temperature nord europee Questi mangimi si sono dimostrati stabili anche a temperature mediterranee aprendo nuove prospettive all allevamento di P lividus nelle nostre regioni Bibliografia AZAD A K PEARCE C M MCKINLEY S R 2011 Effects of diet and temperature on ingestion absorption gonad yield and gonad quality of the purple sea urchin Strongylocentrotus purpuratus Aquaculture 317 187 196 LAWRENCE J M OLAVE S OTAIZA R LAWRENCE A L BUSTOS E 1997 Enhancement of gonad production in the sea urchin Loxechinus albus in Chile f
97. of global change and increasing coastal erosion risk due to sea level rise and human threats these results support the hypothesis that vermetid reefs can act as a wave energy buffer and give a first insight about their engineering properties Such a bio protective potential of the vermetid reef should be considered in coastal management plans aiming to further integrate this neglected biogenic habitat into human systems and enhancing its protection as required by many international conventions and directives Habitats Directive 92 43 EEC Barcelona and Berna Conventions EU Biodiversity Strategy 2020 References BOIZARD S D DEWREEDE R E 2006 Inexpensive water motion measurement devices and techniques and their utility in macroalgal ecology a review ScienceAsia 32 Suppl 1 43 49 CHEMELLO R 2009 Marine bioconstruction in Mediterranean Sea A state of the art on the vermetid reef Biol Mar Mediterr 16 1 2 18 HASSAN R SCHOLES R ASH N 2005 Ecosystems and human well being current state and trends Vol 1 Island Press 948 pp MUUS B J 1968 A field method for measuring exposure by means of plaster balls A preliminary account SARSIA 2 European Symposium on Marine Biology 34 61 68 114 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 C MANZO A FABBROCINI R D gt ADAMO Istituto di Scienze Marine ISMAR Consiglio Nazionale delle Ricerch
98. of macroalgae in the Mar Piccolo during 2014 Materials and methods The multispectral data acquired in August 2014 were previously corrected for atmospheric noise then the obtained multispectral data were classified into four classes using a supervised ML Maximum Likelihood parametric algorithm Quantitative sampling was carried out monthly from May to December 2014 in four stations of the Mar Piccolo Fig 1 Each time three 50x50 cm quadrats were sampled at 0 5 m depth and preserved in 5 Formalin seawater For each quadrat the blotted fresh weight of H cornuta was measured on a triple beam balance The biomass was expressed as the mean fresh weight per m Siw m Results From the thematic map and in agreement with the in situ collected data the Hypnea cornuta distribution obtained from the remote sensing satellite techniques showed that the species is confined to the Second Inlet of the Mar Piccolo of Taranto Fig 1 Thalli were found only in two stations namely Battendieri and Cimino The highest biomass values 1234 12 gxw 51 07 were recorded at Battendieri in June The low values recorded at Cimino in the same period 13 25 g y 11 21 might be probably due to a delay in the growth 36 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Conclusions The highest biomass values were registered in the station of the first finding Battendieri These preliminary results e
99. of nutrients and phytoplankton are required in order to satisfy the nutritional needs of the farmed organisms and produce commercially attractive products These conditions are rarely met in the Ligurian Sea characterized by oligotrophic conditions To overcome this limit a novel approach which involves farming of filter feeders downstream finfish cages was adopted This research was part of the project FP7 IDREEM on integrated multitrophic aquaculture IMTA Materials and methods On 27 June 2013 2100 oysters Ostrea edulis Linnaeus 1758 and Crassostrea gigas Thunberg 1793 each accounting for half of the total number were deployed downstream a seabass and seabream farm whose production reaches 250 tons yr 2 nmi off the eastern Ligurian coast Oysters were placed in lantern nets and equally distributed at two depth treatments 7 and 14 m to test for a depth effect in intercepting the plume of particulate material and subsequent phytoplankton bloom escaping from the finfish cages During deployment on 28 November 2013 and 15 May 2014 shell length SL and whole wet weight of 100 individuals per treatment N 400 were measured and the number of dead individuals was counted On the first and second sampling times 10 individuals per treatment were also collected and dissected to get an estimate of the relative contribution of the edible parts to the total wet weight Data were analyzed via 1 way ANOVA testing for an effect of depth on s
100. of the results from the two projects Seagrass medows In the framework of MEDISEH a dataset of distribution of seagrasses across the Mediterranean was derived from the compilation of published and unpublished information from several areas Distribution maps were drawn based on the revised information of phanerogams i e Posidonia oceanica Cymodocea nodosa Zostera marina Zostera noltii Halophila stipulacea Ruppia maritima Results showed that the known P oceanica meadows cover 11 687 km in the Mediterranean basin but information on regression signs health status of meadows is very limited P oceanica modelling was carried out accounting for both presence and absence records using Random Forests models A fine scale assessment of the current and historical known distribution of P oceanica has been provided evaluations of the total area of meadows and the magnitude of regressive phenomena in the last decades Telesca et al submitted Bioconstructions A thorough review of existing spatial datasets showing the distribution of coralligenous and ma rl habitats across the Mediterranean Sea was undertaken highlighting current gaps in knowledge Predictive modelling was then carried out based on environmental predictors to produce the first continuous maps of these two habitats across the entire Mediterranean basin Martin et al 2014 Habitats of small pelagic species Historic survey data i e acoustic ichthyoplankton bottom trawl
101. offrono nella biocostruzione dell habitat e nell aumentarne la complessit Bibliografia AGNESI S ANNUNZIATELLIS A CASSESE M L DI NORA T LA MESA G MO G PERGENT MARTINI C TUNESI L 2009 Analysis of the Coralligenous assemblages in the Mediterranean Sea a review of the current state of knowledge in support of future investigations In Pergent Martini C Brichet M eds Proceedings of the 1 Symposium on the Coralligenous and other calcareous bio concretions of the Mediterranean Sea Tabarka 15 16 January 2009 RAC SPA Publ Tunis 41 46 BALLESTEROS E 2006 Mediterranean coralligenous assemblages a synthesis of present knowledge Oceanogr Mar Biol 44 123 195 BIANCHI C N 1981 Guide per il riconoscimento delle specie animali delle acque lagunari e costiere italiane AQ 1 96 5 Policheti Serpuloidei Consiglio Nazionale delle Ricerche 187 pp BIANCHI C N MORRI C 2001 The battle is not to the strong Serpulid reefs in the Lagoon of Orbetello Tuscany Italy Estuar Coast Shelf S 53 215 220 FAGERSTROM J A 1991 Reef building guilds and a checklist for determining guild membership A new approach for study of communities Coral Reefs 10 47 52 NECHAMA BEN ELIAHU M TEN HOVE H A 1992 Serpulids Anellida Polychaeta along the Mediterranean coast of Israel new population build ups of lessepsian migrants Israel J Zool 38 35 53 ROSSO A SANFILIPPO R 2009 Ruolo di Briozoi e
102. orate infettate sperimentalmente con Vibrio anguillarum iii CAVALLARO M GIARRATANA F MUSCOLINO D DANZ A NAVARRA E Prima esperienza di riproduzione in cattivit del tritone mediterraneo Charonia lampas lampas Gastropoda Caenogastropoda iii a ail FERRANTI M P DE LA FUENTE MANCEBO G PECORINO D ASNAGHI V CANNELLA L SICURELLI D CHIANTORE M Echinocoltura di Paracentrotus lividus effetto della dieta su crescita Somatica e gonadica iosail oeiee eh eT EE REEE SEE EEEE E eE MAURIZIO D CARBONARA S D ADAMO R NOVELLI A FABBROCINI A Gestione integrata di aree marino costiere produzione di giovanili di Paracentrotus lividus Lamarck 1816 per prove di ripopolamento sperimentale ie PAGLIARANI A CIMA F VENTRELLA V FABBRI M NESCI S SERRATORE P VOLPE E CIULLI S Valutazione dello stress ossidativo da impiego di un germicida commerciale per la depurazione di Venerupis Tapes philippinarum iii PECORINO D FANCIULLI L CHIANTORE M Oyster farming in the Ligurian Sea an integrated multitrophic aquaculture IMTA approaches enn AI vata see gece Ea S vee noes RAKAJ A BONCAGNI P FIANCHINI A GRAVINA M F Risultati preliminari sulla riproduzione artificiale di Holothuria tubulosa Holothurioidea Echinodermata SFRISO A A Macroalgae growth rates and biomass production in eutrophic areas of the Venice lagoon Vo
103. preys Despite the legislative framework still few data are available in the Mediterranean basin on marine macro litter and there is a lack of knowledge on sensitive areas where the potential damage to the biota is greater Based on methodologies in use by international programs for monitoring of marine debris a specific protocol was adopted by the FLT Mediterranean network Arcangeli et al 2013 allowing a complementary data collection on marine mega fauna and plastic debris H03 03 Habitats Directive threats code Preliminary results along the Civitavecchia Barcelona transect allowed to detect risky areas due to the overlap of high plastic density and squid eaters records Materials and methods An experienced observer is positioned on one side of the vessel and makes the observation by the naked eye using binoculars to confirm the sighting of debris bigger than 20 25 cm Data are recorded on a handheld GPS effort track and marked points and on data sheets At the beginning of the survey the width of the monitored strip is defined a priori up to a maximum of 100 m based on the type of platform of observation height sea state lt 2 on the Beaufort scale and visibility assuming that all litter larger than 20 25 cm is detected For each sighting composition source buoyancy dimensions are recorded Within the strip sea turtles and other macro fauna is also recorded Since 2013 the protocol was applied along 5 218 Volume pre print 4
104. prime fasi di allevamento di H tubulosa che potrebbero aprire nei prossimi anni la strada ad un nuovo approccio per la maricoltura in Mediterraneo ampliando le specie nuove candidate per l acquacoltura Materiali e metodi Esemplari adulti di H tubolosa sono stati campionati in localit Torre Astura Mar Tirreno centrale Lazio IT con una cadenza settimanale da fine luglio a met novembre periodo che corrisponde alla loro attivit riproduttiva Il prelievo stato effettuato ad una profondit di 2 4 m su substrato sabbioso Gli esemplari sono stati trasportati ai laboratori del LESA presso l Universit degli Studi di Roma Tor Vergata dove sono stati mantenuti in acquari di stabulazione Dopo alcuni giorni stata indotta l evacuazione delle gonadi mediante stimolazione chimica senza sacrificare l animale Le uova estratte dalle gonadi sono state poste in becker con acqua di mare filtrata e pastorizzata a cui si aggiunto sperma diluito Le larve sono state alimentate con fitoplancton Nannochloropsis sp Chlorella sp Tetraselmis suecica Rhodomonas baltica Rhinomonas reticulata messo in coltura parallelamente in laboratorio I vari stadi di sviluppo dalla fecondazione fino allo stadio di auricularia 51 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 sono stati documentati con immagini al microscopio ottico e microscopio a scansione elettronica SEM Risultati
105. print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 C CAROPPO F CERINO T CIBIC Consiglio Nazionale delle Ricerche CNR Istituto per 1 Ambiente Marino Costiero IAMC Via Roma 3 74123 Taranto Italy carmela caroppo iamc cnr it OGS Istituto Nazionale di Oceanografia e Geofisica Sperimentale Sezione Oceanografia Via A Piccard 54 34151 Trieste Italy PHYTOPLANKTON ASSEMBLAGES AND HARMFUL ALGAL BLOOMS IN A SEMI ENCLOSED COASTAL AREA ASSOCIAZIONI FITOPLANCTONICHE E FIORITURE ALGALI DANNOSE IN UN AREA COSTIERA SEMICHIUSA Abstract The aim of this work is to assess the phytoplankton dynamics and occurrence of the harmful algal species in one the most important farming sites in Italy the Mar Piccolo of Taranto Results evidenced the occurrence of potentially toxic dinoflagellates and diatoms Blooms due to the diatom Pseudo nitzschia cf galaxiae Lundholm amp Moestrup 2002 and nano sized cryptophyceans were detected in spring The new knowledge will be useful to develop and implement plans for monitoring and management of HABs to foster environmental protection public health and sustainable mussel culture Key words phytoplankton mussel culture HABs Pseudo nitzschia Mar Piccolo Introduction Coastal lagoons and semi enclosed seas have peculiar functional and structural characteristics due to their localization between land and sea The Mar Piccolo of Taranto Southern
106. profiles revealed the presence of hyperdense NAdDW 09 gt 29 5 kg m in the Pomo Pit gt 200 m At the SAP the layer gt 550 m was occupied by ADW whereas above a clear signal of LIW was detected Viral abundances at Pomo pit ranged between 1 94 0 18x10 L and 3 29 0 09x10 L The highest value was observed at the confinement depth between different water masses The BCP ranged between 3 01 0 06 and 8 25 0 18 ngC L The VBR variability 2 1 4 9 fell within the range of values for pelagic environment without displaying typical decreasing surface to bottom gradient in the deeper water layer 240 m the highest VBR was observed suggesting the presence of infection processes coupled with the maximum BGE of the station 25 7 For the rest of the water column BGE remained comprised within 3 4 and 12 1 Different dynamics characterized the deep pit SAP where generally the decreasing values of all microbial parameters were observed with depth In the SAP viral abundance resulted similar to those observed at the Pomo pit from 1 62 0 15x10 to 4 30 0 04x10 L whereas the BCP reached the maximum rate of 16 76 0 24 ngC L h at 50 m depth At that layer also the bacterial abundances and respiration rates reached the maximum values suggesting the copious presence of active bacterial community Along the entire profile of the SAP the VBR was higher 11 4 18 8 if compared to the Pomo pit Conclusions The microbial dynamics in two
107. prove in vitro sono state effettuate utilizzando colture di emociti a breve termine 60 min a 25 C Cima et al 2000 provenienti da emolinfa prelevata da animali acclimatati per 3 4 gg in laboratorio Sugli emociti sono state determinate la LCs del germicida contenente pentapotassio bis perossimonosolfato bis solfato 49 8 sodio esametafosfato 18 5 sodio dodecilbenzensolfonato 14 95 acido malico 10 acido sulfamico 5 NaCl 1 5 nonch lo stress ossidativo come produzione di ROS contenuto di tioli GSH perossidazione lipidica Sulle vongole trattate in vivo 3 ore di immersione in acqua contenente 1000 ppm del germicida sono state effettuate 4 prove sperimentali nel periodo luglio dicembre utilizzando diversi stock di animali uno per prova provenienti dalla Sacca di Goro Dopo il campionamento iniziale tempo 0 le vongole sono state suddivise in 4 vasche di cui 2 47 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 trattate T e 2 di controllo C Ultimate le tre ore di trattamento 50 vongole per vasca sono state congelate intere a 80 C fino al momento delle analisi biochimiche Sia la valutazione quantitativa dei composti reattivi all acido tiobarbiturico TBARs per via spettrofotometrica Banni et al 2009 sia quella delle sostanze organiche volatili VOC tramite analisi SPME GC Fratini et al 2012 sono state effettuate sui tessuti eduli in toto adegu
108. questo contributo presenta i primi risultati di un indagine sulle attuali condizioni trofiche ed ecologiche del bacino settentrionale effettuate nell ambito del progetto LIFE12 NAT IT 000331 SeResto Habitat 1150 Coastal lagoon recovery by SEagrassRESTOration A new strategic approach to meet HD amp WFD objectives Materiali e metodi In 17 stazioni della parte settentrionale della laguna nord sono stati analizzati i nutrienti nella colonna d acqua e nei 5 cm di sedimento superficiale Fig 1 In 8 stazioni l acqua stata campionata mensilmente da aprile a dicembre 2014 mentre i campioni di sedimento sono stati prelevati in primavera ed autunno Nelle restanti 9 stazioni stato fatto un unico prelievo d acqua e di sedimenti in primavera Le analisi dei nutrienti disciolti e nel sedimento sono state effettuate in accordo con le metodologie riportate in Sfriso et al 2005 Nelle medesime 17 stazioni stato eseguito il campionamento delle macrofite in accordo con i protocolli ISPRA 2011 mentre la determinazione dello stato ecologico avvenuta applicando il Macrophyte Quality index MaQI basato sullo studio delle associazioni di macrofite Sfriso et al 2014 Risultati Le concentrazioni di nutrienti nell acqua mediamente sono risultate piuttosto basse fosforo reattivo RP 0 22 0 10 uM azoto inorganico disciolto DIN 16 3 10 4 uM anche se con marcate variazioni tra le singole stazioni Le stazioni 1 e 5 poste in pross
109. recent work by Helm et al 2014 We however can confirm that P massiliensis dwells preferentially in the acidified zones of the Castello vent s system where the pH can show values below 7 0 units Calosi et al 2013 Ricevuto et al 2014 The unique distribution of this species opens challenging questions about the potential advantage provided by brooding as adaptation to ocean acidification Lucey et al 2014 The presence of P massiliensis in the Gulf of Naples recorded since Hauenschild study in 1951 is reappraised and this species should be included in the checklist of the Italian marine fauna In the light of these results the distribution of P dumerilii needs also to be reconsidered since the presence of its sibling species could be more common and widespread than expected References CALOSI P RASTRICK S P S LOMBARDI C DE GUZMAN H J DAVIDSON L JAHNKE M GIANGRANDE A HARDEGE J D SCHULZE A SPICER J I GAMBI M C 2013 Adaptation and acclimatization to ocean acidification in marine ectotherms an in situ transplant experiment with polychaetes at a shallow CO vent system Phil Trans R Soc B 368 doi 10 1098 rstb 2012 0444 CASTELLI A BIANCHI C N CANTONE G INAR M E GAMBI M C GIANGRANDE A IRACI SARERI D LANERA P LICCIANO M MUSCO L SANFILIPPO R SIMONINI R 2008 Annelida Polychaeta In Relini G ed Checklist della flora e della fauna dei mari italiani Parte I Biol Mar Medit
110. regions high density and biomass of snapper Pagrus auratus Sparidae in northern New Zealand marine reserves J Appl Ecol 40 214 227 128 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 N UNGARO A M PASTORELLI E BARBONE Agenzia Regionale per la Prevenzione e la Protezione dell Ambiente ARPA Puglia Corso Trieste 27 70126 Bari Italia n ungaro arpa puglia it UNA PRIMA VALUTAZIONE DEI RIFIUTI SPIAGGIATI LUNGO LE COSTE PUGLIESI A FIRST ASSESSMENT OF LITTER ON THE APULIAN COAST Abstract The presence and the distribution of marine litter along the coast of Puglia Region were evaluated for the first time on ten beaches of Adriatic and Ionian Sea Results suggested that the distribution of litter on the Apulian beaches is linked more to local and regional hydrological features of the sea than to human and environmental features of the coastal zone Key words Marine Strategy marine litter beaches Adriatic Sea Ionian Sea Introduzione L attenzione alla problematica dei rifiuti marini emersa alquanto recentemente supportata da numerosi studi che ne evidenziavano gli effetti negativi sull ambiente e le ricadute sul piano economico e sociale Galgani ef al 2013 Ad esempio la recente Direttiva europea sulla Marine Strategy MSFD 2008 56 EC include tra i descrittori da monitorare i rifiuti marini intesi come qualsiasi oggetto costruito o usato dall
111. small scale driftnet fisheries in the Italian scas snrira itato lider Maa sete ol ie Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 SBRANA M COLLOCA F LIGAS A MANNINI A MASTRANTONIO G SARTOR P SERENA F Abundance of blackmouth catshark Galeus melastomus in the FAO GFCM GSA 9 Ligurian and northern central Tyrrhenian Sea and identification of NUCSEry rounds asili lia a ia stele Al teen ia els 158 SPERONE E CIRCOSTA V LEONE A GIGLIO G TRIPEPI S MICARELLI P Preliminary observations on great white shark Carcharodon carcharias surface predatory activity eeeeeseeereeereeeneee 160 STAGIONI M MONTANINIS VALLISNERI M Diet of common pandora Pagellus erythrinus Sparidae in northern middle Adriatic VENTURA D BONIFAZI A ARDIZZONE G D Comportamento di pulizia intraspecifica in giovanili di due specie di Diplodus Teleostea Sparidae casualit 0 simbiosi eeeeceeneeceeeeeeeeeeeaeeeeaeeees 164 Poster del Comitato Plancton BATTUELLO M MUSSAT SARTOR R NURRA N ARDIZZONE G D DE BIASI A M PESSANI D I copepodi come bioindicatori ambientali risultati preliminari relativi alle acque interessate dal relitto della Costa Concordia ii 167 CAROPPO C CERINO F CIBIC T Phytoplankton assemblages and harmful algal blooms in a semi enclosed coastal area 169 CARUSO
112. species misidentification References CASTELLI A BIANCHI C N CANTONE G CINAR M E GAMBI M C GIANGRANDE A IRACI S LANERA P LICCIANO M MUSCO L SANFILIPPO R SIMONINI R 2008 Annelida Polychaeta Biol Mar Mediterr 15 323 373 KIRTLEY D W 1994 A review and taxonomic revision of the family Sabellariidae Johnston 1865 Annelida Polychaeta Sabecon Press Science Ser N 1 223 pp LANDI M DIMECH M ARCULEO M BIONDO G MARTINS R CARNEIRO M CARVALHO G R LO BRUTTO S COSTA F O 2014 DNA barcoding for species assignment the case of Mediterranean marine fishes PLoS One 9 9 doi 10 137 1 journal pone 0106135 LA PORTA B NICOLETTI L 2009 Sabellaria alveolata Linnaeus reefs in the central Tyrrhenian Sea Italy and associated polychaete fauna Zoosymposia 2 527 536 LEZZI M CARDONE F MIKAC B GIANGRANDE A 2015 Variation and ontogenetic changes of opercular paleae in a population of Sabellaria spinulosa Polychaeta Sabellaridae from the South Adriatic Sea with remarks on larval development Sci Mar 79 1 137 150 95 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 N UNGARO A M PASTORELLI ARPA Puglia Agenzia Regionale per la Prevenzione e la Protezione dell Ambiente Corso Trieste 27 70126 Bari Italia n ungaro arpa puglia it PERCNON GIBBESI H MILNE EDWARDS 1853 CRUSTACEA GRASPIDAE UNA ULTERIO
113. studied assemblages Key words Amphipoda biogenic reefs diversity distribution pattern Jassa ocia Sicily Strait Introduzione Sabellaria alveolata L 1767 Annelida Sabellariidae un polichete gregario che vive in tubi costruiti compattando sabbia Questo processo crea complesse biocostruzioni biogenic reefs che incrementano la complessita dei fondali sabbiosi nel meso infralitorale di zone temperate atlanto mediterranee La Porta e Nicoletti 2009 Le scogliere biogeniche a Sabellaria formando un habitat favorevole per numerose specie sono incluse nella Direttiva Habitat della UE Lo studio della fauna associata ai sabellarieti costituisce pertanto una priorit per la conservazione della diversit associata a questi habitat Tuttavia poco si conosce riguardo 1 sabellarieti del Mediterraneo soprattutto in comparazione ai corrispettivi atlantici La Porta e Nicoletti 2009 e letteratura citata I crostacei Amphipoda sono sicuramente uno dei gruppi dominanti associati a questo habitat anche se non ancora definito il ruolo e i benefici che questi organismi traggono dall associazione con i policheti biocostruttori Questo studio vuole fornire una prima caratterizzazione di diversit abbondanza e pattern di distribuzione dei popolamenti ad anfipodi delle biocostruzioni di S alveolata dello Stretto di Sicilia a differenti scale spaziali metri decine di metri decine di km Materiali e metodi Porzioni di sabellarieto
114. the two sexes and the analysis of the maturity cycle indicated that the reproduction period is in summer Key words Melicertus kerathurus reproduction South West Adriatic Sea Introduction The Caramote shrimp is distributed in the western part of the Atlantic Ocean from Great Britain to Angola and in the whole Mediterranean sea where it lives on soft bottoms of the continental shelf less than 60 m depth Froglia et al 2013 In the South West Adriatic Sea GSA 18 the Caramote shrimp is mainly caught by the demersal trawlers Few information on the reproductive cycle are actually available The present study aims at estimating the demographic structure of the catches and maturity cycle of M kerathurus in GSA 18 Materials and methods Samples of Caramote shrimp were obtained from commercial landings Data Collection Framework EU Reg 199 2008 The demographic structure by sex was obtained from the length frequency distributions LFDs of 2011 13 The maturity stage followed the colorimetric scale proposed by Rodriguez 1985 adapted in the MEDITS Protocols 1 immature virgins with translucent transparent gonads 2a virgins developing and 2b adults recovering with white cream gonads 2c maturing or almost matures with gonads light yellow yellow green colored 2d matures with olive green dark green gray brown gonads 2e resting adults with yellowish white gonads with possible green translucent or transparent residues The Lmso
115. their seasonal dynamics the abundance of planktonic phototrophs was investigated and associated with physical chemical features of the water column and primary production The lowest abundance of all planktonic photoautotrophs was detected in February 2014 In April 2014 the proliferation of the largest micro sized fraction was observed In June 2013 primary production PP rates were high up to 10 14 1 45 ug CI h in the first inlet and 20 0743 12 ug CI h in the centre of the second inlet This major photosynthetic rate was likely ascribable to the nanoplanktonic fraction that reached its maximum abundance over the study period In October the picophytoplankton peaked to 10 cells L with higher abundances detected in the inner inlet High densities of all photoautotrophic organisms caused phosphate depletion especially in June 2013 Our results indicate a clear seasonal succession of plankton phototrophs in the very productive system of the Mar Piccolo Key words primary production picophytoplankton nanophytoplankton microphytoplankton Mar Piccolo Introduction The Mar Piccolo is a shallow nearly enclosed sea that consists of two basins i e First and Second Inlet with maximum depths of 13 and 10 m and surface areas of 8 28 km and 12 43 km respectively The circulation is restricted as the water is exchanged with the Mar Grande only through two narrow channels Salinity is influenced by the input of freshwater deriving f
116. to assess population diversity and recent population dynamics Analisys of Molecular Variance AMOVA was conducted to test whether significant differences occurred among sampling sites sub basins i e Tyrrhenian Sea Sicilian channel and Ionian Sea Adriatic Sea and Oceans i e Mediterranean sea Atlantic and Indo Pacific oceans All analyses were performed using Arlequin 3 5 Excoffier e Lischer 2010 206 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Results The sequencing of ND1 fragments resulted in 750 bp long sequences A total of 14 haplotypes were recorded with 13 haplotypes exclusive to the Mediterranean Sea The single non exclusive haplotype described in the Mediterranean was shared with the Atlantic and Indo pacific samples and present in all localities investigated by our study Two haplotypes were shared among the majority of the investigated Mediterranean samples while the others were private haplotypes exclusive to each specific site Average haplotype and nucleotide diversities of Mediterranean populations were h 0 769 and 7 0 004 This picture high h low x along with the support of the significant negative value of Tajima s D D 2 15387 p lt 0 05 suggested a recent population expansion of the species after a population bottleneck AMOVA performed at the geographical scale of sites and sub basins showed no significant differences inside the Mediterrane
117. under the project LIFE12 NAT IT 000331 SeResto Key words sea grass restoration benthos fish coastal lagoons Introduction The LIFE project N LIFE12 NAT IT 000331 SeResto started in 2014 aiming at restoring seagrass meadows in the northern basin of Venice lagoon Facca et al in press Sfriso et al in press and enhancing the overall ecological status sensu WFD Dir 2000 60 EC of the area As a primary action of the project seagrass sods extracted from Venice lagoon fishing ponds by means of a 30 cm core were transplanted during spring 2014 in 17 stations with optimal environmental conditions for plants to engraft and spread The aim of this study was to assess the ecological status during the first year of restoration by applying the Macrophyte Quality Index MaQI Sfriso et al 2014 the Multivariate Azti Marine Biotic Index M AMBI Muxika et al 2007 and the Habitat Fish Bioindicator Index HFBI a habitat specific pressure sensitive multimetric index Zucchetta et al in preparation Materials and methods Macrophyte macrozoobenthos and fish were sampled in spring few weeks after the transplantations and in autumn 2014 following respectively Sfriso et al 2014 ISPRA 2008 and Franco et al 2006 Sampling was carried out in eight stations selected for their representativeness of the whole project area After index estimation a single MaQI and M AMBI score and two seasonal HFBI scores were avai
118. ventura uniromal it Dipartimento di Biologia Universita di Roma Tor Vergata Via della Ricerca Scientifica s n c 00133 Roma Italia COMPORTAMENTO DI PULIZIA INTRASPECIFICA IN GIOVANILI DI DUE SPECIE DI DIPLODUS TELEOSTEA SPARIDAE CASUALITA O SIMBIOSI INTRASPECIFIC CLEANING BEHAVIOUR IN JUVENILES OF TWO DIPLODUS SPECIES TELEOSTEA SPARIDAE HAZARD OR SYMBIOSIS Abstract Cleaning behaviour of the ectoparasitic Peniculus fistula Copepoda Pennellidae between juveniles of Diplodus sargus and D puntazzo was observed and reported for the first time in the Mediterranean Sea Key words Ectoparasitism symbiosis marine crustaceans fish inspections juveniles Introduzione Sebbene le interazioni simbiotiche interspecifiche di pulizia siano ben conosciute e comuni alle basse latitudini in alcune famiglie di teleostei quali ad esempio Gobiidae e Labridae Cheney e C t 2003 tale comportamento sociale risulta sporadicamente rilevato in Mediterraneo e in Atlantico nelle famiglie Sparidae Schofield et al 2006 Abecasis e Abecasis 2015 e Gobiesocidae Weitzmann e Mercader 2012 Al contrario comportamenti di pulizia intraspecifica risultano occasionali e riportati relativamente alla famiglia Sparidae solo in poche lagune mediterranee Rosecchi 1987 Mariani 2001 Questa nota costituisce la prima segnalazione di interazione intraspecifica di pulizia da copepodi ectoparassiti in giovanili di Diplodus puntazzo Wa
119. verso sud Orli et al 1992 In questo studio sono state analizzate serie storiche relative al popolamento zooplanctonico nell Alto e Medio Adriatico cercando di capire se la struttura del popolamento risponde a condizioni locali o a condizioni che a scala pi ampia siano influenzate dalla circolazione generale Materiali e metodi I dati analizzati provengono dal monitoraggio marino costiero coordinato dal Ministero dell Ambiente e rappresentano otto serie storiche acquisite dal 2001 al 2007 relative al popolamento mesozooplantonico costiero dell Emilia Romagna e delle Marche I campioni sono stati raccolti a 500 m dalla costa nei siti di Porto Garibaldi Lido di Adriano Cesenatico Cattolica Foce del fiume Foglia Foce del fiume Esino Conero e Foce del fiume Chienti Sette di questi siti risultano caratterizzati da perturbazioni locali causate da foci di fiumi aree portuali o altro I dati sono stati dapprima analizzati per trovare le inconsistenze tassonomiche all interno delle serie storiche e tra di esse In particolare stata utilizzata l Indicator Species Analysis per cercare i taxa distribuiti non omogeneamente nelle serie storiche La lista tassonomica stata quindi ristrutturata per omogenizzare l informazione tra le serie conservando la pi alta risoluzione possibile Infine stato usato il test di Mantel come misura di correlazione globale fra le serie storiche opportunamente interpolate al fine di regolariz
120. was correlated with depth 72 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Results The vermetid reefs are exclusively present in the most exposed part of the island with a total length of 123 92 m At RW site a continuous coverage along the walls for a length of 79 m with a width of 131437 cm and a vertical extension of 20 20 9 85 cm was detected The RF reef reached a length of 4 12 1 36 m a width of 41 32 32 01 cm and a vertical extension of 18 13 13 34 cm Complexity value increased from the non colonized Flysch rocks complexity value 1 16 0 11 to the colonized RW 1 36 0 23 and colonized RF 1 95 0 27 with significant differences between the three sites Fig 1 D petraeum was found in small aggregates with a diameter of 13 9 5 64 cm In the overall reef area the mean density value of D petraeum specimens was of 493 9 360 4 ind dm The ANOVA test did not reveal significant differences between the two sites covered by the reef while a positive correlation along the depth gradient results R 0 68 p lt 0 001 Fig 2 1800 5 2 453 8 343 y 358 1x 222 3 1600 R 0 6807 a F 1400 5 094 1200 RW 1000 si 3 800 RF 60 H i 400 t 0 05 1 15 2 25 im 0 UM LM IN Fig 1 Mean number SD of substrate Fig 2 Linear regression between Dendropoma complexity values F non colonized Flysch density and depth UM upper mesolittoral RW ree
121. which never attained high cellular concentrations In April the diatom Pseudo nitzschia cf galaxiae Lundholm amp Moestrup 2002 a potentially domoic acid producer was detected at all the sampled stations and reached the highest value of 1 4x10 cells L In the same period nano sized cryptophyceans bloomed and reached values up to 2 8x10 cells L representing the most abundant component of the community Conclusions The results of this study indicate that in Mar Piccolo phytoplankton assemblages are characterized by the dominance of nano sized species typical of the oligotrophic environments Blooms of crytophyceans and potential toxic diatoms Pseudo nitzschia cf galaxiae were detected in the spring period The latter species was detected for the first time in Mexican and Australian waters Lundholm amp Moestrup 2002 but it is widely distributed in Mediterranean coastal waters Cerino et al 2005 and references therein Previous knowledge on phytoplankton dynamics and diversity and more recent data will be useful to develop and implement plans for monitoring and management of HABs in this coastal site These plans would include the integration of observation forecast and communication into an action plan for rapid response to HABs Initiatives are urgently needed to improve the communication with authorities responsible for environmental protection economic development and public health for a sustainable mussel culture in Mar Picc
122. 0 e quella sulla sorveglianza marittima integrata mentre nella seconda tipologia ricade senz altro la Blue Growth o con una traduzione forse non altrettanto efficace la Crescita Blu La pianificazione dello spazio marittimo che pure parte della PMI si colloca per certi versi a met strada fra le due tipologie di azione di cui si detto perch dovr far leva sulle interazioni fra soggetti e settori di attivit che abitualmente non comunicano fra loro e contemporaneamente garantire il raggiungimento del miglior compromesso nell implementazione simultanea di politiche settoriali diverse fra loro e non coordinate in precedenza Nell ambito di un agenda della PMI tanto articolata quanto di lungo termine nel luglio 2014 stata emanata la Direttiva 2014 89 UE del Parlamento Europeo e del Consiglio che istituisce un quadro per la pianificazione dello spazio marittimo o MSP da qui in avanti per coerenza con l acronimo inglese universalmente adottato 3 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 La competizione per l uso dello spazio marittimo impone una gestione condivisa ed efficace delle risorse e delle opportunit di crescita che questo pu garantire sia per evitare l insorgere di conflitti fra settori diversi o fra Paesi diversi sia per stimolare le pi efficaci sinergie tra le diverse attivit che riguardano il mare interessante notare come la
123. 0 3 000 uova di 0 30 0 40 mm di diametro La femmina pi piccola ha deposto 223 capsule mentre la pi grande ne ha deposte 414 stata osservata una media dei nati di 1 500 300 veligers per ogni capsula Dopo la deposizione delle capsule uovo entrambe le femmine sono rimaste a protezione delle capsule ossigenandole con la propria proboscide ed interrompendo l alimentazione Gli embrioni hanno cominciato a muoversi all interno delle capsule dopo 10 giorni dalla deposizione Le capsule si sono schiuse tra 12 e 20 settimane dopo la deposizione ed ogni capsula conteneva veligers in diverse fasi di sviluppo I veligers appena nati misuravano 0 28 0 02 mm diametro massimo della protoconca Il numero di veliger prodotti da ogni femmina variava da circa 200 000 a pi di 800 000 La schiusa ha coinvolto il 95 del totale delle capsule Ad un mese dalla schiusa la sopravvivenza dei veligers stata stimata intorno al 40 L alta mortalit stata attribuita a problemi legati al trofismo e nonostante crescita e sviluppo siano stati osservati e monitorati per diverse settimane non si potuto osservare alcun segno di insediamento bentonico Conclusioni La riproduzione di C lampas lampas stata eseguita in cattivit con successo presso le strutture dell Acquario Comunale di Messina Sono state ottenute un gran numero di larve veliger ed il loro sviluppo stato seguito per lungo tempo Tuttavia nonostante le numerose prove di isolamento
124. 0 e 30 m il materiale stato fissato in una soluzione di formaldeide 4 ed in seguito smistato e determinato in laboratorio con l ausilio di un binoculare e di un microscopio ottico Per l identificazione delle specie stata utilizzata principalmente la guida di Bianchi 1981 Risultati Sono stati rinvenuti un totale di 762 individui di Serpulidae di cui 707 determinati a livello di specie il resto stato indicato come Serpulidae ind per assenza di caratteri utili al riconoscimento Sono state rinvenute un totale di 23 specie di cui 4 della sub famiglia Spirorbinae La ricchezza specifica aumenta seppur in modo modesto con la profondit presentando un valore medio di 12 specie per i campioni a 10 me 14 specie per i campioni a 20 e 30 m I valori di abbondanza non differiscono tra le stazioni con una media di 84 7 22 3 individui per campione Considerando che la superficie asportata di soli 100 cm si rilevano densit notevoli di questi organismi nelle concrezioni di coralligeno Tra le specie numericamente pi importanti 62 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Hydroides pseudouncinatus Zibrowius 1968 Pileolaria heteropoma Zibrowius 1968 Pileolaria militaris Clapar de 1870 Semivermilia crenata O G Costa 1861 Serpula concharum Langerhans 1880 Serpula vermicularis Linnaeus 1767 Spirobranchus polytrema Philippi 1844 Spirobranchus
125. 07 only a few studies have been made to clarify its molecular functioning O Grady et al 2012 Recently Merlin et al 2009 in the monarch butterfly Danaus plexippus the presence of a double biological clock was identified one localised in the brain and the other one in the antennae both involved in the chronometric mechanism of sun compass The aim of this work was to investigate the existence of an antennal clock regulating the solar orientation in Talitrus saltator Materials and methods The experiments were performed using adult individuals of Talitrus saltator divided into different groups intact animals operated without the second antennae and operated without both the first and second antennae The members of each group were kept under an L D 12 12 cycle in phase with the natural one or an L D cycle advanced by 6 hours The activity of each animals was supervised using a micro waves radar system After at least 10 days of activity registration the 210 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 individuals were tested in a confined environment preventing the vision of the landscape but allowing the view of natural sun and sky A second set of experiments was performed using the same procedure in order to evaluate the behaviour of operated individuals without the antennae both first and second of the right side of the body and keep under an L D cycle in phase with the na
126. 15 negli anni successivi durante i quali nella stessa stazione non sono mai state raggiunte concentrazioni al di sopra delle 3 3x10 cell l Tra le localit indagate La Marina stata quella che ha presentato nei diversi anni una minore variabilit nelle concentrazioni dei picchi stagionali con valori massimi annuali compresi tra 8 5x10 cell L 05 07 2012 e 9 7x10 cell L 24 07 2013 Variabile infine andamento delle densit massime del sito Acque dolci dove le concentrazioni sono variate nell ambito di 5 0x10 cell L 2011 e 2013 e 1 5x10 cell L 2012 e 2014 Nel complesso i superamenti del valore limite di 1 0x10 cell L indicativo della fase di emergenza secondo il D M 30 03 2010 si sono manifestati sempre a partire dal mese di luglio unica eccezione la stazione La Marina con 2 3x10 cell L il 23 06 2014 entro un intervallo di temperatura compreso tra 21 3 e 31 0 C Per ci che concerne i parametri da campo percentuale di saturazione dell ossigeno disciolto pH e salinit i range entro i quali sono avvenuti gli episodi di fioritura sono stati rispettivamente 93 0 240 0 8 06 8 49 e 34 0 39 0 ppt Nei diversi anni le concentrazioni di O cf ovata su matrice macroalgale sono aumentate significativamente solo a partire dalla fine di giugno ma il loro andamento stagionale risultato non sempre sovrapponibile a quello rilevato nella matrice acqua Conclusioni La stagione estiva 2009 stata q
127. 2000 60 EC and ecological status assessment intransitional areas The Venice lagoon as study case Ecol Indic 46 536 547 SFRISO A FACCA C CEOLDO S MARCOMINI A 2005 Recording the occurrence of trophic level changes in the lagoon of Venice over the 90s Environ Int 31 7 993 1001 Il progetto gode del contributo finanziario LIFE dell Unione Europea e si colloca nell ambito della rete Natura 2000 SIC IT3250031 Laguna di Venezia Settentrionale 126 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 D SPATAFORA C CATTANO I DOMINA M GRISTINA M MILAZZO G TURCO Istituto per l Ambiente Marino Costiero IAMC CNR U O di Mazara del Vallo Via Vaccara 61 91026 Mazara del Vallo TP Italia davidespata87 gmail com Dipartimento di Scienze della Terra e del Mare DiSTeM Universita di Palermo Palermo Italia IMPIEGO DEI BRUV BAITED REMOTE UNDERWATER VIDEO PER LA VALUTAZIONE DEL POPOLAMENTO ITTICO NELL AREA MARINA PROTETTA CAPO GALLO ISOLA DELLE FEMMINE PALERMO EVALUATION OF FISH ASSEMBLAGES IN CAPO GALLO ISOLA DELLE FEMMINE MARINE PROTECTED AREA USING BAITED REMOTE UNDERWATER VIDEO BRUV Abstract A Baited Remote Underwater Video BRUV system was used to assess fish assemblages on detritic bottoms 40 m inside and outside the Capo Gallo Isola delle Femmine MPA Our study investigated the suitability of Baited Remote Underwater
128. 2012 I prelievi finalizzati alla ricerca di Ostreopsis cf ovata sono stati programmati da giugno ad agosto nei primi tre anni e da giugno a settembre a partire dal 2013 La frequenza ordinaria di campionamento prevalentemente bisettimanale stata intensificata nei periodi di fioritura Contestualmente al prelievo dei campioni di macroalghe per la ricerca di O cf ovata sono stati rilevati i parametri fisico chimici da campo ed i dati meteo marini prescritti dal D M 30 03 2010 I campioni di macroalga sono stati trattati opportunamente per il distacco di O cf ovata epifita mentre le aliquote di acqua destinate alla determinazione quali quantitativa della microalga sono state fissate con Lugol acido Successivamente i conteggi su entrambe le matrici sono stati effettuati seguendo il metodo di Uterm hl 1958 Risultati La presenza di Ostreopsis cf ovata stata osservata in tutte le campagne di monitoraggio gi a partire dal mese di giugno Nel corso delle indagini effettuate sono avvenuti episodi di fioritura in tutti e tre i siti di prelievo I picchi massimi relativi sia alla concentrazione di O cf ovata in colonna sia alla temperatura dell acqua sono stati registrati nella stazione di Las Tronas il 03 07 2009 con rispettivamente 8 8x10 cell L e 31 0 C Questo episodio si discostato notevolmente da quanto osservato 181 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 20
129. 2013a Passive acoustic monitoring of Sciaena umbra on rocky habitats in the Venetian littoral zone Fish Res 145 76 81 PICCIULIN M CALCAGNO G SEBASTIANUTTO L BONACITO C CODARIN A COSTANTINI M FERRERO E A 2013b Diagnostic of nocturnal calls of Sciaena umbra L fam Sciaenidae in a nearshore Mediterranean marine reserve Bioacoustics 22 2 109 120 ROBINSON S P LEPPER P A HAZELWOOD R A 2014 Good practice guide for underwater noise measurement National Measurement Office marine Scotland the crown estate NPL Good Practice Guide 133 95 pp SEGVIC BUBIC T GRUBI I L KARAMAN N TICINA V MISLOV JELAVI K KATAVI I 2011 Damages on mussel farms potentially caused by fish predation Self service on the ropes Aquaculture 319 497 504 120 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 F RICCATO R FIORIN M PICONE N NESTO V MOSCHINO L DA ROS Laguna Project snc Castello 6411 30122 Venezia Italia Istituto di Scienze Marine ISMAR CNR Arsenale Tesa 104 Castello 2737 F 30122 Venezia Italia nicoletta nesto ve ismar cnr it PRIMI DATI SULLA PRESENZA DI RETI FANTASMA NELLE AREE DI TEGN A DEL GOLFO DI VENEZIA FIRST DATA ON GHOST NETS IN THE OUTCROP AREA OF THE GULF OF VENICE Abstract Acoustic and underwater surveys evidenced ALDFG Abandoned Lost or otherwise Discarded Fishing Gears and other types of marine l
130. 222 226 ALESSI C 70 ALESSI J 220 226 ALLEGRA A 132 AMALFITANO S 185 AMMENDOLIA G 194 ANDALORO F 117 132 ANTONACCI R 233 APPOLLONI L 26 72 74 ARCANGELI A 218 226 ARCULEO M 192 206 ARDIZZONE G D 62 164 167 ARIZZA V 214 ARNESANO M 134 ASNAGHI V 43 103 ATZORI F 154 226 AZZARO M 171 AZZOLIN M 218 226 B BACCI G 188 BADALAMENTI F 30 94 100 117 BADALUCCO C 84 BARBONE E 129 BAROLI M 82 BATTUELLO M 167 BAVA S 8 BAVESTRELLO G 8 56 76 BELLINGERI M 222 228 235 BELLUSCIO A 62 BENNI E 146 148 BERNARDI G 105 BERTO D 125 BERTOLINO M 56 90 196 BERTOLOTTO R 103 BESBES A 206 BETTI F 196 BIANCHINI MLL 136 BITETTO I 138 BO M 8 76 196 BOCCHI N 86 88 237 BONALDO M 202 BONCAGNI P 51 BONELLI P 222 BONIFAZI A 164 BONOMETTO A 111 123 125 BORAZIO M 86 BORFECCHIA F 36 BORGHINI M 173 BORSETTI F 146 BOSCOLO R 111 123 125 BREY T 68 BRUNDU G 82 BUIA M C 32 BUOSI A 111 125 C CACCAMO L 39 CADEDDU B 90 CALABRETTI C 58 CALVO S 12 CAMPANA L 218 226 CANESE S 8 76 CANNELLA L 43 CAPPELLO S 39 CAPRUZZI E 60 113 CARACAPPA S 192 CARBONARA P 134 138 156 CARBONARA S 45 CARLUCCIR 66 231 233 CARNEVALI O 202 CARONNIS 34 58 105 107 CAROPPO C 169 177 CARTA G 100 CARUSO G 171 173 CASABIANCA A 175 CASABIANCA S 175 CASALE A 92 109 CASALE V 92 109 CASCIARO L 134 138 CASINI S 204 CASOLI E 62 CASORIA P 74
131. 28 90123 Palermo Italia emanuelaclaudia lamarca unipa it BIO GEOMORPHOLOGICAL ROLE OF THE VERMETID REEF IN ATTENUATING WAVE ENERGY ON THE COAST IL RUOLO BIO GEOMORFOLOGICO DEL REEF A VERMETI NELL ATTENUAZIONE DELL IDRODINAMISMO IN AMBIENTE COSTIERO Abstract Although the role of the Mediterranean vermetid reef in modifying the biological and physical characteristics of rocky shores is recognised little is know about its geomorphological importance in modifying hydrodynamic energy and attenuating wave action on the coast In this study the potential role of the reef as a wave energy buffer is investigated and preliminary information about the engineering properties of this biogenic habitat are provided Key words reefs wave attenuation coastal erosion shore protection Introduction Many coastal habitats play a relevant role in attenuating wave energy and reducing coastal erosion processes Coral reefs mangroves seagrass beds and salt marshes are examples of shoreline erosion buffer habitats Hassan et al 2005 Although the role of the Mediterranean vermetid reef in modifying the biological and physical characteristics of rocky shores is recognised Chemello 2009 little is know about its importance as geomorphological element that can locally generate a decrease in wave motion and attenuating hydrodynamic energy This study aims to understand if and how the vermetid reef modifies water motion at site scale reducing wave ene
132. 2Seererrerrerneawmaowoagaageccnsc CLYMYORRARBWWMABMDMDAADAAASOOCCSO ecoeceoce cece ceoocosaaan ecoeoscooeooeooeoeoeeoceorsaan ecocooooocoecseoococeco ososebo o oe 0 DD 0 SISGSIZE2IIGGZIZER88 SISSIIS ZIISZZIIIZISE eawdqr awad awae r awdad aweae awdr awdtqr awatr auwdgr auwd Fig 2 Ricchezza specifica a e diversita b della fauna associata alle macroalghe U rigida e G vermiculophylla Richness a and diversity b of macrofauna associated to macroalgae U rigida and G vermiculophylla Conclusioni Il ruolo strutturante delle comunit macroalgali nelle acque costiere temperate principalmente attribuito alla complessit della loro struttura tridimensionale Nella Laguna di Marinetta U rigida supporta una comunit dominata principalmente da Anfipodi e da un bivalve invasivo Il confronto della comunit associata ad U rigida con quella associata all alga invasiva G vermiculophylla presente nella medesima laguna mostra una comunit maggiormente strutturata associata alla Rodophyta probabilmente a causa della maggior complessit ambientale fornita dai talli ramificati tridimensionalmente di G vermiculophylla Bibliografia MCINTYRE A D ELLIOTT J M ELLIS D V 1984 Introduction design of sampling programmes In Holme N A McIntyre A D eds Methods for the study of marine benthos Blackwell Scientific Publications Oxford 1 26 MUNARI C BOCCHI N MISTRI M in stampa Epifauna associata a G
133. 35 mt a diverse distanze dalla costa D1 lt 400 m D2 700 900 m D3 1300 1400 m D4 1500 1700 m D5 gt 2000 m I campionamenti sono stati condotti nel periodo maggio ottobre 2013 per tre giorni al mese durante la fase di luna nuova Una ANOVA a due vie stata usata per esplorare l effetto della Localit 4 liv CA AM IF BO e dei Siti 2 liv E O sulle catture per unit di sforzo CPUE n megalope per trappola L effetto della Distanza 5 liv D1 D5 sulle CPUE stato testato con un ANOVA a una via 100 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 L omogeneita della varianza stata verificata con il test C di Cochran su In CPUE 1 Eventuali differenze significative sono state testate con il test post hoc di Neuman Keuls Risultati In prevalenza le catture 539 individui si sono concentrate nel mese di settembre con una CPUE media di 7 5 10 2 L ANOVA ha evidenziato differenze significative fra le localit n 72 gdl 3 F 5 87 p lt 0 01 ma non fra i siti n 72 gdl 1 F 0 81 p gt 0 05 Le CPUE pi elevate 15 4 16 4 sono risultate in AM quelle pi basse 2 6 2 2 in CA Neuman Keuls AM gt CA BO IF L effetto della distanza sulle CPUE n 72 gdl 4 F 4 93 p lt 0 01 ha evidenziato valori pi elevati nei siti pi distanti dalla costa Neuman Keuls D4 D3 D5 gt D2 D1 Conclusioni In questo studio vengono riportati per la prima volta dati sulla
134. 4 FRANZESE P P BROWN M T ULGIATI S 2014 Environmental accounting emergy systems ecology and ecological modelling Ecol Model 271 1 3 FRANZESE P P CAVALETT O H YH T D ANGELO S 2013 Integrated Environmental Assessment of Agricultural and Farming Production Systems in the Toledo River Basin Brazil The United Nations Educational Scientific and Cultural Organization UNESCO 71 pp FRANZESE P P RICCIO A SCOPA A 2003a Valutazione della sostenibilit ambientale verso un approccio ecodinamico Biologi Italiani 7 58 60 FRANZESE P P RUSSO G F ULGIATI S 2008 Modeling the interplay of environment economy and resources in marine protected areas A case study in Southern Italy Ecological Questions 10 91 97 FRANZESE P P RYDBERG T RUSSO G F ULGIATI S 2009b Sustainable biomass production a comparison between Gross Energy Requirement and Emergy Synthesis methods Ecological Indicators 9 959 970 FRANZESE P P SCOPA A RICCIO A BARONE G 2003b Studio di sistemi complessi la prospettiva ecodinamica in chimica fisica ambientale Biologi Italiani 11 39 45 HAYHA T FRANZESE P P 2014 Ecosystem services assessment A review under an ecological economic and systems perspective Ecol Model 289 124 132 Millennium Ecosystem Assessment MEA 2005 Ecosystems and Human Well being Synthesis Island Press Washington DC 137 pp ODUM H T 1988 Self organization transfor
135. 4 182 MARSILI L CARUSO A FOSSI M C ZANARDELLI M POLITI E FOCARDI S 2001 Polycyclic aromatic hydrocarbons PaHs in subcutaneous biopsies of Mediterranean cetaceans Chemosphere 44 147 154 MARSILI L D AGOSTINO A BUCALOSSI D MALATESTA T FOSSI M C 2004 Theoretical models to evaluate hazard due to organochlorine compounds OCs in Mediterranean striped dolphin Stenella coeruleoalba Chemosphere 56 791 801 MEKENYAN O G ANKLEY G T VEITH G D CALL D J 1994 QSARS for photoinduced toxicity I Acute lethality of polycyclic aromatic hydrocarbons to Daphnia magna Chemosphere 28 567 582 MOLDAN A JACKSON L F 2005 Oil Spill contingency planning in South Africa International Oil Spill Conference Miami Beach Florida USA SCHLENK D SAPOZHNIKOVA Y CLIFF G 2005 Incidence of organochlorine pesticides in muscle and liver tissues of South African great white sharks Carcharodon carcharias Mar Pollut Bull 50 208 211 SERRANO R FERNANDEZ M RABANAL R HERNANDEZ M GONZALES M J 2000 Congener specific determination of polychlorinated biphenyls I shark and grouper livers from the Northwest African Atlantic Ocean Arch Environ Contam Toxicol 38 217 224 WELLS M LLEWLLYN L 2006 DDT contamination in South Africa The International POPs Elimination Project IPEP Fostering Active and Effective Civil Society Participation in Preparation for Implementation of the Stockholm Conventi
136. 50 cm di lato disponendoli alternativamente a destra e a sinistra di essa Le immagini rilevate sono 40 per transetto Porzioni delle diverse specie di spugne presenti nei quadrati sono stati raccolti per permetterne l identificazione Le fotografie sono state analizzate al computer calcolando il ricoprimento percentuale Risultati La temperatura dell acqua in uscita dai sedimenti di circa 90 C che scende a circa 40 C a 1 m sulla verticale della sorgente Lo studio quantitativo del 56 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 ricoprimento della spongofauna associata alle due sorgenti idrotermali prese in esame ha permesso di osservare come la densita dei poriferi decresca drasticamente man mano che ci si allontani dalle sorgenti raggiungendo valori di ricoprimento superiori al 65 nella zona immediatamente circostante la fuoriuscita di acqua calda Le specie di poriferi che vivono nella zona di fuoriuscita dell acqua calda sono tre demosponge appartenenti ai generi Tedania Tedania Haliclona Reniera e Ircinia Conclusioni Generalmente le faune associate alle sorgenti idrotermali hanno pochi elementi in comune con le comunita circostanti anche a livelli sovraspecifici Hessler et al 1988 Al contrario le nostre osservazioni mostrano che le specie di spugne che vivono in prossimit delle sorgenti si possono ritrovare anche nelle scogliere circostanti Una situazio
137. 6 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 transects of the FLT Med Mon Network running between Italy France Spain Tunisia and Greece Fig 1 Results The Civitavecchia Barcelona transect was repeatedly surveyed from Sept 2013 to Sept 2014 along 22932 km on effort for cetacean monitoring 57 runs and 3556 km for macro litter monitoring 40 runs Fig 1 We recorded 34 sightings of squid eaters 10 Z cavirostris Zc 21 P macrocephalus Pm 3 G griseus Gg and 774 items of litter 70 of plastic The proportion of plastic items was higher in Autumn and Summer gt 72 lower in the others lt 68 plastic density was also significantly different throughout the year Kruskal Wallis p lt 0 05 rising from 0 58 0 2 items km Autumn to 2 53 0 5 items km Summer Kernel analysis revealed variation in distribution of plastic debris highlighting areas of higher density in central Tyrrhenian Sea Strait of Bonifacio and Spanish continental shelf Fig 1 Overlap of seasonal distribution of plastic and squid eating species exposed some sensitive areas central Tyrrhenian Sea for Zc Spring Summer Sardinian Sea for Pm Summer and Zc Autumn along the Spanish shelf for Gg Spring Summer and Pm Winter Summer 2 00 E 3 0 0 E 4 0 0 E 5 0 0 E 6 0 0 E 7 0 0 E 8 0 0 E 9 0 0 E 10 0 0 E 11 0 0 E 12 0 0 E 3 Kernel density of plastic I Low density Medium density m G griseus
138. 652 taxa Inoltre sono presenti altre due sezioni di interazione i Giochi e Chiedi all esperto L intera App realizzata in due lingue italiano e inglese Risultati L App Pinneggiando stata ideata cercando di unire tecnologia e biologia marina utilizzando una solida base scientifica di partenza e le moderne tecnologie per rendere pi semplice la visualizzazione di un mondo non accessibile a tutti Pinneggiando scaricabile dal Play Store da ormai un anno e abbiamo raggiunto pi di 1200 downloads con un feedback positivo di 4 65 5 Grazie all App Pinneggiando e quindi alle segnalazioni di molti subacquei e biologi la conoscenza sulla distribuzione di molti organismi stata ampliata in termini di distribuzione geografica Infatti alcune specie sono state segnalate in settori in cui non erano state ancora avvistate ad esempio tra le alghe rosse la specie Mesophyllum alternans stata segnalata anche nel settore 1 tra i pesci le specie Parablennius pilicornis e Sparisoma cretense sono state segnalate rispettivamente nel settore 1 e nel settore 2 tra gli asteroidei la specie Ophidiaster ophidianus stata segnalata anche nel settore 5 e la specie Hacelia attenuata nel settore 5 e 6 i molluschi nudibranchi Polycera quadrilineata e Flabellina lineata sono stati segnalati nel settore 9 il nemertino Notospermus geniculatus stato segnalato nel settore 9 il platelminta Discocelis tigrina stato segnalato nel settore 8 e
139. 66 PANSINI M 56 PANZALIS P 105 PAOLI C 220 PAPALE M 171 173 PARABOSCHI M 218 PARRAVICINI M 111 PARRINELLO N 214 PASQUALI V 210 PASSARELLI S 92 109 PASTORELLI A M 96 129 PATTI F P 32 PECCHIA J 144 PECORINO D 43 49 202 PEDA C 39 PEDRONCINI A 103 PELLEGRINO G 218 226 PENNA A 175 PERDICHIZZI A 39 PEREZ MAYOL S 148 PERINI F 175 PERSICHETTI M F 192 PESCI I 107 PESSANI D 167 PETROCELLI A 36 92 109 PICA D 196 PICCIULIN M 119 PICONE M 121 PIPITONE C 30 100 117 PIRAS M C 105 PONIS E 111 PORTACCI G 36 PORTUNATO N 222 PRANOVI F 119 140 PREVEDELLI D 200 PROFETA A 8 PRONZATO R 90 PUGLIESE L 175 R RABBITO D 208 RAGAZZOLA F 196 RAGONESE S 136 RAKAJ A 51 183 RAMPAZZO F 125 RAPPAZZO A C 171 173 REALE S 192 RELINI G 152 224 RENZI M 196 RICCATO F 121 RICCI P 66 231 RIZZO P 142 RIZZUTO S 204 ROGELJA M 177 ROMANO A 26 ROMANO C 144 ROSSI A 228 ROSSO M 226 RUBINO F 92 109 RUGGERI G 173 RUSSO D 214 RUSSO G F 15 26 72 74 RUSSU C 103 181 RUVOLO A 218 S SABATINI A 150 154 SACCO F 206 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 SALVIOLI F 226 228 SANDULLI R 26 72 74 SANGIORGI V C 103 SANTANGELO G 228 SANTINI C 56 SANTONI M C 222 SARTOR P 156 158 SBRANA M 158 SCAPIN L 123 SCARDI M 3 183 SCHIMMENTI E 94 SCHINTU M 212 SCINTO A 196 SCORDAMAGLIA E 22
140. 7 7 90 D dentex 0 33 1 13 0 07 0 23 1 70 2 37 P pagrus 0 21 0 60 0 06 1 60 1 87 Raja sp 0 28 0 90 0 73 1 95 S catharus 0 11 0 33 0 57 1 86 O melanura 0 07 0 43 0 47 1 20 Altre 3 74 0 42 4 62 TOTALE 15 37 10 42 45 40 19 76 18 51 15 98 Conclusioni Le informazioni raccolte consentono di conoscere la capacita di prelievo della pesca artigianale presso I AMP di Capo Carbonara Il tramaglio risultato l attrezzo maggiormente utilizzato mentre le maggiori catture giornaliere sono state registrate per le nasse Queste prime informazioni suggeriscono l esigenza di operare un monitoraggio continuo e autonomo in collaborazione con i pescatori che consenta una raccolta attendibile di dati informazione base per consentire una gestione sostenibile Da notare che una parte degli operatori del settore ha acquisito piena coscienza della possibilit di orientare lo sviluppo verso nuovi modelli produttivi di integrazione del reddito data dal pescaturismo Mamone et al 1998 Tali risultati rappresentano la base conoscitiva per la definizione di un nuovo piano di gestione della pesca professionale all interno dell AMP Capo Carbonara Bibliografia ARDIZZONE G D BELLUSCIO A GRAVINA F SCHINTU P MARTINI N SOMASCHINI A 1998 Caratteristiche ambientali e risorse di pesca della secca di Tor Paterno Mar Tirreno centrale Biol Mar Mediterr 5 3 736 744 CONSORZIO UNIMAR 2001 Elabor
141. 7 ng g p s per i DDT e tra 379 76 e 11284 31 ng g p s per i PCB In pi i valori dei rapporti pp DDE pp DDT e pp DDE DDT suggeriscono una recente introduzione di DDT nell ambiente probabilmente correlata con l utilizzo di tale pesticida contro il vettore della malaria nel periodo 2000 2005 nella regione nord orientale del KwaZulu Natal Wells e Llewllyn 2006 Gli IPA risultano avere i livelli pi alti quasi doppi comparati agli OC esattamente con un range tra 2769 20 7278 40 ng g p s probabilmente a causa del grande traffico petrolifero presente lungo le rotte navali del Sud Africa Moldan e Jackson 2005 Per quanto concerne i biomarker indagati abbiamo ottenuto risposte per il CYP1A probabilmente indotto da composti planari quali gli IPA stata riscontrata inoltre la presenza di Vtg e Pzr negli esemplari di squalo bianco sia maschi che femmine sessualmente immaturi Conclusioni Non avendo dati sull espressione basale di CYPIA Vtg e Pzr in esemplari di C carcharias provenienti da aree da considerare pristine da un punto di vista di contaminazione non possiamo formulare ipotesi riguardanti l induzione o la risposta di tali proteine in presenza dei contaminanti indagati Bibliografia FOSSI M C CASINI S MARSILI L 2007 Potential toxicological hazard due to endocrine disrupting chemicals on Mediterranean top predators state of art gender differences and methodological tools Environ Res 104 1 17
142. 8 SCUDERIA 144 SCUDERI D 117 SECCI M 154 SERENA F 158 188 SERRATORE P 47 SFRISO A 111 123 125 SFRISO A A 53 SICURELLI D 43 SIMONINI R 200 SIMONOT M 202 SINACORI G 198 SINAGRA A 196 SINOPOLI M 132 SPATAFORA D 127 SPEDICATO M T 20 156 SPERONE E 144 160 204 STABILI L 190 STAGIONI M 162 T TAZIOLI S 196 TEPSICH P 226 TITONE A 84 142 198 TOCCACELI M 70 TOMASELLO A 12 TOTTI C 103 TRAVERSI I 202 TRINGALI M 218 226 TRIPEPI S 160 204 TROCCHIA S 208 TRUCCHI R 222 235 TURCO G 127 TURKI S 103 241 U UGOLINI A 188 210 212 UNGARO N 96 129 V VACCHI M 68 VALLISNERI M 146 148 162 VALVASSORI G 98 VAN WYK H 204 VASSALLI M 103 VASSALLO P 220 222 235 VAZZANA M 214 VEGA FERNANDEZ T 30 80 100 117 VENTRELLA V 47 VENTURA D 164 VESPAZIANI L 144 VETRUGNO A 218 VILA M 103 VINCI A 198 VOLPE E 47 W WILCOCKSON D C 210 Z ZENONE A 100 ZIZZO N 233 ZOPPINI A 185 ZUCCHETTA M 123 ZUPA W 134 Volume pre print
143. A M MARTIN C SPEDICATO M T 2013 Harmonising data from heterogeneous sources to characterise small pelagic fish habitat in the Mediterranean Sea ICES CM2013 G 17 MARTIN C S GIANNOULAKI M DE LEO F SCARDI M SALOMIDI M KNITWEISS L PACE M L GAROFALO G GRISTINA M BALLESTEROS E BAVESTRELLO G BELLUSCIO A CEBRIAN E GERAKARIS V PERGENT G PERGENT MARTINI C SCHEMBRI P J TERRIBILE K RIZZO L BEN SOUISSI J BONACORSI M GUARNIERI G KRZELJ M MACIC V PUNZO E VALAVANIS V FRASCHETTI S 2014 Coralligenous and ma rl habitats predictive modelling to identify their spatial distributions across the Mediterranean Sea Scientific Reports 4 5073 DOI 10 1038 srep05073 TELESCA L BELLUSCIO A CRISCOLI A ARDIZZONE G D APOSTOLAKI E T FRASCHETTI S GRISTINA M KNITTWEIS L MARTIN C S PERGENT G GAROFALO G GERAKARIS V PACE M L PERGENT MARTINI C SALOMIDI M 2015 Seagrass meadows Posidonia oceanica distribution and trajectories of change Scientific Reports submitted 24 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 POSTER DEL TEMA 25 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 L APPOLLONI F DISTEFANO L DONNARUMMA A ROMANO R SANDULLI G F RUSSO Dipartimento di Scienze e Tecnologie DiST Universita di Napoli Parthenope Centro Direzionale Isola
144. ANCEBO D PECORINO V ASNAGHI L CANNELLA D SICURELLI M CHIANTORE Dipartimento di Scienze della Terra dell Ambiente e della Vita DISTAV Universita di Genova Corso Europa 26 16132 Genova Italia mariapaola ferranti gmail com ECHINOCOLTURA DI PARACENTROTUS LIVIDUS EFFETTO DELLA DIETA SU CRESCITA SOMATICA E GONADICA ECHINOCULTURE OF PARACENTROTUS LIVIDUS EFFECT OF DIET ON SOMATIC AND GONADIC GROWTH Abstract The performances of three feeds 1 commercial and 2 experimental for P lividus were tested in a land based system and their ability to produce large gonads was assessed Their stability in seawater was also measured Feed A and C produced a higher gonadal yield while no increase in gonad weight was recorded in urchins fed feed B Feed A and C also proved to be more stable at the chosen farming and experimental temperatures leading to the conclusion that they are more suitable for commercial farming purposes Key words sea urchins echinoculture feeds Paracentrotus lividus aquaculture Introduzione P lividus una specie ad alto valore ecologico e commerciale i cui stock naturali sono in decremento a causa della raccolta indiscriminata La coltura di questa specie tuttavia ancora poco sviluppata Studi precedenti Lawrence et al 1997 Philips et al 2010 hanno dimostrato che possibile ottenere una crescita gonadica con mangimi artificiali superiore a quella naturale con ovvi benefici commerciali
145. ANDULLI R RUSSO G F Aree marine protette e pianificazione spaziale marittima il caso della zonazione dell AMP di Ventotene e Santo Stefano ie COSSU A DE LUCA M Monitoraggio habitat e specie marine costiere nel SIC ZPS Isola dell Asinara een D ANNA G PIPITONE C VEGA FERNANDEZ T GAROFALO G BADALAMENTI F Stakeholder perspectives about the governance of the Egadi Islands Marine Protected Area W Sicily GRECH D CHIARORE A FIORETTI S KUMAR A MULAS M BUIA M C PATTI F P The importance of an integrated approach in the study conservation and restoration of Fucales Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 MACRI G DELARIA M A NAVONE A CARONNI S Una proposta di standardizzazione per la mappatura delle fioriture della microalga bentonica Chrysophaeum taylorii i i PETROCELLI A CECERE E PORTACCI G MICHELI C DE CECCO L MARTINI S BORFECCHIA F Preliminary mapping of the alien seaweed Hypnea cornuta Rhodophyta Gigartinales in the Mar Piccolo of Taranto southern Italy Mediterranean Sea Poster del Comitato Acquacoltura CACCAMO L MANCUSO M CAPPELLO S GAI F GENOVESE M GENOVESE L PED C PERDICHIZZI A MARICCHIOLO G Saccharomyces cerevisiae var boulardii preserva l integrit della mucosa intestinale in
146. AVESTRELLO G SANTANGELO G CAU A MASTASCUSA V CAU AL SACCO F CANESE S 2015 Distribution and assessment of marine debris in the deep Tyrrhenian Sea NW Mediterranean Sea Italy Mar Pollut Bull doi 10 1016 j marpolbul 2014 12 044 BALLESTEROS E 2006 Mediterranean coralligenous assemblages a synthesis of present knowledge Oceanogr Mar Biol 44 123 195 BAVESTRELLO G CERRANO C ZANZI D CATTANEO VIETTI R 1997 Damage by fishing activities to the Gorgonian coral Paramuricea clavata in the Ligurian Sea Aquat Conserv 7 253 262 BO M BAVA S CANESE S ANGIOLILLO M CATTANEO VIETTI R BAVESTRELLO G 2014 Fishing impact on deep Mediterranean rocky habitats as revealed by ROV investigation Biol Conserv 171 167 176 BO M BAVESTRELLO G ANGIOLILLO M CALCAGNILE L CANESE S CANNAS R CAU AL D ELIA M D ORIANO F FOLLESA M C QUARTA G CAU A 2015 Persistence of Pristine Deep Sea Coral Gardens in the Mediterranean Sea SW Sardinia PloS ONE 10 doi 10 137 1 journal pone 0119393 CATTANEO VIETTI R BAVESTRELLO G BO M CANESE S ANDALORO F in stampa Illegal fisheries evidences on a deep red coral bank in the Sicily Channel Aquat Conserv CERRANO C BAVESTRELLO G BIANCHI C N CATTANEO VIETTI R BAVA S MORGANTI C MORRI C PICCO P SARA G SCHIAPARELLI S SICCARDI A SPONGA F 2000 A catastrophic mass mortality episode of gorgonians and other organisms in t
147. An overview of the FADs fishery in the Mediterranean Sea In Le Gall J Y Cayr P Taquet M eds P che thoni re et dispositifs de concentration de poissons Actes Collog Ifremer 28 184 207 133 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 M ARNESANO P GAUDIO W ZUPA L CASCIARO P CARBONARA COISPA Tecnologia e Ricerca Stazione Sperimentale per lo Studio delle Risorse del Mare Via dei Trulli 18 20 70126 Bari Italia carbonara coispa it PRESENCE OF PENAEUS SEMISULCATUS DECAPODA PENEIDAE IN THE NORTH WESTERN IONIAN SEA CENTRAL MEDITERRANEAN PRESENZA DI PENAEUS SEMISULCATUS DECAPODA PENEIDAE NEL MAR IONIO CENTRO SETTENTRIONALE MEDITERRANEO CENTRALE Abstract Green tiger prawn is a lessepsian species with a distribution restricted in the eastern part of the Mediterranean In this note was reported for the first time the caught of this species 76 females 71 males in the Gulf of Taranto North West Ionian Sea The spatial expansion of this species to North West represents one of the changing in Mediterranean fish distribution observed in the last decades Key words Penaeus semisulcatus sex ratio length frequency distribution geographical distribution Introduction The lessepsian Green tiger shrimp Penaeus semisulcatus De Haan 1844 is an Indo Pacific species established along the coast of the Eastern Mediterranean Sea Egyptian Israeli Syr
148. B LIMBURG K NAEEM S O NEILL R V PARUELO J RASKIN R G SUTTON P VAN DEN BELT M 1997 The value of the world s ecosystem services and natural capital Nature 387 253 260 COSTANZA R DE GROOT R SUTTON P VAN DER PLOEG S ANDERSON S J KUBISZEWSKI I FARBER S TURNER R K 2014 Changes in the global value of ecosystem services Global Environ Chang 26 152 158 DAILY G C EHRLICH P R 1992 Population sustainability and Earth s carrying capacity a framework for estimating population sizes and lifestyles that could be sustained without undermining future generations BioScience 42 761 771 17 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 D ANGELO S ARIC S FRANZESE P P 2010 La rete mondiale delle riserve della biosfera dell UNESCO ed il valore del capitale naturale e dei servizi ecosistemici Biologi Italiani 9 41 46 DE GROOT R BRANDER L VAN DER PLOEG S COSTANZA R BERNARD F BRAAT L CHRISTIE M CROSSMAN N GHERMANDI A HEIN L HUSSAIN S KUMAR P MCVITTIE A PORTELA R RODRIGUEZ L C TEN BRINK P van BEUKERING P 2012 Global estimates of the value of ecosystems and their services in monetary units Ecosystem Services 1 50 61 FRANZESE P P BUONOCORE E MELLINO S ULGIATI S 2009a La contabilita biofisica per la valutazione delle sostenibilit ambientale dei Comuni italiani Biologi Italiani 7 64 7
149. C4 80143 Napoli Italia luca appolloni uniparthenope it AMP Riserva Naturale Statale di Ventotene e Santo Stefano Ventotene LT Italia AREE MARINE PROTETTE E PIANIFICAZIONE SPAZIALE MARITTIMA IL CASO DELLA ZONAZIONE DELL AMP DI VENTOTENE E SANTO STEFANO MARINE PROTECTED AREAS AND MARITIME SPATIAL PLANNING THE CASE OF VENTOTENE AND SANTO STEFANO MPA ZONING Abstract A systematic approach was applied to assess the present zoning of Ventotene and Santo Stefano MPA Spatial data of habitats and human activities have been implemented in Marxan software Results show new solutions for a more efficient zoning of the MPA Key words maritime spatial planning marine protected area zoning Marxan Tyrrhenian Sea Introduzione Le riserve naturali rappresentano strumenti d elezione per la conservazione di ambienti in cui le attivit antropiche sono regolamentate al fine di conciliare le esigenze della conservazione con quelle dello sviluppo sostenibile Studi condotti di recente hanno dimostrato che le metodologie finora usate per disegnare le riserve risultano spesso inefficaci ed inefficienti per il raggiungimento degli obiettivi da raggiungere La finalit del presente lavoro applicare un approccio sistematico Margules e Pressey 2000 per migliorare l attuale zonizzazione nell Area Marina Protetta di Ventotene e Santo Stefano in un contesto europeo dove sempre pi pressante la necessit di una pianificazione in
150. CASTELLI A 218 CATTANEO VIETTI R 8 CATTANO C 127 CAVALLARO M 41 194 CAVALLO R A 190 CECCHERELLI G 105 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 CECERE E 36 92 109 CELI M 214 CELONA A 226 CENTANNIE 111 125 CERASIS 8 156 CERINO F 169 CHEMELLO R 60 70 113 CHIANTORE M 43 49 68 103 CHIARORE A 32 CHIMIENTI G 64 66 CIARCIA G 208 CIBIC T 169 177 CICCARESE S 233 CIMA F 47 CIMINIELLO P 103 CIOFINI A 210 CIPRIANO G 231 CIRCOSTA V 160 CITTERIO S 58 CIULLI S 47 COLLA S 119 140 COLLOCA F 142 158 CONTE A 171 COPPOLA D 204 CORCELLA M E 233 COSENTINO A 231 233 COSENZA M 192 COSSU A 28 CROSTI R 218 D D ADAMO R 45 115 D ANNA G 30 100 117 DANZE A 41 DA ROS L 121 DAVID L 222 DE BIASI A M 167 DE CECCO L 36 DE DOMENICO E 173 DE LA FUENTE MANCEBO G 43 196 DELARIA M A 34 105 107 DELL ACQUA O 68 DEL NEGRO P 177 179 DE LUCA M 28 DEMURTAS D 90 DHERMAIN F 222 DI CAMILLO C G 196 DI FRANCO A 196 DI MARTINO E 196 DI MEGLIO N 222 DI POI E 177 238 DI STEFANO F 26 72 DI STEFANO G 100 DOMINA L 70 127 DONNARUMMA L 26 72 E ENEA M 142 F FABBRI M 47 FABBROCINI A 45 115 FACCA C 111 123 125 FACCHINI M T 138 FANCIULLI L 49 FANIZZA C 231 233 FARINA S 82 FAVA F 196 FERRANTI M P 43 196 FERRARO M 202 FERRIGNO F 74 FIANCHINI A 51 78 FIORENTINO
151. CIO U SIMONIELLO P TAMMARO S MARMO F 2009 Morphological and biochemical analyses of otoliths of the ice fish Chionodraco hamatus confirm a common origin with red blooded species J Anat 214 153 162 147 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 S MONTANINI M VALLISNERI E BENNI S P REZ MAYOL B MORALES NIN Department of Biological Geological and Environmental Sciences University of Bologna Via Selmi 3 40126 Bologna Italy Laboratory of Marine Biology and Fisheries University of Bologna Fano PU Italy stefano montanini2 unibo it Instituto Mediterraneo de Estudios Avanzados IMEDEA CSIC UIB Spain PELAGIC LARVAL DURATION AND SETTLEMENT MARKS ON THE OTOLITHS OF TUB GURNARD CHELIDONICHTHYS LUCERNA FROM ADRIATIC SEA DURATA DEL PERIODO PELAGICO LARVALE E MARCATORI MICROSTRUTTURALI IN OTOLITI DI GALLINELLA CHELIDONICHTHYS LUCERNA DELL ADRIATICO Abstract Larval duration of the tub gurnard Chelidonichtys lucerna was estimated for the first time from samples collected in north middle Adriatic Sea using sagittal otoliths Settlement marks characterized by discontinuity of daily growth increments and a re orientation of the growth axes and otolith shape with the appearance of accessory growth centres were determined Pelagic larval duration was a mean of 24 days and it was marked by the development of accessory growth centres K
152. CROALGA CHRYSOPHAEUM TAYLORII FIRST OBSERVATIONS ON THE LIFE CYCLE OF THE MEDITERRANEAN STRAIN OF THE MICROALGA CHRYSOPHAEUM TAYLORII Abstract A research project aimed to describe for the first time the whole life cycle of the Mediterranean strain of the mucilage forming microalga Chrysophaeum taylorii Lewis amp Bryan Pelagophyceae has been conducted since 2013 in the laboratories of the University of Milano Bicocca To the purpose the main morphological changes in C taylorii cells are being monitored through time in cultures of the microalga obtained in the laboratory from natural samples Here the preliminary results of the study are reported Key words life cycle laboratory culture algae organism morphology phytobenthos Introduzione Chrysophaeum taylorii Lewis amp Bryan una microalga produttrice di mucillagine tipica delle regioni tropicali Schaffelke et al 2004 Negli ultimi anni per stata ritrovata anche in Mediterraneo Lugli et al 2008 Aktan e Topaloglu 2011 Blasi er al 2013 dove la mucillagine causa seri danni alle comunit bentoniche ricoprendo organismi sessili macroalghe e piante marine Dopo un primo stadio di sviluppo orizzontale sul substrato la mucillagine raggiunge inoltre la superficie causando problemi al turismo balneazione sgradevole e alla pesca reti appesantite Lugli ef al 2008 Le conoscenze sulla biologia e sull ecologia di C taylorii sono assai carenti e frammenta
153. DELLA PREDAZIONE DA PARTE DEL NOTOTENIDE TREMATOMUS BERNACCHII SULLA STRUTTURA DI TAGLIA DI ADAMUSSIUM COLBECKI A BAIA TERRA NOVA MARE DI ROSS ANTARTIDE Abstract We investigated the impact of the predation by the fish Trematomus bernacchii upon the scallop Adamussium colbecki Based on the length of the scallop preyed by the fish from fish stomach contents and the size distribution of the scallop population through a 24 years long time series sampling we built a statistical model of the predation pressure Comparing this model with the size structure of the scallop living population we can assess the role of the predator to shape the prey population size frequency providing a better understanding for the management of sensitive areas such as Terra Nova Bay ASPA 161 and the Ross Sea Key words Adamussium colbecki Trematomus bernacchii Ross Sea predation Introduction Predation pressure exerted by fishes can play a major role in structuring prey population size structure as capture success handling time prey profitability and vulnerability can be expressed as functions of predator prey size ratio At Terra Nova Bay ASPA 161 Victoria Land coast Ross Sea Trematomus bernacchii is the dominant fish species mostly feeding upon the scallop Adamussium colbecki which is a key species as well with a high density and biomass Chiantore et al 2001 Considering its key role in organic matter flux Chiantore et al 1998 and its capab
154. Direttiva MSP richiami esplicitamente la necessit di una convergenza fra gli obiettivi ecologici economici e sociali ovvero il principio su cui si basa il concetto di sviluppo sostenibile Inoltre essa fa diretto riferimento ai principi generali dell Ecosystem Approach ed in particolare all implementazione di quest ultimo attraverso la Direttiva quadro sulla strategia per l ambiente marino 2008 56 CE ma certamente meglio nota come Marine Strategy che viene cos indicata come il pilastro ambientale su cui la pianificazione dello spazio marittimo deve poggiarsi Un elemento di notevole importanza che la Direttiva solleva per la prima volta non come una concausa ma come una sorgente di perturbazione da prendere direttamente in considerazione per le sue specifiche caratteristiche costituito dagli effetti dei cambiamenti climatici Un ruolo analogo attribuito anche alle calamit naturali ed alle variazioni della linea di costa che pure possono avere effetti rilevanti sulle zone costiere e sugli ecosistemi marini causando peggioramento dello stato ambientale perdita di biodiversit e pi in generale degrado dei servizi ecosistemici Da un punto di vista pratico la Direttiva lascia ampia autonomia ai Paesi membri per ci che riguarda il suo recepimento Tuttavia essa definisce alcuni requisiti minimi per la pianificazione dello spazio marittimo i quali dovrebbero garantire quella convergenza fra attori e processi diversi che rappr
155. ENGONI F SERENA A UGOLINI Dipartimento di Biologia Universita di Firenze Via Romana 17 50125 Firenze Italia khaledfaraga abdelrhman unifi it ARPAT Risorsa Ittica e Biodiversita Marina Livorno Italia INDAGINI PRELIMINARI SUL MICROBIOMA INTESTINALE DELLA TARTARUGA MARINA CARETTA CARETTA LINNAEUS 1758 PRELIMINARY INVESTIGATION ON THE GUT MICROBIOME OF THE SEA TURTLE CARETTA CARETTA LINNAEUS 1758 Abstract The gut microbiome of the sea turtle Caretta caretta has been explored by 16S rRNA metagenomic analysis Results have shown the prevalence of Firmicutes and the presence of taxa known to be involved in human gut nutrient assimilation as Blautia and of marine free living taxa Marinobacter Key words Caretta caretta gut microbiome 16S rRNA Illumina MiSeq Introduzione Da ormai molti anni le comunita microbiche microbioma associate con l apparato digerente degli animali sono oggetto di forte interesse a livello internazionale Zhu et al 2010 Negli ultimi anni emersa la presenza di una stretta interrelazione funzionale tra l ospite e il microbioma associato tanto che si proposto il nuovo termine di ologenoma Zilber Rosenberg e Rosenberg 2008 intendendo l insieme delle funzioni geniche dell ospite e dei microrganismi a lui associati A dispetto della notevole importanza per lo studio dei vertebrati e per la salvaguardia della biodiversit marina non vi sono ancora studi sulle comunit microb
156. F 84 142 198 206 FIORETTI S 32 FIORI C 220 226 FIORIN R 121 FORERO MEJIA A 76 FORTI L 200 FOSSA F 222 235 FOSSI M C 204 FOTI A 78 FRANZESE P P 15 FRANZITTA G 60 113 FRANZOI P 123 FRONGIA C 100 G GAIF 39 GALLO P 202 GAMBI M C 98 GANCITANO S 142 GANCITANO V 84 142 198 GARIBALDI F 156 GAROFALO G 30 84 198 GATT M 206 GAUDIO P 134 138 GENOVESE L 39 GENOVESE M 39 GENTILE A 192 GHIANI A 58 GIACALONE V M 100 GIACCONE T 196 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 GIACOMA C 218 226 GIANGRANDE A 78 94 117 GIANI M 179 GIANNETTI M 204 GIARRATANA F 41 GIGLIO G 144 160 GION C 125 GIUSSANI V 175 196 GIUSTO G B 198 GNONE G 222 226 228 235 GRAVINA M F 51 62 78 GRAZIANO M 171 173 GRECH D 32 GRISTINA M 84 127 132 GUALA I 82 GUERRERA M C 194 GUERRIERO G 208 H H LTERS L 210 I IACIOFANO D 80 INGRANDE G 142 INGROSSO G 179 TORI D 200 K KARUZA A 177 179 KUMAR A 32 L LABACH H 222 LAGAN P 171 LA MARCA E C 60 113 LANTERI L 156 LARAN S 222 LEMBO G 156 LEM E R 103 LEONE A 160 LEZZI M 78 LIGAS A 158 LIONETTI A 66 231 LO BRUTTO S 80 94 117 206 LO GIUDICE A 171 LOI B 82 LUCCHETTI A 156 LUNGARINI S 185 LUPERINI C 218 226 LUZZU F 12 M MACRIG 34 107 MADONNA A 208 MADRIGRANO M 194 MAIORANO P 64 MALAVASI S 119 MANCA
157. Fig 1 CoNISMa U L R Genova ARPAL 2006 2014 16 siti LOV UNS CoNISMA U L R Ancona 2010 2014 8 siti 2007 2014 7 siti ARI i ICM Barcelona Pace 201479 siti ARPA S fidegna ni Napoli ARPAC 2014 8 siti 2014 15 siti 2010 2014 1 sito ey INSM O A curs finan 1997 2014 40 siti 1997 2014 5 siti Li Fig 1 Mappa dei dataset e metadati relativi ai rilevamenti di Ostreopsis e variabili ambientali correlate a disposizione nell ambito del progetto M3 HABs Map of the available datasets on Ostreopsis presence and related environmental variables in the framework of M3 HABs project Conclusioni Le dinamiche di fioritura di Ostreopsis a diverse scale spaziali e temporali sono complesse ed il ruolo dei driver ambientali di non facile individuazione con differenze rilevanti a scala di bacino Mangialajo et al 2011 Ad oggi stato evidenziato tramite studi descrittivi Pistocchi et al 2011 e preliminari modellizzazioni del fenomeno Asnaghi et al 2012 un ruolo rilevante della temperatura dell acqua Il progetto M3 HABs fornendo protocolli comuni e intercalibrati garantisce campionamenti comparabili nello spazio e nel tempo a livello mediterraneo L investigazione dei dataset raccolti nell ambito del progetto M3 HABs permetter di mettere in luce differenze nelle dinamiche delle fioriture nelle diverse aree del Mediterraneo oltre che fornire ai Paesi partner un utile strumento previsional
158. G GNONE F DHERMAIN S NUTT S AIROLDI N PORTUNATO L DAvip N DI MEGLIO P BONELLI R TRUCCHI S LARAN H LABACH M C SANTONI P VASSALLO DISTAV Dipartimento di Scienze della terra dell Ambiente e della Vita Universit di Genova Corso Europa 26 16132 Genova Italia chiara marini edu unige it Acquario di Genova Area Porto Antico Ponte Spinola 16128 Genova Italia GECEM Groupe d tudes des C tac s en M diterran e Marseille France CE TU S Centro di Ricerche sui Cetacei Viareggio LU Italia Tethys Research Institute Milano Italia 5NURC Nato Undersea Research Centre La Spezia Italia coOc an Institut Montpellier France Ambiente Mare Faenza RA Italia 8WWF Liguria Genova Italia GIS3M Le Kalliste Sausset les pins France OEC Office de l Environnement de la Corse Base technique de la Rondinara Bonifacio France MODELLO PREDITTIVO DI DISTRIBUZIONE DEL TURSIOPE TURSIOPS TRUNCATUS MONTAGU 1821 NEL SANTUARIO PELAGOS ATTRAVERSO LA TECNICA DI RANDOM FOREST PREDICTIVE MODELLING OF THE BOTTLENOSE DOLPHIN TURSIOPS TRUNCATUS MONTAGU 1821 SPATIAL DISTRIBUTION THROUGH RANDOM FOREST TECHNIQUE IN THE PELAGOS SANCTUARY Abstract Habitat modeling is an important tool to investigate the quality of the habitat for a species within a certain area to predict species distribution and to understand the ecological processes behind it Many species have b
159. GOLINII BELLAN SANTINI E RUFFO 1991 E SARDORCHESTIA PELECANIFORMIS BELLAN SANTINI E RUFFO 1985 NEW DATA ON THE DISTRIBUTION OF TALORCHESTIA UGOLINII BELLAN SANTINI AND RUFFO 1991 AND SARDORCHESTIA PELECANIFORMIS BELLAN SANTINI AND RUFFO 1985 Abstract The addition of new locations in Corsica and Sardinia configures Talorchestia ugolinii as a typical Sardinian Corsican endemism Sardorchestia pelecaniformis is a Sardinian endemism being present in most of Sardinia but not in Corsica Key words Talorchestia ugolinii Sardorchestia pelecaniformis distribution Sardinia Island Corsica Island Introduzione Nel quadro di un progetto teso allo studio dei microbiomi presenti in anfipodi talitridi viventi in ambienti sopralitorali sono stati effettuati campionamenti nel 2010 e nel 2012 2014 in spiagge sabbiose della Sardegna meridionale sud occidentale e in Corsica meridionale ed orientale L anfipode Talorchestia ugolinii Bellan Santini e Ruffo 1991 era stato in precedenza segnalato per varie localit della Corsica orientale Ugolini et al 1995 mentre Sardorchestia pelecaniformis era nota soltanto per due localit sarde Baia Chia 38 53 09 N 8 51 58 E Sardegna meridionale e Cabru Aspru 40 51 48 N 8 16 56 E Sardegna settentrionale Porto Torres Bellan Santini e Ruffo 1985 Tafani et al 2004 Risultati Le prospezioni hanno messo in luce la presenza di consistenti popolazioni di T ugolinii nelle se
160. H D ALVAREZ E ALVAREZ BERASATEGUI D DEUDERO S 2014 Spatial distribution modelling of the endangered bivalve Pinna nobilis in a Marine Protected Area Medit Mar Sc 15 626 634 ZAVODNIK D HRS BRENKO M LEGAC M 1991 Synopsis on the fan shell Pinna nobilis L in the eastern Adriatic Sea In Boudouresque C F Avon M Gravez V eds Les Esp ces Marines Prot ger en M diterran e GIS Posidonie Marseille 169 178 93 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 E SCHIMMENTI S LO BRUTTO F BADALAMENTI A GIANGRANDE B Mikac L Musco Dipartimento STeBiCeF Sezione di Biologia Animale Universita di Palermo Via Archirafi 18 90123 Palermo Italia sabrina lobrutto unipa it CNR IAMC Castellammare del Golfo TP Italia 2DiSTeBA Universita del Salento Lecce Italia DNA BARCODING TO SOLVE THE TRICKY CASE OF CO OCCURRING SABELLARIA ANNELIDA SPECIES IN THE MEDITERRANEAN SEA DNA BARCODING PER LA CORRETTA IDENTIFICAZIONE DELLE SPECIE DEL GENERE SABELLARIA ANNELIDA IN MEDITERRANEO Abstract Intraspecific morphological variation of key taxonomic features is probably responsible for frequent misidentification of Sabellaria Lamarck 1818 species This is the case of Sabellaria alcocki Gravier 1906 whose Mediterranean records probably refer to juveniles of S spinulosa Leuckart 1849 We hereby provide molecular tools DNA barcoding to
161. H INGICES i rta Le assi ila eso gc ec eben iaia 123 SFRISO A FACCA C BUOSI A CENTANNI E BERTO D RAMPAZZO F GION C BONOMETTO A BOSCOLO R Stato trofico e stato ecologico dell area settentrionale della laguna veneta 125 SPATAFORA D CATTANO C DOMINA I GRISTINA M MILAZZO M TURCO G Impiego dei BRUV Baited Remote Underwater Video per la valutazione del popolamento ittico nell Area Marina Protetta Capo Gallo Isola delle Femmine Palermo 127 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 UNGARO N PASTORELLI A M BARBONE E Una prima valutazione dei rifiuti spiaggiati lungo le coste pugliesi Poster del Comitato Necton e Pesca ALLEGRA A ANDALORO F GRISTINA M SINOPOLI M Utilizzo di nuove tecnologie nella pesca della lampuga Coryphaena hippurus Linnaeus 1758 le FADS b0 ie ARNESANO M GAUDIO P ZUPA W CASCIARO L CARBONARA P Presence of Penaeus semisulcatus Decapoda Peneidae in the north western Ionian Sea central Mediterranean BIANCHINI M L RAGONESE S Aspetti biologici ed alieutici della boga Boops boops Linnaeus 1758 nello Stretto di Sicilia CASCIARO L GAUDIO P BITETTO I FACCHINI M T PALMISANO M CARBONARA P Catch structure and reproductive pattern of Melicertus kerathurus in the south west Adriatic Sele
162. HDS W 8 N 1994 me 1990 1992 mm i Ml Si osserva un vuoto corrispondente agli anni 2009 2010 nel 2009 rilevamenti aerei nel Santuario per il censimento di grandi pelagici trovarono pochissime balenottere e si fece una stima della popolazione estiva pari a soli 137 individui Lauriano e Panigada 2010 Tuttavia nel Santuario di parte francese indagini con programmazione pluriennale e pluristagionale non ebbero interruzioni GIS3M WWF 2012 Oggi si pu constatare che il vuoto 2009 2010 superato dal fatto che i quattro anni successivi hanno registrato 13 individui cio pi di quelli attesi 2 8x4 11 2 La ripresa era evidente gi nel 2011 Anche il numero di balenottere del primo anno di vita registrate negli spiaggiamenti individui in nero nelle colonne di Fig 1 sembra indicare una regolarit delle nascite nel tempo questo numero oltrepassa il 40 come gi osservato anche analizzando le distribuzioni lunghezza frequenza pi di dieci anni fa Orsi Relini et al 2004 Sfortunatamente il risultato dei rilevamenti aerei confrontato con criticabili censimenti di venti anni prima divent rapidamente un trend di popolazione negativo da portare in sede IUCN parte mediterranea Panigada e Notarbartolo 2012 al contrario gli specialisti che nello stesso documento trattano delle balenottere di tutto il mondo considerano con grande cautela il problema dei trend 2014 Mie S Ea 3 mo 2012 lum
163. I DELL ISOLA DI LICOSA AMP SANTA MARIA DI CASTELLABATE Abstract The aim of this study was to investigate the morphological features of the northernmost Mediterranean vermetid reef Observations were carried out at Licosa island Campania coast using tape measures and image analysis to characterize the vermetid aggregates and the colonization pattern of the species along a depth gradient from upper mesolittoral to infralittoral The results showed a well structured bioconstruction with an increasing density of Dendropoma petraeum along the gradient Key words reef formation Dendropoma petraeum colonization Mediterranean Sea Introduction Dendropoma petraeum Monterosato 1884 is a sessile gastropod belonging to the family Vermetidae and endemic of the Mediterranean Sea Ekman 1953 The colonization of the rocky shore by the vermetid at Licosa island Tyrrhenian Sea Gulf of Salerno offers the opportunity to carry out a detailed study on the northernmost Mediterranean vermetid reefs in a site that falls within the MPA of Santa Maria di Castellabate where human impact e g trampling and water pollution is negligible Despite several studies describing the distribution of vermetid reefs along the warm water Mediterranean coasts Antonioli et al 1999 Chemello 2009 there are gaps of information in literature concerning these bioconstructions along the Campania coast in Italy The present study is focused on the physiognomic char
164. IA V M GIACALONE M MUNTONI M MURENU C PIPITONE T VEGA FERNANDEZ G D ANNA Istituto Ambiente Marino Costiero IAMC CNR Via del Mare 3 91021 Torretta Granitola Fraz di Campobello di Mazara TP Italia arturozeno gmail com IAMC CNR Via Giovanni da Verrazzano 17 91026 Castellammare del Golfo TP Italia CATTURE DI PERCNON GIBBESI H MILNE EDWARDS 1853 CON TRAPPOLE DI LUCE NELLA SICILIA NORD OCCIDENTALE CATCH OF PERCNON GIBBESI H MILNE EDWARDS 1853 BY LIGHT TRAPS IN NORTH WESTERN SICILY Abstract The tropical Atlantic grapsid crab Percnon gibbesi H Milne Edwards 1853 is an invasive decapod reported since 1999 along several coasts of the Mediterranean Sea Several studies have been conducted on this species mainly at the adults stages but scarce information are available at the present on the early life stages of this species In order to sample early life history stages of several organism from May to October 2013 we deployed light traps over the new moon period for three days per month in 4 sites of NW of Sicily The present study reports the abundances of P gibbesi megalopae in the NW Sicilian waters for which no information are available The CPUE showed high variability among localities and in relation to the distance from the coast likely due to the different oceanographic conditions characterizing each locality However further investigations are required to better understand the potential fo
165. INI A 2015 Distribution of spawning and nursery grounds for deep water red shrimps in the central western Mediterranean sea Medit Mar Sci 16 1 117 127 151 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 G RELINI Dipartimento di Scienze della Terra dell Ambiente e della Vita DISTAV Universita di Genova Corso Europa 26 16132 Genova Italia biolmar unige it BIODIVERSIT ITTICA DELLE CAMPAGNE MEDITS FISH BIODIVERSITY OF MEDITS SURVEYS Abstract Fishes collected during 20 MEDITS surveys from 1994 to 2013 are recorded as number of species for each of the 18 GSAs In total 344 species of bony fish belonging to 101 families are recorded Elasmobranchs are represented by 50 species 22 sharks 1 rabbit fish 27 rays and skates Among 14 alien species of bony fish 12 have been recorded in GSA 25 Cyprus Key words bony fish elasmobranchs trawl survey Mediterranean Sea Introduzione MEDITS Mediterranean International Trawl Survey l annuale campagna a strascico promossa dalla CE che vede coinvolti tutti e 8 i paesi Mediterranei della CE oltre ad Albania e Montenegro Attualmente questa campagna fa parte della raccolta dati per la pesca del regolamento CE n 199 2008 e successivi Per le finalit e l organizzazione di MEDITS che si svolge a primavera inizio estate a partire dal 1994 si consulti Bertrand et al 2002 Scopo della presente nota fo
166. Ia Impatto bassa copertura Ib Controllo C Sono stati pianificati due confronti a priori Ia vs C Ib vs 117 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 C col fattore Sito random e gerarchizzato in I vs C 2 livelli Sono state condotte analisi multivariate MANOVA SIMPER Risultati Sono stati identificati 8 773 individui di 351 taxa della macrofauna Nei controlli i crostacei sono risultati dominanti crostacei 59 e 61 seguiti da policheti 26 e 28 e molluschi 12 e 13 Nell area impattata si osservato un incremento di policheti 36 e 80 rispettivamente in Ia e Ib una diminuzione di crostacei 35 e 11 e una variabilit nei molluschi 28 e 8 I nematodi sono risultati il taxon dominante della meiofauna nell area impattata 68 e 54 rispettivamente in Ia e Ib seguiti da copepodi 19 e 39 e policheti 8 e 5 Anche nei controlli i nematodi sono stati il taxon dominante 55 e 60 seguito da copepodi 34 e 25 e policheti 7 e 12 L analisi statistica ha mostrato differenze significative nel pattern di distribuzione della macrofauna in tutti i confronti I vs C Fp 3 36 3 94 p 0 0004 Ia vs C Fi 247 4 1 p 0 004 e Ib vs C Fi 2 54 5 49 p 0 0005 Per la meiofauna sono risultati significativi i confronti I vs C Fo 3 39 4 82 p 0 0105 Ia vs C Fi 34 7 36 p 0 006 ma non il confronto tra porzioni di posidonieto a bassa copertura e controlli
167. Italy Ionian Sea represents a pattern of enclosed coastal marine ecosystem heavily exploited for commercial mussel Mytilus galloprovincialis Lamarck 1819 farming During 2000 2006 an important policy decision was implemented 6 out of 12 sewage outfalls of Mar Piccolo were progressively relocated to Gennarini in the Gulf of Taranto to reduce bacterial exposure Caroppo et al 2012 Environmental conditions influence the composition and succession of phytoplankton communities and despite the reduction of the nutrient inputs in Mar Piccolo algal blooms still represent a problem for the mussel culture Caroppo et al 2010 In the frame of the Italian Flagship Project Ritmare researches were carried out to comprehend the functioning of this ecosystem and to promote the ecosystem based management Particularly this work is aimed to assess dynamics of phytoplankton communities and occurrence of harmful algal blooms HABs Materials and methods Cruises were carried out in six stations of Mar Piccolo in June and October 2013 and in February and April 2014 Samples collected with a 5 L Niskin bottle at the surface and bottom layers were fixed with Lugol s iodine solution and examined under inverted microscope Labovert FS Leitz equipped with phase contrast at a magnification of 400x and 630x Depending on phytoplankton densities sub samples varying from 50 to 100 ml were allowed to settle for 24 48 hours and examined following the Uterm
168. LL SCALE FISHERY VULNERABILITY TO CLIMATE CHANGE IN THE NORTHERN ADRIATIC SEA Abstract Within the context of global warming the western coast of the northern Adriatic Sea can be regarded as an extremely vulnerable area By analysing the composition of landings from small scale fisheries in terms of thermal affinity groups we highlighted the potential vulnerability of these activities being catches mainly composed by cold and temperate affinity species Key words small scale fishery climate changes northern Adriatic Sea Introduzione Nel contesto del riscaldamento globale il nord Adriatico da considerarsi estremamente vulnerabile per le sue caratteristiche geografiche infatti ospita elementi dalle caratteristiche boreali Tortonese 1964 ed inoltre essendo un bacino semichiuso pu essere considerato un cul de sac per le specie endemiche Ben Rais Lasram et al 2010 impossibilitate ad ulteriori migrazioni verso nord In questo contesto le comunit nectoniche potrebbero subire profonde modifiche in termini di struttura con conseguenze anche sulla pesca professionale Scopo del lavoro fornire una prima descrizione di un caso di studio sulla piccola pesca costiera in Nord Adriatico in relazione alla sua potenziale vulnerabilit ai cambiamenti climatici Materiali e metodi L area oggetto di studio si estende nel tratto di costa compreso tra la foce del fiume Piave e la foce del fiume Sile entro le 3 mn nell ambi
169. LLIS D V 1984 Introduction design of sampling programmes In Holme N A McIntyre A D eds Methods for the study of marine benthos Blackwell Scientific Publications Oxford 1 26 NORKKO J BONSDORFF E NORKKO A 2000 Drifting algal mats as an alternative habitat for benthic invertebrates species specific responses to a transient resource J Exp Mar Biol Ecol 248 79 104 SFRISO A MAISTRO S ANDREOLI C MORO I 2010 First record of Gracilaria vermiculophylla Gracilariales Rhodophyta in the Po Delta lagoons Mediterranean Sea Italy J Phycol 46 1024 1027 89 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 A PADIGLIA B CADEDDU M BERTOLINO D DEMURTAS R MANCON R PRONZATO Dipartimento di Scienze della Terra dell Ambiente e della Vita DISTAV Universit di Genova Corso Europa 26 16132 Genova Italia Dipartimento di Scienze della Natura e del Territorio DipNeT Universita di Sassari Via Muroni 25 07100 Sassari Italia andreapadiglia alice it SPUGNE DI PRATERIE DI POSIDONIA OCEANICA IN DUE AREE MARINE PROTETTE MAR DI SARDEGNA SPONGES OF POSIDONIA OCEANICA MEADOWS IN TWO MARINE PROTECTED AREAS SARDINIA SEA Abstract This paper reports on a faunistic study of Posidonia oceanica meadows Results focused on sponges are a contribution to the assessment of biodiversity and the basis to evaluate the impa
170. M PIPITONE C VEGA FERNANDEZ T D ANNA G Catture di Percnon gibbesi H Milne Edwards 1853 con trappole di luce nella Sicilia nord occidental varia ela ra 100 Poster del Comitato Gestione e Valorizzazione della Fascia Costiera ASNAGHI V ABBOUD ABI SAAB M BERTOLOTTO R CIMINIELLO P LEMFE R MANCA V MANGIALAJO L OTTAVIANI E PEDRONCINI A RUSSU C SANGIORGI V C TOTTI C TURKI S VASSALLI M VILA M CHIANTORE M M3 HABs Monitoraggio Modellazione e Mitigazione del rischio associato alle fioriture di microalghe bentoniche tossiche lungo le COSte medi terrane siea e E arie sk eee eh a 103 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 BERNARDI G CARONNI S DELARIA M A NAVONE A PANZALIS P PIRAS M C CECCHERELLI G Effetto dell invasione di Caulerpa cylindracea in popolamenti macroalgali di substrato duro soggetti a disturbo meccanico ie 105 CARONNI S DELARIA M A MACRI G PESCI I OCCHIPINTI AMBROGI A Una nuova segnalazione della microalga produttrice di mucillagine Chrysophaeum taylorii lungo le coste della Sardegna 107 CECERE E PETROCELLI A RUBINO F CASALE V PASSARELLI S CASALE A Report of Caretta caretta Reptilia Testudines in the Mar Piccolo Gulf of Taranto Mediterranean Sea 109 FACCA C BONOMETTO A BOSCOLO R BUOSI A CENTANNI E PARRAVICINI M PONIS E
171. MASCO A BUBIC N LIUBESIC Z VILICIC D BOLDRIN A MALACIC V CELIO M COMICI C RAICICH F 2013 Exceptional dense water formation on the Adriatic shelf in the winter of 2012 Ocean Sci 9 561 572 PACKARD T T WILLIAMS P J LEB 1981 Rates of respiratory oxygen consumption and electron transport in surface sea water from the Northwest Atlantic Oceanol Acta 4 351 358 PATEL A NOBLE R T STEELE J A SCHWALBACH M S HEWSON I FUHRMAN J A 2007 Virus and prokaryote enumeration from planktonic aquatic environments by epifluorescence microscopy with SYBR Green I Nature Protocols 2 269 276 The study was conducted in the framework of MedGES Mediterranean Sea Good Ecological Status EU Project 180 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 V MANCA G A MOCCI C NIGRA C RUSSU Dipartimento di Sassari ARPA Sardegna Via Rockefeller 58 60 07100 Sassari Italia vmanca arpa sardegna it OSTREOPSIS CF OVATA IN TRE AREE DEL NORD SARDEGNA OSTREOPSIS CF OVATA IN THREE AREAS OF THE NORTH SARDINIA Abstract Monitoring of the potentially toxic dinoflagellate Ostreopsis cf ovata Fukuyo 1981 was carried out by ARPA Sardinia in three coastal areas located in the North West of the Island In all three stations O cf ovata blooms occurred with the maximum value of 8 3x1 0 cell L Physico chemical parameters have been also detected Key words benth
172. MOLECULAR PROTOCOLS FOR THE STUDY OF THE SOCIAL STRUCTURE IN STENELLA COERULEOALBA IN THE GULF OF TARANTO PROTOCOLLI DI ANALISI GENETICO MOLECOLARI PER LO STUDIO DELLA STRUTTURA SOCIALE IN STENELLA COERULEOALBA NEL GOLFO DI TARANTO Abstract The genetic analysis of population structure notices the level of variability among and within populations This study aims to enhance the knowledge of the genetic variability of Stenella coeruleoalba population in the Gulf of Taranto Northern Ionian Sea Central Mediterranean Sea through molecular genetic analysis using both nuclear and mitochondrial DNA We have performed and validated protocols of analysis for sex determination for the study of microsatellites and mitochondrial DNA in S coeruleoalba Key words Stenella coeruleoalba sex determination microsatellite analysis mtDNA analysis Mediterranean Sea Introduction S coeruleoalba is regularly observed in the Gulf of Taranto with a predictable distribution of sightings suggesting the presence of a resident population with a high site fidelity Dimatteo et al 2011 Fanizza et al 2014 Previous studies suggest that the predominant social structure is likely fission fusion for Stenella coeruleoalba in the Mediterranean Sea Gaspari et al 2007 In this work we have performed and validated genetic molecular protocols for a population study using nuclear microsatellite and sex markers and mithocondrial DNA in this species Materials and
173. Map of intervention area b plant implantation diagram in each site Risultati Il primo monitoraggio sulla sopravvivenza delle zolle settembre 2014 ha evidenziato che in 8 siti almeno 6 zolle sono sopravvissute e talvolta sono confluite in un unica macchia variabile da 2 a 4 m di diametro In 3 siti non sono state osservate zolle e nelle restanti apparentemente sono sopravvissute al massimo 3 zolle R cirrhosa ha proliferato oltre le aspettative mentre C nodosa sembra aver avuto scarso successo ma si potr verificare solo in maggio quando potr produrre i nuovi fasci fogliari Di 72 zolle di N noltii apparentemente ne sono sopravvissute solo 25 mentre di Z marina 52 su 67 Le stazioni che hanno dato i risultati peggiori sono state quelle direttamente influenzate dalle foci fluviali Il successivo monitoraggio di gennaio 2014 ha evidenziato una sopravvivenza prossima al 100 per Z marina e vicina al 90 per N noltii In alcune stazioni sono state trovate macchie pi ampie delle attese Conclusioni I dati ambientali Sfriso et al in stampa hanno permesso di identificare nelle precipitazioni dei primi 8 mesi del 2014 fino a 4 5 volte maggiori rispetto agli anni precedenti la causa di elevate immissioni di nutrienti e di una massiccia proliferazione di Ulvaceae che ha impedito o ridotto l attecchimento delle piante soprattutto presso le foci dei fiumi Tuttavia le stime di sopravvivenza delle zolle sono da considerarsi provviso
174. Marxan stato calibrato ed eseguito 1000 volte 26 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 ed ha restituito la mappa della soluzione sommata che riporta la frequenza di selezione delle UP durante le esecuzioni e quindi rappresenta l importanza priorit di ciascuna UP per il raggiungimento degli obiettivi di conservazione La soluzione stata infine comparata con la zonazione attuale Risultati Le aree pi selezionate ai fini della conservazione in verde in Fig 1 sono localizzate principalmente nell attuale zona B 88 mentre le UP dell attuale zona A vengono scarsamente selezionate 5 Riguardo alle superfici interessate dallo studio emerge che posizionando opportunamente le zone A e B le misure di conservazione ad esse inerenti possono concentrarsi in 484 ha rispetto agli attuali 2011 ha Ottimizzando i costi di conservazione ricadrebbe quindi in zona C circa 183 dei 2920 ha complessivi dell AMP rispetto all attuale 27 Legenda AE terratinersa Risultati elaborazione MARXAN AE Non protetto AE Protetio Zonizazione AMP C zonaa J zonas C zona e wao awenn ULR Universita di Napoli Parthenope li so 7000 Milers Fig 1 Soluzione sommata elaborata con il MARXAN con zonazione dell AMP Summed solution developed with MARXAN and AMP zoning Conclusioni Lo studio condotto nell AMP di Ventotene e Santo St
175. NEREIS MASSILIENSIS MOQUIN TANDON ANNELIDA NEREIDIDAE A NEGLECTED SIBLING SPECIES OF PLATYNEREIS DUMERILII AUDOUIN amp MILNE EDWARDS PLATYNEREIS MASSILIENSIS MOQUIN TANDON ANNELIDA NEREIDIDAE UNA SPECIE CRIPTICA DIMENTICATA DI PLATYNEREIS DUMERILII AUDOUIN amp MILNE EDWARDS Abstract Specimens of the presumed nereidid polychaete species Platynereis dumerilii collected from the acidified areas of a CO vents system of Ischia Island when reared in laboratory conditions gave evidence on the occurrence of the sibling species Platynereis massiliensis This taxon has been neglected in our seas since it can be distinguished only by the reproductive habit and life history brooding semi direct development protandrous hermaphrodite With this work we wish to reappraise the presence of P massiliensis along the Italian coast and report a stable population off the coast of Ischia and its preliminary reproductive biology Key words Polychaeta sibling species reproductive biology ocean acidification Tyrrhenian Sea Introduction The Nereididae polychaete Platynereis massiliensis Moquin Tandon 1869 is the only known sibling species of Platynereis dumerilii Audouin amp Milne Edwards whose adult stage is identical but with a strongly different reproductive habit and life history P dumerilii in fact is gonochoric with heteronereid modification epitoky a single reproductive event in life free spawning and pelagic larva
176. Nella localit di Fautea 41 42 45 N 9 24 10 E spiaggia di modeste dimensioni prospezioni condotte nel 2008 non hanno confermato la presenza di 7 ugolinii rilevata invece in anni precedenti In questa localit vi stato un consistente aumento della frequentazione turistica nei mesi estivi Conclusioni L aggiunta delle localit sarde configura 7 ugolinii come un tipico endemismo sardo corso mentre l areale di distribuzione di S pelecaniformis appare limitato alle sole coste sarde Inoltre vari indizi sembrano indicare che come 7 saltator Ugolini et al 2008 Ugolini e Ungherese 2012 anche 7 ugolinii e probabilmente S pelecaniformis appaiono sensibili alla pressione turistica esercitata sulla fascia sopralitorale di coste sabbiose anche se tale fattore non spiega completamente la sostituzione fra specie Bibliografia BELLAN SANTINI D RUFFO S 1985 Une nouvelle esp ce de Talorchestia des cotes de Sardaigne Boll Mus Civ St Nat Verona 12 405 410 TAFANI B UGOLINI A BAZZICALUPO M MENGONI A RUFFO S 2004 Phylogenetic relationships among Mediterranean sandhoppers J Nat Hist 38 499 508 UGOLINI A FELICIONI S RUFFO S CIPRIANI L 1995 Distribution of Talorchestia ugolinii and other sandhoppers in Corsica Boll Zool 62 291 296 UGOLINI A UNGHERESE G 2012 Sandhoppers as Bioindicators of Anthropogenic Influence on Mediterranean Sandy Beaches In Stambler N ed Life in
177. O NORD OCCIDENTALE MEDITERRANEO CENTRALE Abstract The main behaviours affecting the daily variations in the group size of Stenella coeruleoalba in the Gulf of Taranto Northern Ionian Sea Central Mediterranean Sea were studied discussing its basic social organization in the area The focal group method was applied during 254 sightings of striped dolphin occurred in the area from 2009 to 2014 The number of specimens in group size significantly decreased from morning to early afternoon probably due to the shifting of behaviour from resting with larger aggregation of dolphins groups to feeding with dispersal of the groups on a larger area Key words behaviour striped dolphin Gulf of Taranto Northern Ionian Sea Mediterranean Sea Introduction This contribution represents a first study on the behaviours of Stenella coeruleoalba Meyen 1883 in the Gulf of Taranto Northern Ionian Sea Central Mediterranean Sea where the species is observed with a predictable distribution of sightings Dimatteo et al 2011 Fanizza et al 2014 suggesting the presence of a resident population with a high site fidelity and different behavior patterns In particular the main behaviours characterizing the daily variations in the group size of the striped dolphin were studied discussing the basic social organization of the species in the area Generally the group size in dolphins as well as in other marine or terrestrial mammals Sutherland 1996 was doc
178. P macrocephalus High density Z cavirostris 3 0 0 E 4 0 0 E 5 0 0 E 6 0 0 E 7 0 0 E 8 0 0 E 9 0 0 E 10 0 0 E 11 0 0 E 12 0 0 E Fig 1 Kernel density of plastic Densit Kernel delle plastiche Conclusions Results of the study highlight the importance of gathering simultaneous information on mega fauna and potential threat at multi annual scale necessary to confirm patterns The information collected within this network covering a wide area during all the seasons will definitely be an important step to identify sensitive areas needing focused mitigation measures References ARCANGELI A CASTELLI A MARINI L MOULINS A PALIAGA B TEPSICH P TRINGALI M 2013 A cooperative programme for cetacean monitoring over the Mediterranean Sea the example of the fixed transects monitoring network Biol Mar Mediterr 20 1 254 255 219 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 C FrorI J ALESSI A MANDICH C PAOLI P VASSALLO Dipartimento di Scienze della Terra dell Ambiente e della Vita DISTAV Universita di Genova Corso Europa 26 16132 Genova Italia 2MENKAB il respiro del mare Lungomare Matteotti 1 17100 Savona Italia cristina fiori unige it INDAGINE SUL POTERE ATTRATTIVO DELLE MONTAGNE SOTTOMARINE TIRRENICHE SU STENELLA COERULEOALBA ASSESSMENT OF TYRRHENIAN SEAMOUNTS ATTRACTIVENESS ON STENELLA COERULEOALBA Abstract
179. QIRAJ S KASHTA L KU I M KASEMI D MATO X GACE A 2008 Benthic macrofauna of Posidonia oceanica meadows in the Albanian coast Nat Montenegrina 7 2 55 69 CHESSA L A COSSU A 2012 Analisi ed interpretazione della cartografia biocenotica dell Isola Asinara nell ambito del progetto 4 A M P del Ministero dell Ambiente CoNiSMa Biol Mar Mediterr 19 1 96 99 LEDDA F D MANCONI R PRONZATO R 2014 Mariculture for bacterial and organic waste removal a field study of sponge filtering activity in experimental farming Aquac Res 45 1389 1401 PANSINI M 1970 Inquilinismo in Spongia officinalis Ircinia fasciculata e Petrosia ficiformis della Riviera Ligure di Levante Boll Mus Ist Biol Univ Genova 38 5 17 PANSINI M MANCONI R PRONZATO R 2011 Porifera I Calcarea Demospongiae partim Hexactinellida Homoscleromorpha Fauna d Italia Vol 46 Calderini Ed BO 554 pp PANSINI M PRONZATO R 1982 Distribuzione dell epifauna di una prateria di Posidonia dell isola di Ischia Napoli Poriferi Nat Sicil 4 6 Suppl 3 517 522 PANSINI M PRONZATO R 1985 Distribution and ecology of epiphytic Porifera in two Posidonia oceanica L Delile meadows of the Ligurian and Tyrrhenian Sea P S Z N I Mar Ecol 6 1 1 11 SIRIBELLI L 1963 Considerazioni sulla fauna di Poriferi delle praterie di Posidonia del Golfo di Napoli Ann Ist Mus Zool Univ Napoli 15
180. QUAID C D 2009 Larval supply and dispersal In Wahl M ed Hard bottom communities patterns dynamics diversity and change Springer New York 165 176 ROGNSTAD R L HILBISH T J 2014 Temperature induced variation in the survival of brooded embryos drives patterns of recruitment and abundance in Semibalanus balanoides J Exp Mar Biol Ecol 461 357 363 THOMAS M L H 1986 A physically derived exposure index for marine shorelines Ophelia 25 1 13 WATSON D I BARNES D K A 2004 Temporal and spatial components of variability in benthic recruitment a 5 year temperate example Mar Biol 145 201 214 61 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 E CASOLI M F GRAVINA A BELLUSCIO G D ARDIZZONE Dipartimento di Biologia Ambientale Universita di Roma La Sapienza Piazzale Aldo Moro 5 00185 Roma Italia edoardo casoli uniromal it Dipartimento di Biologia Universit di Roma Tor Vergata Via della Ricerca Scientifica 1 00173 Roma Italia POLICHETI SERPULIDAE ANNELIDA ASSOCIATI AL CORALLIGENO DELL ISOLA DEL GIGLIO TOSCANA SERPULIDAE POLYCHAETES ANNELIDA FROM CORALLIGENOUS CONCRETIONS FROM GIGLIO ISLAND TUSCANY Abstract Serpulidae polychaetes associated to coralligenous assemblages upon vertical walls 10 30 m depth have been studied along P ta del Lazzaretto Giglio Island Tuscany High species richness and
181. R EDWARDS D JEWELL O J D 2013 Gauging the Threat The First Population Estimate for White Sharks in South Africa Using Photo Identification and Automated Software PLoS ONE 8 6 doi 10 1371 journal pone 0066035 145 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 S MONTANINI E BENNI F BORSETTI M VALLISNERI Department of Biological Geological and Environmental Sciences BiGeA University of Bologna Via Selmi 3 40126 Bologna Italy Laboratory of Marine Biology and Fisheries of Fano University of Bologna Italy stefano montanini2 unibo it FIRST STUDY ON THE PROPERTIES OF THE ORGANIC MATRIX IN THE OTOLITHS OF SOME BONY FISH SPECIES PRIMO STUDIO SULLE PROPRIETA DELLA MATRICE ORGANICA DEGLI OTOLITI DI PESCI OSSEI Abstract The aim of the present study is to analyse the properties of the organic matrix from the otoliths of some bony fish species with the aim of investigating intra and inter specific differences in otolith biomineralization processes In the urea soluble fractions a unique large band around 50 55 kDa was observed in all samples Acid protein fractions were observed in two out of three species indicating that the organic matrix has different roles depending on species and the time of its formation Key words otolith protein matrix SDS page Silver staining Adriatic Sea Introduction Otoliths are calcium carbonate structures us
182. R S DE VREES L 2013 Marine litter within the European Marine Strategy Framework Directive ICES J Mar Sci 70 6 1055 1064 OSPAR Commission 2010 Guideline for monitoring marine litter on the beaches in the OSPAR maritime area ISBN 90 3631 973 9 UNEP 2009 Marine Litter A Global Challenge Nairobi UNEP 232 pp 130 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 POSTER COMITATO NECTON E PESCA 131 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 A ALLEGRA F ANDALORO M GRISTINA M SINOPOLI C N R LA M C UOS Mazara del Vallo Via L Vaccara 61 91026 Mazara del Vallo TP Italia alessandro allegra iamc cnr it I S P R A STS Palermo Via S Puglisi 9 90100 Palermo Italia UTILIZZO DI NUOVE TECNOLOGIE NELLA PESCA DELLA LAMPUGA CORYPHAENA HIPPURUS LINNAEUS 1758 LE FADs BOE USE OF NEW TECHNOLOGIES IN DOLPHINFISH FISHERY CORYPHAENA HIPPURUS LINNAEUS 1758 THE FADS BUOY Abstract The use of fish aggregating devices FADs in the dolphinfish fishery is a widespread practice in Sicily that use hundreds of FADs per boat FADs are moored in long rows from the coast towards several miles offshore In this work FADs equipped with echo sounder and global position system buoy have been used for the first time in Mediterranean Sea to analyze the possibility to decrease the number of FADs and
183. RAMMATI 7 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 G BAVESTRELLO S BAVA S CANESE R CATTANEO VIETTI S CERASI A PROFETA M BO Dipartimento di Scienze della Terra dell Ambiente e della Vita DISTAV Universit di Genova Corso Europa 26 16132 Genova Italia giorgio bavestrello unige it Area Marina Protetta Isola di Bergeggi AMP Via De Mari Bergeggi Italia Istituto Superiore per la Protezione e la Ricerca Ambientale ISPRA Via Vitaliano Brancati Roma Italia 3DISVA Universita Politecnica delle Marche Via Brecce Bianche Ancona Italia COMUNITA CORALLIGENE E PESCA PROFESSIONALE UNA SFIDA PER LA PIANIFICAZIONE TERRITORIALE MARITTIMA CORALLIGENOUS ASSEMBLAGES AND PROFESSIONAL FISHERIES A CHALLENGE FOR THE MARINE SPATIAL PIANNING Abstract The Mediterranean coralligenous communities are vulnerable ecosystems greatly sensitive to the changes of a broad range of environmental and anthropic variables In particular along the Italian coasts these communities are known to be subjected to major direct and indirect impacts from the fishing activities To protect these communities networks of in shore and offshore managed areas are urgently needed according to the supply side ecology principle and with an ecosystem based approach In this regards some efforts have been conducted both for coastal Marine Protected Areas and offshore fishing grou
184. RANEAN SEA QUANTIFICATION OF FEMALE REPRODUCTIVE PARAMETERS DEMOGRAFIA DEL TURSIOPE TURSIOPS TRUNCATUS MONTAGU 1821 NEL MAR MEDITERRANEO OCCIDENTALE QUANTIFICAZIONE DEI PARAMETRI RIPRODUTTIVI DELLE FEMMINE Abstract Reproductive parameters of females are essential to foster the conservation of cetaceans In the work here presented we analyzed photo identification data on female bottlenose dolphins in the Eastern Ligurian Sea to assess 1 nursery area 2 fertility rate the number of offspring produced by each female in one year 3 calving interval the time between two subsequent births Key words nursery area fertility rate calving interval individual life history Ligurian Sea Introduction The knowledge of female reproductive parameters is crucial to assess population survival probability and thus to formulate management and conservation plans The analysis of long term databases of photo identified individuals allows the estimate of these parameters Rossi et al 2014 The bottlenose dolphin Tursiops truncatus Montagu 1821 is one of the most well known cetaceans of the world however little demographic knowledge manly based on stranding data is available Stolen and Barlow 2003 Rossi et al in prep The aims of the present study are to identify nursery area and to estimate the fertility rate and the calving interval of the Eastern Ligurian Sea sub population Materials and methods We analyzed the data collected d
185. RCHARODON CARCHARIAS Abstract Studying the behaviour of the White Shark is a recent and big challenge Optimising the photoidentification of White Shark dorsal fins is a basic goal in order to compare behavioural information in both immature and mature specimens and between females and males During a 6 years research from 2009 to 2014 in South Africa we observed 296 sharks and 8 specimens were resighted several times Data about sex sizes environmental conditions and behaviours were collected This is the first step to develop a more complex database in which all the observed behaviors for each shark in different environmental conditions will be included Key words photoidentification dorsal fin behaviour Carcharodon carcharias Introduction The top predator Carcharodon carcharias widely distributed in the oceans has recently been the subject of extensive research concerning population dynamics genetic ecotoxicology and behaviour In particular in the last two decades many efforts were carried out in order to get more information about the behaviour Klimley et al 1996 Martin 2003 Micarelli et al 2006 Sperone et al 2010 of this vulnerable specie included in the IUCN red list This information could be useful to better plan the conservation of this species The possibility that the dorsal fin can be compared for a long time more than 22 years Anderson et al 2011 could represent a good tool to study single specimen
186. RE SEGNALAZIONE PER L ADRIATICO PERCNON GIBBESI H MILNE EDWARDS 1853 CRUSTACEA GRASPIDAE AN OTHER REPORTING IN THE ADRIATIC Abstract First record of the alien species Percnon gibbesi H Milne Edwards 1853 is reported for the coastal zone of Bari Italy During July 2014 one specimen was found at 0 8 m depth on rocky bottom during an environmental survey The new finding is the northernmost for the Adriatic Sea Key words Percnon gibbesi alien species new finding South Western Adriatic Sea Introduzione Il crostaceo decapode Percnon gibbesi H Milne Edwards 1853 specie di origine atlantica considerata aliena per il Mediterraneo Galil et al 2002 stato segnalato per la prima volta nei mari italiani nel 1999 nelle acque costiere di Linosa Relini et al 2000 Negli anni successivi la specie stata ritrovata lungo le coste della Sicilia Pipitone et al 2001 della Calabria ionica Faccia e Bianchi 2007 e dello Ionio salentino Crocetta e Colamonaco 2010 Licchelli et al 2011 Gennaio 2014 sino al Canale d Otranto Froglia e Marchini 2014 Katsanevakis et al 2011 indicano l isola di Saseno nelle acque costiere albanesi 40 29 30 N 19 16 50 E come limite settentrionale della distribuzione della specie nel bacino Adriatico Ionico Materiali e metodi Durante il mese di agosto 2014 nella zona costiera immediatamente a sud est della citt di Bari stato realizzato un rilievo subacq
187. ROGI A PANZALIS P PINNA S SATTA C SECHI N 2009 Distribuzione e densit della microalga bentonica Chrysophaeum taylori Lewis amp Bryan nell Area Marina Protetta di Tavolara Punta Coda Cavallo Biol Mar Mediterr 16 1 250 251 FRYXELL G A 1983 Survival strategies of the algae CUP Archive Cambridge 144 pp LEWIS I F BRYAN H F 1941 A new protophyte from the Dry Tortugas Am J Bot 28 4 343 348 LUGLI A SATA C PADEDDA B PULIN S SECHI N 2008 What is Chrysophaeum taylorii Lewis amp Bryan doing in Sardinia Tyrrhenian Sea Mediterranean Harmful Algae News 36 4 6 NOEL M H KAWACHI M INOUYE I 2004 Induced dimorphic life cycle of a coccolithophorid Calyptrosphaera sphaeroidea Prymnesiophyceae Haptophyta J Phycol 40 112 129 RUMI B CARONNI S PANZALIS P NAVONE A GHIANI A CITTERIO S 2012 Saggi finalizzati alla coltivazione in laboratorio della microalga bentonica Chrysophaeum taylorii Lewis amp Bryan Biol Mar Mediterr 19 1 267 268 SCHAFFELKE B HEIMANN K MARSHALL P A AYLING A M 2004 Blooms of Chrysocystis fragilis on the Great Barrier Reef Coral reefs 23 514 59 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 E CAPRUZZI E C LA MARCA G FRANZITTA M MILAZZO R CHEMELLO Dipartimento di Scienze della Terra e del Mare Universita di Palermo Via Archirafi 28 90123 Palermo Ita
188. Risultati Sono state identificate complessivamente 23 specie appartenenti a 12 famiglie 20 di queste sono state osservate nella zona a protezione integrale A 9 nella zona a protezione parziale B e 14 in CTL Le famiglie maggiormente rappresentate sono i labridi 6 specie e gli sparidi 5 specie Composizione e struttura dei popolamenti ittici differiscono significativamente nelle tre zone esposte a diversi livelli di protezione p 0 0001 In particolare dal pairwise test si riscontrano differenze significative tra zona A e B p 0 0034 tra zona B e CTL p 0 0025 e tra A e CTL p 0 001 Anche S ha mostrato differenze significative tra i tre livelli di protezione p 0 0057 In particolare dal pairwise test emerso che il valore medio di S della zona CTL 6 86 2 34 risulta significativamente maggiore rispetto alla zona A 3 83 1 7 p 0 006 e alla zona B 3 2 p 0 027 Non si registrano invece differenze nei valori di Max N tra le tre zone prese in esame Conclusioni Dai risultati ottenuti sono emerse differenze significative in composizione e struttura tra le tre zone a differente livello di protezione Diversamente da quanto si possa attendere i valori di S erano maggiori nella zona non sottoposta a vincoli di protezione In questa zona infatti stato registrato un numero medio di specie due volte superiore rispetto alle zone A e B dell AMP Questo risultato potrebbe suggerire una inefficace gestione dell AMP di Capo Gallo Iso
189. S project In Bertrand J A Relini G eds Demersal reosurces in the Mediterranean Proceedings of the Symposium held in Pisa 18 21 March 1998 IFREMER Actes de Colloques 26 76 93 BERTRAND J A GIL DE SOLA L PAPACONSTANTINOU C RELINI G SOUPLET A 2002 The general specifications of the Medits survey Sci Mar 66 Suppl 2 9 17 R CORE TEAM 2014 R A language and environment for statistical computing R Foundation for Statistical Computing Vienna Austria URL http www R project org STECF 2013 Assessment of Mediterranean Sea stocks Part I STECF 13 2 Scientific Technical and Economic Committee for Fisheries Publications Office of the European Union Luxembourg EUR 26329 EN JRC 86087 400 pp 143 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 P MICARELLI E SPERONE G GIGLIO J PECCHIA C ROMANO A SCUDERI L VESPAZIANI F MELE Centro Studi Squali Aquarium Mondo Marino Loc Valpiana 58024 Massa Marittima GR Italy centrostudisquali aquariummondomarino com Department of Ecology University of Calabria Arcavacata di Rende CS Italy Department of Marine Biology University of Pisa Pisa Italy DORSAL FIN PHOTOIDENTIFICATION TOOL FOR LONG TERM STUDIES OF WHITE SHARK CARCHARODON CARCHARIAS BEHAVIOUR FOTOIDENTIFICAZIONE DI PINNA DORSALE STRUMENTO PER STUDI DI LUNGO TERMINE SUL COMPORTAMENTO DI SQUALO BIANCO CA
190. SIcily i IORI D MIRRA M FORTI L PREVEDELLI D SIMONINI R Analisi preliminari sulla tossicit di essudati di Arenicola marina Linnaeus 1758 Annelida Arenicolidae i MANDICH A TRAVERSI I FERRARO M BONALDO M SIMONOT M PECORINO D MARADONNA F GALLO P MITA G CARNEVALI O Gill histopathology and enzymatic activity in seabream juveniles exposed to alkylphenols and bisphenol A Comtamined feedin ne aeee is vet heed solace E EE EEL EE AE Re nE RIZZUTO S CASINI S COPPOLA D GIANNETTI M FOSSI M C VAN WYK H SPERONE E TRIPEPI S MICARELLI P MARSILI L Biopsie cutanee per la valutazione dello stato Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 ecotossicologico del grande squalo bianco Carcharodon carcharias Linnaeus 1758 nil esse ea EN neni ii SACCO F MARRONE F LO BRUTTO S BESBES A NFATI A GATT M FIORENTINO F ARCULEO M Molecular diversity of dolphinfish Coryphaena hippurus shows the merging of endemic and widespread haplotypes in the Mediterranean Sea TROCCHIA S RABBITO D MADONNA A ABDEL GAWAD F KH GUERRIERO G CIARCIA G DNA barcoding e pleuronettiformi applicazione nel controllo delle frodi alimentari UGOLINI A CIOFINI A HOLTERS L PASQUALI V WILCOCKSON D C The role of antennae in the solar orientation of Talitrus saltator Montag
191. SPRA Chioggia VE Italia STATO TROFICO E STATO ECOLOGICO DELL AREA SETTENTRIONALE DELLA LAGUNA VENETA TROPHIC STATE AND ECOLOGICAL ASSESSMENT OF THE NORTHERN AREA OF THE VENICE LAGOON Abstract The concentrations of phosphorus and nitrogen in the water column and in surface sediments associated with the change in the macrophyte assemblages in 17 sampling sites have been employed to assess the trophic conditions and ecological status of the northern basin of the Venice Lagoon Key words Nutrient concentrations trophic status macrophytes Ecological assessment Venice Lagoon Introduzione L area settentrionale della laguna veneta in questi ultimi quarant anni ha subito rilevanti cambiamenti di trofia e conseguentemente dello stato ecologico Prima degli anni 80 tutta l area era colonizzata da vaste praterie di angiosperme acquatiche e da macroalghe di elevata valenza ecologica Successivamente tra gli anni 80 e 90 il bacino stato interessato da un aumento di nutrienti che ha favorito la proliferazione di alghe tionitrofiliche ad elevato accrescimento come Ulva e Gracilaria facendo regredire o scomparire del tutto le piante acquatiche Un importante contributo al degrado ambientale originato anche dalla distruzione dei fondali e dalla risospensione di sedimenti fini ad opera di attivit di pesca alle vongole filippine introdotte in laguna all inizio degli anni 80 Attualmente la situazione sta migliorando e
192. Serpulidi nelle biocostruzioni a coralli profondi del Mar Ionio Biol Mar Mediterr 16 1 44 45 63 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 G CHIMIENTI P MAIORANO F MASTROTOTARO Dipartimento di Biologia Universita di Bari Aldo Moro Via Orabona 4 70125 Bari Italia giovanni chimienti uniba it PENNATULA RUBRA FACIES IN THE IONIAN SEA CENTRAL MEDITERRANEAN FACIES A PENNATULA RUBRA NEL MAR IONIO MEDITERRANEO CENTRALE Abstract A facies of the endemic sea pen Pennatula rubra was recorded in the North western Ionian Sea Central Mediterranean during 3 MEDITS trawl surveys 2012 2014 A total of 943 colonies were sampled between 22 and 65 m in depth with a maximum density of 9492 colonies km at 63 m depth Key words Pennatula rubra Pennatulacea facies Mediterranean Sea Introduction Pennatula rubra Ellis 1761 is a sea pen endemic of the Mediterranean Sea Morri et al 2008 The presence of this species along Italian coasts is recorded in the Ligurian Sea in the Tyrrhenian Sea in the Messina Strait and the central Adriatic Sea Morri et al 1991 2008 Although P rubra is considered widespread on the circalittoral muds of the western Mediterranean Sea Ktikenthal amp Broch 1911 very few information on its distribution across the Mediterranean are available so far and no quantitative data are still reported in the literature The o
193. Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 antropica da sola non giustifica la sostituzione di una specie di talitri con un altra Infatti ripetute visite in localit corse in cui in anni precedenti era stata riscontrata 7 ugolinii hanno evidenziato cambiamenti nella densit di tale specie ma non la completa sostituzione Ad esempio nella localit tipo di Cateraggio d Aleria situata fra la foce del fiume Tavignano e lo sbocco a mare dello stagno di Diana nel 1988 la popolazione di talitri era costituita esclusivamente da 7 ugolinii nel 2009 tale specie era ancora presente con una buona non quantizzata densit di individui peraltro gi in sintopia con 7 saltator forse proveniente dalla spiaggia situata a sud oltre la riva destra del Tavignano Due visite compiute in gennaio ed in giugno 2010 hanno mostrato un notevole decremento nella densit di T ugolinii ed un contemporaneo incremento di 7 saltator in un rapporto di 1 20 1 30 in una proporzione francamente poco giustificabile alla luce delle normali fluttuazioni delle popolazioni di talitri da considerare che almeno per T saltator le attivit legate alla presenza di bagnanti calpestamento pulizia della spiaggia operata con mezzi meccanici etc influiscono in modo decisamente negativo sulla consistenza delle popolazioni di anfipodi ed altri artropodi sopralitorali fino a determinarne la scomparsa Ugolini et al 2008 Ugolini e Ungherese 2012
194. T T T T 0 4 0 32 0 24 0 16 0 08 o 0 08 0 16 0 24 0 32 Coordinate 1 Fig 1 Ordinamento ottenuto con nMDS indice di Bray Curtis stress 0 16 su dati di abbondanza nero Gaeta bianco Taranto quadrati luglio 2013 triangoli ottobre 2013 triangoli rovesciati gennaio 2014 ovali aprile 2014 nMDS ordination Bray Curtis index stress 0 16 on abundance data black Gaeta white Taranto squares July 2013 triangles October 2013 inverted triangles January 2014 circles April 2014 Conclusioni Le comunit osservate nei due ambienti oggetto di studio sono risultate sufficientemente diverse da distinguere completamente i campioni in due gruppi sulla base del sito di campionamento in particolare la netta separazione dei campioni della stagione estiva di Taranto pu essere spiegata con l elevata componente di specie aliene che stata osservata sui pannelli posti in acqua in questo periodo Ulteriori distinzioni sono state registrate su scala temporale in funzione della stagione di immersione in acqua dei pannelli tuttavia i campioni di Taranto e Gaeta mostrano pattern analoghi rispetto al secondo asse riconducibili ai periodi di reclutamento simili delle specie presenti in entrambi i siti La presenza di specie di potenziale impiego nella biorimediazione Licciano et al 2007 appare promettente per ulteriori indagini sulle comunit mature e sul loro ruolo di biofilter naturale in impianti di maricoltura Bibliografia ANGEL D L
195. TERTIDALE A VARIAZIONI DI pCO E TEMPERATURA PRELIMINARY ANALYSIS ON INTERTIDAL COMMUNITY EARLY RESPONSES TO CHANGES IN pCO AND TEMPERATURE Abstract Anthropogenic carbon dioxide CO emissions are increasing greenhouse effects leading to ocean warming and acidification To predict the effects of these changes on intertidal biofilm we conducted an in situ experiment to follow the process of biofilm recruitment and early succession on artificial substrata positioned along a shallow CO gradient at cold seep off Vulcano Island We manipulated temperature by building black and white frames on recruitment tiles We show that biofilm settlement and cover was significantly altered as CO2 concentration and temperature increase however these two stressors did not interact each other Key words biofilms climatic changes intertidal ecosystem Introduzione La principale conseguenza delle emissioni atmosferiche di CO di origine antropica l incremento dell effetto serra che sta conducendo al fenomeno del riscaldamento globale IPCC 2013 Una parte di queste emissioni viene sequestrata dagli oceani causando profondi cambiamenti nella chimica dei carbonati un processo noto come acidificazione degli oceani Caldeira e Wickett 2003 La temperatura ed il pH possono interagire fra loro inducendo cambiamenti nelle risposte delle comunit marine come ad esempio nella ricchezza specifica copertura percentuale e biomassa Questo studio si pr
196. TICO PASSIVO DI SCIAENA UMBRA IN UN ALLEVAMENTO DI MITILI DEL NORD ADRIATICO PASSIVE ACOUSTIC MONITORING OF SCIAENA UMBRA IN A MUSSEL FARM IN THE NORTHERN ADRIATIC SEA Abstract A passive listening survey was conducted in a mussel farm characterised by the presence of concrete structures on the bottom The area was located adjacent to the mouth of Sile river 1 nautical mile from the coast in the Venetian littoral zone The monitoring proved to be successful in detecting Sciaena umbra drumming sounds The distribution of the species was assessed on acoustic basis suggesting that the concrete artificial structures of the area may work as reproductive FAD for breeding aggregations of Sciaena umbra Key words passive acoustic Sciaena umbra mussels farm sound Northern Adriatic Sea Introduzione Le mitilicolture in mare aperto svolgono sia il ruolo di barriera anti strascico che di strutture per l aggregazione di specie ittiche Segvi Bubi et al 2011 Caratterizzate da strutture tridimensionali interdette alla pesca professionale le mitilicolture rappresentano potenziali aree di rifugio e riproduzione per le specie ittiche specialmente in un ambiente profondamente omogeneo e bidimensionale quale il bacino Alto Adriatico Segvi Bubi er al 2011 Al fine di testare la funzione di una mitilicoltura quale potenziale sito di riproduzione per specie tipiche di fondali coerenti stata valutata la presenza di vocalizzazioni di origi
197. V 103 181 MANCONI R 90 MANCUSI C 188 MANCUSO M 39 84 MANDICH A 202 220 MANFREDI P 228 MANGANO R 226 N N N MANGIALAJO L 103 MANNINI A 158 MANZO C 115 MARADONNA F 202 MARICCHIOLO G 39 MARINI C 222 235 MARINI L 218 MARRONE F 206 MARSILI L 204 MARTINIS 36 MASSA GALLUCCI A 98 MASSI D 84 142 198 MASTRANTONIO G 158 MASTROTOTARO F 64 66 MATARRESE A 66 MATRONE M 196 MAURIZIO D 45 MELE F 144 MENGONI A 188 212 MICARELLI P 144 160 204 MICCOLI SARTORI S 231 233 MICHELI C 36 MIKAC B 94 117 MILAZZO M 60 70 113 127 MIRAGLIUOLO A 226 MIRRA M 200 MIRTO S 117 MISTRI M 86 88 MITA G 202 MOCCIG A 181 MONTALBANO G 194 MONTANINI S 146 148 162 MORALES NIN B 148 MOSCHINO V 121 MOSETTI R 19 MOULINS A 226 MULAS M 32 MUNARI C 86 88 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 MUNTONI M 100 MURENU M 100 MUSCO L 80 94 117 196 MUSCOLINO D 41 MUSSAT SARTOR R 167 196 MUSSI B 226 N NARRACCI M 190 NAVARRA E 41 NAVONE A 34 58 105 NESCI S 47 NESTO N 121 NFATI A 206 NIGRA C 181 NISTRI A 212 NOVELLI A 45 NURRA N 167 NUTI S 222 226 228 0 OCCHIPINTI AMBROGI A 107 OLITA A 150 ORSI RELINI L 224 OSELLADORE F 123 OTTAVIANI E 103 P PACE D S 226 PADIGLIA A 90 PAGLIARANI A 47 PALA A 233 PALMAS F 150 154 PALMISANO M 138 PANETTA P
198. Via L Vaccara 61 91026 Mazara del Vallo TP Italia daniela massi iamc cnr it NEPTUNEA CONTRARIA LINNAEUS 1771 AND BUCCINUM UNDATUM LINNAEUS 1758 GASTROPODA BUCCINIDAE THANATOCOENOSIS IN THE STRAIT OF SICILY TANATOCENOSI A NEPTUNEA CONTRARIA LINNAEUS 1771 E BUCCINUM UNDATUM LINNAEUS 1758 GASTROPODA BUCCINIDAE NELLO STRETTO DI SICILIA Abstract The analysis of 973 benthic samples from the trawlable bottoms of the Strait of Sicily allowed to identify a thanatocoenosis characterized by the fossil gastropods Neptunea contraria and Buccinum undatum in a restricted area of the incoherent bottoms of the canyon on the western shoulder of the Adventure Bank This finding extends southernmost the known distribution area of these fossil species Benthic community living on thanatocoenosis showed a higher biodiversity than those found in areas without fossil shells Key words Neptunea contraria Buccinum undatum thanatocoenosis biodiversity Strait of Sicily Introduction Neptunea contraria Linnaeus 1771 and Buccinum undatum Linnaeus 1758 are boreal guest that occurred in Pleistocene sedimentary successions in the western Mediterranean N contraria is a left coiled gastropod that to date extends in Atlantic waters from the southern Biscay coast of France to Cape Spartel in Morocco B undatum is still living in the north eastern Atlantic Ocean and in the Mediterranean below 1000 m From the literature N contraria is
199. Video to describe fish relative abundance and diversity between sites at different protection levels The fish assemblages relative abundance and species richness significantly differed between the three different location A B e CTL considered The largest difference occurred at CTL site position outside the MPA where 2 fold increase in the number of species was recorded relative to the A and B sites Key words videotape recording fish marine parks Introduzione Molti studi hanno valutato l efficacia della tecnica BRUV per monitorare l abbondanza e la diversit dei popolamenti ittici all interno di Aree Marine Protette AMP Westera et al 2003 Willis et al 2003 L impiego dei BRUV presenta svariati vantaggi 1 capacit di campionare in modo non distruttivo rendendolo idoneo per il monitoraggio all interno di AMP 2 capacit di monitorare ambienti poco accessibili al tradizionale censimento visivo 3 bassi costi di utilizzo Dalle analisi delle immagini ottenute per mezzo dei sistemi BRUV possibile ottenere l abbondanza relativa la densit la struttura e composizione del popolamento ittico Stobart et al 2007 In questo studio la tecnica BRUV stata utilizzata per valutare l abbondanza relativa e la ricchezza specifica del popolamento ittico confrontando aree a differenti livelli di protezione di una AMP zona A B e un sito di controllo CTL non soggetto a vincoli di protezione Materiali e metod
200. a loro classificazione ecologica Northern lagoon with the sampling sites and their ecological assessment Adriatico settentrionale L applicazione del Macrophyte Quality Index MaQI Sfriso et al 2014 mostra condizioni ecologiche che variano da Poor presso la gronda lagunare a Moderate a nord ovest della Palude Maggiore fino a Good High a nord est dello stesso bacino con un incremento anche di due classi ecologiche rispetto ai valori rilevati nel 2011 Conclusioni L area settentrionale del bacino nord della laguna veneta presenta condizioni trofiche notevolmente inferiori a quelle rilevate all inizio negli anni 80 90 quando predominavano i blooms di alghe tionitrofile soprattutto nelle aree pi lontane dall influenza del fiume Silone Attualmente la ridotta disponibilit di fosforo sia nelle acque che nei sedimenti superficiali l elemento che maggiormente limita la crescita delle alghe tionitrofile e ci si riflette in un aumento delle condizioni ecologiche come rilevato anche dall applicazione dell indice MaQI Bibliografia ISPRA 2011 Protocolli per il campionamento e la determinazione degli elementi di qualit biologica e fisico chimica nell ambito dei programmi di monitoraggio ex 2000 60 CE delle acque di transizione In El Pr TW Protocolli Monitoraggio 03 06 ISPRA SFRISO A FACCA C BONOMETTO A BOSCOLO R 2014 Compliance of the Macrophyte Quality index MaQI with the WFD
201. a negligible way Our model depicting a strong biotic connection will help for a better understanding and management of sensitive areas such as Terra Nova Bay ASPA 161 and the Ross Sea References CCAMLR 2009 Report of the workshop on Vulnerable Marine Ecosystems La Jolla CA USA 3 to 7 August 2009 SC CAMLR XXVIII 10 CCAMLR Hobart Australia CHIANTORE M CATTANEO VIETTI R ALBERTELLI G MISIC C FABIANO M 1998 Role of filtering and biodeposition by Adamussium colbecki in circulation of organic matter in Terra Nova Bay Ross Sea Antarctica J Mar Syst 17 411 424 CHIANTORE M CATTANEO VIETTI R BERKMAN P A NIGRO M VACCHI M SCHIAPARELLI S ALBERTELLI G 2001 Antarctic scallop Adamussium colbecki spatial population variability along the Victoria Land Coast Antarctica Polar Biol 24 139 143 VACCHI M CATTANEO VIETTI R CHIANTORE M DAL M 2000 Predator prey relationship between the nototheniid fish Trematomus bernacchii and the Antarctic scallop Adamussium colbecki at Terra Nova Bay Ross Sea Antarct Sci 12 1 64 68 69 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 I DOMINA R CHEMELLO C ALESSI M TOCCACELI M MILAZZO Dipartimento di Scienze della Terra e del Mare DiSTeM Universit di Palermo Via Archirafi 28 90123 Palermo Italia dominailenia gmail com ANALISI PRELIMINARE DELLE RISPOSTE DELLA COMUNITA IN
202. ab 1 Tab 1 Confronto dell indice di incontro per le specie di cetacei nelle zone A e B Cetacean encounter rate comparison in A and B Bp Dd Gg Pm Sc Tt Zc totale ER 0 001552 0 0003581 0 000955 0 000836 0 019637 0 0000597 0 003044 0 026441 N avv 26 6 16 14 329 1 51 443 ER 0 000988 0 000165 0 0 002306 0 011528 0 000988 0 001153 0 017128 N avv 6 1 0 14 70 6 7 104 La specie che complessivamente presenta il pi alto indice di incontro la stenella con valori di ER pari a 0 019637 e 0 011528 rispettivamente nella zona con i canyon e in quella extra canyon L analisi statistica ha evidenziato differenze altamente significative per stenella preferenza per zona canyon p lt 0 001 e capodoglio preferenza per zona extra canyon p lt 0 01 Sono risultate differenze significative per zifio e grampo preferenza per zona canyon p lt 0 05 mentre per la balenottera non risultano differenze significative Per le altre specie il numero di campioni insufficiente per un approfondimento statistico Conclusioni L area si rivela nel suo complesso come un interessante campo d indagine per lo studio dei cetacei come denota l osservazione di 7 delle 8 specie considerate regolarmente presenti nel Santuario Pelagos Notarbartolo di Sciara et al 2008 Lo studio ha fornito risultati attesi come la preferenza dello zifio per la zona dei canyon Tepsich et al 2014 assieme ad altri inattesi Nel caso della stenella specie
203. acteriology Vol 1 Williams amp Willkins Baltimore 516 548 NOGUEROLA I BLANCH A R 2008 Identification of Vibrio spp with a set of dichotomus keys J Appl Microbiol 105 175 185 191 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 S CARACAPPA S REALE M COSENZA A GENTILE M F PERSICHETTI M ARCULEO Istituto Zooprofilattico della Sicilia Via G Marinuzzi 3 90129 Palermo Italia mfpersichetti gmail com Dipartimento STEBICEF Universit di Palermo Via Archirafi 18 90123 Palermo Italia VARIABILITA DEL NUMERO DI PIASTRE DEL CARAPACE DI CARETTA CARETTA LINNAEUS 1758 RECUPERATE IN SICILIA CARAPACIAL SCUTE VARIATION IN CARETTA CARETTA LINNAEUS 1758 RESCUED IN SICILY Abstract The carapacial scutes of 23 Caretta caretta collected from different area of the Sicily were examined Three individuals presented a different combination of prefrontal costal vertebral and inframarginal scutes making difficult the assignment to the species Caretta caretta A 243 bp sequence of the mitochondrial cytochrome b gene was used to support morphological identification Some differences between the morphological characters and genetic sequences were observed suggesting to upgrade the criteria used for the identification of species Key words scute variation Caretta caretta Sicily Introduzione Caretta caretta Linnaeus 1758 tra le tartarughe marine la
204. acterization of vermetid bioconstructions complexity of aggregates and patterns of D petraeum colonization along a depth gradient upper mesolittoral low mesolittoral and infralittoral zones Materials and methods The study was carried out on shallow rocks located around Licosa island 40 15 N 14 54 E that presents two sides differently exposed to wave conditions Using a tape measure the total length of the vermetid reefs was obtained The hard substrate at the reef base is artificial ancient roman walls in the northernmost part and natural sedimentary rocks named Flysch in the remaining parts of island In these two sites namely RW and RF respectively the length of reefs was measured In addition 10 random measurements of the reefs width and vertical extension were recorded The complexity value was calculated as the relation between the effective and the linear length of the outer edge of reefs at RW and RF and on non colonized Flysch F control site and then statistically analysed by Student s t test In addition the maximum diameter in cm of 20 random small aggregates was measured all around the island Vermetid density was analysed in both sites and for each of the three zones within a frame of 10x10 cm random photographic replicates For each picture the shell apertures of D petraeum were counted Density data were analysed using one way ANOVA to test the differences between RF and RW and the colonization pattern
205. ages from 8 sites in the Adriatic Sea have been analyzed to understand whether the dynamics of coastal zooplankton assemblages is driven only by local environmental conditions or if it is influenced by basin circulation Cross correlation between time series has been evaluated by means of Mantel statistics shifting the series relative to each other with a weekly time lag Our results revealed that maximum cross correlation occurs when time series are shifted according to their position along the coastline with the southmost series lagged by one or two weeks This pattern suggests that dynamics of zooplankton assemblages is clearly affected from the general circulation pattern in Adriatic Sea Key words zooplankton general circulation Adriatic Sea community structure Introduzione L Adriatico una delle aree pi produttive del Mediterraneo caratterizzato soprattutto nella sua parte settentrionale da consistenti immissioni di acque interne dalla costa occidentale fra le quali la pi importante la foce del fiume Po Quest ultima genera un ampia plume che fa s che la produzione di biomasse fito e zooplanctoniche sia tra le pi rilevanti del bacino Benovi et al 1984 Fonda Umani et al 2010 La circolazione generale dell Adriatico ha un andamento abbastanza costante nel corso dell anno La massa d acqua fluisce in senso antiorario dalla costa dalmata verso quella italiana intercettando la plume del Po e trasportandola
206. aggior parte delle persone rispetto a quella degli ambienti tropicali Quindi dopo anni di studio nell ambito della biologia marina abbiamo pensato di realizzare l applicazione gratuita Pinneggiando per rendere pi fruibile ad esperti e non il mondo marino e in particolare quello delle coste italiane Materiali e metodi L App Pinneggiando stata realizzata per smartphone e tablet che utilizzano la piattaforma Android La base scientifica di riferimento della App rappresentata da Bianchi 2004 per ci che concerne la suddivisione dei mari italiani in nove settori biogeografici e dalla Check list della flora e della fauna dei mari 196 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 italiani Relini 2008 2010 per la distribuzione degli organismi marini La classificazione delle specie segnalate fa affidamento alle conoscenze di alcuni colleghi tassonomi Pinneggiando stata concepita in modo da identificare automaticamente puntando il dispositivo portatile verso il mare il settore biogeografico in cui ci si trova Inoltre stata realizzata un apposita interfaccia per la selezione manuale del settore anche senza doversi trovare in prossimit del mare Per ogni settore vengono visualizzati 1 taxa presenti dalle alghe ai mammiferi con fotografie e informazioni habitat distribuzione geografica ecc La versione attualmente scaricabile dell App comprende
207. ait of Sicily GSA 16 an area subject to intense and varied human pressure with relative systemic impacts on coastal and marine environment Materials and methods Quantitative data on marine litter were collected during the MEDITS survey carried out in GSA 16 in 2013 A total of 120 stations were sampled All solid debris present in the catches were collected and classified according to macro categories and categories defined in the MEDITS Protocol Anonymus 2013 The number of items in each category was standardized to 1 km N km Results and conclusions A total of 619 items of marine litter were collected in the whole area distributed in 87 of the sampled stations Overall the estimated mean density was 66 N km being 51 N km the mean density in the macro stratum 10 200 m and 79 N km in the depth range 201 800 m Fig 1 shows the percentage of abundance of the 9 MEDITS macro categories Plastic was the most abundant category 55 followed by Metal 17 and Glass Ceramic 9 It is worth noting the category Other which accounted for 10 of the total litter recorded Many items of this category are constituted by limestone blocks mazzare frequently found in the area Bianchini and Ragonese 1999 because they are used as mooring weights for the fish aggregating devices FADs in the traditional dolphinfish Coryphaena hippurus fishery They are tied to very long synthetic ropes which constitute another rel
208. al 1970 Sono ora in corso ricerche per valutare la presenza di arenicocromo e il suo ruolo nel determinare la tossicit dell essudato colorato di A marina Bibliografia DALES R P 1963 Pigments in the skins of the Polychaetes Arenicola Abarenicola Dodecaceria and Halla Comp Biochem Physiol 8 99 108 FAUVEL P 1927 Faune de France 16 Polych tes s dentaires Paul Lechavalier Paris 494 pp HARDEGE J D BENTLEY M G SNAPE L 1998 Sediment selection by juvenile Arenicola marina Mar Ecol Progr Ser 166 187 195 IORI D FORTI L MASSAMBA N SIALA G PREVEDELLI D SIMONINI R 2014 Toxicity of the purple mucus of the polychaete Halla parthenopeia Oenonidae revealed by a battery of ecotoxicological bioassays Sci Mar 78 4 589 595 MORIMOTO I SHAIKH M I N THOMSON R H WILLIAMSON D G 1970 The structure of arenicochromine a trihydroxymethoxybenzpyrenequinone from Arenicola marina J Chem Soc Chem Commun 9 550 551 201 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 A MANDICH I TRAVERSI M FERRARO M BONALDO M SIMONOT D PECORINO F MARADONNA P GALLO G MITA O CARNEVALI Dipartimento di Scienze della Terra dell Ambiente e della Vita DISTAV Universita di Genova Corso Europa 26 16132 Genova Italia 7INBB Consorzio Interuniversitario Biosistemi e Biostrutture Roma Italia mandich
209. al 2011 and slightly higher than that observed in 1993 by Mariem 29 30 mm in the Gulf of Gab s These differences might be ascribed to different estimation methods applied and or to the geographical differences 20 F n 1397 15 M n 1643 10 x 5 0 16 21 26 31 36 41 46 51 56 61 CL mm Fig 1 Carapace length frequency distribution of M kerathurus Distribuzione di lunghezza carapace di M kerathurus PENA KER females m 2b n 27 2c n 16 or FEMALE m 2d n 10 m 2e n 618 100 a 90 2 80 da 70 5 S 60 E 50 g S 40 5a aoe 5 525 7 20 P Wee 2710 0188 10 Sr 0 Li I 20 30 40 50 60 1 n 19 2 n 20 Quarter 3 n 30 4 n 602 lengxmm Fig 2 Female quarterly maturity stage composition n 671 and maturity ogive of M kerathurus Percentuali degli stadi di maturit e ogiva di maturit per femmine n 671 di M kerathurus References CONIDES A GLAMUZINA B DULCIC J KAPIRIS K JUG DUJAKOVIC J PAPACONSTANTINOU C 2008 Study of the reproduction of the Karamote shrimp Penaeus Melicertus kerathurus in Amvrakikos Gulf western Greece Acta Adriatica 49 2 97 106 FROGLIA C SCARCELLA G LUCCHETTI A 2013 On the recent increase of Penaeus Melicertus kerathurus stock in the Northern and Central Adriatic Sea possible explanations Rapp Comm Int Mer M dit 40 780 ICES 2008 Report of Workshop on Maturity Ogive Estimation fo
210. albot and Ante Talbot Banks These banks are eroded and fault affected structural highs where rocky substrata crop out with a thin sedimentary cover of poor sorted muds 84 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 biocalcarenites with reworked faunal assemblages late Pleistocene in age are found scattered along the western sides of the banks Colantoni ef al 1985 The thanatocoenosis includes a third buccinidae B humphreysianum with empty shells another boreal guest still surviving in few districts of the western Mediterranean such as the northern border of the Skerki Bank The comparison of specific richness within the depth range 200 300 m showed that number of living species in the thanatocoenosis is higher 10 hauls with min 7 median 23 max 32 than in the other hauls 45 hauls with min 3 median 12 max 30 Moreover although most of characteristic species of biocoenoses belongs to bathyal mud in the whole examined depth range VP 2 Annelida 16 Arthropoda 4 Cnidaria 8 Echinodermata 4 Mollusca 1 Porifera 1 Tentaculata hauls with fossil shells showed an higher occurrence of characteristic taxa of detritic biocoenosis DC DL DE 3 Annelida 2 Arthropoda 3 Cnidaria 9 Echinodermata 6 Mollusca 1 Tentaculata 2 Tunicata The species found more frequently in these hauls were the Mollusca Gastropoda B humphreysianum Euspira fusca Galeodea ech
211. alermo Italia sebastiano calvo unipa it L IMPIEGO DI STRUMENTI ACUSTICI AD ALTA RISOLUZIONE NELLA VALUTAZIONE MONITORAGGIO E GESTIONE DELLE PRATERIE DI POSIDONIA OCEANICA ASSESSMENT MONITORING AND MANAGEMENT OF POSIDONIA OCEANICA MEADOWS BY HIGH RESOLUTION SONAR SYSTEMS Abstract High resolution sonar system MBS SSS SBP can be used for mapping and monitoring Posidonia oceanica meadow and its structures allowing to discriminate P oceanica from sandy substrata by automatic classification to estimate extension and volume of the matte and to perform large scale control of progressive lower limit Key words P oceanica lower limit MBS SSS SBP mapping bottom classification Carbon reserve Introduzione Gli strumenti acustici ad alta risoluzione Multibeam Side Scan Sonar Sub Bottom Profiler etc fonte primaria di informazione per ricerche geologiche marine trovano anche applicazione nel campo della ricerca in ambito biologico e rappresentano potenti strumenti per la valutazione il monitoraggio e la gestione degli ambienti marini costieri Si presentano di seguito alcune applicazioni in ambito biologico di strumenti acustici ad alta risoluzione MBS SSS SBP con particolare riferimento alle praterie di Posidonia oceanica ed alle sue formazioni matte Mappatura di P oceanica con Multibeam Il sistema multibeam MBS ampiamente considerato come uno degli strumenti pi potenti per rappresentare con tecniche di ri
212. aluated through acute toxicity bioassays on the annelid Dinophilus gyrociliatus Preliminary chemical analyses were also performed The exudate and its n buthanol extract were toxic LCs0 24n 12 c i 9 7 14 7 and 31 7 mg II c i 27 9 36 mg r respectively The results support the hypothesis that the exudate could be involved in the chemical defence of A marina Keywords chemical defence Arenicola marina marine annelids ecotoxicology exudates Introduzione Arenicola marina Linnaeus 1758 un anellide fossorio che vive in fondi molli di zone intertidali particolarmente abbondante lungo le coste atlantiche dell Europa occidentale mentre in Mediterraneo presente nelle lagune dell Alto Adriatico Fauvel 1927 In seguito a stimolazione meccanica A marina emette un fluido giallo Dales 1963 che potrebbe rappresentare una difesa chimica mirata a limitare l insediamento di larve di potenziali competitori nei sedimenti colonizzati da A marina Hardege et al 1998 I saggi ecotossicologici si sono rivelati un utile strumento per studiare le difese chimiche dei policheti lori et al 2014 In questo lavoro stata valutata l attivit biologica dell essudato prodotto da A marina attraverso saggi ecotossicologici sul polichete Dinophilus gyrociliatus Schmidt 1857 che ben rappresenta piccoli invertebrati e larve individui giovanili che potrebbero entrare in contatto con l essudato D gyrociliatus inoltre pu ess
213. amente quella a cui si presta meno attenzione e su cui si investono meno risorse in Italia come in Europa ed in Europa come nel resto del mondo Nella cronica assenza di dati sufficienti non un caso che alcune forme surrogate di informazione godano di una sempre maggiore popolarit Ad esempio le applicazioni 5 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 di habitat modelling o niche modelling o altro ancora la terminologia non del tutto matura sono sempre pi numerose anche grazie allo sviluppo di metodi efficienti soprattutto mutuati dal campo del machine learning e di pacchetti software di uso molto semplice che mettono questo tipo di attivit alla portata di chiunque voglia cimentarsi in questo campo Questa tendenza non avrebbe nulla di negativo in s se non fosse per il fatto che oggi nel suo complesso lo sviluppo di modelli quasi sempre pi intenso dell acquisizione dei dati su cui i modelli stessi si poggiano Inoltre pu succedere che chi sviluppa modelli soprattutto se utilizzando pacchetti software chiusi ignori o trascuri problemi metodologici che sono invece ecologicamente rilevanti o sottovaluti il peso di questioni ecologiche che richiederebbero approcci metodologici adeguati Un esempio tipico di questo problema sta nella valutazione dell effetto delle scale spaziali e o temporali a cui si considera un fenomeno sulla nostra reale capaci
214. an overall low impact on the environment The nets also resulted highly size selective on the target species since only specimens above MLS were caught These aspects together with the economic importance at local scale can provide robust evidences to implement specifically oriented management measures which could ensure the regulated activity of these fisheries References EC 1992 Council Regulation n 345 92 of 27 January 1992 Official Journal of the European Communities L 42 15 23 EC 2007 Council Regulation n 809 2007 of 28 June 2007 Official Journal of the European Communities L 182 1 2 SARTOR P COORD 2014 Identification and characterisation of the small scale fisheries in Mediterranean DRIFTMED Specific Contract n 8 under the EU MAREA Framework MARE 2009 05 Lot 1 Draft Final report The study was MARE 2009 05 Lot 1 supported by the EU Contract 157 DRIFTMED EU MAREA Framework Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 M SBRANA F COLLOCA A LIGAS A MANNINI G MASTRANTONIO P SARTOR F SERENA Centro Interuniversitario di Biologia Marina ed ecologia applicata CIBM Viale N Sauro 4 57128 Livorno Italy sbrana cibm it TAMC CNR Mazara del Vallo TP Italy 2DISTAV University of Genoa Italy University of Rome La Sapienza Italy 4ARPAT Area Mare Livorno Italy ABUNDANCE
215. an sea s7 0 021 p 0 696 Per 0 002 p 0 498 Conversely the comparison among the Mediterranean sea and oceans showed a sharp separation cr 0 115 p 0 036 The pairwise sr confirmed the differences occurring among each of the sub basins of Mediterranean Sea vs the Atlantic Ocean Tyrrhenian Sea sr 0 062 Sicilian Channel and Ionian Sea s7 0 117 Adriatic Sea sr 0 058 p lt 0 05 AMOVA revealed a significant difference between the Indo pacific Ocean the Mediterranean Sea and the Atlantic Ocean respectively y7 0 077 0 167 p lt 0 05 Conclusions Though connection with the Atlantic Mediterranean dolphinfish samples seem to maintain a degree of isolation which preserve an endemic gene pool Current genetic diversity of Mediterranean dolphinfishes is probably the result of a vicariance event followed by a secondary contact between Mediterranean and Atlantic populations Our study shows the absence of a sharp molecular structuring of the species in the western and central Mediterranean basin basin as commonly scored in other species Lo Brutto et al 2004 Maggio et al 2009 Acknowledgements We are grateful to FAO MEDSUDMED and FAO COPEMED II projects to Dr J Caminas IEO Malaga Dr E Massuti IEO Palma de Mallorca Dr F Grati SMAR CNR Ancona and Dr P Psomadakis FAO FIRF for help in collecting samples References DIAZ JAIMES P URIBE ALCOCER M ROCHA OLIVARES A GARCIA DE LEON F J NORTMOON P DURAND J D 2010
216. ana di Biologia Marina Roma 10 12 giugno 2015 M L BIANCHINI S RAGONESE Istituto per l Ambiente Marino Costiero IAMC Consiglio Nazionale delle Ricerche CNR Via L Vaccara 61 91026 Mazara del Vallo TP Italia bradipo50 yahoo com ASPETTI BIOLOGICI ED ALIEUTICI DELLA BOGA BOOPS BOOPS LINNAEUS 1758 NELLO STRETTO DI SICILIA BIOLOGY AND FISHERY TRAITS OF THE BOGUE BOOPS BOOPS LINNAEUS 1758 IN THE STRAIT OF SICILY Abstract The density indices number and weight of the bogue Boops boops in the Strait of Sicily have been assessed in the years 1994 2009 moreover in the 2006 2009 some biological traits such as the sex ratio sizes at maturity length weight relationships and growth parameters have been estimated too Key words bogue Boops boops biology fishery Strait of Sicily Introduzione La boga Boops boops Linnaeus 1758 uno sparide gregario diffuso in tutto il Mediterraneo e l Atlantico settentrionale Froese e Pauly 2014 su ogni tipo di fondo da 0 a 350 m ma specialmente nella zona della piattaforma superiore Relini et al 1999 la taglia pu superare i 40 cm LT ma pi comune intorno ai 10 25 cm LT Bauchot e Hureau 1986 la specie gonocorica generalmente considerata proterogina con basse presenze di ermafroditismo Bottari et al 2014 Nonostante il modesto valore commerciale le quantit sbarcate in Italia sono importanti intorno a qualche migliaio di tonnellate
217. and all these environments are very rich in pabulum For C caretta the Mar Piccolo may represent a feeding site www tartalife eu since specimens were observed among mussel farming plants eating fouling settled on mussel cultivation socks These findings of sea turtles in the Mar Piccolo could also be linked to the natural bettering of the environmental conditions and they must be taken into account in the framework of the recovery plans of some polluted areas A specific research is going to be planned to study the population of the loggerhead sea turtle in the Mar Piccolo References BENTIVEGNA F 2002 Intra Mediterranean migrations of the loggerhead sea turtles Caretta caretta monitored by satellite telemetry Mar Biol 141 795 800 MAGAZZINO M 2014 Attivisti tarantini accudiscono e proteggono uova di Caretta caretta si attende la schiusa Grottaglie 24 www grottaglie24 it 201408271692 notizie ambiente e territorio 1692 attivisti tarantini accudiscono e proteggono uova di caretta caretta si attende la schiusa html Consultato il 05 02 2015 MO G MONTALTO F SERANGELI M T DUPR E 2013 Linee guida per il recupero soccorso affidamento e gestione delle tartarughe marine ai fini della riabilitazione e per la manipolazione a scopi scientifici ISPRA Manuali e Linee Guida 89 72 pp NOVARINI N MIZZAN L VERZA E VIANELLO C 2009 Segnalazione di tartarughe marine in laguna di Venezia e lungo le coste venet
218. and Guillou 2007 The understanding of reproductive cycle features could be crucial to ensure a sustainable harvesting of this species also considering that differences in gonad growth in populations separated even by relatively short distances have been reported Byrne 1990 Lozano et al 1995 Guettaf et al 2000 Our aim was to determine the reproductive cycle of P lividus at two areas of Sardinia in order to establish the time and duration of spawning and to preliminarily underline the main features in gonad growth and development which could be useful in the management of the fishery Materials and methods Reproductive cycle was monitored by the gonad index method and histological examination of gonads From June 2013 to May 2014 874 sea urchins of commercial size diameter gt 50 mm without spines were collected from two coastal areas where populations are subjected to different levels of harvesting pressure Su Pallosu HP high harvesting pressure along the western coast and Tavolara Punta Coda Cavallo Marine Protected Area LP low harvesting pressure in the northeastern coast of Sardinia Gonadosomatic index GSI was assessed as gonad wet weight total wet weight x100 Histological examination was done on a fraction of the total sample 226 individuals After the extraction gonads were preserved in formalin dehydrated embedded in paraffin sectioned at 7 um stained with hematoxylin eosin and observed in light microscopy The
219. and operate close to the coast The target species dominated the caught biomass from 70 to 100 the by catch was relevant only for the sgomberara and mostly constituted by bullet tuna Discard was always scarce the not authorised species were rare and the protected ones were not observed The catch of target species was composed entirely by specimens greater than the size at first sexual maturity and larger than the Minimum Landing Size MLS The average length of the menaide nets was always lt 500 m the maximum length was observed for the ferrettara in GSA10 2400 m The mesh size of the menaide ranged from 20 to 30 mm for the other nets from 70 to 90 mm 156 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Tab 1 Summary of the characteristics of the SSD fisheries in Italy Sintesi delle caratteristiche della pesca con piccole reti derivanti in Italia Fishery Area Local name Target species Fishing period N of vessels N fishermen Annual fishing days avg by boat Avg mesh size Avg net length Total catches Composition of the catch in weight Main by catch species Fishery Area Local name Target species Fishing period N of vessels N fishermen Annual fishing days avg by boat Avg mesh size Avg net length Total catches Composition of the catch in weight Main by catch species 1 2 GSA 19 E Sicily GSA
220. ando le metodiche sopra citate Risultati stata evidenziata una forte tossicit del germicida in vitro sugli emociti sia a livello morfologico sia funzionale a concentrazioni molto inferiori a quella utilizzata per il trattamento in vivo Il germicida infatti mostra una LCs di 600 ppm sugli emociti e gi a 100 ppm induce diminuzione dei tioli e aumento della perossidazione lipidica riconducibile a stress ossidativo come era da attendersi in base alle caratteristiche del germicida che sviluppa H20 e ClO in soluzione acquosa Nelle prove in vivo gli animali T non hanno mostrato mortalit diversa da C Nell ambito di ciascuna prova indipendentemente dal periodo stagionale stata evidenziata una sostanziale costanza dei TBARs e una sovrapposizione degli spettri dei VOC nei tessuti eduli delle vongole T e C Conclusioni Il duplice approccio in vitro e in vivo consente di abbozzare un quadro anche se preliminare degli effetti del germicida sulla specie in esame Negli esperimenti di tossicit acuta in vitro le caratteristiche di forte ossidante del germicida si riflettono chiaramente su alterazioni funzionali significative degli emociti D altra parte il trattamento germicida in vivo ripetuto in periodi diversi non modifica la mortalit n induce variazioni riferibili all ossidazione e quindi apparentemente non incide sulle qualit organolettiche del prodotto aspetto fondamentale in vista di una commercializzazione Per compr
221. anean fin whale Balaenoptera physalus what clues can be obtained from photo identification data Theoretical Biology Forum 107 1 2 123 142 STOLEN M K BARLOW J 2003 A model life table for bottlenose dolphins Tursiops truncatus from the Indian River Lagoon system Florida U S A Mar Mammal Sci 19 4 630 649 TEZANOS PINTO G COSTANTINE R MOURAO F BERGHAN J SCOTT BAKER C 2014 High calf mortality in bottlenose dolphins in the Bay of Islands New Zealand a local unit in decline Mar Mammal Sci 31 2 540 559 doi 10 1111 mms 12174 WURSIG B JEFFERSON T A 1990 Methods of photo identification for small cetaceans Rep Int Whal Common 12 Special Issue 43 52 229 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 POSTER 230 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 R CARLUCCI P RICCI S MICCOLI SARTORI G CIPRIANO A COSENTINO A LIONETTI C FANIZZA Department of Biology University of Bari Via Orabona 4 70125 Bari Italy roberto carlucci uniba it Jonian Dolphin Conservation Viale Virgilio 102 74121 Taranto Italy CHANGES IN BEHAVIOUR AND GROUP SIZE OF STENELLA COERULEOALBA IN THE GULF OF TARANTO NORTHERN IONIAN SEA CENTRAL MEDITERRANEAN SEA VARIAZIONI NEL COMPORTAMENTO E NELLA NUMEROSIT DEI GRUPPI DI STENELLA COERULEOALBA NEL GOLFO DI TARANTO MAR IONI
222. ant CLS was prepared according to Arizza et al 2013 Rabbit RE and sheep SE erythrocytes were gently provided by the Istituto Zooprofilattico della Sicilia A Mirri Palermo Italy The coelomocytes cytotoxic assay CCA vs erythrocytes was examined according to Arizza et al 2007 The hemolysis degree was evaluated following the formula Hemolysis degree O D measured release O D T spontaneous release O D Complete release O D T spontaneous release x 100 Results H tubulosa coelomocytes and their CLS showed a clear cytotoxic activity against RE SE Fig 1 The cytotoxic activity was able to lyse targets both in presence and in absence of calcium divalent cation As shown in Fig 1 the assay with rabbit or sheep erythrocytes revealed that the haemolytic degree increased depending on the ET ratio and reached the maximum value 95 at a 1 8 1 16 ratios Significantly lower values were observed at 1 128 1 256 ratios where the media supplemented with EDTA 214 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 100 80 60 age AWN Hemolysis degree Hemolysis degree y g 8 40 20 0 0 1 256 1 128 1 64 1 32 1 16 1 8 1 256 1 128 1 64 1 32 1 16 1 8 E T ratio E T ratio a b a 120 100 ee ee 100 80 ee 8 3 2 80 f 60 3 60 40 2 40 20 2 20 E o E 0 T 2 5 5 10 20 40 80 Sa 2 5 5 10 20 40 80 Protein concentration ug
223. ar Biol 102 425 429 HESSLER R LONSDALE P HAWKINS J 1988 Patterns on the ocean floor New Scient 24 47 51 MARTIN W BAROSS J KELLEY D RUSSELL M J 2008 Hydrothermal vents and the origin of life Microbiology 6 805 814 PANSINI M MORRI C BIANCHI C N 2000 The sponge community of a subtidal area with hydrothermal vents Milos Island Aegean Sea Estuar Coast Shelf S 51 627 635 TARASOV V G GEBRUK A V MIRONOV A N MOSKALEV L I 2005 Deep sea and shallow water hydrothermal vent communities two different phenomena Chem Geol 224 5 39 TARASOV V G GEBRUK A V SHULKIN V M KAMENEV G M FADEEV VI KOSMYNIN V N MALAKHOV V V STARYNIN D A OBZHIROV A I 1999 Effect of shallow water hydrothermal venting on the biota of Matupi Harbour Rabauls Caldera New Britain Island Papua New Guinea Cont Shelf Res 19 79 116 57 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 C CALABRETTI A GHIANI A NAVONE S CITTERIO S CARONNI Dipartimento di Scienze della Terra e dell Ambiente Universita di Pavia Via S Epifanio 14 27100 Pavia Italia chiara calabretti gmail com Dipartimento di Scienze dell Ambiente e del Territorio Universit di Milano Bicocca Milano Italia Area Marina Protetta Tavolara Punta Coda Cavallo Olbia Italia PRIME OSSERVAZIONI SUL CICLO VITALE DEL CEPPO MEDITERRANEO DELLA MI
224. as been calculated The experiment was repeated twice in September and October 2014 and in similar meteo marine conditions 113 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Results Overall the mean plaster abrasion declined from Habitat I toward Habitat III independently from the different physical features of the two reefs The pairwise comparisons of plaster consumption among the three habitats of each reef did not show any significant difference in Reef 1 Conversely in Reef 2 high differences were detected between Habitat I vs Habitat HI p 0 0001 and Habitat II vs Habitat II p 0 0006 Moreover in the comparison among habitats of the two different reefs plaster abrasion differed only in Habitat II p 0 0067 Since Habitat III is located at different distances from the water edge in Reef 1 8 40 m and Reef 2 12 m reef amplitude seems to be more relevant for wave attenuation rather than the presence of the step structure on the external rim Conclusions The reduction of plaster abrasion between habitats is entailed by a reduction of wave energy This lost energy is absorbed by the reef surface that attenuates wave force and possibly the wave impact which generates erosion on the coast These results suggest differential capacity in wave attenuation of the two reef morphologies although the experimental setup needs to be spatially and temporally extended In the context
225. ata expert judgement and multivariate analysis in assessing reference conditions and benthic ecological status according to the European Water Framework Directive Mar Pollut Bull 55 16 29 SFRISO A FACCA C BONOMETTO A BOSCOLO R 2014 Compliance of the macrophyte quality index MaQI with the WFD 2000 60 EC and ecological status assessment in transitional areas the Venice Lagoon as study case Ecol Indic 46 536 547 SFRISO A FACCA C BUOSI A CENTANNI E BERTO D RAMPAZZO F GION C BONOMETTO A BOSCOLO R in press Stato trofico e stato ecologico dell area settentrionale della laguna veneta Biol Mar Mediterr 22 1 ZUCCHETTA M FRANCO A SCAPIN L CICCOTTI E TORRICELLI P FRANZOI P in prep Uncertainty in developing fish based multimetric indices LIFE SeResto project is funded with the contribution of the LIFE financial instrument of the European Union and is contextualized within the Natura 2000 Network SIC IT3250031 Northern lagoon of Venice 124 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 A SFRISO C FACCA A BUOSI E CENTANNI D BERTO F RAMPAZZO C GION A BONOMETTO R BOSCOLO Dipartimento di scienze Ambientali Informatica e Statistica DAIS Universita Ca Foscari di Venezia Dorsoduro 2137 30123 Venezia Italia sfrisoad unive it Istituto Superiore per la Protezione e la Ricerca Ambientale I
226. ategory of cnida used in tube construction by a cerianthid anemone Biol Bull 152 392 405 SHEPARD A N THEROUX R B COOPER R A UZMANN J R 1986 Ecology of Ceriantharia Coelenterata Anthozoa of the Northwest Atlantic from Cape Hatters to Nova Scotia Fish Bull 84 625 646 77 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 A FOTI M LEZZI A FIANCHINI A GIANGRANDE M F GRAVINA Dipartimento di Biologia Universit degli Studi di Roma Tor Vergata Via della Ricerca Scientifica 00133 Roma Italia alessandra foti uniroma2 it Laboratorio di Zoologia DISTEBA Universit del Salento Via per Monteroni 73100 Lecce Italia MODALIT DI RECLUTAMENTO SU SUBSTRATI ARTIFICIALI IN DUE IMPIANTI DI ACQUACOLTURA NEL MAR MEDITERRANEO RECRUITMENT PATTERNS ON ARTIFICIAL SUBSTRATA IN TWO AQUACULTURE FARMS IN THE MEDITERRANEAN SEA Abstract The development of fouling communities on artificial structures at two aquaculture farms in Gulf of Gaeta Tyrrhenian Sea and Gulf of Taranto Ionian Sea was assessed to select organisms potentially useful in bioremediation Samples have been collected trimonthly and fouling communities showed a higher species richness at the aquaculture site of Taranto than at Gaeta Overall community composition was significantly different between two sites while seasonal similarities in recruitment periods of common species were also observ
227. ative abbondanze Centropages typicus Kr yer 1849 Nannocalanus minor Claus 1863 Temora stylifera Dana 1849 Farranula rostrata Claus 1863 e Oithona nana Giesbrecht 1892 che assommano sempre oltre il 70 del totale della comunit a Copepodi Complessivamente non si riscontrano rilevanti variazioni di biomassa dopo un anno di permanenza del relitto 283 ind m luglio 2012 278 ind m luglio 2013 Temperatura superficiale e pH non hanno registrato a un anno 167 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 di distanza sostanziali variazioni 2012 T C min 24 2 max 25 pH 8 5 2013 T C min 24 8 max 25 pH 8 3 Si apprezza invece l incremento dell ossigeno disciolto che varia da 6 6 6 9 mg l nel luglio 2012 a 9 1 9 4 mg l nel luglio 2013 Rilevanti appaiono sia la differente distribuzione verticale della comunit a Copepodi lungo la colonna d acqua uniforme tra superficie e fondale nel 2012 direttamente proporzionale alla profondit nel 2013 sia la differente ricchezza quantitativa superficiale 384 ind m nel 2012 18 ind m nel 2013 Nel secondo survey stato riscontrato se pur con abbondanze modeste l aumento della famiglia Sapphirinidae generi Sapphirina e Vettoria rappresentata nel 2012 dalla sola Sapphirina nigromaculata Claus 1863 Tab 1 Elenco specie sensu Biol Mar Mediterr 2010 luglio 2012 e luglio 2013 List of the species sens
228. attracted white sharks at Dyer Island South Africa Mar Biol Res 6 408 414 STRONG W R JR 1996 Shape discrimination and visual predatory tactics in white sharks In Klimley A P Ainley D G eds Great White Shark The Biology of Carcharodon carcharias San Diego CA Academic Press 229 240 TRICAS T C 1985 Feeding ethology of the White shark Carcharodon carcharias Proc Calif Acad Sci Mem 9 81 90 161 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 M STAGIONI S MONTANINI M VALLISNERI Department of Biological Geological and Environmental Sciences University of Bologna Via Selmi 3 40126 Bologna Italy maria vallisneri unibo it Laboratory of Marine Biology and Fisheries University of Bologna Fano PU Italy DIET OF COMMON PANDORA PAGELLUS ERYTHRINUS SPARIDAE IN NORTHERN MIDDLE ADRIATIC SEA DIETA DEL FRAGOLINO PAGELLUS ERYTHRINUS SPARIDAE NELL ALTO MEDIO ADRIATICO Abstract The diet of the common pandora Pagellus erythrinus of the Adriatic Sea was examined A total of 1 148 specimens ranging between 50 to 217 mm TL were collected in 2005 and 2006 from experimental trawl surveys The diet was composed of 56 different prey species mainly belonging to Polycheta and Crustacea Decapoda Policheta were found more frequently in the diet of small specimens TL lt 110 mm and decapods in the largest fishes Key words die
229. atturati nel Golfo di Taranto Tab 1 The parameters a and b of the length weight relationship of P semisulcatus Parametri a e b della relazione lunghezza peso P semisulcatus a b R N p specimens Female 0 0028 2 6119 0 93 76 0 021 Male 0 0026 2 6286 0 98 71 0 014 Combined 0 0025 2 6403 0 98 147 4 03E 10 Conclusions The spatial expansion from the eastern to north west was documented for several species in the Mediterranean Bianchi 2007 Azzurro et al 2011 This phenomenon which has been named as meridionalization Azzurro et al 2011 and or tropicalization Bianchi 2007 within the literature seem manly linked to the warm up of the Meditarranean basin CIESM 2008 Moreover Galil amp Kevrekidis 2002 attributed to chancing of the water circulation pattern in the Ionian Sea known as Eastern Mediterranean Transient the penetration of Indo Pacific crustacean species into the south eastern Aegean These authors noted also that the lessepsian species showed in most cases the first appear at the Rodos Island before the expansion in Norh West direction Kevrekidis amp Galil 2003 Another possible cause of the expansion of this species could be also the increasing of aquaculture activity of Green tiger shrimp along the west coast of Turkey Giirel 2007 References AZZURRO E MOSCHELLA P MAYNOU F 2011 Tracking signals of change in Mediterranean fish diversity based o
230. aturalmente nel carbon fossile e nel petrolio e gli Organoclorurati OC in particolare quelli conosciuti per avere propriet di Endocrine Disrupting Chemicals EDCs fra cui esaclorobenzene HCB diclorodifeniltricloroetano DDT e metaboliti e policlorobifenili PCB Marsili et al 2001 2004 In questo lavoro la biopsia cutanea viene proposta come tecnica non letale per la valutazione dello stato ecotossicologico del grande squalo bianco Carcharodon carcharias Materiali e metodi Quindici esemplari di C carcharias sono stati campionati nelle acque antistanti la riserva naturale di Dyer Island Sud Africa e nel muscolo prelevato sono stati valutati i livelli di IPA di HCB delle forme op e pp di DDT DDE e DDD e di 33 congeneri di PCB Inoltre nella parte epidermica della biopsia sono stati messi a punto per la prima volta per esemplari di squalo bianco biomarker di esposizione citocromo P450 CYP450 ed effetto Vtg e proteine della zona radiata Pzr Queste ultime dovrebbero essere normalmente presenti solamente nelle femmine mature delle specie ovipare ed ovovivipare in quanto utilizzate per la produzione dell uovo 204 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Risultati I risultati mostrano livelli di OC pi alti di quelli riscontrati in letteratura con un range tra 66 80 e 21 26 ng g peso secco p s per l esaclorobenzene HCB tra 86 72 e 1416 9
231. avia Italia Dipartimento di Scienze della Natura e del Territorio Universita di Sassari Sassari Italia Area Marina Protetta Tavolara Punta Coda Cavallo Olbia Italia Dipartimento di Scienze della Terra e dell Ambiente DiSTA Universit di Pavia Via S Epifanio 14 27100 Pavia Italia sarah caronni unipv it UNA PROPOSTA DI STANDARDIZZAZIONE PER LA MAPPATURA DELLE FIORITURE DELLA MICROALGA BENTONICA CHRYSOPHAEUM TAYLORII A STANDARDIZATION PROPOSAL FOR THE MAPPING OF THE BLOOMS OF THE BENTHIC MICROALGA CHRYSOPHAEUM TAYLORII Abstract Since the summer 2007 the mucilaginous blooms of the benthic mucilage forming microalga Chrysophaeum taylorii Lewis amp Bryan Pelagophyceae have become recurrent in Tavolara Punta Coda Cavallo Marine Protected Area seriously affecting benthic communities Therefore a tool for graphically representing numerical data regarding blooms using Geographic Information Systems GIS is most urgently needed to monitor them and to easily identify the most damaged sites and communities Key words GIS mapping distribution algal blooms standardization Introduzione L Area Marina Protetta Tavolara Punta Coda Cavallo NE Sardegna ha recentemente realizzato un prototipo GIS per ottenere un quadro sintetico della distribuzione ed abbondanza delle principali specie aliene vegetali presenti nella zona tra queste si annovera anche la microalga bentonica produttrice di mucillagine Chrysophaeum tay
232. azione delle linee guida per la redazione di un piano di gestione della pesca nelle Aree Marine Protette 131 pp MAMONE R D AMBRA R DELL AQUILA M FEZZARDI D FIORE M MACCARONI A MARIANI A PAGLINO F RAMPACCI M SALERNO G TANCIONI L 1998 Prospettive di sviluppo del pescaturismo Biol Mar Mediterr 5 3 2418 2427 155 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 P SARTOR P CARBONARA S CERASI F GARIBALDI L LANTERT G LEMBO A LUCCHETTI M T SPEDICATO Centro Interuniversitario di Biologia Marina ed ecologia applicata CIBM Viale N Sauro 4 57128 Livorno Italia sartor cibm it COISPA Bari Italia Maja s c a r l Roma Italia 3DISTAV Universita di Genova Italia CNR ISMAR Ancona Italia IDENTIFICATION AND CHARACTERISATION OF THE SMALL SCALE DRIFTNET FISHERIES IN THE ITALIAN SEAS IDENTIFICAZIONE E DESCRIZIONE DELLA PESCA CON PICCOLE RETI DERIVANTI NEI MARI ITALIANI Abstract This note is aimed to identify and characterize the small scale driftnet fisheries in Italy During the investigations performed in March October 2013 99 vessels belonging to eight fisheries were identified The fisheries are very specialised by catch is often negligible as well as the overall impact on the environment The nets used were size selective on the target species only specimens above MLS were caught Key words driftnets fishery
233. bilita nel sistema economico La mancanza di un adeguata valorizzazione economica dei servizi ecosistemici e la pressione delle attivita antropiche sugli ecosistemi in costante aumento sta determinando una perdita di resilienza degli ecosistemi ed un deterioramento delle funzioni ecologiche che sottendono alla generazione di prodotti e servizi ambientali A marzo 2007 nel corso del G8 5 che ebbe luogo a Potsdam in Germania fu lanciata l idea di esplorare la valutazione della perdita di ecosistemi e biodiversit analizzandola dal punto di vista strettamente economico attraverso l implementazione del programma The Economics of Ecosystems and Biodiversity TEEB Lo scopo principale del progetto quello di stimare il valore economico dei servizi ecosistemici e di proporre quindi degli strumenti economici per la loro valutazione valorizzazione e conservazione 3 Contabilit ambientale e valore ecologico di beni e servizi ecosistemici Negli ultimi anni stata attribuita una grande enfasi alla valutazione delle relazioni tra attivit antropiche e degrado del capitale naturale e dei servizi ecosistemici soprattutto nell ottica del cambiamento climatico Diversi approcci e metodologie sono stati sperimentati al fine di stimare il valore del capitale naturale e dei servizi ecosistemici Questo ha permesso di definire meglio il loro importante contributo al sistema economico produttivo evidenziando anche lo sfruttamento spesso insosten
234. biodiversity conservation tourism aquaculture etc has motivated the development of the Integrated Maritime Policy EU Directive 2014 89 based upon an integrated maritime spatial planning and management approach for governance i e Blue Growth The strategy for marine and maritime research is an essential pillar of the European Maritime Policy as it is pivotal to allocate the full potential of sea based activities in an environmentally sustainable manner For the European Member States obligations arising from the Habitats Directive e g for the protection of regional priority habitats and the Marine Strategy Framework Directive EC Directive 2008 56 are further important drives for mapping the conditions as well as the pressure components acting on predominant and sensitive habitats The broad scope of the Common Fisheries Policy CFP aims for a sustainable exploitation of living aquatic resources in economic social and environmental terms thus it is intrinsically linked to both the Marine Strategy Directive and the Integrated Maritime Policy The framework project MAREA MARE 2009 05_Lot1 was launched by the European Commission DGMARE in 2009 to provide scientific advice and other services for the implementation of the Common Fisheries Policy CFP in the Mediterranean One of the pillar of the MAREA project was the ecosystem knowledge and its integration into fisheries management Along 4 years life of MAREA http mareaproject net 11
235. ble covers etc 5 2 3 3 g Fishing lines 1 6 15 0 i Ropes strapping bands 4 23 12 5 RUBBER a Tyres 2 25 METAL a Beverage cans 34 1 30 0 e Cables 2 4 0 0 NATURAL FIBRES c Natural ropes 16 7 5 OTHER Anchorage blocks 7 6 16 7 References ANONYMUS 2013 MEDITS Instruction Manual Version 7 Medits Handbook_2013 MEDITS Working Group 120 pp BIANCHINI M L RAGONESE S 1999 Anthropogenic waste on deep fishing grounds in the Strait of Sicily MEDCOAST99 EMECS99 Joint Conf 727 733 CANNIZZARO L GAROFALO G GIUSTO G B RIZZO P LEVI D 1995 Qualitative and quantitative estimate of solid waste in the Channel of Sicily In Ozhan E ed Proceedings of the Second International Conference on the Mediterranean Coastal Environment MEDCOAST 95 2 1409 1416 199 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 D IORI M MIRRA L FORTI D PREVEDELLI R SIMONINI Dipartimento di Scienze della Vita Universita di Modena e Reggio Emilia Via Campi 213 D 41125 Modena Italia dario iori unimore it ANALISI PRELIMINARI SULLA TOSSICITA DI ESSUDATI DI ARENICOLA MARINA LINNAEUS 1758 ANNELIDA ARENICOLIDAE PRELIMINARY ANALYSES ON THE TOXICITY OF EXUDATES PRODUCED BY ARENICOLA MARINA LINNAEUS 1758 ANNELIDA ARENICOLIDAE Abstract The effects of the exudate crude and its organic extracts obtained by Arenicola marina Annelida Arenicolidae were ev
236. by P erythrinus in the Northern Central Adriatic Sea Cn percentage by number Cw percentage by weight F frequency of occurrence percentage IRI percentage of index of relative importance J Juveniles A Adults Analisi della dieta in P erythrinus del nord centro Adriatico Cn numero percentuale Cw peso percentuale F frequenza di occorrenza RI percentuale dell indice di importanza relativa J giovanili A adulti Cn Cw F IRI TAXA J A J A J A J A Actinopterygii 2 228 4 637 12 538 20 691 3 579 5 469 0 9 3 494 Bivalvia 2 089 4 328 0 333 2 078 2237 3 32 0 09 0 536 Cephalopoda 0 279 0 618 0 128 0 857 0 447 0 781 lt 0 001 0 029 Copepoda lt 0 001 1 7 lt 0 001 0 838 lt 0 001 1 367 lt 0 001 0 088 Echinoidea 0 139 lt 0 001 0 009 lt 0 001 0 224 lt 0 001 lt 0 001 lt 0 001 Foraminifera 0 418 0 773 0 005 0 007 0 224 0 391 lt 001 0 008 Gastropoda lt 0 001 5 255 lt 0 001 1 662 lt 0 001 3 711 lt 0 001 0 648 Hexacorallia 1 811 0 155 0 182 0 583 0 447 0 195 0 891 0 004 Holothurioidea lt 0 001 0 618 lt 0 001 1 299 lt 0 001 0 781 lt 0 001 0 038 Malacostraca 23 259 25 811 34 642 29 333 23 043 23 828 23 956 33 151 Unidentified 23 677 28 284 19 435 19 777 37 136 34 766 28 764 42 156 Phascolosomatidea lt 0 001 5 41 lt 0 001 4 038 lt 0 001 3 516 lt 0 001 0 838 Polychaeta 46 1 19 011 32 729 16 79 32 662 20 898 46 23 18 876 Stelleroidea lt 0 001 3 4 lt 0 001 2 047 lt 0 001 0 977 lt 0 001 0 134 References
237. ccurrence of a facies of such sea pen is only recorded in the Messina Strait by Porporato et al 2008 For these reasons P rubra has been classified as DD Data Deficient species in the IUCN Red List Salvati et al 2014 The present study reports the occurrence of a P rubra facies in the North western Ionian Sea as well as the first data on its density in this area Materials and methods Data were collected during 3 experimental bottom trawl surveys carried out from 2012 to 2014 in the north western Ionian Sea as part of the MEDITS Project Bertrand et al 2002 In particular it were considered data from 2 sampling stations St 37 and St 39 located along the Calabrian coast Punta Alice at a mean depth of 24 and 63 m respectively All the colonies of P rubra collected by trawl in these stations were counted and their density No km was estimated as number on the swept area Results A high density of P rubra was recorded in 2 sampling stations on the sandy mud bottom at 24 and 63 m in depth where a total of 943 colonies of P rubra were collected during the three surveys The highest value of abundance was recorded at the St 39 in 2012 with 403 colonies sampled 9492 colonies km at 63 m in depth while any colony was sampled in St 37 in the 2014 Despite the low number of sampling replicas it seems that the species is more abundant on sandy mud bottoms at 63 m in depth with a mean density of 526843778 colonies km
238. cellato e disciolto agendo come biofiltri filtratori attivi Ledda et al 2014 c contribuiscono a migliorare la qualit della colonna d acqua producendo correnti particolarmente efficaci per la microcircolazione dei nutrienti e dei cataboliti nei microhabitat Dalla letteratura risulta un elevata ricchezza specifica della fauna a poriferi associata alle praterie dei mari circum italiani L inventario di Siribelli 1963 comprende 50 specie nel Golfo di Napoli Pansini e Pronzato 1982 1985 riportano 59 specie a Ischia e 42 specie a Prelo Liguria mentre Ben Mustapha et al 2003 segnalano 82 specie nel Canale di Sicilia In contrasto solo 13 specie sono state censite nelle praterie al confine orientale fra Adriatico e Ionio Beqiraj et al 2008 I nostri dati preliminari che sono in accordo con la letteratura suggeriscono la necessit di ulteriori indagini sia per colmare le lacune sulle conoscenze dei poriferi del mar di Sardegna e sia per poter valutare l impatto di specie aliene nelle due AMP sarde L analisi della bibliografia estesa all intero bacino mediterraneo tuttora in corso consentir di fare una sintesi anche delle innumerevoli segnalazioni di poriferi sparse nelle pubblicazioni di carattere generale tassonomico o mirate ad altri taxa Bibliografia BEN MUSTAPHA K ZARROUK S SOUSSI A EL ABED A 2003 Diversite des Demosponges Tunisiennes Bull Inst Natn Scien Tech Mer de Salammb 30 55 78 BE
239. ci in termini di rendimenti di pesca Le FADs boe sono utilizzate nella pesca oceanica di tunnidi e sono un importante supporto tecnico per i pescatori In questo studio si riporta un esperienza dell uso di queste boe in Mediterraneo per valutarne l applicazione nella pesca commerciale e nella ricerca scientifica Materiali e metodi Lo studio stato svolto a largo del Golfo di Castellamare Mar Tirreno meridionale a circa 12 miglia dalla costa La raccolta dei dati avvenuta per 5 giorni consecutivi nel mese di dicembre 2014 Sono state usate 5 boe a pannelli solari Satlink ELB 3010 www satlink es munite di sistema GPS ed ecoscandagli scientifici Simrad ES 12 190 5 kHz Gli ecoscandagli trasmettono via satellite la biomassa sottostante rilevata in tonnellate sotto forma di un grafico ad istogramma su scala cromatica Le boe sono state assicurate a 5 FADs ad una distanza di 500 m l uno dall altro direzione nord sud all interno dei lunghi filari usati tradizionalmente dai pescatori Per monitorare la posizione dei FADs e la biomassa ittica associata stato programmato un comando di ricezione dati via satellite ogni due ore attraverso il 132 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 software fornito dalla casa madre su una mappa georeferenziata Per verificare l attendibilit dei rilevamenti delle boe sono state effettuate delle pescate sperimentali Risultati
240. cial value Gracilaria gracilis Stackhouse M Steentoft et al 1995 Gracilariopsis longissima S G Gmelin M Steentoft et al 1995 Gracilaria vermiculophylla Ohmi Papenfuss 1967 and Ulva rigida C Agardh 1823 These seaweeds were monitored in two stations on the opposite sides of the bridge that connects Venice to the mainland They are characterized by high trophic conditions and productivity and anoxic crises occasionally can occur leading to biomass degradation Seaweed growth rates GR biomass production and the main physico chemical parameters of the water column were measured every 7 15 days The stations were Tresse TR located at the southwestern side in front of the industrial area of Porto Marghera and San Giuliano SG placed at the northeastern side Materials and methods Two replicates 0 2 kg fwt of the selected species were grown in grid cages of 25x25x25 cm and mesh size of 1 cm That biomass accounting for ca 3 2 kg m fwt and similar to the values recorded in field was weekly weighted and restored At each sampling some environmental parameters temperature dissolved oxygen salinity pH Eh Chlorophyll a and light transmission underwater and nutrients dissolved inorganic nitrogen DIN and reactive phosphorus RP were measured in the water column Results The data collected from May to October 2014 highlighted a significant difference between the stations and different algal growth patterns At Tr
241. circa 5 mm Risultati Le condizioni di allevamento dei riproduttori sono risultate ottimali in quanto hanno garantito una sincrona maturazione delle gonadi 80 esemplari in emissione gameti di ottima qualit fecondazione gt 90 con una mortalit degli esemplari trascurabile lt 2 Anche i tassi di sviluppo larvale fino alla competenza 25 sono incoraggianti rientrando nel range riportato per esperienze precedenti con il P lividus Grosjean et al 1998 Conclusioni Sulla base dei risultati ottenuti possibile fare alcune considerazioni Innanzitutto l elevato numero di embrioni ottenuti da ogni batch di fecondazione permette di utilizzare pochi riproduttori preferibilmente provenienti dalle stesse aree che si intende ripopolare in pratica si intervenuti semplicemente massimizzando la produzione di gameti mediante maturazione delle gonadi in condizioni controllate e facendo avvenire in condizioni controllate e quindi protette le fasi di sviluppo larvale metamorfosi e primo accrescimento che sono quelle pi critiche nel ciclo vitale del P lividus Inoltre il protocollo di allevamento sperimentato prevede l utilizzo di impianti non particolarmente complessi che richiedono altrettanto semplici e non eccessivamente costose procedure di gestione permettendo quindi di affiancare l echinocoltura ad altre attivit acquacolturali con la conseguente diversificazione delle produzioni Considerando infine i risultati a pi
242. clusioni Questo studio mostra la tendenza delle osservazioni relative al popolamento zooplanctonico effettuate su pi stazioni del Medio ed Alto Adriatico ad avere sincronicit massima quando quelle meridionali sono sfasate positivamente nel tempo rispetto a quelle pi settentrionali di 7 14 giorni verosimile anche se resta da provare che questo pattern ricorrente sia dovuto ad un effetto di deriva del popolamento zooplanctonico causato dalle correnti Ci porterebbe a concludere che la struttura del popolamento zooplanctonico nei siti analizzati non governata soltanto da una dinamica sito specifica che esprime l effetto di perturbazioni e fattori stagionali locali ma chiaramente influenzata anche dalla circolazione generale a scala di bacino Nel caso dell area di studio il popolamento zooplanctonico viene quindi trasportato lungo la costa attraverso i diversi siti e la sua struttura viene conservata anche su lunghe distanze oltre 150 km Il popolamento zooplanctonico ha quindi la capacit di conservare la memoria delle pressioni che agiscono sulla colonna d acqua sia nello spazio che nel tempo Sembra quindi essenziale ai fini della Marine Strategy Framework Directive ovvero 2008 56 EC EC 2008 e delle sue ricadute sulla direttiva sul Maritime Spatial Planning ovvero 2014 89 EU EU 2014 sottolineare l importanza della componente zooplanctonica per valutare dinamiche rilevanti a scala di bacino anche grazie al monitora
243. compared to the 234642313 colonies km found at 24 m depth Tab 1 Conclusions The present finding improve the knowledge about the distribution of P rubra in the Mediterranean Sea also upgrading the data reported in the Italian check list Morri et al 2008 for the biogeographic zone 6 Considering the high density of 64 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 the colonies mostly recorded it can be assessed that a true facies of P rubra is present along the northern Calabrian coast in the Ionian Sea The presence of such facies can be due to particular environmental conditions affecting the area Indeed despite P rubra is a pivotant species being able to move in case of stress the trawling activities deeply affect these benthic communities However it is to note the downward trend of the abundance in both the stations till the zero cached of the 2014 in the St 37 Considering that the analysis is carried out on only three years we can t exactly know if there is a true decline of the population in the area as our data seems to suggest or if this is just related to the patchy distribution that characterize sea pens facies Mastrototaro et al 2013 2015 also indicated by the high value of standard deviation associated to the mean density of the colonies Therefore further analysis is necessary in the area to improve the knowledge about the distribution and density
244. con altri soggetti Questa necessit riguarda certamente chi gi oggi opera in questo campo ma riguarda soprattutto la prossima generazione di biologi marini che dovranno essere capaci di padroneggiare le nuove tecnologie senza perdere di vista una solida formazione naturalistica e che dovranno coltivare i propri interessi specialistici senza mai rinunciare a confrontarsi con i temi della ricerca e delle politiche ambientali in una prospettiva che sia la pi ampia possibile Questo obiettivo tuttavia ostacolato dalla necessit di massimizzare la produzione scientifica che pi che mai pressante e che spinge verso una forte 4 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 verticalizzazione delle competenze soprattutto fra i giovani che si affacciano al mondo della ricerca Sara dunque opportuno favorire una formazione che sia il pit possibile generalista e che non diventi per questo generica ma al tempo stesso si dovra fare pressione perch si trovino i giusti modi per valorizzare le attivita di supporto istituzionale in campo ambientale ad esempio attraverso una loro specifica valutazione nell ambito della cosiddetta terza missione Se la convergenza fra usi diversi e a volte contrastanti del mare e delle sue risorse l obiettivo della Direttiva una delle sfide che la comunit scientifica che si interessa del mare ed i biologi marini come parte di questa dov
245. considerata cosmopolita pelagica Forcada et al 1995 stupisce la netta preferenza per la zona dei canyon mentre nel caso del capodoglio sorprende la preferenza per la zona extra canyon Il grampo sembra preferire la zona dei canyon ma in questo caso i dati sono appena sufficienti per una robusta analisi statistica e devono essere presi con cautela Ulteriori studi saranno necessari per confermare tali preferenze di habitat e indagare gli aspetti ecologici specifici che le determinano Bibliografia FORCADA J NOTARBARTOLO DI SCIARA G FABBRI F 1995 Abundance of fin whales and striped dolphins summering in the Corso Ligurian Basin Mammalia 59 1 127 140 NOTARBARTOLO DI SCIARA G AGARDY T HYRENBACH D SCOVAZZI T VAN KLAVEREN P 2008 The Pelagos Sanctuary for Mediterranean marine mammals Aquat Conserv 18 367 391 PAULL C USSLER B BIRD L CARESS D HOBSON B LUNDSTEN E THOMAS H 2008 Confirming that Active Canyons Make Waves Monterey Bay Aquarium Research Institute Annual Report 22 24 TEPSICH P ROSSO M HALPIN P N MOULINS A 2014 Habitat preferences of two deep diving cetacean species in the northern Ligurian Sea Mar Ecol Prog Ser 508 247 260 236 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 INDICE AUTORI A ABBOUD ABI SAAB M 103 ABDEL GAWAD E KH 208 ABDELRHMAN K F A 188 212 ACQUAVIVA M 190 ADDIS P 154 AIROLDI S
246. ct of alien species in two Sardinian Marine Protected Areas Key words Porifera biodiversity assessment shallow water checklist Mediterranean Sea Introduzione I poriferi sono uno dei taxa zoobentonici pi comuni delle praterie di Posidonia oceanica L Delile 1813 Per contribuire alla valutazione della biodiversit delle Aree Marine Protette della Sardegna nord occidentale che ospitano ampie praterie di P oceanica Chessa e Cossu 2012 questo lavoro riporta i dati relativi a un indagine preliminare sulla fauna a poriferi nell AMP Isola dell Asinara e nell AMP Capo Caccia Isola Piana Materiali e metodi Il censimento della spongofauna stato effettuato lungo transetti mediante snorkeling in baie a bassa profondit 0 5 m Le spugne sono state fotografate in vivo raccolte frammenti rappresentativi conservate a secco e o in etanolo identificate a livello di specie sulla base di macro e micro tratti diagnostici e inserite in una collezione di riferimento Lo status tassonomico delle specie stato validato sulla base della Fauna d Italia Pansini et al 2011 e del World Porifera Database van Soest et al 2015 Risultati Il censimento faunistico ha rivelato la presenza di una ricca e diversificata comunit a poriferi nelle praterie a bassa profondit delle due AMP Le analisi preliminari dei campioni hanno permesso l identificazione di circa 50 specie Sui rizomi sono presenti per esempio Cacospongia m
247. cul de sac for endemic fishes facing climate change Glob Change Biol 16 3233 3245 CACCIN A ANELLI MONTI M PRANOVI F 2014 Vulnerability of the Northern Adriatic Sea fishery to climate change Atti della 2 Conferenza Annuale della Societ Italiana per le Scienze del Clima Venezia 29 30 settembre 2014 1021 1035 PRANOVI F CACCIN A FRANZOI P MALAVASI S ZUCCHETTA M TORRICELLI P 2013 Vulnerability of artisanal fisheries to climate change in the Venice Lagoon J Fish Biol 83 847 864 TORTONESE E 1964 Main biogeographical features and problems of the Mediterranean fish fauna Copeia 1 98 107 141 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 V GANCITANO M ENEA F COLLOCA S GANCITANO G INGRANDE D MASSI P RIZZO A TITONE F FIORENTINO Consiglio Nazionale delle Ricerche CNR Istituto per 1 Ambiente Marino Costiero IAMC Via Luigi Vaccara 61 91026 Mazara del Vallo TP Italia vita gancitano iamc cnr it TEMPORAL DYNAMICS OF DEMERSAL RESOURCES IN THE SOUTH OF SICILY GSA 16 DURING THE LAST TWENTY YEARS ANDAMENTO TEMPORALE DELLE RISORSE DEMERSALI NELLA SICILIA MERIDIONALE GSA 16 NEL CORSO DEGLI ULTIMI VENTI ANNI Abstract 20years abundance time series of bony fish cartilaginous fish cephalopods and crustaceans from MEDITS survey in the South of Sicily GSA 16 were analyzed using a trend approach and short term predic
248. d 43 mm CL in females The LFD show Fig 1 a peak included between 27 and 30 mm of CL for the male and at 38 mm for the female The vectorial sex ratio indicated an exclusive presence of females starting from 33 mm CL The parameters a and b of length weight relationship were reported in Tab 1 Regarding the maturity stages the higher number of ripe females occurred in the sample of December 72 while in September and October developing 65 and nearly ripe 55 were respectively the maturity stage more frequent In general an increasing percentage of mature ripe females were observed from October to December in accordance with a winter early spring reproduction period observed in Turkish Levantine coast Manasirli et al 134 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 2014 The smallest ripe female was 31 7 mm CL All males showed a completed joint petasma with spermatic masses in the seminar ampullae Length Frequency Distribution Sex ratio by Length Class 16 1 14 dal F n 76 S os M n 71 S 210 06 Si tra 6 04 2 4 g 0 2 2 4 x ee eae ota nea 23 25 27 29 31 33 35 37 39 41 43 23 25 27 29 31 33 35 37 39 41 43 Carapace Length mm Carapace Length mm Fig 1 LFD by sex and sex ratio of P semisulcatus caught in the Gulf of Taranto LFD per sesso e rapporto sessi di P semisulcatus c
249. d della Toscana che presentano caratteristiche diverse in termini di piattaforma al fine di allenare il sistema attraverso il processo di autoapprendimento e per elaborare un modello di previsione adattabile ad aree morfologicamente molto diverse I dati utilizzati in questa fase vanno dal 2007 al 2013 222 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Gli avvistamenti 366 in questa fase e le variabili selezionate sono stati riportati su un grigliato regolare di 1x1 NM miglia nautiche equivalenti a 1852 m all interno del quale sono state individuate 4 variabili statiche profondita pendenza del fondale distanza dalla batimetrica dei 100 m e distanza dalla costa A questo punto stato elaborato un modello predittivo su tutto il Santuario Pelagos per evitare problemi di false assenze o false presenze stata applicata una correzione a zero inflated Per la fase di validazione sono stati utilizzati dati raccolti dai partner di ricerca e dati provenienti dal progetto GIONHA dal 1994 al 2014 per un totale di 417 avvistamenti Risultati In Fig 1 sono riportati gli istogrammi di frequenza degli avvistamenti in relazione alla percentuale di predizione la linea nera identifica la media della probabilit predetta nelle celle di presenza che risulta dell 80 nelle aree di training A e circa del 50 nell intera area Pelagos B Random fo
250. d in the Egadi Islands MPA Twenty three interviews were conducted in eight stakeholder groups Fisheries vs conservation tourism vs conservation and fisheries vs tourism conflicts were identified The analysis suggests that the top down approach used in the MPA creation and management has hampered participation and acceptance although in recent years steps were taken towards a larger involvement of stakeholders in the governance process Key words Egadi MPA governance analysis stakeholder perception conflicts uncertainty Introduction Marine protected areas MPAs are a tool for spatial management of human uses in the maritime domain However their success depends on the implementation of a governance framework that moves away from a sectoral management approach and goes towards an integrated process Established in 1991 the Egadi Islands MPA is a large and complex system of spatially based sectoral initiatives For this reason it has been selected to carry out a governance analysis focused on stakeholder perspectives about the management and conservation of the marine resources around the islands Materials and methods Twenty three semi structured interviews were conducted in 2012 within 8 stakeholder groups fishers public administration staff local fisheries management plan staff enforcement bodies trade associations tourist companies non profit organizations in order to identify their perspectives about the MPA governance Inter
251. d on 78 occasions in all study areas with striped dolphin Stenella coeruleoalba Meyen 1833 observed in 58 mixed cases and bottlenose dolphin Tursiops truncatus Montagu 1821 in 10 ones all near Lampedusa island Other associated species included Risso s dolphin Grampus griseus Cuvier 1812 sperm whale Physeter macrocephalus Linnaeus 1758 and fin whale Balaenoptera physalus Linnaeus 1758 Mixed encounters occurred mainly during feeding and or travelling activities in few cases social interactions between common dolphins and other species were documented principally with striped dolphins around Ischia island A number of 20 photographically identified individuals were captured in the Pelagos Sanctuary with resightings between 2004 and 2010 and 97 around Ischia Island with 70 resightings over the years No matches between the PS and CT areas were currently found Photoidentification catalogues in ST and SC are still in progress Conclusions Preliminary pooled data on short beaked common dolphins in Italian waters showed the great potential of this new research network and provided a novel picture on the presence and distribution of the species between 2000 and 2014 CT Ischia Island ST Strait of Messina and SC Lampedusa Island resulted marine areas that are deemed significant ecosystems or habitats for the endangered D delphis These regions seem to give strong arguments for specific management strategies to be d
252. dMed Tech Doc 53 pp CD Rom FIORENTINI L CADDY J F DE LEIVA J I 1997 Long and short trends of Mediterranean fishery resources Stud Rev GFCM 69 72 pp FROESE R PAULY D EDs 2014 FishBase www fishbase org IREPA 2009 Osservatorio economico sulle strutture produttive della pesca marittima in Italia 2007 XVI Rapporto Collana Irepa Ricerche Franco Angeli Ed Milano 174 pp RELINI G BERTRAND J ZAMBONI A 1999 Sintesi delle conoscenze sulle risorse da pesca dei fondi del Mediterraneo centrale Italia e Corsica Biol Mar Mediterr 6 Suppl 1 382 386 137 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 L CASCIARO P GAUDIO I BITETTO M T FACCHINI M PALMISANO P CARBONARA COISPA Tecnologia amp Ricerca Stazione Sperimentale per lo Studio delle Risorse del Mare Via dei Trulli 18 20 70126 Bari Italia casciaro coispa it CATCH STRUCTURE AND REPRODUCTIVE PATTERN OF MELICERTUS KERATHURUS IN THE SOUTH WEST ADRIATIC SEA CICLO RIPRODUTTIVO E STRUTTURA DEMOGRAFICA DELLA CATTURA DI MELICERTUS KERATHURUS IN ADRIATICO MERIDIONALE Abstract Demographic structure of catches and size at first maturity of Melicertus kerathurus Forskdl 1775 females 38 52542 71 mm were estimated from commercial fisheries data collected in the South West Adriatic Sea from 2011 to 2013 The length distribution of the catches shows a different pattern for
253. da una equipe di biologi e naturalisti ha permesso di fornire all Ente gestore importanti indicazioni sia sullo stato del patrimonio di specie e habitat marini di elevato interesse naturalistico sia dell efficacia delle azioni di tutela fin ora poste in atto Per P ferruginea l area Isola dell Asinara Arcipelago di La Maddalena Sud della Corsica costituisce la zona di tutela pi importante del Mediterraneo appare giusta la destinazione d uso del sito a regime di tutela integrale di Cala di Sgombro di Dentro poich include oltre il 15 della popolazione femminile dell isola con individui di grandi dimensioni altamente produttivi L byssoides mostra essere pi abbondante nel lato ovest dove l aspra morfologia e il continuo moto ondoso proteggono naturalmente la specie da possibili frequentazioni infatti non sono state rilevate significative differenze nei popolamenti delle zone sottoposte a differenti regimi di tutela in questo versante I popolamenti di P nobilis mostrano la presenza di prelievo nel sud dell isola e si dovrebbe esercitare un maggiore controllo anche per l incoraggiante presenza di numerosi giovanili che potrebbero riportare la popolazione su valori di sicurezza demografica Le praterie a P oceanica indicano l urgenza di intensificare l ampliamento di campi boa soprattutto nell Isola Piana per limitare la negativa azione delle ancore delle barche da diporto Bibliografia COMBELLES S MORETEAU J C
254. dagine l autore definiva il numero di piastre costali vertebrali e inframarginali poco variabile e quindi da considerare carattere costante delle Caretta caretta mediterranee Tale dato stato in parte confermato da Turkozan et al 2001 in diverse aree della Turchia e Cipro da Margaritoulis e Chiras 2011 lungo le coste dell Isola di Zakynthos Grecia e da Oliver 2014 lungo le coste francesi mediterranee che segnalano combinazioni numeriche percentuali differenti e suggeriscono la necessit di una rivisitazione dei criteri fino ad oggi utilizzati per l identificazione della specie Infine essendo tali caratteri probabilmente correlati con la variazione di alcuni parametri ambientali durante il periodo di incubazioni l acquisizione di maggiori informazioni sulla loro variazione e sui siti di deposizione potranno contribuire a migliorare le conoscenze su questa specie Bibliografia CAPOCACCIA L 1966 Variabilit della popolazione Mediterranea di Caretta caretta L Annales del Civico Museo di Storia Naturale di Genova 76 1 22 IUCN 2012 IUCN Red List of Threatened Species Version 2012 2 http www iucnredlist org MARGARITOULIS D CHIRAS G 2011 Scalation patterns of loggerhead turtles nesting in Laganas Bay Zakynthos Island Greece Marine Turtle Newsletter 131 29 31 MARQUEZ MLR 1990 FAO Species Catalogue Vol 11 Sea Turtles of the World An annotated and illustrated catalogue of sea turtle species
255. dditional information date day time sex and size of the shark weather conditions and behaviour social individual predatory investigative Identification of individual sharks was based on a larger pattern including not only the different notches of the dorsal fin but also body patterns presence of scars and or ectoparasite Sperone et al 2012 We assumed that at least 5 matching points must be present in each resighting Results and conclusions The analysis of collected photos showed that the observation of the same animal along the years is a useful tool for behavioural studies however the analysis must be very detailed and must include many other information to avoid potential mistakes During our research 8 sharks were resighted Fig 1 for all of them were collected also behavioural information but results are still not significant because this number is too low for an accurate analysis The challenge is to improve the database of identified and catalogued specimens Further investigations are needed and are actually in progress to compare the development of the behaviour of sharks over the years Fig 1 Match examples Specimen No 1 11 05 2014 15 05 2014 and Specimen No 5 22 03 2012 11 05 2013 Esempi di match Esemplare N 1 11 05 2014 15 05 2014 ed Esemplare N 5 22 03 2012 11 05 2013 References ANDERSON S D CHAPPLE T K JORGENSEN S J KLIMLEY A P BLOCK B A 2011 Long term individual identif
256. dell isola gt 500 cellule ml Caronni et al dati non pubblicati e paragonabile a quella osservata in altre zone di recente colonizzazione Caronni et al 2010 Blasi et al 2013 Questi risultati cos come l assenza di ammassi mucillaginosi sul substrato permettono di ipotizzare che nella zona di studio C taylorii si trovi in una fase iniziale dell introduzione Le densit significativamente maggiori registrate a Cala Pischina 146 cellule ml e Capo Testa 163 cellule ml rispetto a Rena Bianca possono essere spiegate considerando che C taylorii sembra insediarsi pi facilmente nei siti poco esposti e dunque soggetti ad un minore idrodinamismo come osservato da Caronni et al 2014 Bibliografia ABBATE M BORDONE A CERRATI G LISCA A PEIRANO A 2007 Variabilit della distribuzione e densit di Ostreopsis ovata nel Golfo della Spezia Biol Mar Mediterr 14 2 286 287 AKTAN Y TOPALOGLU B 2011 First record of Chrysophaeum taylorii Lewis amp Bryan and their benthic mucilaginous aggregates in the Aegean Sea Eastern Mediterranean J Black Sea Medit Environ 17 2 159 170 BLASI F DELARIA M A CARONNI S 2013 Prima segnalazione della microalga bentonica Chrysophaeum taylorii Lewis e Bryan lungo le coste laziali Biol Mar Mediterr 20 1 120 121 CARONNI S CECCHERELLI G NAVONE A OCCHIPINTI AMBROGI A PANZALIS P PINNA S SECHI N 2010 Distribution and density of the benth
257. delle larve in ambienti controllati chiusi non stata osservata la metamorfosi cos come la transizione alla vita bentonica Questo studio ha dimostrato un ottimo adattamento di questa specie alla cattivit considerando che i tritoni si alimentavano metodicamente e regolarmente Saranno necessari ulteriori studi e prove di riproduzione per migliorare le tecniche per la produzione delle larve di questa specie cos sensibile soprattutto nella fase di abbandono della vita pelagica e sulle abitudini trofiche particolarmente selettive e quasi sconosciute Ci al fine di poter costituire dei contingenti di giovani esemplari da utilizzare per esperimenti volti al ripopolamento di zone sensibili come le aree marine protette Bibliografia BEU A G 1985 A classification and catalogue of living world Ranellidae Cymatiidae and Bursidae Conchologists of America Bulletin 13 4 55 66 BEU A G 1987 Taxonomy of gastropods of the families Ranellidae Cymatiidae and Bursidae Part 1 Adoption of Ranellidae and review of Linatella Gray 1857 New Zeal J Zool 13 241 266 NATEEWATHANA A AUNGTONYA C 1994 The Indo Pacific trumpet triton snail Charonia tritonis morphometrics of a species on the verge of local extinction Phuket Marine Biological Center Special Publication 25 1 153 160 42 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 M P FERRANTI G DE LA FUENTE M
258. di laboratorio diluendo in 200 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 acqua marina artificiale Reef Crystals aliquote note di estratto o essudato fresco o decongelato In ciascun saggio sono stati considerati 6 trattamenti 5 concentrazioni della matrice da testare un controllo in acqua o in DMSO decisi in base a range finding tests La tossicit stata espressa in termini di LCso con i relativi intervalli di confidenza al 95 c 1 calcolata utilizzando il metodo Trimmed Spearman Karber Risultati Gli animali isolati nelle capsule Petri emettevano un essudato giallo che virava al verde e poi al blu aumentando il pH a valori di 8 10 mentre si colorava di rosso arancio a pH 5 Miscelando l essudato giallo con etere e successivamente DCM stato osservato un viraggio da giallo a verde blu nella fase acquosa Sostituendo il DCM con butanolo la fase organica si colorava di giallo arancione mentre quella acquosa diventava trasparente Dopo evaporazione dei solventi non stato recuperato materiale da etere e DCM mentre dal butanolo stato ottenuto un solido amorfo rosso marrone I saggi ecotossicologici hanno evidenziato che l essudato di A marina sia fresco che congelato era tossico per D gyrociliatus LCs 241 12 c 1 9 7 14 7 e 9 8 c 1 8 3 11 6 per fresco e congelato rispettivamente LCso 961 8 5 C 1 6 7 10 7 e 7 1 c i 6 3 8 per fresco e c
259. e anno 2007 Reptilia Testudines Boll Mus Civ St Nat Venezia 59 109 115 YALCIN OZDILEK S EVSEN A KAPLAN E IRPAN H 2012 Is ardak lagoon Canakkale Turkey possible foraging habitat of loggerhead turtle In Bradai M N Casale P eds Proceedings of 3 Mediterranean Conference on Marine Turtles Yassmine Hammamet Tunisia 20 23 October 2008 117 110 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 C FACCA A BONOMETTO R BoscoLo A BUOSI E CENTANNI M PARRAVICINI E PONIS A SFRISO Dipartimento di Scienze Ambientali Informatica e Statistica DAIS Universit Ca Foscari di Venezia Dorsoduro 2137 30123 Venezia Italia facca unive it Istituto Superiore per la Protezione e la Ricerca Ambientale ISPRA Chioggia VE Italia Laguna Venexiana Onlus Via A Costa 35 c 30172 Venezia Italia INTERVENTI DI RICOLONIZZAZIONE DI ANGIOSPERME ACQUATICHE IN LAGUNA DI VENEZIA RISULTATI DEL PRIMO ANNO DI TRAPIANTI NELL AMBITO DEL PROGETTO LIFE SERESTO LIFE12 NAT IT 000331 AQUATIC ANGIOSPERM RECOLONIZATION IN VENICE LAGOON RESULTS AFTER ONE YEAR OF TRANSPLANTATIONS IN THE FRAMEWORK OF THE LIFE PROJECT SERESTO LIFE12 NAT IT 000331 Abstract The project SeResto started on January 2014 is implemented in the Northern Venice Lagoon with the aim of restoring and consolidating the coastal lagoon habitat n 1150 via the transplantation o
260. e CNR UOS Lesina Via Pola 4 70010 Lesina FG Italia cristina manzo fg ismar cnr it RISPOSTA DELLA FAUNA ITTICA DELLA LAGUNA DI LESINA AL GRADO DI CONNESSIONE CON IL MARE E AICAMBIAMENTI DELLE STRATEGIE GESTIONALI RESPONSE OF THE FISH COMMUNITY OF LESINA LAGOON TO THE CONNECTIVITY WITH THE SEA AND TO CHANGES IN MANAGEMENT STRATEGIES Abstract The fish community of Lesina Lagoon has been investigated and the recruitment of young of the year marine fishes has been compared before and after the construction of engineering works in connections with the sea The fish community of Lesina Lagoon was characterized by the presence of mugilid species which recruit to the lagoon during the late autumn and winter New recruits of Sparidae family were conversely scarce indicating a probable decrease of the connectivity with the sea in spring Moreover results do not have highlighted changes in the recruitment dynamics after rearrangements of the connections with the sea Key words fish community connectivity coastal lagoon Mediterranean Sea Introduzione La composizione e la variazione temporale della struttura delle comunit ittiche lagunari dipende fortemente dalla connettivit laguna mare la quale influenza l entit e le dinamiche del reclutamento dei giovanili di specie marine eurialine Costa et al 2002 La laguna di Lesina una laguna nanotidale che possiede due canali artificiali che la collegano al mare In questi cana
261. e CS Italia Aquarium Mondo Marino Centro Studi Squali Massa Marittima GR Italia BIOPSIE CUTANEE PER LA VALUTAZIONE DELLO STATO ECOTOSSICOLOGICO DEL GRANDE SQUALO BIANCO CARCHARODON CARCHARIAS LINNAEUS 1758 SKIN BIOPSY AS A SENSITIVE NON LETHAL TECHNIQUE FOR THE ECOTOXICOLOGICAL STUDIES OF GREAT WHITE SHARK CARCHARODON CARCHARIAS LINNAEUS 1758 Abstract Top predators as great white sharks Carcharodon carcharias may be extremely vulnerable to environmental contaminants such as organochlorines OCs and Polycyclic Aromatic Hydrocarbons PAHs mostly because of their position in the trophic web In this study we propose the use of skin biopsy as a sensitive non lethal technique for the toxicological assessment of white shark living along the South African coasts Key words Carcharodon carcharias skin biopsy organochlorine contaminants EDCs South Africa Introduzione Nelle ultime decadi vari studi hanno mostrato quanto i pesci top predators per loro posizione apicale nella rete trofica marina siano sensibili agli effetti tossicologici di alcuni contaminanti ambientali Fossi et al 2007 Schlenk et al 2005 Serrano et al 2000 sia xenobiotici che naturalmente presenti ma aumentati esponenzialmente nella loro biodisponibilit dall attivit antropica Mekenyan et al 1994 Di particolare interesse per le loro caratteristiche tossicologiche gli Idrocarburi Policiclici Aromatici IPA i quali si ritrovano n
262. e basato su variabili ambientali facilmente misurabili o prevedibili tramite modellistica meteo marina Bibliografia ASNAGHI V BERTOLOTTO R GIUSSANI V MANGIALAJO L HEWITT J THRUSH S MORETTO P CASTELLANO M ROSSI A POVERO P CATTANEO VIETTI R CHIANTORE M 2012 Interannual variability in Ostreopsis ovata bloom dynamic along Genoa coast North western Mediterranean a preliminary modeling approach Cryptogamie Algol 33 2 181 189 MANGIALAJO L GANZIN N ACCORONI S ASNAGHI V BLANFUN A CABRINI M CATTANEO VIETTI R CHAVANON F CHIANTORE M COHU S COSTA E FORNASARO D GROSSEL H MARCO MIRALLES F MASO M REN A ROSSI A M MONTSERRAT SALA M THIBAUT T TOTTI C VILA M LEMFE R 2011 Trends in Ostreopsis proliferation along the Northern Mediterranean coasts Toxicon 57 408 420 PISTOCCHI R PEZZOLESI L GUERRINI F VANUCCI S DELL AVERSANO C FATTORUSSO E 2011 A review on the effects of environmental conditions on growth and toxin production of Ostreopsis ovata Toxicon 57 3 421 428 104 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 G BERNARDI S CARONNI M A DELARIA A NAVONE P PANZALIS M C PIRAS G CECCHERELLI Area Marina Protetta di Tavolara Punta Coda Cavallo Olbia Italia Dipartimento di Scienze della Terra e dell Ambiente Universita di Pavia Pavia Italia Dipartimento di Scienze del
263. e il caso degli ecosistemi antropizzati nei quali il grado di complessit aumenta a causa delle interazioni uomo ambiente Lo studio olistico e sistemico degli ecosistemi antropizzati non pu quindi prescindere da un analisi di contesto e da una valutazione quantitativa delle interazioni tra le principali componenti naturali ed antropiche dell ecosistema Tali interazioni si manifestano attraverso lo scambio di flussi di materia energia e denaro i quali possono essere contabilizzati al fine di definire una solida base conoscitiva sulla quale fondare le future valutazioni di carattere ecologico ed economico In altre parole necessario implementare una contabilit ambientale che integrando variabili biofisiche ed economiche sia in grado di cogliere la complessit delle relazioni uomo ambiente La valutazione quantitativa dei flussi di materia energia e denaro di un sistema consente il calcolo di una serie di indicatori di performance ambientale e sviluppo sostenibile Questi indicatori possono fornire una chiave di lettura del territorio marino e delle principali dinamiche naturali e antropiche che lo caratterizzano supportando la pianificazione ambientale e le scelte dei decisori politici in un ottica di gestione sostenibile del capitale naturale e dei servizi ecosistemici Bibliografia CDB 2010 Global Biodiversity Outlook 3 CBD Publishing Montreal 94 pp COSTANZA R D ARGE R DE GROOT R FARBER S GRASSO M HANNON
264. e rappresentata quella delle reti attive 39 seguita da quelle relative a cime scotte tiranti corpi morti e rifiuti della pesca 33 a reti passive 17 e a rifiuti da acquacoltura 11 La presenza di fauna incrostante risultata complessivamente molto scarsa tranne che sui telai metallici colonizzati prevalentemente da molluschi bivalvi pectinidi e Crassostrea sp mentre quella di organismi intrappolati risultata pressoch nulla probabilmente in relazione alla vetust degli attrezzi che perdono in tempi abbastanza rapidi l efficienza di cattura Tab 1 Superfici esaminate e numero di ALDFG per km osservati nei diversi siti Examined areas and number of ALDFG km observed in each site Sito 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 Area d indagine eee alate Te Ue ela acustica km Superficie affioramento 4800 15267 12000 2000 2500 1200 3000 7500 1200 180 1500 8500 16000 5000 1000 roccioso m n ALDFG km 97 28 25 5 50 28 26 5 3 0 0 0 0 0 0 0 Legenda Legend 1 Cavallino Vicino 2 Secca 125 3 D Ancona 4 LA1 5 Pivetta 6 A1 7 Malamocco 8 Motta Sile Tette 9 Secca Elisabetta 10 Excelsior 11 Secca Cortellazzo 12 Cavalllino Lontano 13 Serenissima 14 Mona 15 Secca 150B Conclusioni I risultati di questa indagine mostrano che nelle aree monitorate sono presenti ALDFG con valori di densit conf
265. e average size of the modal component plus 1 Standard Deviation Spatial analysis was used to study the distribution of the species and presence of juveniles following three approaches a Kriging with first order trend for the species distribution Cressie 1993 a Bayesian approach with a linear effect of latitude for recruits Martino and Rue 2008 a GAM with a smooth effect on the deep slope Hastie and Tibshirani 1990 Maps with temporal persistency of the hot spot areas were produced Results Density and biomass indices show a fluctuating trend with an evident peak in 2007 MAFA highlighted one significant trend with a cyclic pattern Fig 1 The yearly LFD were always polymodal even though it was not easy to single out the first component The modal size 1 SD of the first modal component ranged from 16 1 to 24 7 cm TL even though in most years it was at around 17 19 cm TL As concerns the spatial analysis a good correlation between the observed and the predicted values was found The produced maps well described the experimental data Fig 2a shows the distribution map of the species for the year 2007 as an example As expected the highest density is located from 300 to 500 m depth In addition the population is 158 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 concentrated in well defined zones uniformly distributed along the investigated area Nursery areas were clearly
266. e di carbonio organico disciolto Pettine et al 2001 e la respirazione Zoppini et al 2010 Incubazioni parallele arricchite di nutrienti NH4NO e K HPO aggiunti nel rapporto C N P 80 10 1 sono state 185 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 utilizzate per misurare eventuali limitazioni nutrizionali Le incubazioni sono state condotte in triplo al buio e alla temperatura di 20 C Le analisi per la descrizione della comunita microbica abbondanze microbiche produzione batterica attivita enzimatiche extracellulari e test BIOLOG non sono riportate poich in via di elaborazione Risultati Dall analisi della concentrazione del DOC si osserva come la frazione LMW contribuisca per il 51 al TDOC mentre le frazioni VHMW e HMW contribuiscano per il 26 e 23 rispettivamente Dalle misure dei tassi di respirazione osserviamo che la frazione HMW mineralizzata pi lentamente 2 7 umol C h mmol TDOC delle altre 4 9 e 4 5 umol C h mmol TDOC VHMW e LMW rispettivamente I tempi di turnover stimati variano da 1 settimana per la VHMW e LMW a 2 settimane per la HMW L arricchimento di nutrienti induce in generale un innalzamento delle velocit di mineralizzazione riducendo del 30 il tempo di turnover L ampio contributo della frazione LMW e la relativamente elevata velocit di rimozione suggerisce la composizione eterogenea di questa frazione molecolare a diver
267. e il coro ovvero una produzione di suoni praticamente continua tale da non poter distinguere le emissioni di un animale da quelle di un altro Questo parametro potrebbe essere indice di un maggior numero di individui coinvolti nella produzione di suoni o di una maggior motivazione all attivit sonifera da parte degli stessi individui In ogni caso la presenza del coro evidenzia una rilevanza del sito nel contesto riproduttivo della specie Ulteriori studi futuri serviranno a confermare i dati qui raccolti Conclusioni La tecnica del passive listening ha consentito di individuare aggregazioni riproduttive di corvina suggerendo come la presenza di strutture al fondo in un ambiente interdetto alla pesca professionale quali le mitilicolture agisca da FAD per una specie ittica tipica di substrati rocciosi Inoltre sulla base dei dati raccolti e del ruolo delle emissioni di corvina durante la fase riproduttiva Picciulin et al 2013b si pu concludere che aree simili a quella di studio possono costituire un habitat appropriato per la riproduzione di questa specie dall elevato interesse economico e conservazionistico Bibliografia COLLA S INNANGI S TONIELLI R BOLDRIN A BRIGOLIN D PRANOVI F 2014 Mapping seafloor habitat an integration between different approaches Book of Abstract 24 Congresso della S It E Ferrara 15 17 settembre 2014 122 p PICCIULIN M BOLGAN M CODARIN A FIORIN R ZUCCHETTA M MALAVASI S
268. e metodi L esperimento stato condotto nei mesi estivi del 2012 in una zona A dell Area Marina Protetta Tavolara Punta Coda Cavallo AMP TPCC davanti all isola di Molarotto 40 52 28 N 9 46 40 E Sul fondale roccioso gi invaso da C cylindracea a circa 10 m di profondit sono state preparate 15 unit sperimentali 40x40 cm attribuite in modo random a tre trattamenti rimozione dei popolamenti macroalgali compresa C cylindracea A rimozione di C cylindracea C e controlli C La composizione della comunit macroalgale e l abbondanza dei gruppi tassonomici presenti di ricoprimento del substrato sono state definite analizzando secondo la metodologia descritta da Dethier et al 1993 le immagini raccolte nel corso dei 2 campionamenti fotografici effettuati all inizio ed alla fine dello studio To 25 luglio T 24 ottobre I dati raccolti sono stati analizzati statisticamente mediante analisi multivariate PERMANOVA ed univariate ANOVA rispettivamente sulla composizione dei popolamenti sia in Tp sia T e sulla copertura di C cylindracea Risultati Nei popolamenti macroalgali considerati sono state registrate al tempo T percentuali di ricoprimento del substrato pi elevate nelle unit in cui era stata rimossa C cylindracea C 83 rispetto alle altre unit C 68 e A 73 ma le analisi statistiche hanno escluso l esistenza di differenze significative tra popolamenti in relazione al trattamento
269. e of its formation and specie specific ontogenetic changes according to Morales Nin 1986 Further studies have to focus on protein content variation with fish age especially because the organic matrix acts as a guide to the deposition and growth of otoliths Tab 1 Protein yields Rese proteiche L cav L die T las H dac Otoliths weight mg 191 0 192 0 298 0 1040 0 30 0 220 130 001 Urea soluble fraction ug 11 0 11 0 17 0 1 6 Protein Yield by Acetic Acid extraction ug protein mg otoliths 0 16 0 11 0 04 0 00 Protein Yield by Urea extraction ug protein mg otoliths 0 058 0 057 0 057 0 002 References BORELLI G MAYER GOSTAN N DE PONTUAL H BEOUF G PAYAN P 2001 Biochemical relationships between endolymph and otolith matrix in the trout Oncorhynchus mykiss and Turbot Psetta maxima Calc Tissue Int 69 356 364 DAUPHIN Y DUFOUR E 2003 Composition and properties of the soluble organic matrix of the otolith of a marine fish Gadus morhua Linne 1758 Teleostei Gadidae Comp Biochem Phys A 134 3 551 561 GAULDIE R W 1999 Ultrastructure of lamellae mineral and matrix components of fish otolith twinned aragonite crystals implications for estimating age in fish Tissue Cell 31 138 153 MORALES NIN B 1986 Structure and composition of otoliths of Cape Hake Merluccius capensis S Afr J Sci 4 3 10 MOTTA C M AVALLONE B BALASSONE G BALSAMO G FAS
270. e pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 B Lor S FARINA G BRUNDU I GUALA M BAROLI Fondazione IMC International Marine Centre Onlus Loc Sa Mardini Torregrande 09170 Oristano Italia Dipartimento di Scienze Ecologiche e Biologiche DEB Universita della Tuscia Largo dell Universit 01100 Viterbo Italia b loi imc it org REPRODUCTIVE CYCLE OF PARACENTROTUS LIVIDUS AT TWO SARDINIAN COASTAL AREAS CICLO RIPRODUTTIVO DI PARACENTROTUS LIVIDUS IN DUE AREE COSTIERE DELLA SARDEGNA Abstract Reproductive cycle of the sea urchin Paracentrotus lividus Lamarck 1816 at two Sardinian areas subjected to different levels of fishing pressure was evaluated by the analysis of the gonadosomatic index GSI and histological examinations of gonads The two populations examined showed different annual GSI trends as well as slightly different timelines in the reproductive cycle The histological approach together with the analysis of the gonadosomatic index resulted to be a valuable tool for a correct description of the reproductive cycle of P lividus Key words reproductive cycle gonadosomatic index histology Paracentrotus lividus Sardinia Introduction Gonads of Paracentrotus lividus Lamarck 1816 are very appreciated in Mediterranean countries and their harvesting has been leading to the drastic depletion of sea urchin populations in many areas Sellem
271. e print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 A A SFRISO Dipartimento di Scienze Molecolari e Nanosistemi Universita Ca Foscari di Venezia Calle Larga S Marta 2137 30123 Venezia Italia asfriso hotmail it MACROALGAE GROWTH RATES AND BIOMASS PRODUCTION IN EUTROPHIC AREAS OF THE VENICE LAGOON TASSI DI CRESCITA E PRODUZIONE DI BIOMASSA MACROALGALE IN AREE AD ELEVATA TROFIA DELLA LAGUNA DI VENEZIA Abstract Four seaweeds Ulva rigida Gracilaria gracilis Gracilariopsis longissima and Gracilaria vermiculophylla were monitored from May to October to assess the growth rates and the biomass production in two eutrophic areas of the Venice lagoon The growth patterns of the four species displayed a similar behaviour during the year Ulva grew fastest up to 17 day followed by Gracilariopsis and G gracilis in the early summer while G vermiculophylla grew slower mainly in spring Key words Ulva Gracilaria Gracilariopsis growth rates biomass production Introduction In Italy the seaweeds collected by companies or local governments were considered as waste by law till the emanation of the decrees 152 2006 and 2 2009 becoming a new abundant and unused resource A sustainable use of this raw material begins from the study of its productivity and growth patterns For this purpose four species were selected for their abundance fast growth and potential biotechnological and commer
272. e species resulted scantly studied Tirado amp Salas 1999 and limited information are available on its distribution and population structure in the Adriatic Sea The present contribution reports the remarkable finding of juveniles of D semistriatus in the South Adriatic Sea along the Apulian coasts providing a description of the population structure Materials and methods A total of 68 sampling stations were investigated during February March 2013 in the South Adriatic Sea along the coasts of Apulia in the framework of the National Project Messa a punto del sistema di monitoraggio annuale dello stato dei molluschi Bivalvi oggetto di sfruttamento mediante draga idraulica supported by the Italian Minister for Agriculture Food and Forestry Policies Sampling was carried out between the Saccione river and Barletta by using a hydraulic dredge with 2 m of iron opening A net sampler of 40 cm opening and 7 mm of mesh was placed in the dredge All the collected species were identified and living specimens of D semistriatus were measured considering the Shell Length SL greatest antero posterior length mm Length frequency distribution was analysed to describe the population structure Mean length with standard error median and mode were calculated together with the coefficients of kurtosis and skewness Results Finding of D semistriatus occurred on a sandy seabed at 2 m in depth localized 0 125 nautical miles far from the coastline star
273. e sue innumerevoli cavit influenza le micro condizioni di illuminazione e sedimentazione Il coralligeno ospita inoltre una grande quantit di organismi target della pesca professionale mentre le sue caratteristiche estetiche e paesaggistiche lo rendono l ambiente d elezione del turismo subacqueo Mediterraneo Impatti I popolamenti coralligeni si sono rivelati molto sensibili ai recenti fenomeni di riscaldamento globale che ha determinato importanti conseguenze sulla struttura e composizione della comunit spesso in conseguenza di estesi fenomeni di mortalit di massa Cerrano et al 2000 Ciononostante i principali impatti sulle formazioni coralligene sono principalmente di origine antropica La sensibilit di queste comunit 8 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 alle variazioni di salinit e torbidit dell acqua ha comportato evidenti processi di degrado in vicinanza di effluenti urbani mentre danni ad alcuni gruppi poriferi gorgonie madreporari briozoi ascidie solitarie sono da imputarsi anche all impatto del turismo subacqueo di massa Luna P rez et al 2010 Tuttavia la pesca che rappresenta il principale fattore d impatto sulle comunit coralligene soprattutto quando viene praticata sugli affioramenti rocciosi oltre i 50 m di profondit dove lo strascico consentito Questo tipo di pesca viene talvolta operato in prossimit dei banchi
274. eaufort lt 3 Different platforms of observation ferries sailing vessels 226 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 inflatables fishing motor boats oceanographic vessel were employed A group of common dolphin was defined as an aggregation of all the dolphins within visual range A visual count or estimate of the number of animals in the focal group was recorded Age class was assessed whenever possible through size based estimates In some cases common dolphins were individually photo identified through long term natural marks on dorsal fins Results A total of 266 encounters with 4675 common dolphins was recorded 40 from ferries and 226 from other platforms The species was mainly recorded in the central n 73 sightings principally around Ischia and southern n 109 sightings mainly in the Strait of Messina Tyrrhenian sea in both pelagic and neritic habitats A number of 54 encounters were located in the Pelagos Sanctuary area 24 in the Sicily Channel principally around Lampedusa Island and 5 in the Western Ionian Group size ranged from 1 to gt 100 individuals with differences in average between study areas PS 5 9 6 3 CT 33 5 35 1 ST 13 9 10 6 SC 34 9418 8 WI 29 8 18 9 The presence of immature animals juveniles calves and newborns was repeatedly documented around Ischia island only Mixed groups of common dolphin with other cetacean species were encountere
275. ed Key words recruitment fouling community artificial substrata bioremediation Mediterranean Sea Introduzione Recentemente la ricerca nel campo della mitigazione di impatti ambientali degli impianti di maricoltura si rivolta verso lo studio delle potenzialit di depurazione di organismi biorimediatori biofilter Angel e Spanier 2002 La dinamica di colonizzazione del fouling in due impianti di maricoltura stata analizzata al fine di caratterizzare gli aspetti quali quantitativi del popolamento e indagare le dinamiche temporali e le condizioni ambientali che favoriscono l insediamento e la crescita di organismi sessili da impiegare come potenziali biorimediatori In questo lavoro sono presentati i risultati preliminari di uno studio condotto su substrati artificiali posti in acqua in diversi periodi dell anno e prelevati dopo tre mesi di immersione Materiali e metodi Il disegno sperimentale complessivo prevede l analisi di 288 pannelli artificiali con campionamenti replicati nel tempo tra il 2013 e il 2015 I pannelli sono costituiti da quadrati di plexiglas di 15 cm di lato posti in acqua in ciascuno dei due siti di campionamento individuati presso due impianti di maricoltura nel Mar Grande di Taranto e nel Golfo di Gaeta Ogni serie di campionamento costituita da 12 pannelli mantenuti in acqua per 3 6 9 e 12 mesi in tre repliche a tre diverse profondit in superficie a 3 m e a 6 m I periodi di immersione di cia
276. ed extruded feeds J World Aquacult Soc 28 91 96 PHILIPS K HAMID N SILCOCK P SEWELL M A BARKER M WEAVER A THEN S DELAHUNTY C BREMER P 2010 Effect of manifactured diets on the yield biochemical composition and sensory quality of Evechinus chloroticus sea urchin gonads Aquaculture 308 49 59 44 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 D MAURIZIO S CARBONARA R D ADAMO A NOVELLI A FABBROCINI Consiglio Nazionale delle Ricerche Istituto di Scienze Marine ISMAR UOS Lesina Via Pola 4 71010 Lesina FG Italia adele fabbrocini fg ismar cnr it Azienda Agricola Ittica Caldoli Poggio Imperiale FG Italia GESTIONE INTEGRATA DI AREE MARINO COSTIERE PRODUZIONE DI GIOVANILI DI PARACENTROTUS LIVIDUS LAMARCK 1816 PER PROVE DI RIPOPOLAMENTO SPERIMENTALE INTEGRATED MANAGEMENT OF COASTAL AREAS PRODUCTION OF JUVENILES OF PARACENTROTUS LIVIDUS LAMARCK 1816 TO BE USED IN RESTOCKING PROGRAMS Abstract Paracentrotus lividus Lamarck 1816 juveniles were producted in a medium scaled system for their further use in restocking programs Adult urchins were reared up to gonad maturation Larvae coming from the obtained gametes after metamorphosis were reared up to the size of 5 mm The results show the feasibility of this system in programs for the integrated management of resources in coastal areas Key words reproduction restoc
277. eed the assessment of the status of P nobilis in this heavily impacted environment and the correct management of this species are surely necessary References ADDIS P SECCI M BRUNDU G MANUNZA A CORRIAS S CAU A 2009 Density size structure shell orientation and epibiontic colonization of the fan mussel Pinna nobilis L 1758 Mollusca Bivalvia in three contrasting habitats in an estuarine area of Sardinia W Mediterranean Sci Mar 73 143 152 BUTLER A VICENTE N DE GAULEJAC B 1993 Ecology of the pterioid bivalves Pinna bicolor Gmelin and Pinna nobilis L Mar Life 3 37 45 CENTODUCATI G TARSITANO E BOTTALICO A MARVULLI M LAI O R CRESCENZO G 2007 Monitoring of the endangered Pinna nobilis Linn 1758 in the Mar Grande of Taranto Ionian Sea Italy Environ Monit Assess 131 339 347 CERRUTI A 1939 Ulteriori notizie sull allevamento della Pinna nobilis L nel Mar Piccolo di Taranto La Ricerca Scientifica 18 110 1121 FERRAIOLO L FORLEO V 1928 Porpora e bisso Bollettino della Provincia Ionica 2 4 19 HENDRIKS LE TENAN S TAVECCHIA G MARBA N JORDA G DEUDERO S ALVAREZ E DUARTE C M 2013 Boat anchoring impacts coastal populations of the pen shell the largest bivalve in the Mediterranean Biol Conserv 160 105 113 PARENZAN P 1984 II Mar Piccolo di Taranto Camera di Commercio Industria Artigianato e Agricoltura di Taranto 319 pp VAZQUEZ LUIS M MARC
278. een investigated by means of habitat modeling techniques mainly to address effective management and protection policies and cetaceans play an important role in this context The bottlenose dolphin Tursiops truncatus has been investigated with habitat modeling techniques since 1997 The aim of this study was to develop a predictive model of bottlenose dolphin distribution and habitat preference in the whole area of Pelagos Sanctuary We focused on the application of machine learning techniques Random Forest Key words cetology ecology habitat selection Pelagos Sanctuary Introduzione Nel Santuario Pelagos il tursiope abita soprattutto acque costiere profondit inferiore a 200 metri e sembra essere pi densamente presente nella porzione orientale del Santuario e lungo la costa nord occidentale della Corsica Gnone et al 2011 L obiettivo di questo lavoro proporre un modello di distribuzione del tursiope nel Santuario Pelagos utilizzando la Random Forest RF Cutler et al 2007 un analisi spaziale basata sulle reti neurali con un set di dati di avvistamento di tursiope provenienti da 10 gruppi di ricerca che operano nel Santuario Pelagos La RF stata utilizzata precedentemente in un area pi piccola e ha mostrato risultati pi accurati rispetto a quelli ottenuti con altre analisi spaziali Marini et al 2015 Materiali e metodi Per lo studio sono state selezionate due aree di training il Levante Ligure e la costa nor
279. efano dimostra che l approccio sistematico applicato nell ambito della Pianificazione Spaziale Marittima consente di ottimizzare le politiche di conservazione dell ambiente marino minimizzando i conflitti d uso del territorio e fornendo strumenti incisivi anche per riconsiderare le attuali zonazioni delle AMP Bibliografia BALL I R POSSINGHAM H P 2002 MARXAN A reserve system selection tool DI DONATO R DI STEFANO F RUSSO G F 2012 Distribuzione spaziale degli habitat e dell uso del territorio nell AMP di Capo Rizzuto valutazione della migliore zonazione Biol Mar Mediterr 19 1 100 103 FRANZESE P P RUSSO G F ULGIATI S 2008 Modelling the interplay of environment economy and resources in Marine Protected Areas A case study in Southern Italy Ecological Questions 10 91 97 MARGULES C R PRESSEY R L 2000 Systematic conservation planning Nature 405 243 253 27 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 A Cossu M DE LUCA Dipartimento di Architettura Urbanistica e Design DADU Universita di Sassari Via Piandanna 4 07100 Sassari Italia acossu uniss it MONITORAGGIO HABITAT E SPECIE MARINE COSTIERE NEL SIC ZPS ISOLA DELL ASINARA HABITAT MONITORING AND COASTAL MARINE SPECIES IN SIC ZPS ASINARA ISLAND Abstract Maritime Spatial Planning MSP is the European Union s new community programme for its monitoring
280. elative alla difficolt di identificazione alla relativa rarit ed alle difficolt di campionamento con mezzi tradizionali l ecologia dei ceriantari mediterranei cos come la loro distribuzione ancora largamente sconosciuta Questo particolarmente vero per quel che riguarda i fondi della cosiddetta zona crepuscolare per i quali risulta impossibile una ispezione diretta tramite operatori subacquei I dati ottenuti da questo studio evidenziano come questi cnidari rappresentino una componente non trascurabile del megazoobenthos profondo talvolta diventando l elemento determinante della comunit Alcune popolazioni estremamente dense come nel caso di A oligopodus potrebbero rappresentare un elemento chiave nei trasferimenti energetici tra le catene trofiche planctoniche e quelle dei fondi mobili Dati simili sono stati descritti per l Atlantico nord occidentale Shepard et al 1986 Sebbene i dati qui riportati siano ampiamente da confermare a livello tassonomico possibile inoltre ipotizzare differenze nella distribuzione di alcune specie come nel caso di P solitarius pi settentrionale di P dohrni Bibliografia BO M CANESE S SPAGGIARI S PUSCEDDU A BERTOLINO M ANGIOLILLO M GIUSTI M LORETO M F SALVATI E GRECO S BAVESTRELLO G 2012 Deep Coral Oases in the South Tyrrhenian Sea PlosOne 7 doi 10 1371 journal pone 0049870 MARISCAL R N CONKLIN E J BIGGER C H 1977 The ptychocyst a major new c
281. elevant scales of variability of the benthic allochthonous microalga Chrysophaeum taylorii Mar Biol 161 1787 1798 DE VAUGELAS J MEINESZ A BALLESTEROS E ANTOLIC B BELSHER T CASSAR N CECCHERELLI G CINELLI F COTTAROLDA J M ORESTANO C GRAU A M JAKLIN A MORUCCI C RELINI M SANDULLI R SPAN A TRIPALDI G ZULJEVIC A ZAVODNIK N VAN KLAVEREN P 1999 Standardization proposal for the mapping of Caulerpa taxifolia expansion in the Mediterranean Sea Ocean Acta 22 1 85 94 MACRI G NAVONE A SPALLA A CARONNI S 2014 Un prototipo GIS per il monitoraggio e la gestione delle specie aliene vegetali nell Area Marina Protetta Tavolara Punta Coda Cavallo NE Sardegna Biol Mar Mediterr 21 1 349 350 ZURLINI G AMADIO V ROSSI O 1999 A landscape approach to biodiversity and biological health planning the Map of Italian Nature Ecosyst Health 5 4 294 311 35 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 A PETROCELLI E CECERE G PORTACCI C MICHELI L DE CECCO S MARTINI F BORFECCHIA Istituto per 1 Ambiente Marino Costiero IAMC CNR Via Roma 3 74123 Taranto Italia antonella petrocelli iamc cnr it ENEA Centro Ricerche Casaccia C P 2400 00123 S Maria di Galeria RM Italia PRELIMINARY MAPPING OF THE ALIEN SEAWEED HYPNEA CORNUTA RHODOPHYTA GIGARTINALES IN THE MAR PICCOLO OF TARANTO SOUTHERN ITALY
282. eliminary results on organic and mineral fractions in otoliths of three fish species from Adriatic Sea Biol Mar Mediterr 21 1 310 312 149 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 F PALMAS A OLITA A SABATINI Department of Life Science and Environment University of Cagliari Via T Fiorelli 1 09126 Cagliari Italy fpalmas unica it CNR IAMC Institute for Coastal Marine Environment Oristano Section Italy MODELING THE GIANT RED SHRIMP LARVAL DISPERSAL PROCESSES IN THE CENTRAL WESTERN MEDITERRANEAN MODELLIZZAZIONE DEI PROCESSI DI DISPERSIONE LARVALE DEL GAMBERO ROSSO NEL MEDITERRANEO CENTRO OCCIDENTALE Abstract A preliminary evaluation through a 3D egg larvae dispersion model of the potential dispersal areal connected to the persistence spawning areas of Aristaeomorpha foliacea Risso 1827 has been performed in the Sardinian seas Two scenarios have been simulated one with eggs and larvae passively advected by 3D currents PT another where eggs account for a positive buoyancy inducing an initial vertical migration VM The preliminary results provide precious suggestions on the physical biological processes governing the dispersal and concentration of larvae in the Sardinian slope region areas Key words Aristaeomorpha foliacea spawning areas larvae Lagrangian transport Sardinian seas Introduction The early life history of many marine taxa i
283. els in treated and control clams suggests that the organoleptic features are unaffected thus shouldering this treatment before clam introduction into the market Key words oxidative stress germicide treatment Philippine clam TBARs organoleptic features Introduzione Le vongole veraci filippine provenienti da allevamenti in acque classificate B e C come la Sacca di Goro sono commercializzate vive in condizioni che consentono la sopravvivenza di contaminanti microbici Per essere destinate al consumo devono essere sottoposte a depurazione che risulta efficace sui contaminanti fecali ma non sulla quota endogena di Vibrio spp Serratore 2004 Disinfettanti commerciali con forte potere ossidante sono gia stati utilizzati in acquacoltura Frerichs et al 2000 ma mai saggiati per depurare vongole prima della loro immissione sul mercato Uno dei possibili problemi legato a tale utilizzazione lo stress ossidativo con ricadute negative sulla qualit del prodotto In questo studio parte di un progetto pi ampio sull efficacia del germicida su Vibrio spp e virus sono state affrontate due possibili problematiche gli effetti tossici del germicida in vitro e la potenziale insorgenza di degradazioni ossidative nei tessuti in seguito a trattamenti in vivo Materiali e metodi Sono state utilizzate vongole Venerupis philippinarum Adams amp Reeve 1850 di taglia commerciale provenienti da allevamenti nell Adriatico settentrionale Le
284. emissioni acustiche e il tasso di pulses calcolato per minuto 119 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 di registrazione secondo la metodologia proposta da Picciulin et al 2013a Usando il software di analisi SpectraPlus 5 0 Pioneer Hill Software WA U S A calibrato con un segnale di 100 mV RMS 1 kHz sono state calcolate per ogni campione acustico il livello di pressione sonora SPL Sound Pressure Level ovvero venti volte il logaritmo in base 10 del rapporto della media quadratica della pressione sonora rilevata nei 10 minuti di registrazione e il valore di riferimento per la pressione sonora in acqua pari a 1 uPa per la banda di frequenze compresa tra 50 e 20000 Hz e la pressione delle bande di 1 3 di ottava Robinson et al 2014 Risultati Emissioni acustiche prodotte da corvina sono state identificate in diversi punti interni alla mitilicoltura Analizzando il numero di pulses prodotti per unit di tempo e la loro intensit stata ricostruita la distribuzione spaziale degli individui che risultano massimamente aggregati nell area caratterizzata delle strutture sommerse Registrazioni N 5 effettuate all esterno dell impianto e lontano dalle strutture sommerse presentano invece suoni molto rari e distanti ovvero caratterizzati da una minore intensit pur a parit di rumore di fondo nelle due condizioni La produzione sonora registrata era prevalentement
285. emistriatus resulted affected by fishing impact before reaching the maturity size References MANCA ZEICHEN M AGNESI S MARIANI A MACCARONI A ARDIZZONE G D 2002 Biology and population dynamics of Donax trunculus L Bivalvia Donacidae in the South Adriatic coast Italy Estuar Coast Shelf S 54 971 982 NEUBERGER CYWIAK L ACHITUV Y MIZRAHI L 1989 The ecology of Donax trunculus Linnaeus and Donax semistriatus Poli from the Mediterranean coast of Israel J Exp Mar Biol Ecol 134 3 203 220 PERES J M PICARD J 1964 Nouveau manuel de bionomie benthique de la Mer M diterran e Rec Trav Sta Mar Endoume 31 47 5 137 TIRADO C SALAS C 1999 Reproduction of Donax venustus Poli 1795 Donax semistriatus Poli 1795 and intermediate morphotypes Bivalvia Donacidae in the littoral of Malaga Southern Spain Mar Ecol 20 2 111 130 67 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 O DELL ACQUA T BREY M VACCHI M CHIANTORE Dipartimento di Scienze della Terra dell Ambiente e della Vita DISTAV Universit di Genova Corso Europa 26 16132 Genova Italy ombretta dellacqua gmail com Alfred Wegener Institute Bremerhaven Germany 7ISPRA Italy PREDATION IMPACT OF THE NOTOTHENIOID FISH TREMATOMUS BERNACCHII ON THE SIZE STRUCTURE OF THE SCALLOP ADAMUSSIUM COLBECKI IN TERRA NOVA BAY ROSS SEA ANTARCTICA EFFETTO
286. endere appieno gli effetti del trattamento occorrer verificare l efficienza del sistema antiossidante essendo note nella specie variazioni stagionali del sistema antiossidante Bocchetti ef al 2008 oltre che della composizione lipidica Bibliografia BANNI M BOURAOUI Z GHEDIRA J CLEARANDEAU C JEBALI J BOUSSETTA H 2009 Seasonal variation of oxidative stress biomarkers in clams Ruditapes decussatus sampled from Tunisian coastal areas Environ Monit Assess 155 119 128 BOCCHETTI R VIRNO LAMBERTI C PISANELLI B RAZZETTI E M MAGGI C CATALANO B SESTA C MARTUCCIO C GABELLINI M REGOLI F 2008 Seasonal variations of exposure biomarkers oxidative stress responses and cell damage in the clams Tapes philippinarum and mussels Mytilus galloprovincialis from Adriatic Sea Mar Environ Res 66 24 26 CIMA F MATOZZO V MARIN M G BALLARIN L 2000 Haemocytes of the clam Tapes philippinarum Adams amp Reeve 1850 morphofunctional characterisation Fish Shell Immunol 10 677 693 FRATINI G F LOIS S PAZOS M PARISI G MEDINA I 2012 Volatile profile of Atlantic shellfish species by HS SPME GC MS Food Res Int 48 856 865 FRERICHS G M TWEEDIE A STARKEY W G RICHARDS R H 2000 Temperature pH and electrolyte sensitivity and heat UV and disinfectant inactivation of sea bass Dicentrarchus labrax neuropathy nodavirus Aquaculture 185 13 24 SERRATORE P 2004 Efficacia del
287. ene 60 250 300 R2cyiB TGG TTT GAT GTG TGC AGG GGT G cytB gene 60 250 300 Conclusions We have developed experimental protocols for determining by sex determination and genetic analysis variability the population structure of the S coeruleoalba in the Gulf of Taranto Our immediate goal is to improve the way of collecting samples since one important issue with our method is related to the adequacy of the samples function of the total skin amount collected However the so far obtained results will be a critical support to ethological data for determination of the S coeruleoalba genetic population structure within the Gulf of Taranto References DIMATTEO S SINISCALCHI M ESPOSITO L PRUNELLA V BONDANESE P BEARZI G QUARANTA A 2011 Encounters with pelagic and continental slope cetacean species near the northern shore of the Gulf of Taranto Italy Ital J Zool 78 1 130 132 FANIZZA C DIMATTEO S POLLAZZON V PRUNELLA V CARLUCCI R 2014 An update of the occurrence of cetaceans in the Gulf of Taranto Western Central Mediterranean Sea Biol Mar Mediterr 21 1 373 374 FARRO A P C ROLLO M M R SILVA J M JR MARINO C L 2008 A simple protocol for a low invasive DNA accessing in Stenella longirostris Cetacea Delphinidae Pan American Journal of Aquatic Sciences 3 2 130 134 GASPARI S AZZELLINO A AIROLDI S HOELZEL R 2007 Social kin associations and genetic structuring of striped dolphin
288. entonici e g Morato et al 2006 2008 mentre la loro influenza sugli organismi pelagici poco studiata Solo recentemente sono stati effettuati degli studi per verificare gli effetti delle montagne sottomarine sull aggregazione di diverse specie pelagiche Partendo da questi presupposti stata analizzata la distribuzione di S coeruleoalba Meyen 1833 al fine di confermare l attrattivit delle montagne sottomarine su questo predatore pelagico in Mar Tirreno stato inoltre possibile identificare le caratteristiche morfologiche delle SM che maggiormente influenzano la distribuzione di S coeruleoalba e dunque di classificare le strutture in base al loro potere attrattivo Materiali e metodi Al fine di sviluppare il modello di regressione Random Forest Breiman 2001 l area di studio 9 1 16 0 longitudine E 37 6 42 9 latitudine N stata suddivisa in un grigliato regolare di 3657 celle di 5x5 NM miglia nautiche 1852 m e ad ogni centro cella sono state assegnate le seguenti variabili pendenza e profondit del fondale distanza da costa e dalla pi vicina SM pendenza SM estensione e perimetro della base elevazione SM orientazione della struttura profondit del picco presenza assenza di S coeruleoalba Per l analisi sono stati considerati 467 avvistamenti di S coeruleoalba provenienti dal database on line OBIS SEAMAP Halpin et al 2009 campionamenti aerei nell area tirrenica effettuati dall istituto Tet
289. er of Excellence for Advanced Science National Research Center Dokki Giza Egypt Centro Interdipartimentale di Ricerca Ambiente CIRAM Universit di Napoli Federico II Napoli Italia DNA BARCODING E PLEURONETTIFORMI APPLICAZIONE NEL CONTROLLO DELLE FRODI ALIMENTARI DNA BARCODING AND PLEURONECTIFORMES APPLICATION IN THE CONTROL OF FOOD FRAUDS Abstract Progress made in food technology permits to improve the labeling using barcode The molecular identification by cytochrome oxidase I COI a mitochondrial gene with taxonomic value allowed to discriminate the Pleuronectiformes species examined and to demonstrate the effectiveness of the analysis of the variability in the application area as well as in basic research In this content the barcoding was used as a marker in the replacement of valuable edible fish species with others of lower value Key words mislabelling Pleuronectiformes barcoding fraud Introduzione La forte espansione globale nel settore ittico e il commercio di prodotti della pesca lavorati in combinazione con la scarsit delle risorse marine e la crisi economica mondiale hanno portato ad un notevole aumento delle sostituzioni di specie ittiche pregiate con altre di minor valore Rasmussen e Morrissey 2009 In particolare l alto grado di trasformazione di alcuni prodotti non consente una facile e attendibile analisi dei caratteri morfologici per cui si rende necessario l utilizzo di marcatori mo
290. ere facilmente mantenuto in laboratorio e permette l allestimento di test rapidi economici e riproducibili Iori et al 2014 I test sono stati eseguiti sia sull essudato grezzo sia su estratti dell essudato stesso ottenuti tramite solventi organici Sono state inoltre analizzate le modalit di secrezione dell essudato e alcune sue propriet chimiche Materiali e metodi Esemplari di A marina originari della laguna di Venezia sono stati trasportati refrigerati a 8 C in laboratorio a Modena Qui sono stati estratti dal sedimento e posti in vasche di stabulazione contenenti acqua marina a salinit 30 33 o a temperatura ambiente Gli individui sono stati trasferiti in piastre Petri per 15 minuti senza sgocciolarli Il materiale secreto dai vermi stato raccolto trasferito in fiale e centrifugato Il sopranatante omogeneo giallo e limpido indicato di seguito essudato stato diviso in aliquote met delle quali sono state congelate a 80 C La maggior parte dell essudato fresco stato sottoposto ad estrazione sequenziale con etere diclorometano DCM e n butanolo Dopo avere rimosso il solvente tramite evaporatore rotante gli estratti secchi sono stati pesati e risospesi in DMSO Altre aliquote sono state usate per valutare l effetto di variazioni del pH sul colore dell essudato con l aggiunta di HCl IN o NaOH IN I test acuti con D gyrociliatus Iori et al 2014 sono stati allestiti a partire da colture
291. ermiculophylla il taxon dei Gasteropodi risultato il pi numeroso 34 del totale seguito dagli Anfipodi 25 7 dai Bivalvi 25 6 e dai Policheti 11 Le specie dominanti sono risultate essere Ecrobia ventrosa Gammarus aequicauda Microdeutopus gryllotalpa Arcuatula senhousia Hydroides dianthus e Neanthes succinea Un notevole incremento nell abbondanza del mitilide non indigeno A senhousia stato registrato 88 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 durante il periodo di studio con punte fino a 7 ind gPS nell estate 2010 Dal punto di vista trofico il gruppo maggiormente rappresentato risultato quello dei detritivori 41 1 del totale seguito dai sospensivori 36 4 dagli erbivori 21 8 e dai predatori 0 7 Nel periodo di indagine la ricchezza oscillata tra 10 novembre 2007 e 17 ottobre 2008 e maggio 2010 specie mentre la diversit tra 1 1 giugno 2009 e 2 3 novembre 2006 100 R 0 411 Anfipodi 25 7 Decapodi 0 5 Insetti 1 6 Gasteropodi 33 9 e e Isopodi mma 25 e t sopodi 1 7 0 Policheti 2 4 i A o 00 00 600 800 1000 11 Bivalvi Nind 25 6 Fig 1 a Relazione tra la biomassa algale gPS e l abbondanza della fauna b composizione media della comunit epifaunale su G vermiculophylla a Relationship between algal biomass gPS and macrofaunal abundance b average composit
292. err 15 Suppl 1 323 373 HAUENSCHILD C 1951 Nachweis der sogenannten atoken Geschlechtsform des Polychaeten Platynereis dumerilii Aud et M Edw Als eigene Art auf Grund von Zuchtversuchen Zool Jb Anat 63 107 128 HELM C ADAMO H HOURDEZ S BLEIDORN C 2014 An Immunocytochemical window into the development of Platynereis massiliensis Annelida Nereididae Int J Dev Biol 58 613 622 LUCEY N M LOMBARDI C DE MARCHI L SCHULZE A GAMBI M C CALOSI P 2014 Marine species that protect their offspring are more tolerant to the long term impacts of ocean acidification Gordon Research Conference 6 11 July 2014 New Hampshire USA Abstract RICEVUTO E KROEKER K J FERRIGNO F MICHELI F GAMBI M C 2014 Spatio temporal variability of polychaete colonization at volcanic CO vents indicates high tolerance to ocean acidification Mar Biol 161 12 2909 2919 SCHNEIDER S FISCHER A DORRESTEIJN A W 1992 A morphometric comparison of dissimilar early development in sibling species of Platynereis Annelida Polychaeta Roux s Arch Dev Biol 201 243 256 This project is part of the G V Open University PhD thesis funded by the Stazione Zoologica Anton Dohrn A M G was funded by the PON MODO project Regione Campania 99 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 A ZENONE F BADALAMENTI G CARTA G DI STEFANO C FRONG
293. err 16 1 2 18 EKMAN S 1953 Zoogeography of the sea Sidwick and Jackson London 417 pp 73 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 F FERRIGNO L APPOLLONI R SANDULLI P CASORIA G F RUSSO Department of Science and Technology DiST University of Naples Parthenope Centro Direzionale Isola C4 80143 Napoli Italy federica ferrigno uniparthenope it DEEP CORALLIGENOUS ASSEMBLAGES OFF PUNTA CAMPANELLA TYRRHENIAN SEA WITH SPECIAL REFERENCE TO SOME FACIES WITH FAN CORALS BIOCENOSI CORALLIGENE PROFONDE DI PUNTA CAMPANELLA MAR TIRRENO CON PARTICOLARE RIFERIMENTO ALLE FACIES A GORGONIE Abstract High definition videos of deep coralligenous assemblages in a site located off Punta Campanella were acquired by ROV Frames were extracted in order to study the benthic communities and the dominant facies A relatively healthy coralligenous biocoenosis resulted the dominant habitat in the investigated site Corallium rubrum Eunicella cavolinii Paramuricea clavata and encrusting sponges represent the dominant facies Key words coralligenous assemblages fan corals facies sea walls ROVs Introduction Coralligenous assemblage is a hard bottom biocoenosis characteristic of Mediterranean Sea It originates from biogenic formations produced by the accumulation of encrusting calcareous algae growing at low irradiance conditions Ballesteros 2006 Bei
294. erved in 70 ethanol Diet was expressed as percentage by number by weight by frequency of occurrence by index of relative importance IRI Pinkas et al 1971 Tab 1 Results and conclusions The stomach contents of P erythrinus were composed of 56 different prey species belonging to 6 major taxa Tab 1 The dominant prey were Polychaeta 18 prey species and Crustacea 20 followed by the Sipunculid Aspidosiphon muelleri Polychaeta were mainly represented by Nephtys sp Sternaspis scutata Aponuphis sp Glycera sp Among crustaceans the most abundant preys were benthic decapods such as the shrimps Processa sp Philocheras sp Alpheus glaber Upogebia sp and brachyuran crabs as Goneplax rhomboides Ebalia sp Secondary preys like benthic Mollusca Bivalvia mainly Abra sp and Gastropoda mainly 162 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Nassarius sp were recorded Teleostei were mainly represented by benthic species Holoturoidea were also found Significant differences were found between diet and fish size Juveniles lt 110 mm diet was more based on infaunal preys as Polychaeta J A 11 2702 df 1 P 0 00078 In conclusion this study confirmed that P erythrinus belongs to the benthic carnivore group according to Fanelli et al 2011 and supporting the hypothesis of the greater complexity and length of benthic trophic webs Tab 1 Diet analysis
295. esenta il suo obiettivo primario I biologi marini sono certamente fra le figure pi direttamente coinvolte nei processi che saranno generati dal recepimento della Direttiva MSP sia da un punto di vista scientifico sia da un punto di vista professionale Tuttavia ci avverr in maniera molto diversa rispetto a quanto si verificato in passato per esempio con la Direttiva Quadro sulle Acque o con la Marine Strategy Infatti ancor pi che nell ambito di queste ultime si tratter di agire in stretta relazione con un ampio spettro di attori che normalmente operano ben al di fuori del perimetro della Biologia Marina Fra questi non saranno compresi solo ricercatori attivi in altre discipline scientifiche ma anche e soprattutto figure professionali del tutto differenti come ad esempio economisti giuristi ingegneri architetti e funzionari delle diverse Amministrazioni coinvolte Anche le interazioni con gli stakeholders come conseguenza della trasversalit della Direttiva potrebbero non essere relegate come in altri casi ad un ruolo di contorno ma diventare una parte essenziale del processo e quindi coinvolgere attivamente anche la componente scientifica inutile sottolineare come questo scenario richieda profili professionali decisamente orizzontali non solo per poter dare risposta ai ricorrenti richiami ad un approccio ecosistemico e dunque olistico ma anche per poter interagire con efficacia possibilmente in maniera proattiva
296. esse during the examined period Ulva fluctuated weekly between growth and decline GR from 17 8 to 6 0 day increasing the risk of anoxic crises The Gracilariaceae instead displayed a slower and more uniform growth with a maximum in July GR 7 0 day G gracilis and Gracilariopsis displayed similar growth patterns but Ulva exhibited 53 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 both the highest GRs and biomass production during the whole experimental period Fig 1 G vermiculophylla GRs were positive until July then biomass degradation predominated favoring the growth of the other species as also found at SG Fig 1 The differences between stations were enhanced by different environmental conditions At SG freshwater outflows from the Osellino river lowered the salinity 19 8 psu at SG vs 23 3 psu at TR and conveyed high amounts of nutrients At Tresse nutrients were lower but steadily supplied by the high water renewal from the close big canals Malamocco Marghera and Vittorio Emanuele Ulva rigida _ Ulvarigida G vermiculophylla G vermiculophylla G gracilis 8 G gracilis G longissima ET G longissima Fig 1 Biomass production kg m fwt at Tresse A and at San Giuliano B Produzione di biomassa kg m peso fresco alle Tresse A e a San Giuliano B Conclusions Ulva rigida displayed a pulsing growth pattern and the highest bi
297. est that these patterns appear to be adapted for exploiting a challenging suite of surface dwelling prey species and may be the basis of a speculative hunting strategy wherein individuals sacrifice much of the possibility of identifying a potential prey item for an increased chance of capture Further investigations are needed to understand predatory responses by great white shark References ANDREOTTI S MICARELLI P SPINETTI S FERRERO E TRIPEPI S SPERONE E 2008 Curiosity or aggressivity Surface predatory behaviour of the White Shark Biol Mar Mediterr 15 1 312 313 COMPAGNO L DANDO M FOWLER S 2005 A field guide to the sharks of the world Collins Ed London 368 pp MICARELLI P SPINETTI S TRIPEPI S SPERONE E 2006 Observations about surface behaviour of the Great White Shark Carcharodon carcharias L versus passive preys in Dyer Island SA Biol Mar Mediterr 13 2 278 279 MYRBERG A A NELSON D R 1991 The Behaviour of sharks what have we learned In Gruber S H ed Discovering Sharks Spec Pub 14 Higlands American Littoral Society 92 100 SPERONE E MICARELLI P ANDREOTTI S BRANDMAYR P BERNAB I BRUNELLI E TRIPEPI S 2012 Surface behaviour of bait attracted white sharks at Dyer Island South Africa Mar Biol Res 8 982 991 SPERONE E MICARELLI P ANDREOTTI S SPINETTI S ANDREANI A SERENA F BRUNELLI E TRIPEPI S 2010 Social interactions among bait
298. esta percentuale aumenta fino al 46 se viene considerato 154 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 l impiego delle sole nasse Questo attrezzo ha garantito i rendimenti giornalieri maggiori con 45 40 19 76 kg g seguito da quelli registrati con il palangaro 18 51 15 98 kg g Il tramaglio nonostante sia risultato l attrezzo maggiormente impiegato in termini di giornate ha fatto registrare i rendimenti pi bassi con 15 37 10 42 kg g Tab 1 Con il tramaglio le specie pi abbondanti sono risultate la Sepia officinalis e Scorpaena scrofa Maggiormente selettive sono risultate le catture con le nasse in cui la specie prevalente Octopus vulgaris Il palamito attrezzo utilizzato in modo meno frequente fa registrare le maggiori catture di Epinephelus marginatus Diplodus sp e M helena Tab 1 Rendimenti medi giornalieri delle principali specie catturate per attrezzo Mean daily catches of the main species caught by different m tiers Tramaglio Nasse palangaro kg g d s kg g d s kg g d s S officinalis 2 48 3 59 0 12 0 42 S scrofa 1 62 2 00 0 29 0 56 0 38 0 91 O vulgaris 1 31 6 11 39 54 19 23 S tinca 1 06 1 86 S sarda 0 89 7 36 M helena 0 83 2 18 4 17 8 02 2 53 4 52 E alletteratus 0 69 3 05 P phycis 0 60 1 67 0 45 0 96 Diplodus sp 0 58 1 01 2 64 2 75 M surmuletus 0 57 1 41 0 30 0 99 E marginatus 3 2
299. eteporella sp and Schizomavella sp annelids e g Protula sp and the alcyonarian A coralloides Finally in the deepest part of the investigated wall from 112 to 155 m the erected stratum of fan corals disappears and the encrusting sponges e g Cliona sp Halyclona sp and Aplysina sp became dominant with about 4 covering Depth m Em vusting Sponges Fig 1 Schematic representation of dominant facies with bathimetric ranges Rappresentazione schematica delle facies dominanti con gli intervalli batimetrici Conclusions Investigated site is characterized by a rich and diversified coralligenous assemblage mainly dominated by erect suspension feeders such as the fan corals typical of highly hydrodynamic Bo et al 2009 and enriched Ballesteros 2006 environments Strong currents around Punta Campanella may generate high turnover of water promoting the dispersion of terrigenous inputs and nutrients resulting in well structured facies with fan corals till the depth of 115 m References BALLESTEROS E 2006 Mediterranean coralligenous assemblages a synthesis of present knowledge Oceanogr Mar Biol 44 123 195 BAVESTRELLO G BO M CANESE S SANDULLI R CATTANEO VIETTI R 2014 The red coral populations of the gulfs of Naples and Salerno human impact and deep mass mortalities Ital J Zool 81 4 552 563 BO M BAVESTRELLO G CANESE S GIUSTI M SALVATI E ANGIOLILLO M GRECO
300. evaluated according to the Exposure Index EIm by Thomas 1986 The sampling has been carried out on the outer and inner edges of the reefs during low tide and calm sea Results SZA is the locality with highest value of the EI at each month Elm 1 43 0 56 followed by SLD EIm 0 29 0 15 TDC Elm 0 04 0 01 and TDS Elm 0 04 0 02 Data analysis shows a significant relationship between reef amplitude and EI R Squared 0 63 p lt 0 001 In addition the results show the highest number of recruits in the outer edge with respect to the inner edge In the outer edge recruits density reaches both the highest values in SLD in July Dm 115 60 87 16 100 cm while the lowest recorded in TDS in August Dm 0 30 0 67 100 cm In the inner edge characterized by sheltered conditions the highest recruits density is evident in SLD in August Dm 18 60 21 74 100 cm while the lowest in TDS in June Dm 0 40 1 26 100 cm In both edges only in TDS in July the recruitment of D petraeum is absent The linear regression between EI and average densities of recruits does not show any significant relationship for both the edge of the reefs outer edge R Squared 0 04 p gt 0 05 inner edge R Squared lt 0 01 p gt 0 05 Conclusions The hypothesis that different levels of exposure affect the recruitment dynamic of D petraeum is not supported by our results as a non significant relationship between the EI and the density of recruits has sh
301. evant fishing related category of litter in GSA 16 Tab 1 The comparison of present data with estimates of litter abundance carried out in the same area in 1994 Cannizzaro et al 1995 highlights an increase of occurrence for most typology of litter Tab 1 shows the percentage of hauls with litter in 1994 and 2013 considering 198 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 only the categories that were strictly comparable In addition to a dramatic increase of plastic bags all fishing related materials result more frequent then 20 years ago L7 Paper and L9 Unspecified cardboard 2 1 L6 Wood processed 1 L5 Cloth er textil natural N 10 fibres 3 L1 Plastic Fig 1 Percentage of abundance number la 55 of items per square km of macro Glass Ceramic categories of litter as defined in the 9 MEDITS Protocol recorded in GSA 16 in 2013 Composizione percentuale in numero di oggetti per km delle macro categorie di rifiuti definite nel Protocollo MEDITS L2 Rubber rinvenuti nella GSA 16 nel 2013 2 Tab 1 Percentage of occurrence of some litter categories in 1994 and 2013 on the trawlable grounds of the Strait of Sicily Percentuale di occorrenza di alcune categorie di rifiuti nel 1994 e 2013 sui fondi strascicabili dello Stretto di Sicilia Macro category Category occurrence 1994 2013 a Bags 17 3 43 3 PLASTIC d A ta
302. eveloped and applied for a species that rely on these areas for important biological processes i e feeding breeding The persistent presence of the species is of notable importance given the apparent susceptibility of the Mediterranean subpopulation to coastal anthropogenic impacts References BEARZI G REEVES R R NOTARBARTOLO DI SCIARA G POLITI E CANADAS A FRANTZIS A MUSSI B 2003 Ecology status and conservation of common dolphins Delphinus delphis in the Mediterranean Sea Mamm Rev 33 224 252 CANADAS A HAMMOND P H 2008 Abundance and habitat preferences of the short beaked common dolphin Delphinus delphis in the southwestern Mediterranean implications for conservation Endang Species Res 4 309 331 HABITAT DIRECTIVE REPORTING 2014 http ec europa eu environment nature knowledge rep_habitats index_en htm 227 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 E SCORDAMAGLIA A Rossi G GNONE M BELLINGERI P MANFREDI S Nutr F SALVIOLI G SANTANGELO Acquario di Genova Area Porto Antico Ponte Spinola 16128 Genova Italia ester scordamaglia gmail com Department of Biology University of Pisa Via A Volta 6 56126 Pisa Italy Department of Economics and Management University of Pisa Pisa Italy CE TU S Viareggio LU Italy DEMOGRAPHY OF BOTTLENOSE DOLPHIN TURSIOPS TRUNCATUS MONTAGU 1821 INTHE NORTH WEST MEDITER
303. ey words larval duration settlement mark daily increments Chelidonichthys lucerna Adriatic Sea Introduction Tub gurnard Chelidonichthys lucerna L 1758 is the most landed and commercially important gurnard species for the Italian fisheries particularly in Adriatic Sea Profeta et al unpubl data Despite its importance and the increasingly fishing pressure FAO 2007 information on biological traits especially growth and maturity are scarce and sparse Although studies on age and growth counting presumed annuli and studies on changes of habitat during the demersal life have been widely reported little is know about their early pelagic life stages To date only Padoa 1956 described larvae and post larvae stages for few gurnard species and Dul i et al 2001 studied embryonic and larval development on laboratory reared tub gurnard The development of fish ageing using daily growth increments DGI counting in otoliths is an important tool for population dynamic studies of the juvenile phase Morales Nin 2000 The aim of this study is to develop settlement mark identification criteria and estimate settlement age from Adriatic tub gurnard specimens Materials and methods Samples were collected in the north middle Adriatic Sea from two trawl surveys carried out in autumn winter 2002 and summer 2011 Sagittal otolith were removed from tub gurnards ranging from 61 to 277 mm TL After embedding the otolith in epoxy resin using sil
304. f submerged aquatic angiosperms During the first year small transplantations were carried out in 17 sites by local fishermen expressly trained for this activity The survival of transplanted specimens resulted successful in 8 sites in 3 sites only some plants were found and in the remaining sites the growth was lower than expected but some sods bearing new shoots were still present The main factor affecting angiosperm survival was the proliferation of Ulvaceae due to an excess of nutrient inputs in a particularly rainy year Key words aquatic plants transplantation Venice Lagoon Introduzione Le praterie di angiosperme acquatiche svolgono un ruolo fondamentale per la conservazione dell habitat Negli anni 80 e 90 le praterie sono regredite in vaste zone della Laguna di Venezia a causa di molteplici pressioni antropiche Sfriso e Facca 2007 Negli ultimi 20 anni le condizioni ambientali sono migliorate grazie anche alla normativa nazionale e locale che ha regolamentato i principali elementi di disturbo Nella zona settentrionale della laguna SIC IT3250031 per il processo di ricolonizzazione naturale ostacolato dalla limitata circolazione idrodinamica che non favorisce la dispersione dei semi e dei rizomi In questo contesto stato finanziato il progetto LIFE SeResto Habitat 1150 Coastal lagoon recovery by SEagrass RESTOration A new strategic approach to meet HD amp WFD objectives LIFE12 NAT IT 000331 che si propone
305. f P lividus showed different trends in the two areas thus confirming that the annual pattern of the reproductive cycle is highly variable in the Mediterranean Sea see review in Guettaf et al 2000 Comparison of gonad indices revealed differences in the reproductive activity of the two populations with two GSI peaks and higher gonad production at the protected area with a low fishing pressure rather than at the strongly fished area Gonad development occurred during summer and autumn with mature gonads found in winter and a main spawning episode during spring or at the beginning of summer as described by Lozano et al 1995 for populations from northeastern Spain Since several exogenous factors are able to control the reproductive cycle of sea urchins Byrne 1990 Spirlet et al 1998 further studies should be carried out to understand their capability to adapt to different environmental conditions e g exposition algal coverage as well as to different fishing pressure and to explain the diverse GSI trends and the slightly different timelines in the reproductive cycles we observed Acknowledgments The authors acknowledge the director and the staff of the Tavolara Punta Coda Cavallo MPA and B Cristo for the logistic support during field work A Figus A Pinna D Vallainc R Silva M L Vitelletti provided invaluable help during lab activities References BYRNE M 1990 Annual reproductive cycles of the commercial sea urchin Pa
306. f on ancient walls and RF reef on LM low mesolittoral and IN infralittoral Flysches Regressione lineare tra la densit di Valore medio DS di complessit dei substrati Dendropoma e la profondit UM mesolitorale F Flysch non colonizzati RW reef su antiche superiore LM mesolitorale inferiore e IN mura e RF reef su Flysch infralitorale Conclusions The results of the present study are consistent with data from previous investigations confirming the importance of the abrasive platforms and the hydrodynamic regime for the growth of vermetid gastropods and for the edification of the reefs Chemello 2009 A positive development of vermetid reefs was recorded on both Flysch rocks and old walls showing a preferential colonization of the species on all the available hard substrates characterized by high exposure to wave action Moreover the abrasive platforms almost double their length due to the presence of vermetid gastropods The intertidal gradient is a significant factor for the growth of vermetid reefs Finally a marked increase in the abundance of this species was recorded in the infralittoral zone References ANTONIOLI F CHEMELLO R IMPROTA S RIGGIO S 1999 Dendropoma lower intertidal reef formations and their palaeoclimatological significance NW Sicily Mar Geol 161 2 155 170 CHEMELLO R 2009 Le biocostruzioni marine in Mediterraneo Lo stato delle conoscenze sui reef a Vermeti Biol Mar Medit
307. fisheries conservation and tourism Economic incentives are perceived as the only mechanism that allows the application of conservation measures because they raise big interests among stakeholders The MPA establishment was the result of a top down imposition of conservation initiatives through a non participative approach that caused general opposition from resident people Since 2010 the level of participation and transparency associated to the MPA has been increasing even if differences among stakeholders still exist Only recently the MPA management body has promoted accountability As regards equity and justice artisanal fishers enjoy fishing rights inside the MPA and the related additional earnings The trawl fishery the industry and residents who feel a sense of dispossession Badalamenti et al 2000 were identified as the losers As regards the sources of uncertainty they have been poorly managed in the MPA for about 20 years hindering an effective implementation of the reserve Research has lacked integration and multidisciplinarity while the rivalry among research organisms hampered cooperation The legislative acts supporting key sectoral policies were fragmented and disconnected and the institutional landscape contains redundant bodies that partially overlap with no harmonization of their competences and decisions Conclusions The Egadi Islands MPA has proved an interesting case study that has highlighted many institutional leg
308. fraction only when higher amount of total proteins was loaded 30 pg lane No clear signal was instead seen in acid L dieuzeidei fraction 22 ug lane The total amount of H dactylopterus proteins obtained from acid extraction was instead too low to get information about its composition In the urea soluble fractions a unique large band around 50 55 kDa was revealed for L cavillone L dieuzeidei and T lastoviza pellet 11 ug lane In spite of a very low amount of sample loaded into the gel 1 6 ug lane a slight signal was also seen in the lane of H dactylopterus sample Interestingly a common clear band at the top of the separating gel was seen for all samples both acetic acid and urea soluble fractions these signals may indicate the presence of high molecular weight proteins gt 300 350 kDa unable to enter into the pores of polyacrylamide gels 12 Currently it is not possible to indicate whether the 50 55 kDa band represents a unique protein or whether it represents the sum of more distinct proteins with similar molecular size More information may be obtained in the future by 2D map Finally we observed that solutions turned into yellow as a result of a pH decrease by mixing L dieuzeidei and T lastoviza acid protein fractions to bromophenol blue containing sample loading buffer This effect was not seen in L cavillone extract The differences in acid protein fractions showed variation in otolith matrix composition linked to the tim
309. g to Compagno et al 2005 males with TL gt 3 5 m and females with TL gt 4 5 m were considered mature Weather conditions were recorded and classified as clouded sky semi clouded sky or unclouded sky using the Oktas classification The correlations between shark approach and the biological and environmental variables were investigated Results and conclusions A total of 104 great white shark specimens have been identified and monitored On average 4 82 approaches per specimen have been performed and recorded by the scientific staff mainly directed to bait than to decoy However the first approach was mainly targeting the seal shaped decoy than the bait Chi Square test x 5 378 d f 1 P lt 0 05 We did not find any significant correlation between the type of the target and shark sex and size Although mature sharks mainly perform vertical approaches and immature sharks prefer horizontal approaches as previously observed by Andreotti et al 2008 our data do not show any significant correlation between type of approach and type of the target and shark length In contrast there was a strong correlation between the type of approach and the weather conditions a transition from horizontally oriented to vertically oriented approach was observed with increasing cloud coverage 7 31 779 d f 4 P lt 0 05 Vision seems to play an important role in commonly used feeding patterns and appears correlated to weather conditions Our observations sugg
310. g 1 73 p 0 1991 La MANOVA ha mostrato differenze significative tra siti si Loc F3 18 2 56 p 0 0032 ma nessuna differenza tra localit Loc Fz 3 1 50 p 0 2006 indicando che anche la variabilit dei popolamenti cresce al ridursi della scala spaziale considerata Jassa ocia Bate 1862 e Gammaropsis ulrici Krapp Schickel amp Myers 1979 rappresentano le specie pi abbondanti e presenti in tutti i siti L analisi SIMPER ha confermato che queste specie particolarmente J ocia caratterizzano i sabellarieti dell area di studio Conclusioni I risultati mettono in evidenza una forte variabilit dei popolamenti analizzati a scala media decine di m e piccola metri La variabilit riscontrata sembra essere riconducibile ai cambiamenti di abbondanza delle specie dominanti La distribuzione di queste specie tuttavia si mantiene abbastanza stabile alla scala spaziale delle decine di km suggerendo una certa omogeneit dei popolamenti ad anfipodi associati ai reef a Sabellaria dello Stretto di Sicilia Tuttavia specie localmente rare conferiscono una certa peculiarit faunistica ai sabellarieti delle singole localit oggetto di studio Le due specie G ulrici e J ocia posso essere considerate caratteristiche dell habitat nell area di studio anche se non esclusive La prima specie considerata endemica del Mediterraneo dove stata osservata in acque superficiali poco conosciuta e rinvenuta lungo le coste italiane solo due vo
311. g and the maturity ponge MR Lm75 Lm25s were estimated for females using the ogive model M L e PL jeD where M L is the proportion of adults and L is the length class Binomial generalized linear models GLMs with logistic link have been used to describe the proportion of adult individuals on the length as independent variable ICES 2008 Females were considered adults from stage 2c to 2e immature at stage 1 The stages 2a and 2b are not included in the evaluation because they can be easily confused ICES 2008 Results The LFD Fig 1 showed different patterns for males and females The quarterly maturity stage composition of adult M kerathurus in GSA 18 is showed in Fig 2 The presence of mature specimens was recorded especially in summer whilst post spawning and recovering specimens occurred during winter The maturity ogive is showed in Fig 2 where Lmso resulted 38 5 mm and MR resulted 2 8 mm Conclusions The reproduction period observed in the GSA 18 is consistent with data reported for the Ionian Sea Conides et al 2008 the Aegean Sea Turkmen et al 2006 and the Adriatic Sea Lumare et al 2011 though in this last case samples were 138 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 collected only in a restricted zone The Lmso is slightly smaller than that observed by other authors 45 2 mm Conides et al 2008 4 8 cm Turkmen et al 2006 45 6 mm Lumare et
312. g check F were visible in all the sections The distance between the primordium and the first increment H check was 11 24 0 15 um meantsd standard deviation with the first increment having a variable thickness mean 1 49 0 08 um Six increments were laid down between H and F checks according to Dul i et al 2001 and coinciding with the complete reabsorption of the yolk sac Sub daily increments were also laid down in core area showing a fast growth Growth increments located in the core presented a width increasing with the time to the settlement discontinuities and a thick organic matrix layer Wider increments were associated with a reshaping of otolith and a change in growth axis The transition from a rounded shape to additional planes of growth was produced by the development of two to four AGCs to the left and right of dorso ventral core region Relative primordium was not easily visible because it was masked by protein deposition on the dorso ventral axis The deposition of the AGCs is linked to metamorphosis and habitat shift from pelagic to demersal as observed for other fishes Arneri and Morales Nin 2000 From primordium to settlement the mean otolith age was 24 2 43 days Conclusions DGI microstructural pattern and settlement mark were generally similar to what reported in literature for other Scorpaeniformes in different areas McBride 2002 Ahrenholz and Morris 2010 The results showed for the first time the growth at in
313. g for most efficient monitoring designs increasing the knowledge on environmental drivers affecting Ostreopsis blooms and translate this into a forecasting tool Key words HABs European project Mediterranean Sea Ostreopsis environmental drivers Introduzione Il progetto M3 HABs relativo al monitoraggio di fioriture algali nocive ed in particolare al dinoflagellato bentonico Ostreopsis ha avuto inizio nel 2014 nell ambito del programma europeo ENPI CBCMED mirato a consolidare la collaborazione tra i Paesi dell Unione Europea e i Paesi partner che si trovano sulle sponde sud del Mediterraneo Il progetto M3 HABs di durata biennale coordinato dal CoNISMa i Paesi partner sono Italia CNR Istituto di Biofisica ARPAL OnAir e DHI Italia Francia Laboratoire d Oc anographie de Villefranche e Universit Nizza Sophia Antipolis Tunisia INSTM e Libano CNRS Inoltre sono coinvolti nel progetto 15 partner associati italiani francesi tunisini libanesi spagnoli e montenegrini provenienti da istituti di ricerca agenzie ambientali imprese di acquacoltura e media L obiettivo del progetto fornire una strategia comune per il monitoraggio attraverso lo sviluppo di procedure e protocolli comuni pi efficienti riducendo costi e tempi di campionamenti e conteggi e aumentando le conoscenze sui driver ambientali che influenzano le fioriture di Ostreopsis al fine di tradurle in un utile strumento di previsione Uno dei pacchett
314. ggio di pochi siti scelti strategicamente Bibliografia BENOVIC A FONDA UMANI S MALEJ A SPECCHI M 1984 Net zooplankton biomass of the Adriatic Sea Mar Biol 79 209 218 EU 2014 Directive 2014 89 EU of the European Parliament and of the Council of 23 July 2014 establishing a framework for maritime spatial planning OJ L 257 135 145 EC 2008 Directive 2008 56 EC of the European Parliament and of the Council of the 17 June 2008 establishing a framework for Community actions in the field of marine environmental policy Marine Strategy Framework Directive OJ L 164 19 40 FONDA UMANI S MONTI M MINUTOLI R GUGLIELMO L 2010 Recent advances in the Mediterranean researches on zooplankton from spatial temporal patterns of distribution to processes oriented studies Adv Oceanogr Limnol 1 295 356 ORLIC M GACIC M LA VIOLETTE P E 1992 The currents and circulation of the Adriatic Sea Oceanol Acta 15 109 124 184 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 A ZOPPINI S LUNGARINI S AMALFITANO Istituto di Ricerca Sulle Acque IRSA CNR Area della ricerca RM1 Via Salaria km 29 300 00015 Monterotondo RM Italia zoppini irsa cnr it BIODEGRADAZIONE DELLA SOSTANZA ORGANICA DISCIOLTA IN AREE COSTIERE BIODEGRADATION OF DISSOLVED ORGANIC MATTER IN COASTAL AREAS Abstract The bioavailability of the dissolved organic carbon DOC was
315. gilthead sea bream fed with the probiotic the structure of intestinal mucosa is maintained integrates Key words Saccharomyces boulardii challenge Vibrio anguillarum gilthead sea bream Introduzione Le patologie infettive rappresentano un problema di notevole peso nel panorama dell acquacoltura mondiale L orientamento odierno la ricerca di approcci alternativi all utilizzo di farmaci e tra questi i probiotici occupano un posto di rilievo Tra gli innumerevoli effetti benefici dei probiotici la protezione nei confronti delle patologie un aspetto di grande interesse La letteratura evidenzia come i probiotici abbiano la capacit di competere con i patogeni per i siti di attacco alla mucosa intestinale Newaj Fyzul et al 2014 ed esercitare quindi un effetto protettivo Saccharomyces cerevisiae var boulardii un lievito ad azione probiotica conosciuto in campo medico per la sua capacit di mantenere l omeostasi intestinale e di contrastare la capacit dei patogeni di aderire ed infettare la mucosa Scopo del lavoro quello di valutare in Sparus aurata Linnaeus 1758 l effetto protettivo di S boulardii nei confronti di un ceppo patogeno di Vibrio anguillarum Materiali e metodi 36 orate 159 8 2 48 g sono state suddivise in tre gruppi alimentati con tre diete sperimentali isoproteiche ed isoenergetiche ottenute partendo da una formulazione di base a cui sono stati aggiunti livelli crescenti di lievito disidrata
316. guenti localit sarde Piscinas 39 32 03 N 8 26 37 E e Is Arenas 40 04 12 8 28 46 In Corsica stata riscontrata la presenza della stessa specie in spiagge della costa settentrionale dell Isola Piana 41 22 23 N 9 13 45 E Bocche di Bonifacio S pelecaniformis stata raccolta nelle seguenti localit Piscinas 39 32 03 8 26 37 E Arborea 8 32 50 E 39 48 04 N S Giovanni di Sinis 39 52 55 N 8 26 11 E Sa Rocca Tunda 40 02 38 N 8 25 29 E Porto sa Ruxi 39 07 47 N 9 27 07 E S pelecaniformis non mai stata rinvenuta sulle coste corse n in altre localit del Mediterraneo forse utile evidenziare che a Piscinas nella parte settentrionale della spiaggia nel maggio 2013 sono stati rinvenuti solo rari individui di Deshayesorchestia deshayesii mentre in settembre dello stesso anno sono stati catturati rari individui di 7 ugolinii La scarsit di individui pu dipendere dalla elevata pressione antropica dovuta alla consistente presenza di bagnanti in questa parte della spiaggia Infatti allontanandosi da questa zona per circa 500 m verso sud invece gli individui di 7 ugolinii nel 2010 erano numerosi Tuttavia nella stessa localit un campionamento effettuato a distanza di 1 anno non ha fornito alcun esemplare di 7 ugolinii ma numerosissimi individui di S pelecaniformis Tuttavia la pressione 212 Volume pre print 46 Congresso della
317. h were females The highest encounter rate of adult females was found in the sub area B 0 003 while that of the entire population was observed in the sub area C 0 0165 Overall by a careful analysis of photos 70 cubs have been identified corresponding to a fertility rate of 0 35 cubs year The calving interval determined examining the individual life history of 22 females was 3 15 years corresponding roughly to a birth every 3 years Conclusions Our results confirm the shallow water bathimetric distribution of the bottlenose dolphin in the Western Mediterranean Sea Gnone et al 2011 A sub area of the Eastern Ligurian Sea B is likely a nursery area for the target species The fertility rate we found is about 3 fold higher than those obtained for the Scottish New Zealand and Brazilian populations 0 35 vs 0 11 0 13 0 11 cubs years Mitchenson 2008 Tezanos Pinto et al 2014 Fruet et al 2015 In the future it would be worth to investigate whether this difference is due to a real greater female fertility or and to an increased neonatal mortality in the Ligurian sub population The calving interval we found is similar to those measured in the populations previously reported with the exception of the New Zealand one in which this value was slightly higher 3 15 vs 4 3 years The female reproductive parameters here reported will allow us to set out demographic models suitable to project the trends overtime of the Eastern Ligurian bottle
318. hat was formed in the northern Adriatic Sea in the extraordinary cold winter the year before was detected in the deep layer of the Pomo Pit Low microbial abundance and activity characterized both pits but the signal of more efficient bacterial growth associated with more intense viral proliferation was detected in the deeper layer of the Pomo Pit characterized by the presence of residual dense water Key words viruses bacteria dense water Adriatic Sea Introduction The shelf dense water formation area is located in the N Adriatic shelf North Adriatic Dense Water NAdDW flows along the W Adriatic shelf replacing old waters in the middle and south Adriatic depressions Pomo Pit and South Adriatic Pit SAP respectively Mihanovi et al 2013 NAdDW partly transforms into Adriatic dense Water and subsequently flows out the Adriatic through the Strait of Otranto sinking to the Ionian deep layers and affecting the whole deep Eastern Mediterranean The Adriatic Deep Water ADW originates in the South Adriatic The outflow from the Adriatic is compensated by the advection of saltier Levantine Intermediate Water LIW from the Ionian Sea In the winter 2012 the NAdDW reached extremely high densities with op gt 30 kg m Mihanovi et al 2013 mainly due to long lasting 21 days Bora wind bursts measured between the end of January and mid February 2012 and was additionally favoured by very weak riverine discharge Notwithstanding previous inve
319. he Ligurian Sea North Western Mediterranean summer 1999 Ecol Lett 3 284 293 DOUVERE F 2008 The importance of marine spatial planning in advancing ecosystem based sea use management Mar Policy 32 762 771 LUNA PEREZ B VALLE C VEGA FERNANDEZ T SANCHEZ LIZASO J L RAMOS ESPLA A A 2010 Halocynthia papillosa Linnaeus 1767 as an indicator of SCUBA diving impact Ecological Indicators 10 1017 1024 MARTIN C S GIANNOULAKI M DE LEO F SCARDI M SALOMIDI M KNITTWEIS L PACE M L GAROFALO G GRISTINA M BALLESTEROS E BAVESTRELLO G BELLUSCIO A CEBRIAN E GERAKARIS V PERGENT G PERGENT MARTINI C SCHEMBRI P J TERRIBILE K RIZZO L BEN SOUISSI J BONACORSI M GUARNIERI G KRZELJ M MACIC V PUNZO E VALAVANIS V FRASCHETTI S 2014 Coralligenous and ma rl habitats predictive modelling to identify their spatial distributions across the Mediterranean Sea Scientific Reports 4 doi 10 1038 srep05073 Questo lavoro stato prodotto nell ambito del Programma ENPI CBC Bacino del Mediterraneo 2007 2013 11 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 S CALVo F Luzzu A TOMASELLO Dipartimento di Scienze della Terra e del Mare Universita di Palermo Viale delle Scienze Edificio 16 90128 Palermo Italia Biosurvey srl spin off accademico Universita di Palermo c o ARCA Viale delle Scienze Edificio 16 90128 P
320. hell length whole wet weight and relative contribution of the soft parts to it separately for the two species These values were then compared to those of commercial oysters to assess the feasibility of placing IMTA oysters on the market Results Compared to time of deployment size in May 2014 increased by 46 49 and 52 68 in O edulis and C gigas at 7 and 14 m respectively Oysters reached an average size of 84 and 89 mm for O edulis and 88 and 97 mm for C gigas at 7 and 14 m depth respectively Whole wet weight in May 2014 was 81 g at both depths for O edulis 258 increase since deployment and 67 and 75 g for C gigas at 7 and 14m 49 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 respectively 308 ad 359 increase since deployment In May 2014 shell length in both species was significantly higher at 7 m compared to 14 m p lt 0 001 in all cases On the same month whole wet weight was not significantly different at the two depths for O edulis p 0 88 while it was significantly higher at 7 m compared to 14 m for C gigas p lt 0 001 In May 2014 the average percentage of soft body parts to the whole wet weight was 4 6 and 5 6 for O edulis and 5 7 and 5 9 for C gigas at 7 and 14 m respectively For both species there was now significant effect of depth on the percentage of soft body parts Average mortality was very low at all sampling times at both depths lt 1 apart f
321. his species listed as endangered and protected under the directive Habitat 92 43 EEC became rare until its almost complete disappearance Recently due to the improvement of the environmental conditions linked to the closure of many urban discharges some species flourished in this basin among them P nobilis and the seagrass Cymodocea nodosa A high density of live specimens of P nobilis was registered compared to other sites in the Mediterranean and this together with the low number of deads could lead to hypothesize the presence of a stable population with a high grade of recruitment Key words endangered species Mar Piccolo Mediterranean Sea molluscs Pinna nobilis Introduction Pinna nobilis Linnaues 1758 is one of the largest bivalve molluscs worldwide and the biggest in the Mediterranean Zavodnik et al 1991 Its populations are largely threatened by habitat loss recreational and commercial fishing incidental mortality by trawling and boat anchoring Hendriks ef al 2013 and the species is listed as endangered and protected under the European Council Directive 92 43 EEC Since immemorial time Taranto had a great tradition for the fishing of this mollusc Pinna nobilis was one of the most important commercial species in Mar Piccolo with an annual harvest estimated in 20 30 thousands specimens in the first decades of the 20 century Ferrajolo and Forleo 1928 Also rearing experiments were carried out with good resul
322. hys e da ISPRA e da due campagne di campionamento dedicate 220 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Tirreno 2013 e Tirreno 2014 Fig 1 Durante la fase di training sono stati utilizzati 432 avvistamenti 2009 2013 mentre per la validazione stata effettuata una campagna di campionamento dedicata nell estate 2014 35 avvistamenti 40 N 39 N 38 N LER H 10 E 12 E 14 E 16 E Fig 1 Rotte percorse durante le campagne di campionamento 2013 e 2014 La linea grigia spessa identifica la rotta on effort i triangoli neri identificano la disposizione delle montagne Tracks covered during 2013 and 2014 sampling campaigns The thick grey lines identify tracks covered on sighting effort black triangles identify the seamounts position Risultati Il modello ha evidenziato la profondit del fondale profondit crescenti e preferibilmente gt 1000 m e la distanza dalla montagna brevi distanze con una soglia a 15 NM come i parametri pi influenti per la predizione Importanti ai fini predittivi sono risultati anche l orientamento N S e la pendenza media 0 7 0 43 della montagna Le montagne maggiormente attrattive sono risultate essere il Vercelli con 84 di probabilit di presenza 1 Anchise 74 il Vespasiano 73 Conclusioni Le montagne sottomarine hanno un effetto significativo sulla distribuzione di S coeruleoalba in Mar Tirreno Le carat
323. i I campionamenti video sono stati effettuati in due stagioni estate autunno del 2014 all interno e all esterno dell AMP Capo Gallo e Isola delle Femmine Palermo ad una profondit di 40 m su un fondale detritico I video sono stati realizzati attraverso una struttura composta da una videocamera ad alta risoluzione Gopro Hero 3 posta all interno di una custodia stagna montata su un telaio di acciaio e rivolta orizzontalmente rispetto al fondale Allo scopo di attirare la fauna ittica a circa 120 cm dalla videocamera stata posta una rete in nylon riempita con 800 gr di sarde Sardina pilchardus Walbaun 1792 In totale sono state raccolte 12 repliche video 60 minuti ciascuna in zona A 5 in zona B e 7 in CTL Ciascun video stato 127 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 diviso in 19 frames ognuno della durata di 3 minuti per ciascun frame stato registrato il numero massimo di individui Max N di una stessa specie osservati contemporaneamente nel campo visivo e la ricchezza specifica S Per testare potenziali differenze nel popolamento ittico di zone soggette a diversi livelli di protezione A B e CTL stata condotta una analisi permutazionale della varianza PERMANOVA Anderson e Gorley 2007 in ambito multivariato per verificare effetti su struttura e composizione dei popolamenti ittici ed in ambito univariato per verificare effetti su Max N e S
324. i caratteristiche e EUSAIR una strategia integrata per indirizzare temi comuni di Stati Membri e non membri presenti nella Macroregione che beneficeranno di una rafforzata cooperazione e EUSAIR operer senza fondi addizionali nuove istituzioni e nuova legislazione e Tutti i fondi UE 2014 2020 disponibili nella Regione dovranno supportare ove appropriato l implementazione di EUSAIR e il raggiungimento dei suoi obiettivi e MSP sar un componente fondamentale di EUSAIR e supporter l uso ottimizzato delle risorse nei prossimi anni In questo contesto ecco cosa si propone ADRIPLAN e Approccio condiviso ad MSP transnazionale nella Macroregione considerata nel suo insieme e pi dettagliatamente in 2 Focus Areas e Individuazione delle priorit di MSP e definizione del suo valore aggiunto e Sviluppo di proposte concrete di pianificazione e gestione sulle Focus Areas e su problemi specifici e Raccomandazioni per l implementazione di MSP transnazionale nella Macroregione e in altre regioni del Mediterraneo e Supportare le scelte strategiche del Piano d Azione EUSAIR e la sua implementazione e Supportare le scelte di implementazione della Strategia sulla Crescita Blu e Indirizzare e supportare azioni progetti interventi finanziati mediante i fondi strutturali 2014 2020 e Supportare la redazione del Programma di Misure 2015 della Direttiva sulla Strategia Marina e la sua armonizzazione con il Piano MSP da predispo
325. i base tassonomia Bibliografia DI FINIZIO A GUERRIERO G RUSSO G L CIARCIA G 2006 Identification of gadoid species Pisces Gadidae by sequencing and PCR RFLP analysis of mitochondrial 12S and 16S rRNA gene fragments Eur Food Res Technol 225 337 344 RASMUSSEN R S MORRISSEY M T 2009 Application of DNA Based Methods to Identify Fish and Seafood Substitution on the Commercial Market Comprehensive Reviews in Food Science and Food Safety 8 118 154 VARTAK V R NARASIMMALU R ANNAM P K SINGH D P LAKRAC W S 2014 DNA barcoding detected improper labelling and supersession of crab food served by restaurants in India J Sci Food Agr 95 359 366 209 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 A UGOLINI A CIOFINI L HOLTERS V PASQUALI D C WILCOCKSON Dipartimento di Biologia Universit di Firenze Via Romana 17 50125 Firenze Italia alberto ugolini unifi it IBERS Aberystwyth University UK Dip di Psicologia Universit di Roma La Sapienza Italia THE ROLE OF ANTENNAE IN THE SOLAR ORIENTATION OF TALITRUS SALTATOR MONTAGU CRUSTACEA AMPHIPODA IL RUOLO DELLE ANTENNE NELLA CAPACIT DI ORIENTAMENTO SOLARE DI TALITRUS SALTATOR MONTAGU CRUSTACEA AMPHIPODA Abstract We investigated the existence of an extra cerebral clock mechanism in Talitrus saltator Crustacea Amphipoda involved in time compensation of
326. i di lavoro del progetto interamente dedicato alla raccolta di dati omogenei ed all investigazione delle correlazioni esistenti tra le proliferazioni di Ostreopsis lungo le coste dei paesi partner ed i diversi driver chimico fisici e meteorologici Materiali e metodi Un modello per la raccolta dei dati stato concordato e distribuito ai partner Per ogni occasione di campionamento ciascun istituto ha fornito unitamente alle informazioni relative ai conteggi di Ostreopsis in colonna d acqua e su macroalghe i dati disponibili relativi a parametri della colonna d acqua temperatura salinit nutrienti parametri meteo marini temperatura dell aria velocit e direzione del vento altezza dell onda pressione barometrica piovosit nelle 24 ore precedenti caratteristiche del sito di campionamento tipologia di substrato esposizione del sito 103 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 habitat dominante Le informazioni fornite riguardano le campagne di monitoraggio condotte negli anni precedenti ed i metadati riguardanti il campionamento condotto nell estate del 2014 seguendo il protocollo comune concordato nell ambito del progetto M3 HABs Risultati I dati provengono da sei differenti Paesi Mediterranei Italia Francia Principato di Monaco Spagna Tunisia e Libano raccolti da 12 istituti di ricerca o agenzie ambientali come riportato nella mappa in
327. i matched Fig 1 Both haplotypes clustered with the Atlantic S spinulosa though showing a discrete genetic differentiation which could be caused by a geographic isolation Within the spinulosa clade the distances were less than 0 9 while the inter species distance was estimated more than 2 supporting the species delimitation between the alveolata vs spinulosa group In 28S sequences only a single transition mutation occurred between S alveolata and S spinulosa 100r S spinulosa MED S cf alcocki MED S spinulosa ATL A N KF808174 S alveolata MED _ I Fig 1 NJ tree constructed on the K2P model from COI sequences MED collected in the central Mediterranean ATL collected in the Atlantic Albero NJ costruito sul modello K2P da sequenze di COI MED raccolto in Mediterraneo ATL raccolto in Atlantico Conclusions To our knowledge we herein provide the first COI sequences allowing molecular identification of S alveolata and Mediterranean S spinulosa specimens We confirm that identification of Sabellaria spp only based on morphology may lead to misidentification Our results strengthen the hypothesis that S alcocki records in the Mediterranean Sea probably derive from misidentification with S spinulosa juveniles and that the former species is not present in the area Lezzi et al 2015 Combination of morphological and molecular taxonomic approaches may further contribute to solve problems due to
328. iaggiamenti Dopo il 2000 il CSC entr in crisi e la raccolta dati fu riorganizzata dai Ministeri dell Ambiente e della Salute come BDS Pavan et al 2013 questa oggi include i dati del CSC e d informazioni in tempi brevissimi degli spiaggiamenti in corso Con il coinvolgimento dei comuni costieri del Santuario in operazioni di partenariato www sanctuaire pelagos org si auspica una maggiore attenzione agli spiaggiamenti Materiali e metodi Per questa nota stata consultata la banca dati nazionale BDS Pavia e limitatamente alla questione delle nascite di balenottere quelle di Francia e Monaco riguardanti il Santuario Pelagos aggiornate al 2012 Risultati Dalle discussioni riguardanti i Cetacei ai fini della Marine Strategy 2012 2013 risult che gli spiaggiamenti di balenottere in Italia non presentavano particolari trends la loro sequenza dal 1990 al 2009 Fig 1 in media di 2 8 individui per anno 224 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 T Suisse Pu Fig 1 Numero di balenottere spiaggiate per anno dal 1990 e panoramica degli spiaggiamenti totali BDS Italia Number per year of stranded whales from 1990 and general view of total strandings BDS Italy Svizzera Switzerland MN 40 feneve Milano venezi lano Hrva Ar gt roatia n mN 29 KA eG e 1 talia Bosnia a F i agili A N R ornen wu ke
329. ian and Turkish Levantine coast where is one of the most important commercial species for its economic value Oztiirk 2010 In the present contribution we documented the first records of the species along the Italian coasts Observations were recorded during 2014 in the Data Collection Framework context in the North Western Ionian Sea DCF EU Reg 199 2008 In particular on the sampled specimens were reported the length frequency distribution LFD the maturity stage length weight relationship and the vectorial sex ratio Materials and methods Observations of commercial catches onshore and onboard of P semisulcatus were carried out in the Gulf of Taranto during 3 fishing trips from September to December 2014 Specimens were measured at the nearest mm of carapace length CL and nearest g of the weight recording sex and gonads maturity stage The maturity was classified adopting the female macroscopic scale reported by King 1995 The length weight parameters were calculated by a non linear weighted least squares estimate of a power model R cran stats library The sex ratio FF FF MM by length classes was also calculated Results A total of 147 specimens of P semisulcatus were examined from two samples sites off Taranto specimens caught by trammel nets and trawler at a depth ranged between 15 to 45 m and off Schiavonea specimens caught by trawler at 40 m depth The CL sizes ranged between 23 and 32 mm CL in males and between 27 an
330. ibile degli ecosistemi Daily e Ehrlich 1992 Tra questi approcci la teoria Emergetica di Odum 1988 affronta lo studio di sistemi processi e prodotti in funzione dell energia solare direttamente ed indirettamente necessaria per la loro formazione La Valutazione Emergetica Odum 1996 una metodologia in grado di mettere in luce i rapporti di dipendenza tra ecosistema naturale ed economia umana e pertanto risulta particolarmente adatta per lo studio della performance e della sostenibilit ambientale di ambiti territoriali e processi produttivi Franzese et al 2009a b La valutazione biofisica delle risorse ambientali che alimentano i sistemi economico produttivi delle societ umane risulta un elemento di fondamentale importanza per poter realizzare un modello di societ che sia maggiormente compatibile con le leggi della natura La contabilit emergetica Odum 1996 ha fornito le basi teoriche ed applicative per realizzare una contabilit biofisica di ecosistemi naturali ed antropizzati calcolando il valore delle risorse ambientali in funzione del lavoro svolto dalla biosfera per produrle donor side approach Il valore economico rispecchia le preferenze umane e le dinamiche del mercato Il valore ecologico invece fondato sulle dinamiche ecosistemiche e sui cicli della biosfera Per uno sviluppo che sia davvero sostenibile nel lungo periodo bisogna capire 16 Volume pre print 46 Congresso della Societa Italiana di Bio
331. ic dinoflagellates Ostreopsis ovata Sardinia harmful algal bloom Introduzione Nel corso dell ultimo decennio sono stati segnalati nelle acque costiere italiane diversi episodi di proliferazione della microalga bentonica potenzialmente tossica Ostreopsis cf ovata Fukuyo 1981 specie di origine tropicale appartenente alle Dinophyceae Sansoni et al 2003 A causa dell emergenza sanitaria provocata dell evento di fioritura del 2005 presso le coste liguri Brescianini et al 2006 stata stabilita una strategia a livello nazionale che ha previsto il monitoraggio della microalga da parte delle diverse ARPA prima ai sensi della L 979 82 e successivamente in ottemperanza al Decreto del Ministero della Salute 30 03 2010 attuativo del D Lgs 116 2008 Nel presente lavoro vengono riportati i principali risultati ottenuti da ARPA Sardegna nel corso delle campagne effettuate nel 2009 e dal 2011 al 2014 Il monitoraggio effettuato sia su colonna d acqua sia su macroalghe stato condotto in tre stazioni di prelievo caratterizzate da fondale roccioso e individuate tra quelle nelle quali si ipotizzata una maggior capacit di proliferazione della microalga Materiali e metodi Nel corso del 2009 le indagini hanno interessato il solo sito di Las Tronas Alghero mentre nel periodo successivo il monitoraggio stato esteso alle aree Acque Dolci Porto Torres e La Marina Castelsardo rispettivamente dal 2011 e dal
332. ic distinctness Sci Mar 74 317 329 CEVIK C CAVAS L MAVRUK S DERICI O B CEVIK F 2012 Macrobenthic assemblages of newly introduced Caulerpa taxifolia from the Eastern Mediterranean coast of Turkey Biol Invasions 14 499 501 FRANCOUR P PELLISSIER V MANGIALAJO L BUISSON E STADELMANN B VEILLARD N MEINESZ A THIBAUT T DE VAUGELAS J 2009 Changes in invertebrate assemblages of Posidonia oceanica beds following Caulerpa taxifolia invasion Vie milieu 59 1 31 38 JONGMA D N CAMPO D DATTOLO E D ESPOSITO D DUCHI A GREWE P HUISMAN J VERLAQUE M YOKES M B PROCACCINI G 2013 Identity and origin of a slender Caulerpa taxifolia strain introduced into the Mediterranean Sea Bot Mar 56 1 27 39 MUSCO L ANDALORO F MIKAC B MIRTO S VEGA FERNANDEZ T BADALAMENTI F 2014 Concern about the spread of the invader seaweed Caulerpa taxifolia var distichophylla Chlorophyta Caulerpales to the West Mediterranean Medit Mar Sci 15 3 532 538 118 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 M PICCIULIN S COLLA F PRANOVI S MALAVASI Center for Estuarine and coastal Marine Sciences CEMAS Dipartimento Scienze Ambientali Informatica e Statistica DAIS Universita Ca Foscari di Venezia Campus Scientifico Via Torino 150 30170 Venezia Italia slvcolla gmail com Ricercatore indipendente MONITORAGGIO ACUS
333. ic microalga Chrysophaeum taylorii Lewis amp Bryan from northern to central eastern Sardinian coasts Biol Mar Mediterr 17 1 292 293 CARONNI S DELARIA M A NAVONE A PANZALIS P SECHI N CECCHERELLI G 2014 Relevant scales of variability of the benthic allochthonous microalga Chrysophaeum taylorii Mar Biol 161 1787 1798 LEWIS LF BRYAN H F 1941 A new protophyte from the Dry Tortugas Am J Bot 28 4 343 348 SCHAFFELKE B HEIMANN K MARSHALL P A AYLING A M 2004 Blooms of Chrysocystis fragilis on the Great Barrier Reef Coral Reefs 23 514 SPARROW L HEIMANN K 2007 The influence of nutrients and temperature on the global distribution of algal blooms Literature review Australian Government 16 17 108 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 E CECERE A PETROCELLI F RUBINO V CASALE S PASSARELLI A CASALE C N R Istituto per l Ambiente Marino Costiero IAMC UOS Talassografico di Taranto Via Roma 3 74123 Taranto Italia antonella petrocelli iamc cnr it Associazione Onlus Mare per Sempre Taranto Italia REPORT OF CARETTA CARETTA REPTILIA TESTUDINES IN THE MAR PICCOLO GULF OF TARANTO MEDITERRANEAN SEA SEGNALAZIONE DI CARETTA CARETTA REPTILIA TESTUDINES NEL MAR PICCOLO GOLFO DI TARANTO MAR MEDITERRANEO Abstract In 2014 several freediving sightings of specimens of the loggerhead sea t
334. ication and site fidelity of white sharks Carcharodon carcharias off California using dorsal fins Mar Biol 158 1233 1237 GUBILI C JOHNSON R GENNARI E OOSTHUIZEN W H KOTZE D MEYER M SIMS D W JONES C S NOBLE L R 2009 Concordance of genetic and fin photo identification in the great white shark Carcharodon carcharias off Mossel Bay South Africa Mar Biol 156 2199 2207 KLIMLEY A P PYLE P ANDERSON S D 1996 Tail slap and breach agonistic displays among white sharks In Klimley A P Ainley D G eds Great White Shark The Biology of Carcharodon carcharias San Diego CA Academic Press 241 255 MARTIN R A 2003 Field Guide to the Great White Shark Vancouver ReefQuest Centre for Shark Research 185 pp MICARELLI P SPINETTI S TRIPEPI S SPERONE E 2006 Observations about surface behaviour of the great white shark Carcharodon carcharias L versus passive preys in Dyer Island South Africa Biol Mar Mediterr 13 2 278 279 SPERONE E MICARELLI P ANDREOTTI S BRANDMAYR P BERNAB I BRUNELLI E TRIPEPI S 2012 Surface behaviour of bait attracted white sharks at Dyer Island South Africa Mar Biol Res 8 982 991 SPERONE E MICARELLI P ANDREOTTI S SPINETTI S ANDREANI A SERENA F BRUNELLI E TRIPEPI S 2010 Social interactions among bait attracted white sharks at Dyer Island South Africa Mar Biol Res 6 408 414 TOWNER A V WCISEL M A REISINGER R
335. icazioni scientifiche e analisi dati delle blue box Picone 2013 Il sonar utilizzato per i rilievi acustici HRSS series 1171 Kongsberg Maritime ha consentito di ottenere mappe georeferenziate ad alta risoluzione degli affioramenti rocciosi e degli oggetti di origine antropica presenti nelle aree di indagine Successivi rilievi fotografici subacquei condotti lungo ogni singolo affioramento hanno permesso di identificare in maniera puntuale tutti gli ALDFG presenti che sono stati catalogati sulla base della loro tipologia in 1 reti attive strascichi cocce volanti 2 reti passive tramagli e altre reti da posta 3 cime scotte tiranti corpi morti e rifiuti generici della pesca 4 rifiuti da acquacoltura Le indagini fotografiche hanno inoltre consentito di segnalare la presenza di organismi intrappolati e di organismi incrostanti Risultati Sono stati rinvenuti complessivamente 300 strumenti da pesca che sono risultati essere distribuiti esclusivamente sugli affioramenti rocciosi o nelle loro 121 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 immediate vicinanze in 8 aree sul totale delle 15 monitorate su di una superficie di circa 50 000 m Tab 1 La densit di ALDFG n km risultata variabile e mediamente superiore negli affioramenti caratterizzati da maggior elevazione e o in quelli pi vicini alla costa risultato inoltre che la categoria maggiorment
336. iche associate all apparato digerente delle tartarughe marine Materiali e metodi Sono stati analizzati campioni da 8 esemplari di tartarughe marine della specie Caretta caretta L I campioni erano costituiti da feci di esemplari vivi e da contenuto cloacale e sezioni di intestino di 7 animali morti nei centri di recupero della Rete dell Osservatorio Toscano Cetacei e Tartarughe Marine Dai campioni stato estratto il DNA e si proceduto all analisi metagenomica del microbioma batterico attraverso il sequenziamento massivo su piattaforma MiSeq Illumina del gene codificante il 16S rRNA Abdelrhman et al 2015 Bacci et al 2015a b Le sequenze ottenute sono state opportunamente rielaborate attraverso un protocollo bioinformatico standard Bacci ef al 2015a b e identificate a livello tassonomico mediante confronto con il database Greengenes Risultati I risultati ottenuti hanno evidenziato una abbondanza di taxa appartenenti al phylum dei Firmicutes in particolare alla classe Clostridia che costituisce oltre il 50 del microbioma A carico di questa classe risultato dominante il genere Blautia un gruppo che recentemente ha acquisito importanza nell assimilazione di nutrienti nei mammiferi Eren et al 2015 poi emersa la presenza di una discreta frazione di Gammaproteobacteria circa il 25 del microbioma totale in cui stato riscontrato con alta frequenza 15 sul totale il genere Marinobacter un gruppo di batteri mai
337. icon moulds transverse cross sections of 300 to 500 um were prepared using a low speed wafering saw Buehler IsoMet All mounts were ground and polished with frequent microscopic control until the core plane was reached Thin sections of about 100 um were finally obtained for reading using a microscope brightfield and storage Each increment showed a common bipartite structure consisting in a discontinuous zone D zone and an incremental zone L zone which appeared respectively dark and light under transmitted light It was assumed that the increments were laid down daily Corroboration of interpretation criteria was made by two operators counting twice 40x magnification presumed daily 148 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 increments along the proximal distal axis from the primordium to the last increment before the apparition of an accessory growth centre AGC Counts per otolith were generally within 5 10 between readers hence none were excluded The DGI mean was considered the age of the specimen in days Results Otolith sections N 131 were unclear due to difficulties in the sectioning plane core not located slanted sections resulting only in 23 of sections with an increment pattern well defined Tub gurnard otoliths showed a quite circular primordium masked by organic matter A hatch check H and a strong growth check identified as the presumed active feedin
338. idely distributed in the Atlantic Mediterranean region were is used as fishing bait and as a food source Will be useful in the future to develop the aquaculture of H tubulosa in order to avoid over exploitation of this resource Here we show some preliminary results on the artificial reproduction of this species Key words Holothuria tubulosa artificial reproduction in vitro fertilization sediment bioremediation aquaculture Introduzione Holothuria tubulosa Gmelin 1788 una specie bentonica della zona sublitorale ampiamente distribuita nel Mar Mediterraneo e nell Oceano Atlantico Tortonese e Vadon 1987 Kazanidis et al 2010 Vive su diversi tipi di fondali dalla superficie fino ad oltre 100 m di profondita raggiungendo alte biomasse nelle praterie di fanerogame marine e nei fondali mobili con alta concentrazione di detrito H tubulosa una specie saprofaga detritivora che ingerisce il sedimento selezionando la componente organica insieme ai microrganismi ad essa associati Ha quindi una funzione ecologica centrale nella biodinamica del sedimento Coulon e Jagoux 1993 Questa specie viene sfruttata sempre pi intensamente in Mediterraneo sia come esca nella pesca artigianale che come fonte alimentare Sicuro e Levine 2011 Per le sue caratteristiche autoecologiche il taxon pu ricoprire un ruolo di rilievo nel biorimedio in maricoltura In questo lavoro presentiamo i risultati preliminari sulla riproduzione artificiale e le
339. ility as ecosystem engineer CCAMLR 2009 included this scallop in a list of sensitive taxa used to identify Vulnerable Marine Ecosystems VME Vacchi et al 2000 already found a predator prey size relationship between 7 bernacchii and A colbecki pointing out that predation impact was centered on middle prey sizes Starting from this relationship we developed a statistical model that provides a predation probability distribution for any scallop size and compared it with the living population Materials and methods Over 650 fish specimens have been collected during austral summer 1990 91 around Terra Nova Bay and their stomach contents were assessed A colbecki specimens were sampled at Road Bay almost regularly in the austral summers from 1989 90 to 2012 13 From the preys size found in predator stomachs we modeled the size distribution of scallop size consumed by any fish size and consequently the probability for any A colbecki size to be preyed by the whole 7 bernacchii population We then compared the modeled size distribution of preyed scallops with the one of the living population sampled throughout the years 68 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Results Modeled size distribution of preyed scallops shows a strong impact on the middle scallop sizes steeply decreasing toward smallest and largest individuals fitting with a gap in the living population Fig 1
340. imit della foce del fiume Silone hanno presentato le condizioni 125 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 trofiche pit elevate RP 0 44 uM DIN 26 9 uM Le concentrazioni di fosforo organico OP e azoto totale TN nei sedimenti superficiali hanno confermato queste condizioni con una media rispettivamente di 113 83 ug g dwt e 1600 1700 ug g dwt ed un intervallo di concentrazione di 62 305 ug g dwt OP e 331 6850 ug g dwt TN I coefficienti di correlazione di Pearson e l analisi delle componenti principali hanno evidenziato che alcuni parametri ambientali come I RP e la concentrazione di nitriti nella colonna d acqua il fosforo organico nei sedimenti e la copertura delle macroalghe sono eccellenti indicatori del livello di trofia Le differenze di trofia si riflettono sulla tipologia copertura ed abbondanza delle macrofite che caratterizzano le singole stazioni Macroalghe tionitrofile essenzialmente Ulva e Gracilaria hanno dominato le stazioni pi eutrofizzate mentre angiosperme acquatiche e macroalghe di elevata valenza ecologica come Laurencia obtusa Hudson J V Lamouroux 1813 Dasya punicea Zanardini Meneghini ex Zanardini 1841 Chaetomorpha linum O F Miiller Kiitzing 1845 e le piccole epifite calcarizzate dei generi Hydrolithon e Pneophyllum sono prevalse nelle stazioni con minor trofia Fig 1 Laguna settentrionale con indicate le stazioni e l
341. improve correct delimitation of the Mediterranean species of this genus Key words Polychaeta Sabellaria alveolata Sabellaria spinulosa Sabellaria alcocki COI Introduction Sabellaria Lamarck 1818 species are gregarious tube builder polychaetes which produce complex reefs representing valuable and diverse habitats in coastal areas La Porta amp Nicoletti 2009 Today three Sabellaria species are recorded for the Mediterranean Sea S alveolata L 1767 S spinulosa Leuckart 1849 and S alcocki Gravier 1906 Castelli et al 2008 This last is a valid species but according to several authors it is exclusive of the Indian Ocean and its Mediterranean records should be carefully revised Lezzi et al 2015 The operculum is of paramount taxonomic importance for Sabellaria species identification but its intraspecific variation especially during development may lead to confusion This is the case of S spinulosa showing remarkable variation in operculum morphology during development to a level that juveniles of this species resemble S alcocki These facts lead to hypothesize that Mediterranean records of S alcocki could refer to juveniles of S spinulosa Lezzi et al 2015 During faunal characterization of Sabellaria reefs in Sicily S alveolata S spinulosa and some small specimens resembling S alcocki in operculum features sensu Kirtley 1994 were collected As the discriminatory power of DNA analysis is especially valuable
342. in biology Academy Press London 371 pp BREGAZZI P K NAYLOR E 1972 The locomotor activity rhythm of Talitrus saltator Montagu Crustacea Amphipoda J Exp Biol 57 375 391 MERLIN C GEGEAR R J REPPERT S M 2009 Antennal circadian clocks coordinate sun compass orientation in migratory monarch butterflies Science 325 1700 1704 O GRADY J ZHANG L WILCOCKSON D C 2012 Molecular analysis of circadian clocks in an intertidal crustacean Talitrus saltator Conference of the Society for Research on Biological Rhythms Abstract 65 p PARDI L PAPI F 1953 Ricerche sull orientamento di Talitrus saltator Montagu Crustacea Amphipoda II Zeitschrift fur Vergleichende Physiologie 35 459 489 UGOLINI A SOMIGLI S PASQUALI V RENZI P 2007 Locomotor activity rhythm and sun compass orientation in the sandhopper Talitrus saltator are related J Comp Physiol A 193 1259 1263 211 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 A UGOLINI A NISTRI M SCHINTU K F A ABDELRHMAN A MENGONI Dipartimento di Biologia Universita di Firenze Via Romana 17 50125 Firenze Italia alberto ugolini unifi it Museo di Storia Naturale Sez di Zoologia Universit di Firenze Firenze Italia Dipartimento di Sanita Pubblica Medicina Clinica e Molecolare Universita di Cagliari Cagliari Italia NUOVI DATI SULLA DISTRIBUZIONE DI TALORCHESTIA U
343. ini 2000 2010 Bibliografia GIS3M WWF FRANCE 2012 Etude g n tique de la structure de la population de rorquals communs de M diterran e Nord Ouest et de son statut de conservation Rapport final Octobre 2012 LAURIANO G PANIGADA S 2010 Stime di densit e di abbondanza il line transect distance sampling applicato da piattaforma aerea Biol Mar Mediterr 17 1 404 405 ORSI RELINI L 2000 The Cetacean Sanctuary in the Ligurian Sea a further reason Biol Mar Mediterr 7 3 117 126 ORSI RELINI L GARIBALDI F 2013 Birth and postnatal growth of the fin whale in the Central Mediterranean Rapp Comm Int Mer Me dit 40 612 ORSI RELINI L GIORDANO A 1992 Summer feeding of the fin whale Balaenoptera physalus in the Liguro Provengal Basin European Research on Cetaceans 6 138 141 ORSI RELINI L PALANDRI G GARIBALDI F LANTERI L 2004 Note su alcuni parametri di popolazione della balenottera comune B physalus Biol Mar Mediterr 11 2 138 154 PANIGADA S NOTARBARTOLO G 2012 Balaenoptera physalus Mediterranean subpopulation The IUCN Red List of Threatened Species Versione 2014 3 PAVAN G BERNUZZI E COZZI B PODEST M 2013 La rete nazionale di monitoraggio degli spiaggiamenti di mammiferi marini Biol Mar Mediterr 20 1 262 263 PODEST M BORTOLOTTO A BORRI M CAGNOLARO L 1997 Ten years of activity of the Italian Centro Studi Cetacei European Resea
344. inophora Naticarius stercusmuscarum Ranella olearium Semicassis granulata undulata and the Bivalvia Aequipecten opercularis Acanthocardia echinata and Glossus humanus Other abundant species were the echinoids Cidaris cidaris and Stylocidaris affinis the anemones Adamsia carciniopados and Calliactis parasitica the hermit crabs Dardanus arrosor and Pagurus prideaux These findings suggest the fossils shell improve the biotopic complexity and the biodiversity of the bathyal habitat a _ Ao whe a Fig 1 Allocation of the zoobenthos samples x LE det st in the Strait of Sicily and position star of a Aaya a the fossil thanatocoenosis AS A Allocazione dei campioni di zoobenthos nello i ts Stretto di Sicilia e posizione stella della s Se e T E tanatocenosi fossile References BARSOTTI G FRILLI G 1970 Sulla presenza di Neptunea sinistrorsa Deshayes nel Mediterraneo Conchiglie 6 5 6 52 58 BOMBACE G 1970 Sulle biocenosi e sulla malacofauna vivente e fossile del margine continentale e della zona batiale di alcuni fondali tirrenici della Sicilia Boll Pesca Piscic Idrobiol 25 1 169 185 COLANTONI P CREMONA G LIGI M BORSETTI A M CATI F 1985 The Adventure Bank off Southwestern Sicily a present day example of carbonate shelf sedimentation Giornale di Geologia 47 1 2 165 180 P R S J M PICARD J 1964 Nouveau manuel de bionomie benthique de la M
345. investigated pits displayed different characteristics associated with the bathymetry and with the hydrological features of the water masses Microbial abundances and related processes in the SAP were in the range of values and displaying also typical gradients with respect to previous investigations for the study area Corinaldesi et al 2003 and the same season Gallina et al 2011 whereas at the Pomo pit BCP resulted less intense Despite particularly low microbial abundance and activity was detected at Pomo pit the signal of more efficient bacterial growth BGE associated with more intense viral proliferation was detected in the deep layer with residual hyper dense NAdDW Acknowledgements We are grateful to Vanessa Cardin for supplying the CTD data Thanks to the anonymous reviewer for improving the manuscript References COLE J J FINDLAY S E G PACE M L 1988 Bacterial production in fresh and saltwater ecosystems a cross system overview Mar Ecol Progr Ser 43 1 10 CORINALDESI C CREVATIN E DEL NEGRO P MARINI M RUSSO A FONDA UMANI S DANOVARO R 2003 Large scale spatial distribution of viruses in the Adriatic Sea testing the trophic state control hypothesis Appl Environ Microb 69 5 2664 2673 GALLINA A CELUSSI M DEL NEGRO P 2011 Large scale distribution and production of bacterioplankton in the Adriatic Sea J Sea Res 66 1 8 MIHANOVIC H VILIBIC I CARNIEL S TUDOR M RUSSO A BERGA
346. io SIC Alcune AMP come quella dell Isola di Bergeggi hanno recentemente chiesto di allargare i loro confini allo scopo di inglobare le secche pi profonde spesso sottoposte a una notevole pressione di pesca Tuttavia l inclusione in aree tutelate non garantisce una completa salvaguardia in molte AMP infatti sono consentiti diversi tipi di pesca sia professionali reti da posta palangari sia ricreativi traina rockfishing spinning anche sul coralligeno e spesso l impatto di questi metodi di pesca evidente Un problema particolarmente complesso riguarda i banchi presenti sulle secche del largo nell orizzonte inferiore del piano circalitorale Queste zone sono sempre state importanti per la pesca e la loro distanza dalla costa spesso al di fuori delle acque territoriali rende difficile la sorveglianza e la gestione In questi casi nelle aree pi frequentate dalle barche a strascico una dettagliata valutazione della distribuzione delle comunit e dei percorsi di cala potrebbe fornire interessanti indicazioni gestionali Fortunatamente alcune di queste secche del largo talvolta sono protette dalla loro stessa configurazione accidentata e i pescatori le evitano per non perdere gli attrezzi In questi rari casi s incontrano ancora le comunit tipiche dell ambiente profondo del Mediterraneo caratterizzate dallo sviluppo secondo la profondit di ricche facies a madreporari gorgonacei e antipatari Al loro inte
347. ion abundance and movements of the bottlenose dolphin Tursiops truncatus in the Pelagos Sanctuary MPA North West Mediterranean Sea Aquat Conserv 21 372 388 MARINI C FOSSA F PAOLI C BELLINGERI M GNONE G VASSALLO P 2015 Predicting bottlenose dolphin distribution along Liguria coast north western Mediterranean Sea through different modeling techniques J Environ Manage 150 9 20 223 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 L ORSI RELINI G RELINI Dipartimento di Scienze della Terra dell Ambiente e della Vita DISTAV Universita di Genova Corso Europa 26 16132 Genova Italia largepel unige it BALAENOPTERA PHYSALUS L 1758 NEL SANTUARIO PELAGOS TRENDS DI POPOLAZIONE E BANCHE DATI DI SPIAGGIAMENTI BALAENOPTERA PHYSALUS L 1758 INTHE PELAGOS SANCTUARY POPULATION TRENDS AND STRANDING DATABASES Abstract Long sequences of stranding data included in BDS database represent a very important often overlooked reference point for studies regarding B physalus particularly for demographic approaches More attention paid to this subject could re evaluate the significance of last minute discoveries Key words fin whale stranding Mediterranean Sea Introduzione Una grande incertezza caratterizza ancora molti aspetti essenziali della biologia e dell ecologia di Balaenoptera physalus L 1758 cos che i tentativi di
348. ion of epifaunal assemblages on G vermiculophylla Conclusioni Il ruolo strutturante delle comunit macroalgali nelle acque costiere temperate principalmente attribuito alla complessit della loro struttura tridimensionale Norkko et al 2000 Nella Laguna di Marinetta l alga aliena G vermiculophylla fornisce una movimentazione tridimensionale del paesaggio su fondali sedimentari Questo studio ha evidenziato come una ricca epifauna si associ ai talli di G vermiculophylla Tre gruppi Anfipodi Molluschi e Policheti dominano in termini di abbondanza Uno studio parallelo nel medesimo ambiente ha mostrato come la fauna epifitica associata alla clorofita Ulva rigida C Agardh 1822 sia meno diversificata e ricca di specie I nostri risultati mostrano anche che le abbondanze degli organismi epifaunali aumentano all aumentare della biomassa algale Nella Laguna di Marinetta la macroalga invasiva G vermiculophylla contribuisce a diversificare e a determinare la struttura fisica tridimensionale dell habitat altrimenti costituito da banchi fangosi nudi aumentando la eterogeneit di un habitat la cui unica diversificazione tridimensionale principalmente costituita dai talli laminari dell alga verde U rigida Bibliografia BYERS J E GRIBBEN P E YEAGER C SOTKA E E 2012 Impacts of an abundant introduced ecosystem engineer within mudflats of the southeastern US coast Biol Inv 14 2587 2600 MCINTYRE A D ELLIOTT J M E
349. ional ones e g technical effort based Conservation priorities MEDISEH project provided in addition the basic support to identify priority sites for conservation management in the Mediterranean Sea An exercise based on a conservation planning approach was carried out using the software MARXAN Ball and Possingham 2000 Game and Grantham 2008 for prioritizing candidate sites on the basis of quantitative data on the distribution of priority habitats existing threats and existing conservation initiatives for spatial optimization Conservation targets were set in accordance to the EU Habitats Directive 92 43 EEC the Marine Strategy Framework Directive the Convention on Biological Diversity 22 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 http www cbd int convention and the commitments undertaken at the World Summit on Sustainable Development in the Convention on Biological Diversity approved by Council Decision 93 626 EC Results showed that the percentage of overlap between the current conservation measures and the MARXAN scenario is about 50 of the identified priority areas and Adriatic sea emerged as one of the most relevant priority area De Leo et al 2014 From MEDISEH outputs overlap of the nursery grounds with existing spatial fisheries management measures and trawl fisheries restricted areas was also investigated Colloca et al 2015 Spatial analyses showed co
350. ions During the four sampling campaigns a clear seasonal succession was observed in the Mar Piccolo the largest phototrophs reached their maxima in April followed by the nanoplankton fraction in June and the picophytoplankton in October PP rates that represent the first measurements for the Mar Piccolo reflected the same pattern with the highest values estimated in June and the lowest in February High densities of all photoautotrophs caused phosphate depletion in the water column both in April and October Our data indicate that the high abundance of phytoplankton throughout the year cannot be a limiting factor for the mussel farming performance despite its seasonal variability in composition that has been previously reported by Caroppo et al 2012 and references therein References CAROPPO C GIORDANO L PALMIERI N BELLIO G BISCI A P PORTACCI G SCLAFANI P HOPKINS T S 2012 Progress toward sustainable mussel aquaculture in Mar Piccolo Italy Ecol Soc 17 3 10 DI POI E BLASON C CORINALDESI C DANOVARO R MALISANA E FONDA UMANI S 2013 Structure and interactions within the pelagic microbial food web from viruses to microplankton across environmental gradients in the Mediterranean Sea Global Biogeochem Cy 27 1034 1045 FONDA UMANI S DEL NEGRO P LARATO C DE VITTOR C CABRINI M CELIO M FALCONI C TAMBERLICH F AZAM F 2007 Major inter annual variations in microbial dynamics in the Gulf of
351. ioritura lieve Possibile produzione giallo 2 1000 4000 cellule Fioritura moderata Probabile produzione arancione 3 gt 4000 cellule ml Fioritura massiccia Produzione certa rosso 4 Gli score cosi ottenuti sono stati rappresentati nel prototipo creando per ogni anno di studio un layer vettoriale in cui i colori dei simboli utilizzati per indicare i siti di studio sono stati impostati in modo da richiamare quelli associati agli intervalli di densit della microalga corrispondenti alle diverse fasi delle sue fioriture Conclusioni In questo lavoro illustrato il primo tentativo di standardizzare le informazioni disponibili sui bloom di C taylorii che in Mediterraneo stanno causando danni alle comunit bentoniche Caronni ef al 2014 per ricavare in futuro dati confrontabili sulle sue fioriture come gi stato proposto per altre specie invasive De Vaugelas et al 1999 Secondo quanto osservato testando la standardizzazione proposta nel prototipo GIS realizzato dall AMP essa facilita notevolmente la visualizzazione dei dati relativi alle fioriture della microalga perch permette una facile integrazione degli elementi che compongono questo argomento tematico Una simile standardizzazione inoltre restituisce informazioni utili ai fini gestionali come suggerito da Zurlini 1999 per l utilizzo dei GIS in campo ambientale Bibliografia CARONNI S DELARIA M A NAVONE A PANZALIS P SECHI N CECCHERELLI G 2014 R
352. islative and knowledge gaps that have determined inefficient management and governance in the area during the past 20 years The unsolved conflicts represent an important deterrent for an efficient management of the MPA and they put politicians trade associations managers and researchers in a sort of game of roles aimed at defending the interests of single sectors Himes 2007 The lack of integration is common in Italian MPAs since only a few of them have attained an effective co management of natural resources based on a synergy between managers and stakeholders Guidetti and Claudet 2010 However the degree of integration participation and accountability in the MPA management has reversed since 2010 and is now increasing according to the interviewed stakeholders Using incentives knowledge from research and the intermediary role of NGOs an eco social dialogue among all stakeholders could be concretely attained with benefits for the MPA governance Acknowledgements We would like to thank all stakeholders interviewed for their availability and collaboration References BADALAMENTI F RAMOS A A VOULTSIADOU E SANCHEZ LIZASO J L D ANNA G PIPITONE C MAS J RUIZ FERNANDEZ J A WHITMARSH D RIGGIO S 2000 Cultural and socio economic impacts of Mediterranean marine protected areas Environ Cons 27 110 125 GUIDETTI P CLAUDET J 2010 Comanagement practices enhance fisheries in marine protected areas Conserv Biol
353. itter in a number of rocky outcrops Eight out fifteen investigated sites resulted to be affected by ghost nets Over 300 ALDFGs were observed and photographed Trawl nets were the most abundant followed by ropes tie rods and other fishery related waste gill nets and aquaculture waste Key words fishing gear outcrops seafloor mapping coastal zone Introduzione Le reti e attrezzature da pesca perse o abbandonate in mare comunemente note con il termine di reti fantasma o con l acronimo ALDFG Abandoned Lost or otherwise Discarded Fishing Gear possono andare alla deriva o incagliarsi sugli habitat rocciosi che sono abbondantemente distribuiti lungo le coste europee intrappolando animali marini e causando alterazioni dei fondali e della funzionalit degli habitat nonch rischi per la navigazione Macfadyen et al 2009 Nell ambito del progetto GHOST LIFE12 BIO IT 000556 sono state condotte indagini acustiche e rilievi subacquei in alcuni affioramenti rocciosi subtidali al largo delle coste venete noti localmente con il nome di fegn a con l obiettivo di indagare quantit e tipologia di eventuali ALDFG abbandonati Materiali e metodi Le indagini acustiche e subacquee sono state effettuate tra marzo e dicembre 2014 su 15 aree di tegn a di circa 20 km precedentemente individuate come zone ad alta e molto alta probabilit di presenza di ALDFG sulla base di questionari distribuiti a pescatori e sommozzatori pubbl
354. ium Ecosystem Assessment MEA 2005 Se da un lato evidente che ecosistemi poveri in biodiversit possono essere funzionalmente importanti dal punto di vista della sussistenza delle popolazioni locali anche vero che oltre soglie ben determinate tipping points l erosione e la perdita della biodiversit sfoceranno in modo inequivocabile in una perdita di funzioni ecosistemiche e dunque di servizi dai quali il benessere umano e lo sviluppo economico dipendono CDB 2010 D Angelo et al 2010 Tali servizi sono stati classificati sulla base delle seguenti categorie 1 servizi di supporto cicli biogeochimici formazione del suolo produzione primaria 2 servizi di rifornimento cibo acqua potabile legno fibre materie combustibili 3 servizi di regolazione regolazione del clima prevenzione delle inondazioni regolazione delle patologie dipendenti da vettori e fattori ambientali purificazione dell acqua e 4 servizi culturali estetica spiritualit educazione ricreazione MEA 2005 H yh e Franzese 2014 Il capitale naturale lo stock degli ecosistemi naturali che forniscono beni e servizi per il benessere delle generazioni presenti e future Il contributo del capitale naturale rappresenta quindi un fattore determinante per il sostegno del sistema economico produttivo e per il benessere del genere umano I servizi ambientali sono detti anche servizi ecosistemici o servizi ecologici Esis
355. king management of resources Paracentrotus lividus Adriatic Sea Introduzione Molte specie di invertebrati oggetto di pesca dilettantistica o comunque soltanto artigianale non sono state considerate nel passato a rischio di overfishing con notevoli conseguenze sull attuale pattern di distribuzione e consistenza delle popolazioni Guidetti et al 2004 Questo per esempio il caso del riccio di mare Paracentrotus lividus Lamarck 1816 per il quale stata evidenziata una notevole riduzione nella taglia e nella biomassa delle popolazioni in particolar modo lungo le coste pugliesi dove considerato un prodotto di notevole pregio Guidetti et al 2004 Data la rilevanza ecologica di questa specie Bulleri et al 1999 risulta evidente la necessit di una gestione controllata del suo sfruttamento visti i positivi risultati ottenuti in aree sottoposte a regolamentazione dell attivit di pesca Pais et al 2007 Un approccio corretto alla gestione delle aree marino costiere anche alla luce di quanto previsto dalla Marine Strategy Framework Directive deve per tenere conto sia dell esigenza di protezione che di quella di valorizzazione delle risorse Il ripopolamento con P lividus di aree precedentemente colonizzate parallelamente al suo allevamento in condizioni confinate potrebbe essere una buona strategia per rispondere al crescente interesse del mercato verso un prodotto di elevato pregio e valore commerciale garantendo
356. l arrivo in acquario gli esemplari sono stati misurati secondo i parametri di Nateewathana e Aungtonya 1994 I tritoni sono stati alimentati con Echinaster sp Holothuria sp e mitili Dopo la deposizione delle capsule ovigere le stesse sono state contate e sono stati eseguiti dei prelievi per le misure per il conteggio delle larve e dopo la schiusa per l osservazione dello sviluppo dei veliger Le larve sono state alimentate con fitoplancton unicellulare Dupla Rin arricchito con vitamine A B1 B2 B3 B5 B6 C E Infine sono state eseguite osservazioni allo stereomicroscopio per la conta delle uova e per la descrizione della morfologia dei veliger Lo studio sulla morfologia e lo 4l Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 sviluppo degli stessi veliger stato approfondito grazie all impiego di un microscopio elettronico a scansione Risultati I tre esemplari di tritone sono stati stabulati nella stessa vasca per circa due mesi e durante il periodo di stabulazione il consumo di cibo settimanale stato stimato in circa 300 g individuo La deposizione delle capsule ovigere durata per circa 20 giorni I rituali di accoppiamento si verificavano esclusivamente di notte e duravano per diverse ore Le uova sono state depositate in lunghe capsule claviformi impaccate in una matrice gelatinosa Le capsule erano lunghe 15 20 mm e larghe 5 7 mm Ogni capsula conteneva 2 00
357. l indice di incontro delle specie di cetacei nei canyon sottomarini di Genova 235 Indice Autori a ALe Lele N BS 237 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Tema La pianificazione spaziale marittima ruolo del biologo marino 1 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 RELAZIONE INTRODUTTIVA 2 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 M SCARDI Dipartimento di Biologia Universita di Roma Tor Vergata Via della Ricerca Scientifica 00133 Roma Italia mscardi mclink it I BIOLOGI MARINI E LA PIANIFICAZIONE DELLO SPAZIO MARITTIMO MARINE BIOLOGISTS AND MARITIME SPATIAL PLANNING Abstract Maritime Spatial Planning is the object of a recent EU Directive 2014 89 EU and one of the main actions that will be carried out by the European Union in the framework of its Integrated Maritime Policy It will challenge marine biologists to advance their present understanding of marine ecosystems taking into account not only the evaluation of their status but also the role of conservation resources exploitation ecosystems services and other relevant ecosystem processes and functions MSP will also require a tight integration of ecological societal and economic evaluations and therefore marine biologists will interact not only am
358. l habitats have been introduced no Cystoseira spp grows 4 new records of Cystoseira and Sargassum populations have been mapped 5 Cystoseira belts are discontinuous confined mainly in the south west coasts where slope is less than 45 and far away from harbors and sewages 6 C compressa is the most widespread species 7 C crinita occurs in tide pools only 8 Sargassum vulgare populations are genetically connected 9 exclusive haplotypes of Cystoseira and Sargassum spp have been detected in very peculiar habitats such as tide pools and natural underwater CO vents 10 primary metabolism cellular signaling and transposons are the groups with the most differential expressed genes under acidified conditions 11 a change of trophic guilds is evident for the mollusc communities in relation to the algal architectural structure and to the environmental features 12 a Cystoseira transplant method has been set up in situ and in laboratory 13 the Progetto Cystoseira chi l ha vista addressed to local policymakers including MPA stakeholders Scuba Diving Centers and fishermen and citizens has been started in order to increase knowledge on the occurrence of Fucales in the study area Conclusions These results even if referred to the few species present on the Ischia coasts suggest a higher ecological sensitivity in species with a lower genetic variability This aspect coupled to the fragmentation of natural habitats
359. l stage while the sibling P massiliensis shows no epitokous transformation and is a protandrous hermaphrodite characterized by egg brooding and semi direct development Hauenschild 1951 Helm ef al 2014 In the Mediterranean P massiliensis first described in the Marseille region was reported in the Gulf of Naples by Hauenschild 1951 and in Banyuls by Schneider et al 1992 Despite these studies P massiliensis was not included in polychaete check lists including the Italian fauna Castelli et al 2008 because previous records were not taken into account in taxonomic ecological investigations In fact ecological surveys based on the analysis of fixed adult specimens always reported only the presence of P dumerilii Studing a putative P dumerilii population sampled in the acidified areas of a CO vent system off the Ischia island Calosi et al 2013 identified a distinctive genotype which clustered separate from the actual P dumerilii genetic clades Subsequently Lucey et al 2014 rearing specimens from the same population in laboratory conditions and observing egg brooding proved that this different genotype was P massiliensis The aim of this work is to reappraise the occurrence of this species in our seas and provide preliminary observations on its reproductive biology Materials and methods Specimens of Platynereis spp were sampled from May to October 2014 from the acidified areas of the CO vents system off the Caste
360. la Natura e del Territorio Universit di Sassari Via Piandanna 4 07100 Sassari Italia delamarianna libero it EFFETTO DELL INVASIONE DI CAULERPA CYLINDRACEA IN POPOLAMENTI MACROALGALI DI SUBSTRATO DURO SOGGETTI A DISTURBO MECCANICO EFFECT OF CAULERPA CYLINDRACEA INVASION ON HARD BENTHIC MACROALGAL ASSEMBLAGES EXPOSED TO PHYSICAL DISTURBANCE Abstract In the summer of 2012 a manipulative experiment was conducted in Tavolara Punta Coda Cavallo Marine Protected Area N E Sardinia in order to evaluate the effects of the invasion of the allochthonous macroalga Caulerpa cylindracea Sonder Caulerpaceae in hard benthic macroalgal assemblages affected by physical disturbance Key words introduced species algae experimental research ecosystem disturbance marine parks Introduzione La macroalga alloctona Caulerpa cylindracea Sonder sta rapidamente colonizzando il Mediterraneo provocando una considerevole perdita di diversit che sta interessando soprattutto le comunit bentoniche Piazzi e Ceccherelli 2006 Ci nonostante le conoscenze sulle dinamiche invasive di C cylindracea sono ancora assai carenti e frammentarie Piazzi et al 2003 Obiettivo di questo studio stato valutare gli effetti del disturbo meccanico sulla struttura di popolamenti macroalgali autoctoni di substrato duro in aree invase da C cylindracea L ipotesi che la macroalga invada le zone disturbate in modo simile a quelle indisturbate Materiali
361. la delle Femmine spesso oggetto di pesca illegale e non autorizzata Tuttavia non pu essere escluso che all interno delle zone prese in esame si siano instaurati differenti fenomeni di competizione predazione o dominanza e territorialit Andrebbe verificata inoltre la presenza di zone di riproduzione e aggregazione della specie o l istaurarsi di diverse reti trofiche nelle differenti aree Questo potrebbe determinare una maggiore o minore appetibilit dell esca per le specie presenti nei siti che differiscono in composizione e struttura Ulteriori indagini sono necessarie per interpretare i risultati nel modo corretto e per verificare l efficacia del monitoraggio tramite BRUV nelle AMP italiane Bibliografia ANDERSON M J GORLEY R N 2007 PERMANOVA for PRIMER guide to software and statistical methods PRIMER E Plymouth UK 214 pp STOBART B GARC A CHARTON J A ESPEJO C ROCHEL E GO I R RENONES O HERRERO A CREC HRIOU R POLTI S MARCOS C PLANES S P REZ RUZAFA A 2007 A baited underwater video technique to assess shallow water Mediterranean fish assemblages methodological evaluation J Exp Mar Biol Ecol 345 158 174 WESTERA M LAVERY P HYNDES G 2003 Differences in recreationally targeted fishes between protected and fished areas of a coral reef marine park J Exp Mar Biol Ecol 294 145 168 WILLIS T J MILLAR R B BABCOCK R C 2003 Protection of exploited fish in temperate
362. lable for each station Results As shown in Tab 1 the ecological status assessed by MaQI ranged between High and Poor with the highest score at station 17 and the lowest at stations 1 and 5 located in more confined areas with higher trophic state M AMBI assessed the ecological status as Moderate at stations 15 16 and 17 and Poor at the other stations In spring the HFBI classification was Poor at stations 8 and 15 and Moderate at all the others while in Autumn only station 5 resulted Poor and all the others were Moderate 123 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Tab 1 MaQI M AMBI and HFBI scores assessed in eight stations of the northern Venice lagoon Punteggi di MaQI M AMBI e HFBI stimati in otto stazioni della laguna nord di Venezia Station MaQI M AMBI HFBI spring HFBI autumn 1 Legend 5 Ecological status 8 classification sensu WFD 10 High 12 Good 15 Moderate 16 17 Conclusions The ecological status as assessed by MaQI showed a higher spatial variability as compared to M AMBI and HFBI scores While the trophic state is likely a major cause of differences in MaQI scores between stations Facca et al in press Sfriso et al in press the low scores of M AMBI and HFBI suggest a more mediated response of consumers Indeed habitat recovery can be a slow process and more time
363. lassifier for Taxonomic Assignment of 16S rRNA Metabarcoding Sequences Generated from Illumina Solexa NGS J Genomics 3 36 39 BACCI G CECCHERINI M T BANI A BAZZICALUPO M CASTALDINI M GALARDINI M GIOVANNETTI L MOCALI S PASTORELLI R PANTANI O L ARFAIOLI P PIETRAMELLARA G VITI C NANNIPIERI P MENGONI A 2015b Exploring the dynamics of bacterial community composition in soil the pan bacteriome approach Antonie van Leeuwenhoek doi 10 1007 s10482 014 0372 4 EREN A M SOGIN M L MORRISON H G VINEIS J H FISHER J C NEWTON RJ MCLELLAN S L 2015 A single genus in the gut microbiome reflects host preference and specificity ISME J 9 90 100 ZHU B WANG X LI L 2010 Human gut microbiome The second genome of human body Protein amp Cell 1 718 725 ZILBER ROSENBERG I ROSENBERG E 2008 Role of microorganisms in the evolution of animals and plants the hologenome theory of evolution FEMS Microbiol Rev 32 723 735 Questo lavoro stato supportato da un finanziamento concesso da Regione Toscana progetto MICROMAR responsabile A Ugolini nell ambito del bando GoGreen Mare 2014 e dalla Rete dell Osservatorio Toscano Cetacei e Tartarughe Marine per il reperimento dei campioni 189 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 M I Acquaviva M NARRACCI L STABILI R A CAVALLO Istituto per 1 Ambiente Marino C
364. lazione riscontrata tra la 12 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 superficie e la lunghezza del fascio ipotizzabile in futuro che anche quest ultima possa essere stimata indirettamente mediante MBS Di Maida et al 2011 Stima dell estensione e del volume della matte con Sub Bottom Profiler P oceanica l unica fanerogama marina in grado di formare matte che a causa della loro natura altamente refrattaria possono essere conservate per migliaia di anni costituendo importanti riserve di carbonio Mateo et al 2006 Storicamente lo spessore della matte stato valutato mediante ispezione visiva diretta o carotaggi Recentemente gli strumenti sismo acustici ad alta risoluzione SBP sono stati impiegati come valida alternativa ai metodi tradizionali in quanto consentono in modo non distruttivo ed economicamente accettabile di mappare ed acquisire in continuo immagini ed informazioni relative all estensione spessore e volume delle matte sia coperte da praterie di Posidonia Lo Iacono et al 2008 che matte morte visibili e o nascoste da sedimenti Tomasello et al 2009 Luzzu et al 2015 Ci ha consentito di stimare il contenuto globale di carbonio presente nella matte Le tecnologie sismo acustiche applicate su larga scala potranno contribuire anche a comprendere meglio il ruolo di P oceanica nel ciclo del carbonio Cartografia e monitoraggio del limite i
365. lbaum 1792 e D sargus Linnaeus 1758 osservati in mare presso l Isola del Giglio Mar Tirreno centrale Materiali e metodi Un campionamento selettivo in apnea di D puntazzo e D sargus stato eseguito con l impiego di apposito retino in una piccola insenatura rocciosa presso Capo Marino a sud est dell Isola del Giglio tra gennaio e giugno 2014 Le osservazioni e i prelievi dei giovanili sono stati effettuati in un range batimetrico compreso tra 0 30 e 1 5 m in un area con substrato costituito da sabbie grossolane e ciottoli medio grandi con una forte componente algale costituita da talli cespitosi di feoficee Gli esemplari di D puntazzo e D sargus prelevati sono stati fissati e conservati in alcool al 90 per successive analisi in laboratorio finalizzate alla determinazione dei parassiti In situ sono state inoltre effettuate video sequenze time lapse con cadenza di un frame ogni 0 5 secondi in alta risoluzione tramite videocamera GoPro Hero 3 Risultati Sono stati campionati 59 individui giovanili di D puntazzo range di taglie compreso tra i 12 5 e 51 5 mm SL e 97 di D sargus tra i 14 8 e i 38 8 mm SL Quattro esemplari di pesci sono risultati parassitati dal copepode Pennellidae Peniculus fistula Nordmann 1832 2 esemplari di D puntazzo di maggiori dimensioni 34 8 1 6 mm e due esemplari di D sargus di taglia inferiore 18 0 2 mm Femmine adulte 164 Volume pre print 46 Congresso della Societa Italiana di Biol
366. lecolari specifici Di Finizio et al 2006 Il gene mitocondriale citocromo ossidasi I COI che ha nel Regno Animale un elevato tasso di mutazione interspecie e bassa variabilit intraspecie spesso utilizzato con successo ai fini dell etichettatura Vartak et al 2014 Obiettivo del nostro lavoro stato discriminare mediante barcoding specie appartenenti all ordine dei Pleuronettiformi e verificare in prodotti trasformati le eventuali frodi per sostituzione Materiali e metodi Gli esemplari freschi e trasformati congelati e sfilettati Tab 1 di sogliola sottoposti ad analisi sono stati reperiti su banchi di vari mercati rionali di Gaeta e Napoli Aliquote di 100 mg di tessuto muscolare sono state prelevate da ciascun campione il DNA stato estratto seguendo il metodo riportato in Di Finizio et al 2006 Successivamente stata effettuata l amplificazione del gene mitocondriale COI e le sequenze ottenute confrontate con quelle presenti in banca dati tramite un analisi FASTA e per la verifica del grado di similarit mediante BLAST Risultati II DNA stato estratto da tessuto muscolare con una buona resa ed stato amplificato per il tratto genico di interesse tramite PCR semiquantitativa In Fig 1A sono mostrati i prodotti dell amplificazione relativa al tratto mitocondriale COI 650 bp rRNA Tale approccio con successiva verifica delle sequenze ha permesso di discriminare tra le specie dell ordine
367. levamento remoto la topografia dei fondali Kostylev et al 2001 coprendo vaste aree del fondo marino ed ottenendo informazioni batimetriche con elevata precisione Le Gonidec et al 2003 La maggiore risoluzione spaziale ha notevolmente esteso l ambito tradizionale del sistema MBS fornendo le basi per nuove applicazioni nel campo della ricerca per l ambiente marino Brehmer et al 2006 L MBS stato utilizzato anche per mappare praterie a fanerogame marine con maggiore precisione Silva et al 2008 fornendo informazioni sulla copertura la distribuzione verticale e orizzontale e il volume Komatsu et al 2003 Il sistema MBS ad alta risoluzione 455 kHz stato utilizzato Di Maida et al 2011 per identificare e discriminare in modo automatico P oceanica e substrato sabbioso a bassa profondit 8 m I risultati hanno mostrato che l eterogeneit dell architettura della canopy di Posidonia e la relativa semplicit morfologica del substrato sabbioso possono essere rilevati facilmente e con elevata accuratezza 98 99 da indici statistici come deviazione standard o intervallo di profondit ottenuti dalla distribuzione dei beam alla scala del metro Inoltre l intervallo di profondit ottenuto con MBS pu essere considerato in inverno un buona proxy della lunghezza del fascicolo fogliare con un errore di circa il 12 mentre in autunno risponde mediamente al 50 dei dati biometrici rilevati in campo Tenuto conto dell elevata corre
368. li negli anni 90 sono stati effettuati dei lavori di rimaneggiamento per permettere la costruzione di due lavorieri e di un porto canale L obiettivo di questo lavoro stato di analizzare la struttura della comunit ittica nella laguna di Lesina e di confrontare le dinamiche di reclutamento dei giovanili di specie eurialine prima e dopo gli interventi ai canali Materiali e metodi La composizione e la struttura della comunit ittica della laguna di Lesina stata studiata utilizzando i dati provenienti da due campagne di campionamento effettuate nel 2006 07 e nel 2008 10 Le specie ittiche sono state riunite in gruppi ecologici in base all utilizzo che ciascuna specie fa dell ambiente lagunare secondo la tipologia di classificazione di Franco et al 2008 Sono stati identificati in tutto 5 gruppi ecologici specie estuarine ES specie marine migratrici MM specie marine occasionali MS specie catadrome C e specie d acqua dolce F Le dinamiche temporali della rimonta dei giovanili di specie marine eurialine sono state invece esaminate utilizzando i dati sulle catture raccolte ai canali di collegamento con il mare nel 1990 91 da Villani 1998 e nel 2006 07 da Manzo et al 2011 Risultati La comunit ittica della laguna di Lesina risulta composta da 29 specie appartenenti a 19 famiglie La famiglia pi rappresentata quella dei mugilidi con 5 specie Chelon labrosus Liza aurata L ramada L saliens e Mugil cephalus
369. li schemi operativi riportati nel Bergey s Manual of Systematic Bacteriology Bauman e Schubert 1984 integrati con gli schemi di Alsina e Blanch 1994 e di Noguerola e Blanch 2008 mediante l esecuzione di test morfologici biochimici e colturali Successivamente gli isolati 190 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 sono stati sottoposti ad una caratterizzazione fenotipica con il sistema di identificazione API 20 E ID 32 impiegando soluzione salina sterile come diluente d inoculo I campioni di sedimento prelevati sono stati omogeneizzati previa sospensione in acqua di mare sterile in ragione di 1 10 peso volume lasciati sedimentare ed il sovranatante stato utilizzato per le analisi secondo le procedure usate per l acqua Risultati I risultati relativi alla ricerca dei batteri coliformi coliformi totali coliformi fecali ed E coli evidenziano che i valori pi elevati si sono riscontrati nei sedimenti di entrambe le stazioni nel periodo autunnale Anche per le Vibrionaceae si evidenzia una elevata presenza nei sedimenti con valori massimi pari a 3025 33 UFC g per la stazione C in primavera e 515 44 UFC g per la stazione P in autunno Nella stazione C si evidenzia una maggiore presenza di specie ambientali nei sedimenti e una prevalenza di forme potenzialmente patogene in acqua Tra le specie potenzialmente patogene quella pi abbondante V alginolyticus con la
370. lia Via de Mauri Piano Tavola 95032 Belpasso CT Italia IMPATTO DI CAULERPA TAXIFOLIA VAR DISTICHOPHYLLA SU MACRO E MEIOFAUNA ASSOCIATE A POSIDONIA OCEANICA IMPACT OF CAULERPA TAXIFOLIA VAR DISTICHOPHYLLA ON MACRO AND MEIOFAUNA ASSOCIATED WITH POSIDONIA OCEANICA Abstract Macro and meiofauna associated with Posidonia oceanica meadows colonized by the invasive alga Caulerpa taxifolia var distichophylla Caulerpales in Southern Sicily were analyzed and compared with assemblages of control meadows from the same area Independently from the degree of invasion severe or partial the affected macrofaunal assemblages significantly differed from the controls with the former ones characterized by an increase of molluscs and polychaetes and the decrease of crustaceans Meiofaunal assemblages showed contrasting results being affected by severe algal invasion but not significantly differing from control assemblages under partial invasion conditions suggesting some tolerance to the invader Key words sea grass introduced species zoobenthos Introduzione L alga australiana Caulerpa taxifolia Vahl C Agardh var distichophylla Sonder Verlaque Huisman e Procaccini di recente introduzione in Turchia e Sicilia Jongma et al 2013 ha colonizzato ampi tratti di fondale a sud est dell Isola ed particolarmente abbondante sulla matte ai bordi dei posidonieti Musco et al 2014 Visti gli effetti negativi prodotti dalle invasi
371. lia e capruzzi gmail com THE RECRUITMENT OF DENDROPOMA PETRAEUM MOLLUSCA VERMETIDAE AT DIFFERENT HYDRODYNAMIC CONDITIONS IL RECLUTAMENTO DI DENDROPOMA PETRAEUM MOLLUSCA VERMETIDAE IN DIVERSE CONDIZIONI IDRODINAMICHE Abstract Hydrodynamism has an important role in the distribution and growth of the vermetid reef However little is known about the relationship between the local hydrodynamic conditions and the recruitment rate of the main reef building species Dendropoma petraeum The main goal of this work is to evaluate whether and eventually how the recruitment is influenced by different local hydrodynamic conditions Key words Dendropoma petraeum reefs recruitment hydrodynamics Introduction The vermetid reefs are marine bioconstructions highly contributing to modify the structure of the intertidal zone in the southern areas of the Mediterranean Sea The main building species is the gastropod Dendropoma petraeum Monterosato 1892 in association with the red encrusting algae Neogoniolithon brassica florida Harvey Setchell amp Mason 1943 Along a transect coast sea three different portions of the reef can be described the inner edge terrestrial boundary the cuvette pools in the central zone and the outer edge seaward boundary Chemello et al 2000 The vermetid reefs develop very little in width in sheltered areas although form wide platforms on exposed shores In effect the hydrodynamism at the sea surface i
372. ll tissues and chloride cells and altered Na K ATPase ir the severity of injury increasing at the second concentration in NP2 and BPA2 and in mixtures Significant increase of GST in BPA1 NP2 and MIX and significant decrease in NP_BPA were observed Fig 1A Significant increase of Cat activity was observed in BPA1 NP2 and MIX Fig 1B 3500 Y 3000 25 8 o GST nmol min mg S 8 8 8 a b a a a a b di A Cr BPAl BPA2 OCTA OCT2 NPL NPZ C2 NP OCT OCT BPA NP BPA Mix Cr BPA BPA2 OCTA OCT NPI NP2 cre NPOCT OCTBPA NP BPA mx 8 Cat umol min mg w e H Fig 1 GST A and Cat B activities in gills Values are expressed as means SE n 15 Different letters indicate significant differences between groups P lt 0 05 Attivit di GST A e Cat B nelle branchie I valori sono espressi come media SE n 15 Lettere diverse indicano differenze significative tra i gruppi P lt 0 05 Conclusions Several reviews have provided extensive and critic knowledge on the use of teleost gill alteration in eco toxicological studies i e Au 2004 This study demonstrate that in confined waters accumulation of endocrine disruptor via diet can contribute to respiratory distress too The semi quantitative evaluation of the morphological endpoints confirmed their reliability allowing the identification of critical changes in the gills of exposed groups of the same order as those de
373. llo Aragonese Ischia Calosi et al 2013 To study the reproductive biology specimens were reared in Petri bowls 100 ml approx 5 specimens per bowl using filtered sea water 0 22 um and kept in a summer regime 21 1 C and L D 16h 8h inside a 98 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 thermostatic chamber fresh spinach was used to feed the worms Specimens were checked for water change food supply and reproductive status approx every week Results and conclusions A few specimens among those sampled in mid May 2014 n 3 mid June n 2 and end of October n 2 laid eggs inside their tubes after being kept in laboratory conditions for a period ranging between one to four weeks The eggs measured 350 um and were oxygenated through ventilation by regular movement of the female inside the tube The eggs hatched approximately two weeks after being laid The juveniles remained inside the parental tube up to 5 6 segments at 9 10 segments they started to build their own tubes We followed the growth of approx 80 juveniles in total after 4 months August November only 12 of them survived 10 18 mm length All brooding females observed to date survived after the egg deposition Our preliminary observations show comparable egg size with previous works Hauenschild 1951 Schneider et al 1992 while some differences in early juveniles morphology were recorded respect to the
374. logia Marina Roma 10 12 giugno 2015 che spesso il solo valore economico non descrive adeguatamente la reale importanza ed il ruolo delle risorse naturali nei processi produttivi Il valore emergetico pu fornire una misura complementare di quello che potremmo definire il valore ecologico di una risorsa o il benessere reale di un sistema Numerose pubblicazioni hanno dimostrato l utilit della valutazione emergetica per lo studio della performance e della sostenibilit ambientale di sistemi territoriali terrestri e marini e sistemi produttivi di diversa tipologia e scala spaziale Franzese et al 2008 2014 Russo et al 2004 Metodiche di valutazioni multicriteriale che integrano tra gli altri anche il valore emergetico sono state sviluppate per consentire un approccio metodologico multi scala e multi metodo in grado di studiare sistemi naturali ed antropizzati con un approccio olistico Franzese et al 2013 Questo approccio metodologico in fase di sperimentazione anche all interno del network delle Riserve della Biosfera dell UNESCO 4 La necessit di un approccio integrato I sistemi ecologici sono sistemi aperti di dimensioni finite limitati da vincoli biofisici ed altamente integrati da una rete di flussi di materia ed energia Franzese et al 2003a b Numerosi studi hanno messo in evidenza come non sia possibile cogliere la complessit dei sistemi ecologici per mezzo di un analisi riduzionista questo anch
375. lorii Lewis e Bryan Macri et al 2014 Relativamente alla succitata specie in particolare la maggiore difficolt durante la creazione del prototipo stata la trasformazione della notevole mole di dati numerici puntuali sulla sua densit cellulare in informazioni utili a mapparne la distribuzione nell area protetta In questo lavoro descritta la proposta di standardizzazione elaborata per tentare di ovviare al succitato problema e la procedura con cui essa stata ottenuta Materiali e metodi Per la realizzazione della standardizzazione sono stati considerati i dati relativi alla densit cellulare di C taylorii cellule ml raccolti nel quinquennio 2008 2012 5 campionamenti per anno alla sua profondit di massima abbondanza 1 5 m Caronni et al 2014 in 8 siti dell AMP tra fine giugno e fine agosto quando la sua densit pi elevata Caronni et al 2014 Sulla base delle osservazioni complessivamente effettuate nel periodo di studio i dati relativi alla densit media della microalga sul substrato sono stati messi in relazione all entit del bloom e divisi in intervalli stata fornita anche un indicazione di massima sulla possibile presenza di mucillagine sul substrato durante le diverse fasi della fioritura sebbene recenti studi abbiano dimostrato l assenza di una precisa relazione tra la densit e la presenza di mucillagine sul substrato Caronni et al 2014 A ciascuno degli intervalli ottenuti secondo
376. lte Bedini et al 2011 Lo Brutto e Sparla 1993 La specie tubicola J ocia risultata tra le specie dominanti anche nei sabellarieti delle coste laziali La Porta et al 2009 Ci suggerisce che pur non essendo esclusiva J ocia possa essere una specie caratteristica preferenziale dell habitat in questione I risultati confermano il ruolo degli Amphipoda quali descrittori di habitat peculiari Lo Brutto et al 2013 Bibliografia BEDINI R PERTUSATI M BATISTINI F PIAZZI L 2011 Spatial and temporal variation of motile macro invertebrate assemblages associated with Posidonia oceanica meadows Acta Adriatica 52 2 201 214 LA PORTA B NICOLETTI L 2009 Sabellaria alveolata Linnaeus reefs in the central Tyrrhenian Sea Italy and associated polychaete fauna Zoosymposia 2 527 536 LA PORTA B TARGUSI M LATTANZI L LA VALLE P NICOLETTI L 2009 Analisi della fauna associata alle biocostruzioni a Sabellaria alveolata L in relazione al loro stato di conservazione Biol Mar Mediterr 16 1 36 38 LO BRUTTO S ARCULEO M KRAPP SCHICKEL T KETMAIER V 2013 Foreword to the Special Issue New frontiers for monitoring European biodiversity the role and importance of amphipod crustaceans Crustaceana 86 7 8 769 779 LO BRUTTO S SPARLA M P 1993 Anfipodi associati dei banchi di filtratori nel golfo di Castellammare Sicilia N W Biologia Marina Suppl Notiz SIBM 1 295 296 81 Volum
377. lule nonostante le dimensioni microscopiche sono in grado di produrre ingenti quantit di mucillagine visibile ad occhio nudo Sparrow e Heimann 2007 La specie originariamente tipica delle zone tropicali e subtropicali dell Atlantico e del Pacifico Schaffelke et al 2004 stata ritrovata negli ultimi anni anche in Mediterraneo in Turchia Aktan e Topaloglu 2011 e in Italia sia lungo le coste laziali Blasi et al 2013 sia lungo le coste orientali della Sardegna dove sembra essersi insediata stabilmente Caronni et al 2010 Obiettivo di questo studio verificare la presenza di C taylorii anche nella parte settentrionale della Sardegna in alcuni siti ritenuti particolarmente adatti al suo sviluppo Materiali e metodi Lo studio stato condotto nell estate del 2013 in 3 siti nella zona di Santa Teresa di Gallura Cala Pischina 41 9 20 N 9 9 7 E Capo Testa 41 14 10 N 9 9 37 E e Rena Bianca 41 14 54 N 9 11 6 E Nel mese di agosto in cui la densit di C taylorii massima Caronni et al 2010 sono stati raccolti 3 campioni di acqua e materiale epilitico per sito Abbate et al 2007 ad 1 5 m di profondit dove la specie pi abbondante Caronni et al 2010 ed stata verificata l eventuale presenza di mucillagine I campioni sono stati fissati con Lugol ed analizzati al microscopio 3 sub campioni per ciascun campione per il riconoscimento Lewis e Bryan 1941 ed il conteggio delle cellule
378. lume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Poster del Comitato Benthos BERTOLINO M PANSINI M SANTINI C BAVESTRELLO G La spongofauna associata a sorgenti idrotermali superficiali dell Isola di Bangka Indonesia i CALABRETTI C GHIANI A NAVONE A CITTERIO S CARONNI S Prime osservazioni sul ciclo vitale del ceppo mediterraneo della microalga Chrysophaeum taylorii iii CAPRUZZI E LA MARCA E C FRANZITTA G MILAZZO M CHEMELLO R The recruitment of Dendropoma petraeum Mollusca Vermetidae at different hydrodynamic conditions CASOLI E GRAVINA M F BELLUSCIO A ARDIZZONE G D Policheti Serpulidae Annelida associati al coralligeno dell Isola del Giglio Toscana uni atea CHIMIENTI G MAIORANO P MASTROTOTARO F Pennatula rubra facies in the Ionian Sea central Mediterranean CHIMIENTI G PANETTA P LIONETTI A RICCI P CARLUCCI R MATARRESE A MASTROTOTARO F Findings of juveniles of Donax semistriatus Mollusca Bivalvia in the South AdrialcSeazz ssaa ra deiezioni DELL ACQUA O BREY T VACCHI M CHIANTORE M Predation impact of the notothenioid fish Trematomus bernacchii on the size structure of the scallop Adamussium colbecki in Terra Nova Bay Ross Sea Antarctica reisn sieni r a e a E a eas DOMINA I CHEMELLO R ALESSI C TOCCACELI M
379. ly From May 2013 to April 2014 were collected and analysed data from 236 log book compiled from fishermen Trammel net 83 trap 11 and longline 6 were resulted the only meti r employed in the study area Mean catches kg day for gear were reported Even if the trammel net is the most used metier showed the lowest catches 15 37 kg day 10 42 These results represent the knowledge basis for starting a exchange of points of view between fishers and fishery managers aimed at a definition of a proper management plan as required in the Capo Carbonara MPA Key words marine parks coastal fisheries fishery regulation Sardinia Introduzione Tra le finalit istitutive delle Aree Marine Protette la tutela del patrimonio ambientale e culturale legato al mare e quindi la promozione delle attivit economiche tradizionalmente ad essa legate sono senza dubbio i punti cardine DL n 394 91 Per la sua attuazione necessario valutare quale pu essere il tasso di prelievo da pesca al quale sottoporre le risorse dell AMP Ardizzone et al 1998 Consorzio Unimar 2001 L AMP Capo Carbonara si sviluppa lungo 40 km di costa e 140 km di mare suddivisi in 4 zone con diversi livelli di protezione su cui opera una ridotta ma importante flottiglia di pesca costiera locale Per poter attuare le corrette misure di gestione pesca locale costiera in collaborazione con l Ente gestore dell AMP Capo Carbonara Villasimius stato sviluppato un
380. m Google Earth have been analyzed and the ratio of artificial natural coasts has been quantified The role of coastal fragmentation in the species dispersion and recruitment both at plant and associated community levels has been assessed at different spatial scales by measuring the species connectivity and population dynamics Adaptive responses to water acidification have been studied with molecular and genomic approaches Three molecular markers psbA ITS Cox3 have been used and differential regulated genes have been analyzed by RNA sequencing Transplant experiments have been conducted in historical and current sites Finally to raise community awareness on the Cystoseira Sargassum decline issue posters and pamphlets on these species have been elaborated 32 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Results General results indicate that in the Gulf of Naples the loss of historical Cystoseira Sargassum species corresponds to the high presence of urban infrastructures mainly in front of the metropolitan area where the introduction of novel habitats reaches the highest value 63 Results referred to populations around the island of Ischia testify that 1 the historical occurrence of shallow Cystoseira and Sargassum populations are lost 2 this loss coincides with the highest percentage of urban infrastructures and coast transformation North Side 52 3 where artificia
381. ma 10 12 giugno 2015 M BERTOLINO M PANSINI C SANTINI G BAVESTRELLO Dipartimento di Scienze della Terra dell Ambiente e della Vita DISTAV Universita di Genova Corso Europa 26 16132 Genova Italia marco bertolino edu unige it LA SPONGOFAUNA ASSOCIATA A SORGENTI IDROTERMALI SUPERFICIALI DELL ISOLA DI BANGKA INDONESIA THE SPONGE FAUNA ASSOCIATED TO SHALLOW WATER HYDROTHERMAL VENTS AT BANGKA ISLAND INDONESIA Abstract This study reports about the sponge fauna settled around two hydrothermal vents arising from a sandy bottom 20 25 m depth at Bangka Is North Sulawesi Indonesia The water flowing from the sediments has a temperature of about 90 C that 1 m over the vent decreases to about 40 C The main sponge species recorded belong to three genera Tedania Haliclona and Ircinia A quantitative study has been performed to evaluate the sponge cover along four linear transects for each vent The hot water flow exerts a positive influence on sponges favouring their settlement in the area close to the vents It is possible to hypothesise that the water rich in silicates may enhance the sponge growth Key words porifera hydrothermal vents demosponges North Sulawesi Introduzione Le sorgenti idrotermali sottomarine di cui sono ricchi i fondi oceanici ospitano abbondanti comunit microbiche a causa delle temperature elevate e della grande ricchezza di minerali di provenienza endogena che forniscono il subs
382. mediante il grattaggio identificato a livello 70 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 di OTU Unita Tassonomiche Operative pesato con bilancia analitica per la stima del peso secco ed infine i dati sono stati analizzati con ANOVA a due fattori Risultati Differenze significative sono state riscontrate tra le temperature registrate sulle superfici di reclutamento bianche e nere evidenziando un incremento nei valori massimi di T registrata sui trattamenti neri pari a circa 2 C mentre in media queste differenze si attestano su valori di circa 0 65 C tra superfici bianche e superfici nere Dopo quattro mesi il popolamento insediato sulle superfici di reclutamento ad alta pCO era composto principalmente da cianobatteri a patina e filamentosi mentre nelle stazioni di controllo si assisteva ad un significativo incremento di alghe rosse della famiglia Rhodomelaceae Le diatomee invece sono state ritrovate nella maggior parte delle superfici di reclutamento in entrambi i siti esposti a diversi livelli di pCO gt In laboratorio sono state identificate complessivamente nove OTU Nell ANOVA effettuata sulla ricchezza in OTU S non si registrano differenze significative n in funzione della pCO p 0 2338 n all interno del sito tra trattamenti di temperatura differenti p 0 6032 Invece la C dei gruppi algali microalgali presenti sui substrati di reclutamento varia significa
383. mens of Caretta caretta have been observed Their carapaces were a little more than 1 m long Among them four individuals were easily recognizable from the look of their carapace One individual has a clean unfouled carapace another shows its carapace heavily colonized by barnacles only onto the carapace of the third specimen barnacles and oysters are settled and the fourth individual has the hinder right leg signed by an evident falciform scar Three individuals seem female Conclusions The length of the carapaces of the specimes observed in the Mar Piccolo basin suggests that they are adults The presence of C caretta in the high Ionian Sea was already reported indeed a tracked turtle was observed staying there for 40 days Bentivegna 2002 In addition in July 2011 for the first time and in summer 2014 WWE volunteers observed some nests about 60 km far from the town of Taranto Magazzino 2014 So in the high Ionian Sea C caretta lives and also lay eggs Its presence in the Mar Piccolo is surprising but it is not a rare case in a Transitional Water System Indeed juveniles were observed in the lagoon of Venice and at Venetian river mouths Novarini et al 2009 as well as adults in the Marano and the Grado lagoons www blublog net p 438 where they go to feed In the ardak lagoon Turkey the presence of C caretta in spring seems to coincide with the occurrence of two Diplodus species Yalgin Ozdilek et al 2012 On the other h
384. miglie di teleostei segnalate ben 49 sono presenti con una specie e 13 con 2 specie Le famiglie pi numerose sono i Gobidi con 23 specie seguite dagli Sparidi con 22 e dai Labridi con 18 Mictofidi 17 e Soleidi 14 Conclusioni Non si evidenziano gradienti longitudinali o latitudinali nella distribuzione del numero delle specie di Osteitti ed Elasmobranchi Delle 344 specie di Osteitti solo 54 sono comuni a tutte le 18 GSA 288 sono quelle presenti nelle GSA italiane corrispondenti al 65 dei 441 Osteitti dei mari italiani Relini et al 2011 152 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Delle 50 specie di Elasmobranchi solo 5 sono presenti in tutte e 18 le GSA Etmopterus spinax Linnaeus 1758 Galeus melastomus Rafinesque 1810 Dipturus oxyrinchus Linnaeus 1758 Scyliorhinus canicula Linnaeus 1758 e Torpedo marmorata Risso 1810 45 presenti nelle GSA italiane In precedenti lavori erano state segnalate per le campagne MEDITS 1994 1998 Bertrand et al 2000 44 specie 19 squaliformi 24 raiformi 1 chimera Nelle campagne nazionali GRUND tra il 1985 e 1998 sono stati pescati 288 Osteitti Relini 2000 44 elasmobranchi di cui 17 squaliformi 26 raiformi e 1 chimera Relini et al 2000 ovvio che con l aumentare degli anni di osservazione c un incremento del numero totale delle specie ma anche una variazione Un accurato censimento delle specie in ciascuna
385. mity and information Science 242 1132 1139 ODUM H T 1996 Environmental Accounting Emergy and Environmental Decision Making John Wiley and Sons New York 370 pp RUSSO G F ASCIONE M FRANZESE P P 2004 Analisi emergetica della Riserva marina di Punta Campanella valutazione ecologico economica del comparto pesca Biologi Italiani 11 63 70 ULGIATI S ZUCARO A FRANZESE P P 2011 Shared wealth or nobody s land The worth of natural capital and ecosystem services Ecol Econ 70 778 787 18 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 R MOSETTI OGS Istituto Nazionale di Oceanografia e di Geofisica Sperimentale Via A Piccard 54 34100 Trieste Italia rmosetti ogs trieste it IL PROGETTO ADRIPLAN VERSO UNA PIANIFICAZIONE DELLO SPAZIO MARITTIMO NELLA MACROREGIONE ADRIATICO IONICA ADRIPLAN PROJECT MARINE SPATIAL PLANNING IN THE ADRIATIC IONIAN REGION Marine Spatial Planning MSP un modo pratico di creare e definire una pi razionale organizzazione dell uso dello spazio marittimo e delle interazioni fra i suoi usi per bilanciare le domande di sviluppo con la necessit di proteggere gli ecosistemi marini e di raggiungere obiettivi sociali ed economici in un modo trasparente e pianificato Per la Macroregione Adriatico Ionica stata definita una strategia Europea EUSAIR European Strategy for the Adriatic Ionian Region che ha le seguent
386. n local ecological knowledge PLoS ONE 6 9 BIANCHI C N 2007 Biodiversity issues for the forthcoming tropical Mediterranean Sea Hydrobiologia 580 7 21 CIESM 2008 Climate warming and related changes in Mediterranean marine biota CIESM Workshop Monographs 35 152 pp GALIL B S KEVREKIDIS K 2002 Exotic decapods and stomatopods off Rhodes Island Greece and the Eastern Mediterranean Transient Crustaceana 75 7 925 930 GUREL T 2007 Pond culture of Penaeus semisulcatus and Marsupenaeus japonicus Decapoda Penaeidae on the West coast of Turkey Turk J Fish Aquat Sci 7 7 11 KEVREKIDIS K GALIL B S 2003 Decapoda and Stomatopoda Crustacea of Rodos Island Greece and the erythrean expansion NW of the Levantine sea Medit Mar Sci 4 57 66 KING M 1995 Fisheries biology assessment and management Oxford University Press 342 pp MANASIRLI M KIVAGA V B PERKER M 2014 Reproduction growth mortality and exploitation rate of Penaeus semisulcatus De Haan 1844 Decapoda Penaeidae from Iskenderun Bay northeastern Mediterranean Crustaceana 87 4 385 400 OZTURK B 2010 Status of alien species in the Black and Mediterranean Seas Studies amp Reviews FAO General Fisheries Commission for the Mediterranean 87 103 pp This work was carried out within DCF supported by the Italian Ministry of Agriculture MiPAAF and the EC 135 Volume pre print 46 Congresso della Societa Itali
387. n of conspicuous species the dominant facies and their bathymetric range were obtained Some frames of HD videos were then analyzed to calculate the density of fan corals and percent coverings of encrusting sponges through the use of image analysis software ImageJ S Results From the videos analysis a clear succession of facies along the bathymetric gradient is evident Fig 1 The slope margin from 76 to 83 3 m is characterized 74 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 by a facies with P clavata 4 63 1 83 colonies m Calcareous rhodophytes e g Lithothamnion sp and Mesophyllum sp sponges e g Spirastrella sp and Crambe crambe bryozoans e g Reteporella sp and Myriapora truncata ascidians e g Halocyntia papillosa and annelids e g Filograna implexa and Sabella pavonina were observed in association with the fan coral With increasing depth next facies presents the co dominance of C rubrum 43 85 9 01 colonies m and E cavolinii 13 50 5 85 colonies m the former is particularly abundant from 90 to 104 m with a total range between 82 and 115 m while the latter is abundant from 85 to 112 m with a total range between 76 and 115 m Organisms associated to this facies include encrusting sponges e g Cliona sp Halyclona sp Condrosia sp Aplysina sp erected and massive sponges e g Axinella sp bryozoans e g R
388. n of the study area covering only the two main canyon branches was defined Differences in the encounter rate for each species were investigated by performing a comparison between the two subareas ER values resulted higher in the canyons subarea for all species excluding sperm whale and for bottlenose dolphin whose ER was lower when calculated in the canyons subarea Key words cetology ecology distribution Ligurian Sea Introduzione I canyon sottomarini sono considerati strutture chiave dal punto di vista ecologico per via del ruolo che svolgono nel favorire gli scambi di nutrienti tra le acque profonde e la piattaforma continentale Paull et al 2008 In particolare i due canyon che si originano dalle foci dei fiumi Polcevera e Bisagno e che si estendono per oltre 70 km a sud di Genova offrono un campo d indagine potenzialmente interessante per studiare la biodiversita e la distribuzione dei cetacei sia per la relativa vicinanza alla costa sia per la posizione centrale che l area occupa all interno del Santuario Pelagos per la tutela e la salvaguardia dei cetacei del Mediterraneo Materiali e metodi L area di studio va da Capo Arenzano alla Punta di Portofino ha come limite settentrionale la linea batimetrica dei 100 m e si estende per circa 15 miglia in direzione sud interessando una superficie di circa 1125 5 km I dati sono stati raccolti dal 2001 al 2014 con uscite giornaliere condotte su barche da whale watching e su g
389. n the NW part the particles are disposed in a filament like structure as a consequence of the advection operated mainly by LIW flowing northward along the W Sardinia slope On the contrary VM scenario the probability density function for depths shows a larger presence of particles in the surface layers In the horizontal particles are shaped by the Western Sardinian Current and by the Algerian current flowing in the Sardinian Channel Eggs positive buoyancy largely affects the retention percentage in the domain maximum for PT 96 and minimum in VM 40 of which 3 beached Conclusions Lagrangian simulations show that eggs buoyancy could strongly affect the eggs and larval dispersal in the surface layer and thus the retention in the domain considered The VM scenario seems to be the more realistic in which eggs and newly hatched larvae undergo a sub surface horizontal displacements in the surface layer as hypotheses by Orsi Relini et al 2012 The distribution of the particles considering the persistent spawning areas doesn t seem to involve the eastern part of Sardinian coast suggesting that such a stretch of coast should be feeded by different spawning grounds Although the limitations in the model setup mainly due to the lack of knowledge of many biological aspects of the species i e larval stages growth mortality rates presence of food and predators egg buoyancy the ongoing study represents the first attempt to modeling the eggs and
390. na di Biologia Marina Roma 10 12 giugno 2015 G CARUSO M BORGHINI M GRAZIANO M PAPALE A C RAPPAZZO G RUGGERI E DE DOMENICO Istituto per 1 Ambiente Marino Costiero IAMC Consiglio Nazionale delle Ricerche CNR Spianata S Raineri 86 98122 Messina Italia gabriella caruso iamc cnr it Istituto di Scienze Marine ISMAR CNR Pozzuolo di Lerici SP Italia Dipartimento di Scienze Biologiche ed Ambientali Universita di Messina Messina Italia ABBONDANZA BATTERICA ETEROTROFA ED ATTIVITA ENZIMATICHE MICROBICHE IN MEDITERRANEO OCCIDENTALE CAMPAGNA VENUS 2010 ABUNDANCE OF HETEROTROPHIC BACTERIA AND MICROBIAL ENZYME ACTIVITIES IN THE WESTERN MEDITERRANEAN SEA VENUS 2010 CRUISE Abstract Heterotrophic and luminous bacteria leucine aminopeptidase and alkaline phosphatase and the main hydrological parameters were measured in the Western Mediterranean Sea to improve knowledge on the microbial distribution and role at epi meso and bathy pelagic layers Hot spots of abundance and activity were found also at meso and bathy pelagic layers probably related to water circulation dynamics Key words organic matter decomposition enzymes heterotrophic bacteria Mediterranean Sea Introduzione Le dinamiche fisico chimiche del Mar Mediterraneo sono state oggetto di numerose indagini Malanotte Rizzoli et al 2014 tuttavia sono ancora limitate le conoscenze sulle comunit microbiche e sul ruolo svolt
391. na di Biologia Marina Roma 10 12 giugno 2015 G CHIMIENTI P PANETTA A LIONETTI P RICCI R CARLUCCI A MATARRESE F MASTROTOTARO Dipartimento di Biologia Universit di Bari Aldo Moro Via Orabona 4 70125 Bari Italia giovanni chimienti uniba it FINDINGS OF JUVENILES OF DONAX SEMISTRIATUS MOLLUSCA BIVALVIA IN THE SOUTH ADRIATIC SEA RITROVAMENTO DI GIOVANILI DI DONAX SEMISTRIATUS MOLLUSCA BIVALVIA NEL BASSO ADRIATICO Abstract A population of the bivalve Donax semistriatus was found on the sandy shallow seabed of the Adriatic coasts of Apulia Mediterranean Sea with a density of more than 200000 No km The description of the length frequency distribution within the population proved the dominance of juveniles showing a probable high fishing pressure Key words Donax semistriatus marine molluscs biometry Mediterranean Sea Introduction Donax semistriatus Poli 1795 is a littoral species Neuberger Cywiak et al 1989 characterizing the Mediterranean biocenosis of fine sands in shallow waters SFS sensu P r s amp Picard 1964 down to 2 5 m in depth Such mollusc can be also found as associated species within the biocenoses of the fine well sorted sands SFBC together with other species of the genus Donax generally considered as characteristic i e D venustus Poli 1795 and D trunculus Linnaeus 1758 However although D semistriatus presents a commercial value along Italian coasts up to date th
392. ncludes a drifting larval phase that may spend long periods in the open ocean where the larvae are dispersed mainly by marine currents For Aristeid shrimps a model of reproductive dynamics suggested that newly hatched larvae would perform a rapid and long migration from the deeper spawning areas to the upper layers where they are passively transported by the superficial currents Carbonell et al 2010 In the surface layers Mediterranean currents such as the Modified Atlantic Water drift play an important part in the horizontal displacement of the larvae Orsi Relini et al 2012 This displacement during the pelagic life could be very long lasting 3 to 6 weeks Fernandez et al 2011 when the decapodid stage larvae move to deeper waters to reach the deep sea grounds Recently Palmas et al 2015 identified in the Sardinian slope some persistent spawning areas for Aristaeomorpha foliacea Risso 1827 In the present work we perform a preliminary evaluation through a 3D egg larvae dispersion model of the potential dispersal areal connected to the above cited spawning areas Materials and methods Larval and eggs dispersion was modeled using Ichthyop a coupled biophysical Lagrangian particle tracking tool Lett et al 2008 The 3D hydrodynamic fields were produced by a regional model covering the seas of Sardinia SeSaMo Seas of Sardinia Model Olita et al 2015 The simulation was integrated for one year from January to December 2012
393. nd Sicily and recently also in the Tyrrhenian and in the middle Adriatic sea www tartalife eu However C caretta populations are decreasing due to accidental captures by fishing gears pollutants ingestion of plastic bags mistaken for food and the anthropogenic disturb in the localities of nesting Bentivegna 2002 For this reason this species is listed as endangered and protected under the Directive Habitat 92 43 EEC and in the IUCN red list of endangered species It is also included in the framework of the Directive 2008 56 EEC MSFD within the Descriptor 1 Biodiversity Many projects aim to develop strategies to reduce the by catches of sea turtle www tartalife eu and guidelines were developed to recover and medicate injured specimens before releasing them into the sea Mo et al 2013 The aim of this paper is to highlight the presence of Caretta caretta in the Mar Piccolo basin observed since 2010 but never reported Materials and methods In 2014 the freediving sightings occurred while other activities were carried out therefore they were casual and did not occurr in the framework of a research planned to study the population However they were very 109 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 frequent sometimes daily except in winter The divers observed a few morphological features of some specimens useful to recognize them Results A few speci
394. nd Systems Biology University of Turin Turin Italy Accademia del Leviatano Via Astronomia 00144 Rome Italy CISMAR University of Tuscia Borgo Le Saline 01016 Tarquinia VT Italy Dipartimento di Biologia University of Pisa Via Derna 1 56126 Pisa Italy TKetos Via Italia 58 95127 Catania Italy 8Universit Politecnica delle Marche Piazza Roma 22 60121 Ancona Italy MATTM Italy CETACEANS AT RISK BY PLASTIC DEBRIS FIRST RESULTS FROM THE FIXED LINE TRANSECT MEDITERRANEAN MONITORING NETWORK CETACEI E PLASTICA PRIMI RISULTATI DELLA RETE MEDITERRANEA DI MONITORAGGIO Abstract Marine plastic debris is one of the main threat affecting cetaceans and other macro fauna A specific protocol was adapted by the Mediterranean network that monitors cetaceans using ferries as platform of observation allowing a complementary data collection on marine macro litter Since 2013 the protocol was applied along 5 fixed transects 2700 km monitored year round between Italy France Spain Tunisia and Greece Plastic was the main component of the marine litter with highest density in summer 2 53 0 5 items km Kernel analysis revealed variation in distribution of plastic debris and the overlap with squid eating species distribution Key words cetacean plastic debris Mediterranean Sea Introduction Among cetaceans toothed species are mostly affected by ingestion of plastic litter that can be confused with potential
395. nds In the latter case a multilateral cross border cooperation initiative funded by the European Neighborhood and Partnership Instrument ENPI and named ECOSAFIMED is working for the conservation of the Mediterranean benthic communities and the promotion of sustainable artisanal fisheries as a perfect example of ecosystem based case of Mediterranean Marine Spatial Planning Key words coralligenous communities fisheries human impact Mediterranean Sea Introduzione La Pianificazione Territoriale Marittima un mezzo per raggiungere un uso razionale dello spazio marino per ridurre i conflitti tra i diversi utilizzi per bilanciare le richieste di sviluppo sociali ed economiche con la necessaria protezione dell ambiente Questi obiettivi possono essere raggiunti grazie ad una zonizzazione a diversa scala dello spazio marino basata su limitazioni variabili della pesca e degli input urbani e su un diverso impiego degli attrezzi Douvere 2008 Il coralligeno un habitat mediterraneo di interesse comunitario incluso in diverse convenzioni internazionali Convenzione di Berna Direttiva Habitat Convenzione di Barcellona Ospita una grande ricchezza specifica includendo circa il 20 delle specie viventi nel bacino mediterraneo Ballesteros 2006 Questa ricchezza dipende dai molteplici processi di pluri stratificazione dei popolamenti con numerosi fenomeni di epibiosi e criptobiosi e dalla tridimensionalit del substrato stesso che grazie all
396. ne e banche dati di spiaggiamenti neron desea ARL a uae la PACE D S MUSSI B AIROLDI S ALESSI J ARCANGELI A ATZORI F AZZOLIN M CAMPANA IL CELONA A FIORI C GIACOMA C GNONE G LUPERINI C MANGANO R Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 MIRAGLIUOLO A MOULINS A NUTI S PELLEGRINO G ROSSO M SALVIOLI F TEPSICH P TRINGALI M New insights on the presence and distribution of the short beaked common dolphin Delphinus delphis in Italian Waters ii 226 SCORDAMAGLIA E ROSSI A GNONE G BELLINGERI M MANFREDI P NUTI S SALVIOLI F SANTANGELO G Demography of bottlenose dolphin Tursiops truncatus Montagu 1821 in the north west Mediterranean Sea quantification of female TEproductive parameters turin nni ila en n ere 228 Poster CARLUCCI R RICCI P MICCOLI SARTORI S CIPRIANO G COSENTINO A LIONETTI A FANIZZA C Changes in behaviour and group size of Stenella coeruleoalba in the Gulf of Taranto northern Ionian Sea central Mediterranean Sea 231 COSENTINO A FANIZZA C CORCELLA M E PALA A CARLUCCI R MICCOLI SARTORI S ZIZZO N ANTONACCI R CICCARESE S Genetic molecular protocols for the study of the social structure in Stenella coeruleoalba in the Gulf of Taranto 233 FOSSA F BELLINGERI M MARINI C VASSALLO P TRUCCHI R GNONE G Analisi del
397. ne analoga stata documentata nell area di Kolbeinsey North Iceland studiando una sorgente idrotermale situata a 90 m di profondit Fricke et al 1989 Le sorgenti idrotermali indonesiane favoriscono sensibilmente l insediamento e la crescita di spugne in un area di pochi metri intorno ad esse possibile ipotizzare che le acque idrotermali ricche di silicati Tarasov et al 1999 possano facilitare la formazione delle spicole e quindi favorire la crescita delle spugne I pochi dati disponibili sulla presenza di spugne nelle biocenosi delle sorgenti idrotermali Fricke et al 1989 Tarasov et al 1999 Pansini et al 2000 Desbruy res et al 2001 non aiutano a comprendere come le spugne possano sopportare l alta temperatura che si misura nei sedimenti sui quali sono insediate possibile tuttavia ipotizzare che il denso rivestimento di collagene prodotto dal basopinacoderma possa agire come isolante per le cellule Bibliografia DESBRUYERES D BISCOITO M CAPRAIS J C COLAC A COMTET T CRASSOUS P FOUQUET Y KHRIPOUNO A LE BRIS N OLU K RISO R SARRADIN P M SEGONZAC M VANGRIESHEIM A 2001 Variations in deep sea hydrothermal vent communities on the Mid Atlantic Ridge near the Azores plateau Deep Sea Res Pt I 48 1325 1346 FRICKE H GIERE O STETTER K ALFREDSSON G A KRISTJANSSON J K STOFFERS P SVAVARSSON J 1989 Hydrothermal vent communities at the shallow subpolar Mid Atlantic ridge M
398. ne biologica di corvina Sciaena umbra L 1758 Essa rappresenta una risorsa ittica di buon valore economico bersaglio della pesca professionale e dilettantistica La specie inoltre inclusa nell Annesso 3 del Protocollo sulle Aree Specialmente Protette e sulla Diversit Biologica del Mediterraneo della Convenzione di Barcellona 1995 con necessit di intraprendere misure di conservazione e gestione delle sue popolazioni Studi precedenti hanno dimostrato la validit del passive listening per identificare la specie durante il periodo riproduttivo Picciulin et al 2013a Materiali e metodi In data 11 luglio 2014 stato effettuato un campionamento acustico in una mitilicoltura dimensioni 2x1 km situata a 1 mn dalla foce del fiume Sile La linea batimetrica di sviluppo dell impianto quella dei 14 m il fondale caratterizzato da sedimenti incoerenti pelite sabbiosa e dalla presenza di filari abbandonati al fondo Colla et al 2014 Nell impianto inoltre sono presenti strutture sommerse artificiali posate da ARPAV Dalle ore 20 alle ore 24 sono state condotte un totale di 15 registrazioni di circa 10 minuti ciascuna usando una catena strumentale composta da un idrofono Reson TC4032 e da un registratore digitale portatile ZoomH1 Handy Recorder Zoom Corporation Japan sampling rate 44 1 kHz 16 bit precedentemente calibrata Durante l analisi sono stati valutati la presenza dei suoni di corvina la tipologia di tali
399. nean Sea Bot Mar 47 381 388 PETROCELLI A VERLAQUE M PORTACCI G CECERE E 2013 About twelve years of presence of the alien species Hypnea cornuta Rhodophyta Gigartinales in the Mar Piccolo of Taranto Ionian Sea southern Italy Rapp Comm int Mer M dit 40 596 The present study was performed within the RITMARE Project and the LTER network 37 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 POSTER COMITATO ACQUACOLTURA 38 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 L CACCAMO M MANCUSO S CAPPELLO F GAI M GENOVESE L GENOVESE C PEDA A PERDICHIZZI G MARICCHIOLO Istituto per l Ambiente Marino Costiero IAMC U O S Messina Consiglio Nazionale delle Ricerche Spianata S Raineri 86 98122 Messina Italia giulia maricchiolo iamc cnr it SPA Grugliasco TO Italia ISPRA Milazzo ME Italia SACCHAROMYCES CEREVISIAE VAR BOULARDII PRESERVA L INTEGRITA DELLA MUCOSA INTESTINALE IN ORATE INFETTATE SPERIMENTALMENTE CON VIBRIO ANGUILLARUM SACCHAROMYCES CEREVISIAE VAR BOULARDII PRESERVES THE INTEGRITY OF THE INTESTINAL MUCOSA IN GILTHEAD SEA BREAM CHALLENGED WITH VIBRIO ANGUILLARUM Abstract This study clearly underlines the protective effect of Saccharomyces cerevisiae var boulardii Saccharomycetaceae towards a pathogenic strain of Vibrio anguillarum Vibrionaceae In
400. nel contempo il mantenimento del corretto equilibrio nelle popolazioni naturali Obiettivo del Progetto Pilota FEP Puglia 2007 2010 Mis 3 5 i cui risultati pi significativi sono qui brevemente riportati stato appunto quello di valutare la fattibilit dell utilizzo di un impianto di allevamento a scala medio piccola per la produzione di giovanili di riccio di mare P lividus da impiegare successivamente in piani di ripopolamento sperimentali di aree del litorale adriatico pugliese dove l incontrollata attivit di pesca ne ha depauperato nel tempo gli stock Materiali e metodi Esemplari adulti di P lividus 35 45 mm sono stati prelevati in un area del litorale Adriatico centro meridionale in cui i banchi sono ancora consistenti trasportati in azienda e allevati in vasche a ricircolo sulla base dei 45 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 protocolli precedentemente messi a punto Fabbrocini e D Adamo 2010 2011 Una volta raggiunta la maturazione delle gonadi stata indotta l emissione dei gameti per l ottenimento degli embrioni Fabbrocini e D Adamo 2011 Le larve sono state allevate fino alla competenza secondo Grosjean et al 1998 dopo la metamorfosi i giovanili sono stati trasferiti nelle vasche di allevamento ed alimentati ad libitum con frammenti di Ulva rigida Agardh 1872 per circa due mesi fino al raggiungimento di un diametro pari a
401. nferiore della prateria di Posidonia integrando Multibeam e Side Scan Sonar Il limite inferiore progressivo della prateria di P oceanica Meinesz e Laurent 1978 poich direttamente collegato alle variazioni di trasparenza dell acqua considerato un utile bioindicatore in ambiente marino costiero Pergent Martini et al 2005 Il SSS rappresenta uno degli strumenti pi utilizzati per la mappatura su larga scala di praterie di P oceanica Pasqualini et al 2000 Montefalcone et al 2013 Tuttavia il SSS non consente di ottenere informazioni batimetriche ed il suo corretto posizionamento spaziale influenzato dagli effetti inerziali del sensore Buckham et al 2003 L uso simultaneo di SSS e MBS ha consentito di mettere a punto un metodo efficace per la mappatura ed il monitoraggio del limite inferiore progressivo della prateria di P oceanica Luzzu et al 2014 L errore di posizionamento medio del SSS stato di 1 98 m massimo 4 3 m La correzione dei sonogrammi utilizzando come control point le forme di fondo rilevate dal sistema multibeam ha permesso di ottenere un alto livello di concordanza spaziale del limite inferiore con un errore medio di 0 1 m massimo di 0 72 m Bibliografia BREHMER P LAFONT T GEORGAKARAKOS S JOSSE E GERLOTTO F COLLET C 2006 Omnidirectional multibeam sonar monitoring applications in fisheries science Fish amp Fisheries T 165 179 BUCKHAM B NAHON M SETO M ZHAO X LAMBERT
402. ng characterized by the presence of species highly sensitive to human disturbance coralligenous is considered among the endangered habitats according to international agreements Habitat Directive 92 43 CEE SPA BIO Protocol Barcelona Convention Berna Convention The human pressure could strongly endanger the high biodiversity of sites with fan coral populations especially of Corallium rubrum L 1758 as pointed out by previous studies Bavestrello et al 2014 The aims of this work are the investigation and characterization of a deep coralligenous on a rocky wall off Punta Campanella Tyrrhenian Sea The dominant facies with fan corals related to different depth ranges with special reference to C rubrum and to the gorgonians Eunicella cavolinii Koch 1887 and Paramuricea clavata Risso 1826 were investigated Materials and methods ROV surveys were carried out within the Marine Strategy MSFD 2008 56 EC monitoring campaign in May 2014 on board of Titan R V The ROV Ageotec Perseus was equipped with a high resolution HD camera and a navigation camera showing geographic coordinates and depth The study area is located to the south of Punta Campanella 40 33 53 21 N 14 19 29 00 E and the analyzed rocky wall lies from 76 to 750 m depth with a mean slope of about 25 Videos regarding the depth range between 76 and 155 m were georeferenced and a bathymetric profile was created using a DTM According to the observatio
403. no della DOM sebbene la degradazione microbica assuma un ruolo centrale Shank et al 2005 Spencer et al 2007 Molte sono ancora le incognite sulla composizione della DOM Sharp et al 2002 e l applicazione di tecniche come l ultrafiltrazione permette di migliorarne le conoscenze Guo e Santschi 2007 L obiettivo di questa indagine stato quello di descrivere la DOM di un area costiera sia dal punto di vista qualitativo che quantitativo insieme alla velocit di rimozione Materiali e metodi Nell ambito del progetto RITMARE stata condotta una campagna di prelievi dicembre 2014 nel tratto costiero posto di fronte alla foce del fiume Po Alcuni campioni superficiali sono stati filtrati attraverso un apparato di ultrafiltrazione a flusso tangenziale Sartorius Sartocon slice Tra questi ne stato selezionato uno per la sua rappresentativit di acque costiere adiacenti ad apporti fluviali 44 44 35 760 N 12 27 32 460 E sal 26 PSU T 18 C Il campione stato pre filtrato filtri GFF 0 7 um ed il filtrato carbonio organico disciolto totale TDOC passato in successione attraverso due membrane in polisulfone con taglio molecolare di 10 kDa per ottenere la frazioni 0 7 um 10 kDa VHMW e 1 kDa per ottenere la frazione 10 1 kDa HMW e lt 1 kDa LMW Le tre frazioni sono state inoculate rapporto 1 10 con le comunit microbiche naturali lt 0 7 um incubate per 72 ore e caratterizzate per la concentrazion
404. nose dolphins sub population Acknowledgements The authors thank all the researchers who collected data References FRUET P F GENOVES R C MOLLER L M BOTTA S SECCHI E R 2015 Using mark recapture and stranding data to estimate reproductive traits in female bottlenose dolphins Tursiops truncatus of the Southwestern Atlantic Ocean Mar Biol 162 3 661 673 doi 10 1007 s00227 015 2613 0 GNONE G BELLINGERI M DHERMAIN F DUPRAZ F NUTI S BEDOCCHI D MOULINS A ROSSO M ALESSI J MCCREA R S AZZELLINO A AIROLDI S PORTUNATO N LARAN S DAVID L DI MEGLIO N BONELLI P MONTESI G TRUCCHI R FOSSA F WURTZ M 2011 Distribution abundance and movements of the bottlenose dolphin Tursiops truncatus in the Pelagos Sanctuary MPA North West Mediterranean Sea Aquat Conserv 21 4 372 388 MITCHENSON H 2008 Inter birth interval estimation for a population of bottlenose dolphins Tursiops truncatus accounting for the effects of individual variations and changes over time Master Thesis University of St Andrews Scotland ROSSI A BENVEGNU E MANFREDI P GNONE G BELLINGERI M SANTANGELO G in prep Demographic hints from stranding data population structure and mortality table of Mediterranean bottlenose dolphin Tursiops truncatus ROSSI A PANIGADA S ARRIGONI M ZANARDELLI M CIMMINO C MARANGI L MANFREDI P SANTANGELO G 2014 Demography and conservation of the Mediterr
405. nsiderable variation depending on species and associated habitat depth preferences with increased protection seen in coastal nurseries and minimal protection seen for deeper nurseries e g Parapenaeus longirostris 6 This is partly attributed to existing environmental policy instruments e g Habitats Directive and Mediterranean Regulation EC 1967 2006 aiming at minimising impacts on coastal priority habitats such as seagrass coralligenous and maerl beds Conclusions MAREA framework project provided an unprecedented opportunity for filling important gaps of knowledge on spatial localization and modelling of critical and protected habitats as well as for the localization of fishing grounds and for identification of stock units with their spatial boundaries In addition other key results relevant for the management of fishery resources were achieved All these outcomes play a pivotal role for applying at Mediterranean scale the marine spatial planning and the Integrated Maritime Policy but also for assisting the implementation of the ecosystem approach to fisheries management Another important result of the MAREA framework project was represented by the identification of knowledge gaps in the different fields thus providing the basis for future improvements Outcomes of MEDISEH project provided relevant results useful to other European projects such as CoCoNet http www coconet fp7 eu and ADRIPLAN Acknowledgements The MAREA Framework c
406. nti tipologie costiere rispettivamente aree urbanizzate AU foci fluviali FF aree portuali AP e aree remote AR Risultati La quantit di rifiuti spiaggiati per ciascuna spiaggia risultata molto eterogenea considerando entrambe le unit di campionamento risultando compresa tra 253 51 n r 100 m Barletta Ponente e 987 80 n r 100 m Marina di Salve per i tratti da 100 m e tra 48 39 n r km Barletta Ponente e 2323 375 n r km Bosco Isola Lesina per i tratti da 1 km Fig la Per entrambe le unit di campionamento n r 100 m e n r 1 km non sono state evidenziate differenze statisticamente significative tra 129 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 periodi inverno e primavera e mari Adriatico pugliese e Ionio pugliese Per entrambe le unit di campionamento si osservano valori pi elevati di rifiuti nelle spiagge appartenenti alla tipologia Aree remote AR In particolare per la variabile n r 100 m si registra un valore di 719 352 per AR 550 311 per AU 378 131 per AP e 364 221 per FF Fig 1b Per la variabile n r km si osserva un valore di 1068 1043 per AR 336 131 per AP 221 203 per FF e 158 52 per AU Fig 1c Il test di Kruskal Wallis per entrambe le variabili non ha comunque evidenziato differenze statisticamente significative tra le tipologie di aree prese in considerazione r N 0 25 50 100 es kM Fionio A Adriatic Sea
407. o nei processi di decomposizione della materia organica nel bacino Mediterraneo occidentale ed in particolare nelle zone profonde Tale bacino rappresenta un area di transito di masse d acqua di origine atlantica in ingresso attraverso lo Stretto di Gibilterra ed una zona chiave nel contesto dei cambiamenti climatici essendo influenzata da fattori climatologici e meteomarini Recenti ricerche Luna et al 2012 hanno dimostrato come questa area rappresenti una sorta di bireattore di materia organica Scopo della presente nota fornire un ulteriore contributo sull abbondanza e metabolismo della comunit batterica eterotrofa lungo un transetto longitudinale compreso fra lo Stretto di Gibilterra e la Sardegna Materiali e metodi Nel mese di agosto 2010 stata effettuata una campagna oceanografica in Mar Mediterraneo occidentale a bordo della N O Urania CNR campioni d acqua sono stati prelevati a varie quote di 14 stazioni situate lungo un transetto tra lo Stretto di Gibilterra e la Sardegna L abbondanza di batteri eterotrofi totali e batteri luminosi 166 campioni stata valutata su piastre di Marine Agar e SWC agar rispettivamente tassi di attivit esoenzimatica leucin aminopeptidasi LAP e fosfatasi alcalina AP 89 misure sono stati stimati mediante substrati fluorogenici La Ferla et al 2010 le concentrazioni di nutrienti sono state determinate mediante metodi spettrofotometrici I dati ottenuti sono stati correla
408. of P rubra as well as the biodiversity associated to this facies Tab 1 Total number No and density No km of colonies of P rubra sampled from 2012 to 2014 in the Ionian Sea with mean depth and geographic coordinates of starting S and ending E fishing point The Station ID St reports the station code and the year of sampling Numero No e densit No km di colonie di P rubra campionate dal 2012 al 2014 nel Mar Ionio con indicazione della profondit media e delle coordinate geografiche di inizio S e fine E pesca La colonna St riporta il codice della stazione e l anno di campionamento St Depth m Lat_S Lon_S Lat_E Lon_E No No km 37_12 24 39 19 34 N 17 08 79 E 39 18 15 N 17 08 69 E 186 4625 37_13 24 39 18 98 N 17 08 66 E 39 17 95 N 17 08 62 E 97 2412 37_14 23 39 18 15 N 17 08 62 E 39 19 62 N 17 08 78 E 0 0 39_12 63 39 35 19 N 16 52 12 E 39 34 15 N 16 53 56 E 403 9492 39_13 63 39 35 05 N 16 52 26 E 39 34 05 N 16 53 63 E 168 4098 39_14 61 39 34 33 N 16 53 20 E 39 35 25 N 16 51 86 E 89 2213 References BERTRAND J A GIL DE SOLA L PAPACONSTANTINOU C RELINI G SOUPLET A 2002 The general specifications of the MEDITS surveys In Abell P Bertrand J Gil de Sola L Papaconstantinou C Relini G Souplet A eds Mediterranean marine demersal resources the MEDITS international trawl survey 1994 1999 Sci Mar 66 Sup
409. of the Gulf of Taranto Italy Ital J Zool 78 1 130 132 FANIZZA C DIMATTEO S POLLAZZON V PRUNELLA V CARLUCCI R 2014 An update of the occurrence of cetaceans in the Gulf of Taranto Western Central Mediterranean Sea Biol Mar Mediterr 21 1 373 374 GASPARI S AZZELLINO A AIROLDI S RUS HOELZEL A 2007 Social kin associations and genetic structuring of striped dolphin populations Stenella coeruleoalba in the Mediterranean Sea Mol Ecol 16 2922 2933 NEUMANN D R 2001 The activity budget of free ranging common dolphins Delphinus delphis in the Northwestern Bay of Plenty New Zealand Aquatic Mammals 27 2 121 136 SHANE S H 1990 Behaviour and ecology of the bottlenose dolphins at Sanibel Island Florida In Leatherwood S Reeves R R eds The Bottlenose Dolphin Academic Press San Diego 245 265 SUTHERLAND W J 1996 From individual behaviour to population ecology Oxford University Press 224 pp 232 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 A COSENTINO C FANIZZA M E CORCELLA A PALA R CARLUCCI S MICCOLI SARTORI N ZIZZO R ANTONACCI S CICCARESE Dipartimento di Biologia Universit di Bari Via Orabona 4 70125 Bari Italia annalisa_cosentino libero it Jonian Dolphin Conservation Viale Virgilio 102 74121 Taranto Italia Dipartimento di Medicina Veterinaria Universita di Bari Italia GENETIC
410. ogia Marina Roma 10 12 giugno 2015 dell ectoparassita P fistula con i tipici lunghi cordoni ovigeri sono state osservate sui fianchi dei pesci e non sulle pinne come riportato da Ismail et al 2013 L analisi video fotografica ha permesso di evidenziare il comportamento di cleaning simbiotico tra conspecifici in entrambe le specie Infatti i piccoli saraghi sono stati osservati avvicinarsi al corpo di conspecifici toccarlo per meno di 1 s con la bocca ed allontanarsi successivamente Fig 1 Fig 1 a Comportamento di pulizia tra i giovanili di D sargus b esemplare di D sargus parassitato a Cleaning behaviour between juveniles of D sargus b D sargus parasitized specimen Conclusioni Considerata la netta separazione temporale dei periodi di insediamento di questi giovanili i seguenti risultati costituiscono la prima osservazione di cleaning behaviour intraspecifica tra giovanili di sparidi in acque costiere mediterranee Si ritiene che tale comportamento sia dettato da esigenze trofiche in quanto le appariscenti strutture riproduttive delle femmine di P fistula rappresentate dai lunghi cordoni ovigeri sarebbero facile oggetto di attenzione e quindi verrebbero ingerite dai giovanili Ulteriori analisi riguardanti anche le altre due specie congeneriche D vulgaris e D annularis sono in corso per verificare la presenza dei parassiti nei contenuti stomacali dei giovanili per poter attribuire il comportamento osserva
411. ol NP t octylphenol t OP bisphenol A BPA and their mixtures Materials and methods Seabream juveniles BW 10 gr were fed 1 BW once a day for 21 days in two experiments as follows I Control Cr1 fed on commercial 202 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 pelleted food NPI t OP1 BPA1 fed on commercial food enriched with 5 mg Kg bw respectively NP2 OP2 BPA2 fed on commercial food enriched with 50 mg Kg bw respectively II Control Cr2 fed on commercial pelleted food and NP_t OP BPA_t OP NP_BPA and MIX fed on commercial food enriched with 5 mg Kg bw of each contaminant The content of contaminants of the food cubes was verified by chemical analysis as well as water samples at day 21 Fish were sacrificed in an excess of anesthetic MS222 Sigma Aldrich and gills were removed for successive studies Histopathological alterations were qualitatively described in 5 um thick sections stained with haematoxylin H amp E and Periodic Acid Schiff PAS in a second step were evaluated semi quantitatively by ranking the severity of lesions as to belong to grade following Santos et al 2014 The presence of enzyme involved in trans membrane ion transport Na K ATPase was analysed by immunohistochemistry Glutathione S transferase GST and catalyse Cat activities were measured in gill homogenates Results Microscopic examinations revealed injuries to gi
412. ollior Schmidt 1862 Crambe crambe Schmidt 1862 Dysidea fragilis Montagu 1814 Hippospongia communis Lamarck 1814 Spongia virgultosa Schmidt 1868 Spongia officinalis Linnaeus 1759 Sycon sp Tethya aurantium Pallas 1766 e Tethya citrina Sar e Melone 1965 Un solo esemplare appartenente alla specie Hymedesmia Hymedesmia pansa Bowerbank 1882 stato osservato su foglia Le spugne di maggiori dimensioni sono localizzate su substrati rocciosi colonizzati dalla posidonia nelle intermatte e al limite superiore delle praterie da evidenziare in tali ambienti la presenza di diverse specie raggruppate a formare i cosiddetti giardini di spugne In tali associazioni sono presenti grandi esemplari con colori e forme di crescita diverse incrostanti massive arborescenti che conferiscono un notevole valore estetico al paesaggio di prateria sommersa 90 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Conclusioni Le praterie di P oceanica favoriscono la colonizzazione da parte delle spugne proteggendole dalle mareggiate e offrendo ambienti ideali per le specie sciafile rizomi e per quelle fotofile intermatte Le spugne svolgono differenti ruoli funzionali a ospitano numerosi invertebrati costituendo un rifugio per specie sciafile endobionti e fotofile epibionti e una nursery per i loro stadi giovanili Pansini 1970 b riciclano il materiale organico parti
413. olo References CAROPPO C GIORDANO L PALMIERI N BELLIO G BISCI A P PORTACCI G SCLAFANI P HOPKINS T S 2012 Progress toward sustainable mussel aquaculture in Mar Piccolo Italy Ecol Soc 17 3 10 http www ecologyandsociety org vol17 iss3 art10 CAROPPO C GIORDANO L RUBINO F BISCI A P HOPKINS T S 2010 Phytoplankton communities as indicators of ecological change in the anthropogenically impacted Mar Piccolo in Taranto Ionian Sea Biol Mar Mediterr 17 1 102 105 CERINO F ORSINI L SARNO D DELL AVERSANO C TARTAGLIONE L ZINGONE A 2005 The alternation of different morphotypes in the seasonal cycle of the toxic diatom Pseudo nitzschia galaxiae Harmful Algae 4 33 48 LUNDHOLM N MOESTRUP 2002 The marine diatom Pseudo nitzschia galaxiae sp nov Bacillariophyceae morphology and phylogenetic relationships Phycologia 41 6 594 605 UTERMOHL H 1958 Zur Vervollkommnung der quantitativen Phytoplankton Methodik Mitt Int Ver Theor Angew Limnol 9 1 38 ZINGONE A TOTTI C SARNO D CABRINI M CAROPPO C GIACOBBE M G LUGLIE A NUCCIO C SOCAL G 2010 Fitoplancton metodiche di analisi quali quantitativa In Socal G Buttino I Cabrini M Mangoni O Penna A Totti C eds Metodologie di studio del plancton marino ISPRA Manuali e Linee Guida 56 213 237 170 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 gi
414. olphins in resting 41 2 socializing 29 4 feeding 17 6 and travelling 13 8 The main results from the post hoc analysis carried out on the total of sightings indicated as cluster 2 was significantly characterized by feeding 9 1 associated to a significant reduction in size group p lt 0 001 due to the dispersal of striped dolphins in predation activities Finally the distribution of the observed behaviours between clusters showed as the percentage of resting occurring in the morning 27 2 was significantly higher than in the early afternoon 3 1 p lt 0 05 Conclusions The main behaviours characterizing the daily variations in the group size of S coeruleoalba in the Gulf of Taranto were identified In fact the group size significantly decreased from morning to early afternoon probably due to the shifting of behaviour from resting with aggregation of dolphins groups to feeding with dispersal of the groups on a larger area A validation through genetic analysis is required to address variability and possible kinships within groups Gaspari et al 2007 A longer time series is requested to explore adaptations of S coeruleoalba to local hydrographic features and possible effects of anthropogenic pressure in the Gulf of Taranto References DIMATTEO S SINISCALCHI M ESPOSITO L PRUNELLA V BONDANESE P BEARZI G QUARANTA A 2011 Encounters with pelagic and continental slope cetacean species near the northern shore
415. omass production during the year a behavior that could ensure a stable harvesting G longissima and G gracilis both grew well in spring and summer but the production slightly decreased in August Lastly G vermiculophylla grew mainly in spring and early summer than stopped growing That species firstly recorded in the lagoon in 2008 Sfriso et al 2010 completely replaced the Ulvaceae at SG in 2014 avoiding anoxic crises as occurred in the 2013 Bastianini et al 2013 Its presence and growth was favored by lower salinity and higher nutrient availability Thomsen amp Mcglathery 2007 References BASTIANINI M BERNARDI AUBRY F ACRI F BRAGA F FACCA C SFRISO A FINOTTO S 2013 The Redentore fish die off in the Lagoon of Venice an integrated view Gruppo di Algologia Riunione Scientifica Annuale Venezia 18 19 Ottobre 32 p SFRISO A MAISTRO S ANDREOLI C MORO I 2010 First record of Gracilaria vermiculophylla Gracilariales Rhodophyta in the Po Delta lagoons Mediterranean Sea Italy J Phycol 46 1024 1027 THOMSEN M S MCGLATHERY K J 2007 Stress tolerance of the invasive macroalgae Codium fragile and Gracilaria vermiculophylla in a soft bottom turbid lagoon Biol Invas 9 499 513 54 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 POSTER COMITATO BENTHOS 55 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Ro
416. ommone Le uscite sono state realizzate solo con condizioni meteo marine inferiori a Beaufort 4 e soprattutto nei mesi compresi tra maggio e ottobre Le rotte delle imbarcazioni e i punti di avvistamento dei cetacei sono stati registrati tramite GPS AI fine di relazionare la distribuzione dei cetacei con la presenza dei canyon sono state individuate due porzioni dell area di studio una contenente le ramificazioni principali dei canyon zona A 524 6 km e una con la parte rimanente zona B 600 9 km L indice di incontro ER per ogni specie stato calcolato come il rapporto tra il numero di avvistamenti ed i km percorsi in sforzo di avvistamento E stata creata una tabella di contingenza di soli 0 e 1 per confrontare statisticamente gli avvistamenti di ogni specie lungo segmenti di rotta di 10 km nelle 2 zone test chi quadro 235 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Risultati Dal 2001 al 2014 sono stati percorsi circa 22 800 km di rilevamento 1 88 6 dei quali a bordo di imbarcazioni da whale watching mentre 1 11 4 a bordo di gommoni Nella zona A sono stati percorsi 16 755 km in B 6 072 km Complessivamente sono stati registrati 399 avvistamenti di stenella Sc 7 di tursiope Tt 32 di balenottera Bp 58 di zifio Zc 28 di capodoglio Pm 16 di grampo Gg e 7 di delfino comune Dd Per ogni specie sono stati calcolati i valori di ER in ciascuna zona T
417. on 23 pp 205 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 F SACCO F MARRONE S LO BRUTTO A BESBES A NFATY M GATT F FIORENTINO M ARCULEO Dipartimento di Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche STEBICEF Universit di Palermo Via Archirafi 18 90123 Palermo Italia marco arculeo unipa it INSTM Centre de Monastir Tunisie Marine Biology Research Center Tajura Lybia Ministry for Sustainable Development the Environment and Climate Change Malta 4TAMC CNR Mazara del Vallo TP Italia MOLECULAR DIVERSITY OF DOLPHINFISH CORYPHAENA HIPPURUS SHOWS THE MERGING OF ENDEMIC AND WIDESPREAD HAPLOTYPES IN THE MEDITERRANEAN SEA EVIDENZE MOLECOLARI SULLA COESISTENZA DI APLOTIPI ENDEMICI E AD AMPIA DISTRIBUZIONE DI LAMPUGA CORYPHAENA HIPPURUS NEL MAR MEDITERRANEO Abstract Molecular data on Coryphaena hippurus Linnaeus 1758 from western and central Mediterranean Sea were reported and compared The aim of the study was to study the mitochondrial molecular structuring of the species at different geographical scales localities sub basins and oceans Results show the absence of a sharp population structure inside the Mediterranean Sea and the isolation of the Mediterranean dolphinfishes from those inhabiting the Atlantic Ocean Key words population genetics Coryphaena hippurus Mediterranean Sea Introduction The dolphinfish Cor
418. oncentrazione sub letale nonostante fosse virulento non ha causato mortalit n sono state osservate lesioni esterne All esame autoptico l intestino appariva lievemente emorragico nei soggetti del gruppo controllo ed in G2 mentre in G3 non si notavano emorragie Nell intestino delle orate G1 si nota un imponente enterite necrotico emorragica con presenza nel lume intestinale di intere porzioni di epitelio e singole cellule sfaldate La mucosa risulta completamente disepitelizzata ed i villi appaiono spesso decapitati Fig 1a b Di contro Fig 1c d le cellule intestinali delle orate G3 alimentate con LEVUCELL SB20 nella dose di 300 mg kg sono state protette dall attacco di V anguillarum L intestino mostra una struttura conservata epitelio in situ e lume sgombro da elementi cellulari sfaldati TEN soggetto del gruppo G1 c d soggetto del gruppo G3 a c H amp E 5x b d H amp E 10x Proximal gut of S aurata challenged with V anguillarum a b G1 group c d G3 group a c H amp E 5x b d H amp E 10x Conclusioni II LEVUCELL SB20 utilizzato in dose adeguata ha dimostrato di esercitare una azione protettiva a livello della mucosa intestinale pertanto viene raccomandato il suo utilizzo nella dieta di S aurata Ringraziamenti Si ringrazia il dott Amedeo Manfrin dell IZS delle Venezie per la fornitura del ceppo patogeno di V anguillarum O1 Bibliografia NEWAJ FYZUL A AL HARBI A H AUSTIN B 2014 Review
419. ong them or with other scientists but also with stakeholders and policy makers Key words Maritime Spatial Planning Integrated Maritime Policy Marine Strategy Ecosystem Approach Blue Growth La Commissione Europea ha definito da tempo attraverso il cosiddetto Libro blu COM 2007 575 una politica marittima integrata per l Unione Europea basata sull esplicito riconoscimento della correlazione di tutte le questioni connesse agli oceani e ai mari europei e della necessit che le politiche marittime vengano elaborate congiuntamente al fine di ottenere i risultati auspicati La Politica Marittima Integrata PMI si propone dunque di coordinare le politiche relative alle diverse attivit che riguardano il mare non di sostituirsi a strumenti pi mirati Il coordinamento che la PMI attua dovrebbe migliorare la coerenza generale fra iniziative politiche e direttive che riguardano le questioni marittime da diversi punti di vista ma il ruolo che la PMI chiamata a svolgere di particolare rilevanza soprattutto laddove necessario far interagire soggetti e settori di attivit differenti per ottenere un avanzamento delle conoscenze o delle capacit operative dei Paesi membri o laddove si debbano sviluppare iniziative trasversali rispetto a pi politiche settoriali Esempi del primo tipo di azione nell ambito della PMI sono l iniziativa su dati marini e conoscenze oceanografiche meglio nota come Conoscenze Oceanografiche 202
420. ongelato rispettivamente Anche l estratto in n butanolo aveva effetti letali su D gyrociliatus LCso 24n 31 7 mg n c 1 27 9 36 mg Il LC5096 22 4 mg I c i 19 8 25 3 mg T Conclusioni I risultati dei saggi tossicologici confermano che l essudato di A marina ha una certa attivit biologica Ad oggi l unico altro anellide marino in grado di produrre secrezioni colorate tossiche per altri metazoi Halla parthenopeia Iori et al 2014 In entrambe le specie il congelamento almeno a breve termine non modifica l attivit dell essudato muco colorato Il muco di H parthenopeia per circa 100 volte pi letale LCso sen per D gyrociliatus 0 03 0 07 rispetto a quello di A marina Parte delle differenze nella tossicit derivano probabilmente dal fatto che le secrezioni di A marina sono diluite infatti impossibile separarle dall acqua presente sulla superficie dell animale perch hanno la stessa consistenza Al contrario il muco di H parthenopeia molto pi viscoso e compatto tende ad aggregarsi e pu essere separato piuttosto agevolmente L attivit biologica mostrata dall essudato di A marina nei confronti di D gyrociliatus lascia supporre che esso possa rappresentare una difesa chimica Le variazioni cromatiche dell essudato in risposta al pH ricordano quelle dell arenicocromo un tri idrossi metossi benzopirenechinone bisolfato presente nella parete del corpo di A marina Dales 1963 Morimoto et
421. oni di altre alghe aliene del genere Caulerpa su popolamenti di invertebrati bentonici in Mediterraneo Box et al 2010 Francour ef al 2009 stata condotta un analisi d impatto su macro e meiofauna associate alla matte di Posidonia oceanica L Delile dell area interessata in relazione al grado di invasione della matte Materiali e metodi Campioni di matte sono stati prelevati l estate del 2013 a circa 3 m di profondit nel Canale di Sicilia Nella localit impattata Donnalucata sono state scelte 2 porzioni di posidonieto a 100 200 m dalla costa distanti tra loro 1 km circa con diversa copertura dell alga aliena totale gt 95 e parziale lt 20 Le 2 localit di controllo Capo Granitola e Capo San Marco sono state scelte a caso tra quelle con posidonieti aventi caratteristiche simili alle precedenti a monte della zona impattata rispetto alla corrente dominante In ogni porzione di posidonieto sono stati scelti 2 siti distanti 100 m circa ove sono state prelevate 3 repliche di matte per caratterizzare la macrofauna carotatore manuale superficie di 400 cm spinto fino a 10 cm all interno della matte setaccio 500 um e 3 per la meiofauna carotatori 3 5 cm setaccio 38 um per un totale di 48 campioni successivamente trattati ed analizzati in laboratorio con le rispettive tecniche standard Il disegno sperimentale prevede un fattore Impatti vs Controllo I vs C fisso 3 livelli Impatto alta copertura
422. onsiderare per poter stimare correttamente possibili effetti sulla struttura e composizione di una comunit in quanto oltre ad agire direttamente sulle componenti biotiche possono alterare le relazioni tra specie pioniere producendo significativi shift nei successivi stadi della comunit intertidale Bibliografia CALDEIRA K WICKETT M E 2003 Anthropogenic carbon and ocean pH Nature 425 365 IPCC 2013 Working group I contribution to the IPCC 5 Assessment Report Climate Change 2013 the physical science basis RUSSELL B D CONNELL S D FINDLAY H S TAIT K WIDDICOMBE S MIESZKOWSKA N 2013 Ocean acidification and rising temperatures may increase biofilm primary productivity but decrease grazer consumption Philos T Roy Soc B 368 doi 10 1098 rstb 2012 0438 THOMPSON R C NORTON T A HAWKINS S J 2004 Physical stress and biological control regulate the producer consumer balance in intertidal biofilms Ecology 85 1372 1382 71 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 L DONNARUMMA L APPOLLONI F DI STEFANO R SANDULLI G F RUSSO Dipartimento di Scienze e Tecnologie Universit di Napoli Parthenope Centro Direzionale Isola C4 80143 Napoli Italia luigiadonnarumma libero it CHARACTERIZATION OF THE VERMETID BIOCONSTRUCTIONS AT LICOSA ISLAND SANTA MARIA DI CASTELLABATE MPA CARATTERIZZAZIONE DELLE BIOCOSTRUZIONI A VERMET
423. ontract Call for tenders MARE 2009 05_Lot1 was supported and financed by the Commission of the European Union DG MARE with 3 012 267 76 euro The European Commission is thankfully acknowledged The opinions expressed are those of the Author of the study only and do not represent the Commission s official position The Author would express her gratitude to all the colleagues who contributed to the 11 MAREA specific projects and especially to the coordinators of the specific projects References BALL IL POSSINGHAM H 2000 Marxan v1 8 2 Marine Reserve Design using Spatially Explicit Annealing Online at http www marineplanning org pdf marxan_manual_1_8_2 pdf COLLOCA F GAROFALO G BITETTO I FACCHINI M T GRATI F MARTIRADONNA A MASTRANTONIO G NIKOLIOUDAKIS N ORDINAS F SCARCELLA G TSERPES G TUGORES M P VALAVANIS V CARLUCCI R FIORENTINO F FOLLESA M C IGLESIAS M KNITTWEIS L LEFKADITOU E LEMBO G MANFREDI C MASSUTI E PACE M L PAPADOPOULOU N SARTOR P SMITH C J SPEDICATO M T 2015 The seascape of demersal fish nursery areas in the North Mediterranean Sea a first step towards the implementation of spatial planning for trawl fisheries PLOS ONE DOI 10 1371 journal pone 0119590 DE LEO F BELLUSCIO A COLLOCA F D AMBROSIO P GIANNOULAKI M MARTIN C PAPADOPOULOU N SCARDI M SPEDICATO M T FRASCHETTI S 2014 Setting conservation priorities for the conservation of critical habitats in
424. opone di valutare sperimentalmente la risposta del biofilm che caratterizza i primi stadi di colonizzazione delle comunit intertidali rocciose a cambiamenti indotti di temperatura e pCO lungo un gradiente di chimica dei carbonati nell Isola di Vulcano Isole Eolie Il biofilm una delle componenti principali degli ecosistemi costieri in quanto svolge un importante ruolo nel determinare le dinamiche delle comunit bentoniche pi strutturate Thompson et al 2004 Materiali e metodi Per valutare il reclutamento e i primi stadi successionali da giugno ad ottobre 2013 della comunit dell intertidale roccioso sono stati posizionati substrati artificiali in due siti lungo il gradiente di pH pCO di Baia di Levante un sito a bassa pCO 2291 774 uatm ed un sito di controllo 388 14 uatm pCO In ciascun sito sono state fissate 10 superfici di reclutamento di 14 5 em la cui temperatura superficiale stata manipolata applicando una cornice bianca ed una cornice nera La differenza di colore nei contorni di ciascuna superficie di reclutamento conferisce uno scarto di temperatura che stato misurato in continuo con sensori I Buttons Una volta rimosse dal sito di campionamento le superfici sono state fotografate per una successiva stima della copertura percentuale totale C e conservate in una soluzione con alcol etilico al 70 per un analisi tassonomica di dettaglio Il biofilm stato prelevato dalla superficie di reclutamento
425. or cell type was the spherule cell and it could release cytotoxic molecules after the xenogeneic cell contact Electrophoretic analysis showed in the coelomocytes lysate supernatant two hemolytic fractions with a molecular weight of 79 and 44 kDa The two protein fractions are able to lyse rabbit and sheep erythrocytes Key words Holothuria tubulosa invertebrate cytotoxic activity coelomocyte Introduction Immunity in invertebrates is confined to non specific inflammatory responses mediated to a large extent by the circulating blood cells haemocytes or coelomocytes or their products A recent study has shown a cytotoxic activity of the echinoidea Paracentrotus lividus Lamarck 1816 coelomocytes in which the effector cells were the uncolored spherulocytes Arizza et al 2007 The main objective of this work was to study the cytotoxic activity of the cell types present in the coelomic fluid using rabbit and sheep blood cells as targets by in vitro assay in Holothuria tubulosa Materials and methods Healthy adults of H tubulosa 50 animals body length 9 to 13 cm weight 80 to 120 g were collected in the Gulf of Palermo Mongerbino 38 06 00 N 13 30 00 E Animals were kept in aquaria for a week for acclimation before starting the experiments The coelomic fluid CF was collected according to Vazzana et al 2015 Coelomocytes were separated from plasma by centrifugation and suspended again in ISO EDTA Coelomocyte lysate supernat
426. ostiero IAMC CNR UOS Taranto Via Roma 3 74123 Taranto Italia rosanna cavallo iame cnr it Dipartimento di Scienze e Tecnologie Biologiche e Ambientali Universit del Salento Via per Monteroni 73100 Lecce Italia ANALISI MICROBIOLOGICHE DI UN AREA COSTIERA DEL MAR GRANDE DI TARANTO ADIBITA AD ACQUACOLTURA MICROBIOLOGICAL ANALISYS OF AQUACULTURED COASTAL AREA IN MAR GRANDE TARANTO ITALY Abstract In order to study the impact of livestock on the environment it was conducted the analysis of some microbiological parameters Vibrionaceae and coliforms in water bodies of aquaculture facilities in Mar Grande of Taranto The results obtained showed the presence of potentially pathogenic bacterial species both for humans and for animals This study showed the necessity of routine microbiological monitoring in order to better understand the distribution and abundance of potentially pathogenic species It also highlighted the usefulness of defining new metrics for the quality of the environment and the protection of human health Key words aquaculture Vibrionaceae microbial pollution Introduzione L acquacoltura il comparto delle produzioni animali in cui si sta registrando la crescita pi consistente e del quale si cominciano ad evidenziare i limiti di sostenibilit a livello ambientale per questo motivo che le attivit di ricerca in questo settore si stanno orientando alla individuazione di indici e indicatori
427. over time obtaining information about the development of the behaviour The photoidentification ID is a non invasive method of mark and recapture but it still remains a subjective method since the final decision is taken by the observer based on own experience Gubili et al 2009 This study is the first step to develop a protocol for photo ID not merely visual using dorsal fin images and to build a database of individual recognized great white shark Materials and methods During 6 scientific expeditions from 2009 to 2014 the Centro Studi Squali collected 323 valid photos of dorsal fins for 296 sharks along Dyer Island South Africa where an important population of gt 500 great white sharks is yearly present Micarelli et al 2006 Towner et al 2013 and hosts about 60000 cape fur seals Arctocephalus pusillus pusillus the main food resource for the local population of C carcharias With a 12 m long boat we anchored at 100 m close to the island in 8 m deep waters Fin photos were collected using digital cameras 3 CANON model EOS 550 with a SIGMA 70 300 mm lens and 2 with CANON 18 135 mm lenses Images were analysed before with a software create to identify cetaceans that compare the dorsal fin edges and than with an editing program to compare several 144 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 images at the same times Each photo was numbered and completed with a
428. own The Gulf of Cofano a locality of relatively small extent 8 km may be not adequate to represent differences in the EI among localities Furthermore inner and outer edges of the reef resulted different in terms of number of recruits It is likely that desiccation occurring at low tide might affect the settlement of recruits more on the inner edge than on the outer edge Recent studies highlight that the air and sea surface temperature have a major role on both the rate of embryonic development and on the reproductive capacity of intertidal organisms Rognstad and Hilbish 2014 Enhancing management and conservation practices of the vermetid reef requires additional studies to improve the knowledge about the life cycle of D petraeum and to evaluate the influence of other environmental factors on the recruitment patterns of this reef building species References CALVO M TEMPLADO J PENCHASZADEH P E 1998 Reproductive biology of the Gregarious Mediterranean vermetid gastropod Dendropoma petraeum J Mar Biol Assoc UK 78 525 549 CHEMELLO R 2009 Le biocostruzioni marine in Mediterraneo Lo stato delle conoscenze sui reef a vermeti Biol Mar Mediterr 16 1 2 18 CHEMELLO R DIELI T ANTONIOLI F 2000 Il ruolo dei reef a vermetidi nella valutazione della biodiversit In Silenzi S ed Mare e cambiamenti globali Aspetti scientifici e gestione del territorio ICRAM Roma 105 118 MARSHALL D J STYAN C MC
429. pecies became rare Parenzan 1984 until its almost complete disappearance Recently due to the ban on fishing and the improvement of the environmental conditions linked to the closure of many urban discharges some species were observed in this basin with increasingly large populations among these P nobilis and the seagrass Cymodocea nodosa Ucria Ascherson Even considering this study as preliminar and with few sampling sites though chosen ad hoc on the basis of historical data a high mean density of live specimens of P nobilis was registered compared to other sites in the Mediterranean Addis et al 2009 Vazquez Luis et al 2014 and the adjacent Mar Grande too Centoducati et al 2007 This together with the low number of deads could lead to hypothesize the presence of a stable population with a high grade of recruitment In fact especially at the station where an exceptional density was measured a consistent number of juveniles was observed data not shown even if a sporadic local recruitment is reported for this species Butler et al 1993 As already indicated by Centoducati et al 2007 for Mar Grande these results could mean that a recovery of this species is acting in the Taranto seas despite the very high degree of pollution and environmental stress in general Therefore a more detailed study has been planned to gain more consistent data on the structure of the population according to the Directive 2008 56 EEC MSFD Ind
430. pl 2 9 17 KUKENTHAL W BROCH H 1911 Pennatulacea Wiss Ergebn Deutschen Tiefsee Expedition Valdivia 1898 99 13 1 113 576 MASTROTOTARO F CHIMIENTI G CAPEZZUTO F CARLUCCI R WILLIAMS G 2015 First record of Protoptilum carpenteri Cnidaria Octocorallia Pennatulacea in the Mediterranean Sea Ital J Zool 82 1 61 68 MASTROTOTARO F MAIORANO P VERTINO A BATTISTA D INDENNIDATE A SAVINI S TURSI A D ONGHIA G 2013 A facies of Kophobelemnon Cnidaria Octocorallia from Santa Maria di Leuca coral province Mediterranean Sea Mar Ecol 34 313 320 MORRI C BAVESTRELLO G BIANCHI C N 1991 Faunal and ecological notes on some benthic cnidarian species from the Tuscan Archipelago and the Eastern Ligurian Sea Western Mediterranean Boll Mus Ist Biol Univ Genova 54 55 27 47 MORRI C ESPOSITO F PESSANI D 2008 Anthozoa In Relini G ed Checklist della flora e della fauna dei mari italiani Parte I Biol Mar Mediterr 15 Suppl 1 92 101 PORPORATO E MANGANO M C DE DOMENICO F GIACOBBE S SPANO N 2008 Addensamenti di pennatulacei nello Stretto di Messina Biol Mar Mediterr 15 1 284 285 SALVATI E BO M RONDININI C BATTISTONI A TEOFILI C 2014 Lista Rossa IUCN dei coralli italiani Comitato italiano IUCN e Ministero dell Ambiente e della Tutela del Territorio e del Mare Roma 40 pp 65 Volume pre print 46 Congresso della Societa Italia
431. populations Stenella coeruleoalba in the Mediterranean Sea Mol Ecol 16 2922 2933 234 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 F Fossa M BELLINGERI C MARINI P VASSALLO R TRUCCHI G GNONE Acquario di Genova Area Porto Antico Ponte Spinola 16128 Genova Italia ffossa costaedutainment it Dipartimento di Scienze della Terra dell Ambiente e della Vita DISTAV Universit di Genova Corso Europa 26 16132 Genova Italia WWF Italia Liguria Vico Casana 9 3 16123 Genova Italia ANALISI DELL INDICE DI INCONTRO DELLE SPECIE DI CETACEI NEICANYON SOTTOMARINI DI GENOVA CETACEAN ENCOUNTER RATE ANALYSIS IN THE GENOA RIVERS CANYON Abstract Submarine canyon represent an interesting field of study for biodiversity in marine ecosystems From 2001 to 2014 approximately 23 000 km were surveyed in the Gulf of Genoa in an area characterized by the presence of two wide submarine canyons In the whole period 7 cetacean species were observed striped dolphin Stenella coeruleoalba Meyen 1833 bottlenose dolphin Tursiops truncatus Montagu 1821 Mediterranean fin whale Balaenoptera physalus Linnaeus 1758 Cuvier s beaked whale Ziphius cavirostris Cuvier 1823 sperm whale Pyseter macrocephalus Linnaeus 1758 Risso s dolphin Grampus griseus Cuvier 1812 and short beaked common dolphin Delphinus delphis Linnaeus 1758 A restricted portio
432. poradici picchi hot spots di LAP negli strati meso e bati pelagici testimonia la presenza di una comunit microbica attiva nei processi degradativi Tassi enzimatici elevati anche in acque profonde potrebbero costituire un segnale della presenza ad elevate profondit di materiale organico non ancora degradato suggerendo la diffusione nel bacino occidentale di variazioni idrologiche avvenute nel bacino orientale Eastern Mediterranean Transient Malanotte Rizzoli et al 2014 Bibliografia LA FERLA R AZZARO M CARUSO G MONTICELLI L S MAIMONE G ZACCONE R PACKARD T T 2010 Prokaryotic abundance and heterotrophic metabolism in the deep Mediterranean Sea Adv Oceanogr Limnol 1 143 166 LUNA G M BIANCHELLI S DECEMBRINI F DE DOMENICO E DANOVARO R DELL ANNO A 2012 The dark portion of the Mediterranean Sea is a bioreactor of organic matter cycling Glob Biogeochem Cycles 26 doi 10 1029 2011GB004168 MALANOTTE RIZZOLI P ARTALE V BORZELLI EUSEBI G L BRENNER S CRISE A GACIC M KRESS N et al 2014 Physical forcing and physical biochemical variability of the Mediterranean Sea a review of unresolved issues and directions for future research Ocean Sci 10 281 322 174 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 S CASABIANCA F PERINI L PUGLIESE A CASABIANCA V GIUSSANI A PENNA Dipartimento di Scienze Biomolecola
433. prima d ora riscontrato associato ad animali Conclusioni I dati ottenuti permettono di gettare una prima luce sul microbioma intestinale presente nelle feci di C caretta In particolare emersa in molti campioni la presenza di una taxon chiave per il trofismo dell intestino umano Blautia il cui ruolo 188 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 andra quindi chiarito in relazione alle interazioni di simbiosi e commensalismo con vertebrati non mammiferi come C caretta e di taxa batterici mai evidenziati in precedenza negli intestini di animali Marinobacter Tuttavia andra chiarito un possibile legame tra la composizione del microbioma intestinale e lo stato di stress salute degli esemplari analizzati Ringraziamenti Siamo grati al Parco Regionale della Maremma all IZPTL di Pisa e all Acquario di Genova e Livorno per la disponibilit all invio dei campioni di feci e tessuti intestinale di esemplari di Caretta caretta Bibliografia ABDELRHMAN K F A BACCI G MARRAS B NISTRI A SCHINTU M UGOLINI A MENGONI A 2015 The gut microbiota of talitrid amphipods provides insight into the ecology of supralittoral sediments detritivors FEMS Microbiol Ecol under revision BACCI G BANI A BAZZICALUPO M CECCHERINI M T GALARDINI M NANNIPIERI P PIETRAMELLARA G MENGONI A 2015a Evaluation of the Performances of Ribosomal Database Project RDP C
434. progetto di monitoraggio dell attivit da pesca professionale Materiali e metodi Nel periodo maggio 2013 aprile 2014 con cadenza settimanale per ogni mese sono stati rilevati gli sbarcati utilizzando log book consegnati ai pescatori Complessivamente sono state raccolte 236 schede giornaliere In ciascuna scheda stata riportata la data l attrezzo da pesca utilizzato l ora di inizio e di fine della calata le specie catturate con relativo peso e la zona di pesca con l ausilio di un apposita carta dell AMP divisa in settori Le analisi dei rendimenti sono state elaborate come catture medie per giornata di pesca kg g DS Risultati All interno dell AMP sono autorizzate a pescare 14 imbarcazioni Solo 8 di queste si dedicano continuativamente all attivit di pesca mentre le restanti escluse dal campionamento svolgono prevalentemente attivit di pescaturismo L 83 delle imbarcazioni nel periodo osservato ha utilizzato il tramaglio 111 le nasse a polpi e il 6 il palangaro a pesce bianco Quattro imbarcazioni hanno impiegato esclusivamente il tramaglio mentre le altre nel periodo estivo hanno alternato i tre attrezzi consentiti L attivit di pesca si concentrata prevalentemente nell area compresa tra Capo Carbonara e l isola dei Cavoli 44 delle giornate ma interessante rilevare che per il 25 delle giornate campionate gli attrezzi sono stati calati in aree poste fuori dai limiti dell AMP Qu
435. r 523 115 pp PICONE M 2013 Mappa delle zone con maggior probabilita di trovare attrezzi da pesca abbandonati Progetto GHOST LIFE12 BIO IT 000556 Rapporto Tecnico 31 pp http www life ghost eu index php it downloads technical deliverables 122 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 L SCAPIN C FACCA M ZUCCHETTA A BONOMETTO F OSELLADORE R BOSCOLO P FRANZOI A SFRISO Center for Estuarine coastal and MArine Sciences CEMAS Department of Environmental Sciences Informatics and Statistics DAIS Universita Ca Foscari di Venezia Castello 2737 b 30122 Venezia Italia luca scapin stud unive it Istituto Superiore per la Protezione e la Ricerca Ambientale ISPRA Italia FIRST ASSESSMENT OF THE ECOLOGICAL STATUS IN SEAGRASS RESTORATION SITES OF THE NORTHERN VENICE LAGOON APPLICATION OF MACROPHYTE MACROZOOBENTHOS AND FISH INDICES PRIMA VALUTAZIONE DELLO STATO ECOLOGICO IN SITI DI RIPRISTINO DI PRATERIE DI FANEROGAME NELLA LAGUNA NORD DI VENEZIA APPLICAZIONE DI INDICI BASATI SU MACROFITE MACROZOOBENTHOS E FAUNA ITTICA Abstract Macrophyte macrozoobenthos and fish based indices were applied at eight newly created seagrass sites in the northern lagoon of Venice according to the requirements of the Water Framework Directive 2000 60 EC Here are presented the results of the ecological status assessment during the first year of restoration
436. r Stock Assessment WKMOG 3 6 June 2008 Lisbon Portugal 68 pp LUMARE D LUMARE L VITALE S LUMARE F 2011 Reproduction of the caramote shrimp Melicertus kerathurus Decapoda Penaeida in the South Adriatic Sea South Eastern Coast of Italy Crustaceana 84 3 293 305 MARIEM S B 1993 Taille de premi re maturit et p riode de ponte de Penaeus kerathurus dans le Golfe de Gab s Tunisie Crustaceana 65 1 82 96 RODRIGUEZ A 1985 Biolog a del langostino Penaeus keraturus Forskal 1775 del golfo de Cadiz I Reproduccion Inv Pesq 49 4 581 595 TURKMEN G OZDEN O PARUG S AKALIN S 2006 Some reproductive aspects of Melicertus kerathurus Forskal 1775 Decapoda Penaeidae inhabiting the Gulluk Bay Aegean Sea of Turkey J Appl Biol Sci 1 1 69 74 Data used in this paper were collected in the Data Collection Framework and supported by the Italian Ministry of Agriculture Food and Forestry Policy MiPAAF and by the European Commission 139 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 S COLLA F PRANOVI Center for Estuarine and coastal Marine Sciences CEMAS Dipartimento di Scienze Ambientali Informatica e Statistica Universita Ca Foscari Campus Scientifico Via Torino 150 30170 Venezia Italia slvcolla gmail com VULNERABILITA DELLA PICCOLA PESCA COSTIERA DEL NORD ADRIATICO AI CAMBIAMENTI CLIMATICI SMA
437. r colonising new habitats and the factors affecting settlement dynamics of P gibbesi Key words alien species Percnon gibbesi megalopae western Sicily light traps Introduzione Percnon gibbesi H Milne Edwards 1853 un granchio alieno che ha colonizzato molte aree costiere rocciose del Mediterraneo a partire dal 1999 Garcia e Reviriego 2000 Relini et al 2000 Mori e Vacchi 2002 mostrando una spiccata capacit invasiva Katsanevakis et al 2011 La distribuzione e densit di adulti e giovanili in relazione all habitat sono note Deudero et al 2005 Agnetta et al 2013 mentre poco si conosce sulla distribuzione degli stadi larvali e sulle dinamiche di dispersione Uno dei fattori che rendono P gibbesi un invasore di successo la notevole dimensione della megalopa Puccio et al 2003 Tuttavia nonostante l importante ruolo giocato da tale stadio larvale nella fase di transizione dal dominio pelagico a quello bentonico nulla si sa sulla sua distribuzione ed abbondanza Obiettivo di questo studio stato stimare l abbondanza di megalope di P gibbesi lungo le coste della Sicilia NO Materiali e metodi L area di studio include quattro localit Castellamare del Golfo CA Alcamo Marina AM Isola delle Femmine e Bonagia IF e BO In ogni localit sono state utilizzate tre trappole di luce CARE Ecocean in due siti E e O Le trappole sono state posizionate in superficie ed ancorate su un fondale di 20
438. racentrotus lividus from an exposed intertidal and a sheltered subtidal habitat on the west coast of Ireland Mar Biol 104 275 289 GUETTAF M SAN MARTIN G A FRANCOUR P 2000 Interpopulation variability of the reproductive cycle of Paracentrotus lividus Echinodermata Echinoidea in the south western Mediterranean J Mar Biol Assoc UK 80 899 907 LOZANO J GALERA J LOPEZ S TURON X PALACIN C MORERA G 1995 Biological cycles and recruitment of Paracentrotus lividus Echinodermata Echinoidea in two contrasting habitats Mar Ecol Prog Ser 122 179 191 SELLEM F GUILLOU M 2007 Reproductive biology of Paracentrotus lividus Echinodermata Echinoidea in two contrasting habitats of northern Tunisia south east Mediterranean J Mar Biol Assoc UK 87 3 763 767 SPIRLET C GROSJEAN P JANGOUX M 1998 Reproductive cycle of the echinoid Paracentrotus lividus analysis by means of the maturity index Invertebr Reprod Dev 34 1 69 81 This study was funded by RAS project Approccio integrato per la tutela la gestione e la valorizzazione della risorsa riccio di mare in Sardegna CRP49692 83 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 D MASSI A TITONE M MANCUSO G GAROFALO V GANCITANO C BADALUCCO M GRISTINA F FIORENTINO Istituto di Ricerche sulle Risorse Marine e 1 Ambiente IAMC CNR UOS di Mazara del Vallo
439. racilaria vermiculophylla in una laguna del Delta del Po Biol Mar Mediterr 22 2 87 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 C MUNARI N BOCCHI M MISTRI Dipartimento di Scienze della Vita e Biotecnologie Universita di Ferrara Via L Borsari 46 44121 Ferrara Italia msm unife it EPIFAUNA ASSOCIATA A GRACILARIA VERMICULOPHYLLA IN UNA LAGUNA DEL DELTA DEL PO EPIFAUNA ASSOCIATED TO GRACILARIA VERMICULOPHYLLA INA PO DELTA LAGOON Abstract Macrofauna associated with the invasive Rhodophyta Gracilaria vermiculophylla Ohmi Papenfuss was investigated along a 5 years study period in a lagoon of the Po River Delta N W Adriatic Sea The architecturally complex G vermiculophylla supported quite high species richness and diversity of associated macrofauna The abundance of epifauna composed primarily of amphipods small snails and an invasive bivalve increased with macroalgal biomass Key words macrobenthos Gracilaria vermiculophylla Adriatic Sea Introduzione L alga tropicale Gracilaria vermiculophylla Ohmi Papenfuss stata da tempo segnalata nelle lagune costiere del Delta del Po Sfriso et al 2010 dove ha colonizzato ampi tratti di fondale G vermiculophylla un cosiddetto ecosystem engineer in quanto coi suoi talli crea strutture tridimensionali in un paesaggio altrimenti monodimensionale quale i fondali sedimentari lagunari Recenti st
440. ranno raccogliere la valutazione dei servizi ecosistemici Non solo sar necessario identificare quelli che giocano un ruolo chiave e che pi possono essere influenzati dalle attivit antropiche ma bisogner anche quantificarne il valore economico cos che sia possibile effettuare delle analisi costi benefici che coinvolgano entit altrimenti non commensurabili Ad esempio si potrebbe dover confrontare la riduzione nella disponibilit di un determinato servizio ecosistemico con il valore dell allocazione di una particolare attivit produttiva in una determinata area Ci potrebbe essere necessario per decidere se l attivit produttiva potr essere realizzata cio se i suoi benefici e la sua rilevanza socio economica eccedono il valore delle funzioni ecosistemiche che essa compromette Oppure nel caso di attivit che non possono non essere effettuate la valutazione potrebbe avere come obiettivo la scelta della allocazione spaziale ottimale ovvero quella che a fronte dei minimi costi ambientali offre il massimo beneficio socio economico In quest ottica uno dei problemi pi ricorrenti fra quelli che dovranno essere affrontati la valutazione della vulnerabilit del biota a tutti i livelli di organizzazione ed a tutte le scale spaziali Fino ad oggi stato possibile attribuire un valore totemico alla vulnerabilit degli ecosistemi contrapponendo l esigenza della loro conservazione a qualsiasi opera o attivit che la potes
441. rava un incremento di Photobacterium Pseudomonas e Staphylococcus Una maggiore diversit specifica veniva riscontrata nell acqua in ambedue le stagioni nella stazione 4 localizzata alla foce del fiume Quanto alle caratteristiche morfologiche e biochimiche nell acqua in maggio si registrava una maggiore percentuale di batteri gram negativi e pigmentati e con attivit alfa glucosidasica in luglio invece i ceppi isolati presentavano maggiore capacit lipasica e amilolitica beta glucosidasica fosfatasica ed emolitica Non sono state riscontrate invece differenze stagionali significative per capacit di fermentare glucosio attivit proteolitica positivit al saggio dell ossidasi e presenza di luminescenza Nel sedimento in maggio si osservava come nell acqua una maggiore incidenza di batteri gram negativi e pigmentati dotati di luminescenza mentre in luglio Si riscontrava una maggiore percentuale di batteri ossidasi positivi glucosio fermentanti che esprimevano maggiore percentuale di attivit metabolica proteolitica lipolitica amilolitica alfa e beta glucosidasica fosfatasica ed emolitica Conclusioni La valutazione dello spettro metabolico della flora batterica acquatica e della sua variabilit in relazione ai cambiamenti ambientali possono fornire importanti indicazioni sul ruolo della comunit microbica nel funzionamento degli ecosistemi Martinez et al 1996 Lo studio ha permesso l identificazione di diversi g
442. rch on Cetaceans 11 83 86 POGGI R 2014 I Cetacei del Museo Civico di Storia Naturale Giacomo Doria di Genova Museologia Scientifica Memorie 12 117 152 RELINI G ORSI RELINI L TORCHIA G CIMA C FASCIANA C FIORENTINO F PALANDRI G RELINI M TARTAGLIA P ZAMBONI A 1992 Macroplancton Meganyctiphanes norvegica and fin whales Balenoptera physalus along some transects in the Ligurian Sea European Research on Cetaceans 6 134 137 225 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 D S Pace B Mussi S AIROLDI J ALESSI A ARCANGELT F ATZORI M AzzoLin I CAMPANA A CELONA C Fort C GIACOMA G GNONE C LUPERINI R MANGANO A MIRAGLIUOLO A MOULINS S NUTI G PELLEGRINO M Rosso F SALVIOLI P TEPSICH M TRINGALI Oceanomare Delphis Onlus Via G Marinuzzi 74 00124 Rome Italy Dept of Environmental Biology La Sapienza University of Rome Italy danielasilvia oceanomaredelphis org Tethys Research Institute Viale G B Gadio 2 Milan Italy MENKAB il respiro del mare Via Quarda Sup 20 6 Savona Italy Dept of Earth Environmental and Life Sciences DISTAV University of Genoa Italy SISPRA Via Vitaliano Brancati 48 Rome Italy TAMP Capo Carbonara Via Roma 60 Villasimius CA Italy Dept of Life Sciences and Systems Biology Universit
443. rcuatula senhousia Un notevole incremento nell abbondanza del mitilide non indigeno A senhousia stato registrato durante il periodo di studio con punte fino a 10 ind gPS nell estate 2010 Dal punto di vista trofico il gruppo maggiormente rappresentato risultato quello degli erbivori 59 4 del totale seguito dai sospensivori 32 1 dai detritivori 7 4 e dai predatori 1 1 86 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Il confronto con la comunit faunistica associata alla Rodophyta Gracilaria vermiculophylla alga invasiva presente nella medesima laguna in differenti siti Munari et al in stampa mostra che la macrofauna esibisce una maggior ricchezza specifica e diversit associata a G vermiculophylla Fig 2 100 Insetti Gasteropodi Decapodi __g 59_ 4 6 R 0 502 99 75 Bivalvi so Ea 25 t dd ip i Policheti es 9 Isopodi 2 0 200 400 600 800 1000 2 8 Nind Fig 1 a Relazione tra la biomassa algale gPS e l abbondanza della fauna b composizione media della comunit epifaunale su U rigida a Relationship between algal biomass gPS and macrofaunal abundance b average composition of epifaunal assemblages on U rigida Ricchezza specifica Diversita 20 25 18 16 2 14 A 12 15 Vv VY 10 Gracilaria Gracilaria 8 1 6 Ulva Ulva 4 0 5 2 0 0
444. reat white shark Carcharodon carcharias during surface predatory activities According to the present results vision plays an important role in feeding patterns and appears correlated to weather conditions Key words Carcharodon carcharias predatory behaviour elasmobranch South Africa Introduction Great white shark Carcharodon carcharias is distributed in temperate and tropical waters Compagno et al 2005 Since 2003 a multidisciplinary team managed by the Centro Studi Squali Massa Marittima Italy under the scientific coordination of the Universities of Calabria Siena and Bologna is developing research projects concerning different aspects of great white shark biology and conservation with particular attention to social and predatory behaviour ecotoxicology parasitology and genetics Micarelli et al 2006 Sperone et al 2010 2012 Only few studies were addressed at describing mechanisms underlaying patterns of prey selection and approach in great white shark Tricas 1985 Myrberg amp Nelson 1991 Strong 1996 In the attempt to gather new information on those aspects the aim of the research was threefold 1 to understand whether great white shark makes choice based upon the shape or smell in front of a still floating seal shaped decoy and a bloody piece of tuna fish 2 to identify and describe the approach patterns to bait or decoy 3 to correlate the observed patterns to sex and size of the sharks and to weather condition
445. rentini et al 1997 specie gli sbarchi del Mediterraneo orientale La sex ratio F TOT complessiva 2006 2009 0 455 con modeste variazioni annuali 0 42 0 47 la frazione femminile cresce con la taglia senza giungere alla totalit almeno nell intervallo di taglie pescato 100 240 mm Pur essendo leggermente maggiore la lunghezza mediana nelle femmine 175 vs 170 mm nessuna differenza significativa 136 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 riscontrabile nelle LFD per sesso ed anno pin Nel periodo in esame l approccio 25 logistico porta a stimare la taglia di prima 2 maturit a 139 7 mm ed a 149 2 mm LT 0 rispettivamente per femmine e maschi La 15 0 presenza di esemplari maturi o in 10 maturazione e la mancanza di individui 5 0 esausti fanno ritenere che per la boga fi ara 0 dello Stretto di Sicilia il periodo tardo 1992 1994 1996 1998 2000 2002 2004 2006 2008 2010 primaverile sia quello riproduttivo La Fig 1 Indici di biomassa DI kg km annuali relazione lunghezza peso viene a risultare per Boops boops in Sicilia meridionale W 0 000018 LT mm 33 per le femmine e Biomass indexes DI kg km by year for Boops W 0 000024 LT mm per i maschi boops in southern Sicily Infine i parametri di crescita stimati utilizzando metodi indiretti di analisi deconvoluzione delle LFD sono stimati come LT
446. reported in the submarine fossil deposit of the Strait of Sicily more precisely north western of the Egadi Islands in the bathyal muds in association with the gastropod Buccinum humphreysianum Bennet 1824 Bombace 1970 and along Algerian Tunisian and Sicilian coasts where in the last case is generally associated with the gastropod B undatum Linnaeus 1758 Barsotti and Frilli 1970 Materials and methods Data were collected during bottom trawl surveys MEDITS 2004 2008 2009 2010 2011 2012 2013 and GRUND 2003 2004 2008 carried out in the Strait of Sicily that have provided a total of 973 samples of benthos The zoobenthic fraction of the catches was identified at the more detailed possible taxonomic level total number and total weight were recorded for each taxon Zoobenthos biodiversity in terms of total number of species and biocoenotic meaning sensu P r s amp Picard 1964 was compared between hauls with and without fossil gastropods to evaluate the role of thanatocoenoses in increasing the habitat complexity Results and conclusions Fossil shells of N contraria were found only in 9 hauls depth range 200 260 m while those of B undatum in 5 hauls depth range 204 258 m of which 4 in association with the previous species on the north western margin of the Adventure Bank Strait of Sicily Fig 1 From morpholithological data the area is located in correspondence of a narrow and deep erosive channel separating the T
447. reproductive stage was assigned to each sample using the nomenclature of Byrne 1990 stage I recovery II growing III premature IV mature V partly spawned VI spent Results On average GSI values at LP area area were higher than those at HP area mean values standard error 4 4 0 1 and 3 7 0 1 respectively At HP area GSI was low in the first period and increased during autumn 2013 to reach the maximum value of 6 5 0 3 in March 2014 On the contrary at LP area GSI showed two peaks during 82 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 the year one in June with the maximum value of 6 7 0 3 and the other in February 2014 maximum value of 5 3 0 4 Histological analysis confirmed the different trends of GSI At HP area samples were mainly in the recovery stage during summer and autumn Gametogenesis began with decreasing temperatures end of autumn with ripe gonads from January to April when the main spawning event took place At LP area samples were still spawning in June the recovery stage was well represented from middle summer to autumn in October mature or partly spawned individuals which turned into spent stage in December were observed Gametogenesis started in December and fully mature individuals were found in the last part of winter In April all the individuals had spawned yet and were mainly in spent stage Conclusions The reproductive cycle o
448. resso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Umani et al 2007 Nutrient analyses NH NO NO PO and H4SiO4 were performed on a four channel Quaatro SEAL Analytical Continuous Flow Analyzer according to Hansen and Koroleff 1999 Results The minimum abundances for all phototrophic fractions were found in February 2014 at all stations due to low light availability Over the study period picophytoplankton varied from 5 5 0 3x10 cells L to 1 0 0 1x10 cells L Considerably higher abundances were detected in October 2013 especially in the Second Inlet The abundance of nanophytoplankton ranged from 3 6 0 5x10 to 1 340 06x10 cells L with maxima in June 2013 when high abundance of Chaetoceros Ehrenberg 1844 was found In the First Inlet Chaetoceros spp alone constituted up to 54 of the nanophytoplankton assemblage whereas in the Second Inlet this genus represented 25 of total nanophytoplankton Microphytoplankton abundance widely ranged between 0 6x10 organisms L in February and 199 4x10 organisms L in April 2014 and was generally dominated by diatoms and dinoflagellates The highest PP values were obtained in June when hourly rates varied between 2 82 0 10 ug C L h in the First Inlet and 20 0743 12 ug C L h in the Second Inlet The Mar Piccolo was productive also in February in lower light conditions with values up to 3 22 0 14 ug C L h in the First Inlet Conclus
449. rest n Random Forest 60 A Cc Vv E 5 a 40t a 2 g gt E 20 3 Z 0 0 0 5 1 di predizione o 05 di predizione Fig 2 Confronto tra i grafici di frequenza A aree di training B Santuario Pelagos Comparison between frequency graphs A training area B Pelagos Sanctuary In entrambi i grafici l andamento dei dati mostra un picco nella parte destra in corrispondenza delle percentuali di predizione maggiori in B nella parte sinistra del grafico presente una coda generata da avvistamenti con bassa precentuale di predizione Conclusioni La Random Forest si conferma una buona tecnica per modellizzare la distribuzione del tursiope anche su un area che presenta una variabilit nelle caratteristiche geomorfologiche Sebbene la percentuale di predizione dia risultati confortanti la presenza della coda a sinistra suggerisce la necessit di addestrare il modello su nuove aree di training al fine di migliorare la percentuale di predizione Bibliografia CUTLER D R EDWARDS T C BEARD K H CUTLER A HESS K T GIBSON J LAWLER J J 2007 Random forests for classification in ecology Ecology 88 2783 2792 GNONE G BELLINGERI M DHERMAIN F DUPRAZ F NUTI S BEDOCCHI D MOULINS A ROSSO M ALESSI J MCCREA R S AZZELLINO A AIROLDI S PORTUNATO N LARAN S DAVID L DI MEGLIO N BONELLI P MONTESI G TRUCCHI R FOSSA F WURTZ M 2011 Distribut
450. rgy against the coast Materials and methods The experiment has been carried on estimating weight loss over time of plaster spheres placed in different zones of the reef as function of water movement and force Boizard amp DeWreede 2006 Muus 1968 To identify reef traits potentially affecting water motion two reefs with same aspect but different physical characteristics have been compared In detail one reef with external rim with a step structure and 8 4 m wide and one reef without a step structure on the external rim and 12 m wide have been selected respectively named Reef 1 and Reef 2 The experiment was carried out in 3 different steps firstly plaster spheres were prepared and a calibration experiment to estimate plaster dissolution rate in static seawater conditions was run after the spheres were fixed in groups of four to PVC panels 6x25 cm and then fixed on the reef surface The PVC panels were positioned in groups of four in 3 different habitats zones along the reefs the Habitat P was outside the external rim of the reef and above the Cystoseira amentacea var stricta fringe the Habitat Il was on the external rim under the step structure if present the Habitat II was before the internal rim of the reef After 24 hours the panels were collected and the spheres dried and weighed Aiming to estimate a gypsum abrasion rate in each habitat the mean lost weight of the 4 spheres of each panel h
451. ri DISB University of Urbino Viale Trieste 296 61121 Pesaro Italy antonella penna uniurb it DISTAV University of Genoa Italy MONITORING TOXIC OSTREOPSIS CF OVATA IN RECREATIONAL WATERS USING A QPCR BASED ASSAY MONITORAGGIO DELLA SPECIE TOSSICA OSTREOPSIS CF OVATA IN ACQUE DI BALNEAZIONE TRAMITE ANALISI MOLECOLARI DI QPCR Abstract Ostreopsis Schmidt 1901 sp is a toxic marine benthic dinoflagellate that causes high biomass blooms dangerous for human health marine biota aquaculture activities and negatively impacting coastal seawater quality The aim of this study was to apply a rapid and sensitive qPCR method to quantify Ostreopsis cf ovata Fukuyo abundance in environmental samples collected from different Mediterranean coastal sites based on site specific environmental standard curves Key words HABs monitoring Ostreopsis recreational waters qPCR Introduction The benthic dinoflagellate Ostreopsis Schmidt 1901 sp is an epi benthic microalga and it includes Ostreopsis cf ovata Fukuyo 1981 that can produce potent non protein toxins such as palytoxin like compounds and various ovatoxins Massive blooms of Ostreopsis spp occur regularly in tropical and temperate regions worldwide Penna et al 2010 but recently O cf ovata blooms in the Mediterranean Sea have become increasingly frequent In this study seawater affected by Ostreopsis spp blooms at various Mediterranean beaches was monitored using a qPCR assay
452. ri a alias iaia ga aaa Ri COLLA S PRANOVI F Vulnerabilit della piccola pesca costiera del nord Adriatico ai cambiamenti climatici i GANCITANO V ENEA M COLLOCA F GANCITANO S INGRANDE G MASSI D RIZZO P TITONE A FIORENTINO F Temporal dynamics of demersal resources in the south of Sicily GSA 16 during the last twenty years le iii MICARELLI P SPERONE E GIGLIO G PECCHIA J ROMANO C SCUDERI A VESPAZIANI L MELE F Dorsal fin photoidentification tool for long term studies of white shark Carcharodon carcharias behaviour iii MONTANINI S BENNI E BORSETTI F VALLISNERI M First study on the properties of the organic matrix in the otoliths of some bony fish Specie Siiri er eil ia A T MONTANINI S VALLISNERI M BENNI E PEREZ MAYOL S MORALES NIN B Pelagic larval duration and settlement marks on the otoliths of tub gurnard Chelidonichthys lucerna from Adriatic PALMAS F OLITA A SABATINI A Modeling the giant red shrimp larval dispersal processes in the central western Mediterranean RELINI G Biodiversit ittica delle campagne MEDITS eeeee SABATINI A ATZORI F PALMAS F SECCI M ADDIS P La pesca artigianale nell Area Marina Protetta Capo Carbonara SARTOR P CARBONARA P CERASI S GARIBALDI F LANTERI L LEMBO G LUCCHETTI A SPEDICATO M T Identification and characterisation of the
453. ribed by Borelli et al 2001 with some modifications i e protein precipitation was enhanced by using TCA trichloroacetic acid 100 w v Protein fractions soluble in acetic acid 0 5 M or in urea 8 M were loaded into a polyacrylamide gel 12 separated by SDS page and detected by Silver staining Sigma The acid soluble fractions and urea soluble fractions were estimated by Lowry DC Biorad and Bradford QuickStart Biorad methods respectively Results and conclusions A first evidence was that ultrasonic treatment on samples for both cleaning and protein extraction steps should be bypassed in order to avoid protein degradation Tab 1 shows the protein yields computed from known weight fractions of otoliths For L cavillone and L dieuzeidei higher amounts of proteins 146 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 were extracted by acetic acid protocol 0 16 and 0 11 ug proteins mg of otoliths respectively than by urea extraction protocol 0 057 0 058 ug mg In contrast urea was slightly more efficient as solubilizing agent for 7 lastoviza 0 057 vs 0 04 ug mg Very low yields were instead obtained from H dactylopterus otoliths by both methods lt 0 002 ug mg Separation of the total amount of each fraction has revealed that a 50 55 kDa band was clearly evident in the acid fraction of T lastoviza 13 ug protein lane whereas it became evident in L cavillone acid
454. ribuzione e sulla densit delle popolazioni di ceriantari presenti sui fondi circalitorali di tre zone del Mediterraneo Sicilia nord occidentale golfi di Napoli e di Salerno Riviera Ligure di Ponente Materiali e metodi I dati presentati in questo lavoro sono stati ottenuti da una serie di immersioni compiute con il ROV a bordo della R V Astrea nel Golfo di Napoli e Salerno luglio 2010 e 2012 nella Sicilia nord occidentale settembre 2011 e lungo la Riviera Ligure di Ponente giugno 2012 Nella prima area sono state effettuate 23 immersioni a profondit comprese tra 53 e 151 m per un totale di 1300 minuti di riprese in Sicilia sono state effettuate 22 immersioni a profondit comprese tra 52 e 124 m per un totale di 1200 minuti di riprese in Liguria sono state effettuate 18 76 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 immersioni per un totale di 1200 minuti di riprese a profondita comprese tra 41 e 399 m I filmati relativi ad ogni immersione sono stati studiati tutti i ceriantari presenti sono stati identificati a livello di specie per quanto possibile e la loro densit stata valutata come numero di individui N SE 100 minuti di filmato che corrispondono approssimativamente a 2000 m Risultati Dai filmati ROV sono state identificate quattro specie C membranaceus P dohrni P solitarius e A oligopodus C membranaceus stato osservato in tutte e tre le zone
455. rie Caronni et al 2009 e relativamente al suo ciclo vitale in particolare le uniche informazioni risalgono al 1941 e sono relative al ceppo tropicale della specie Lewis e Bryan 1941 In questo lavoro sono descritti i primi risultati di uno studio ancora in corso atto a descrivere 1 differenti stadi di cui si compone il ciclo vitale di C taylorii in Mediterraneo al fine di individuare la presenza della specie sul substrato in qualunque momento del ciclo vitale prevedendo tempestivamente il possibile verificarsi delle sue fioriture Materiali e metodi In laboratorio sono state allestite pi colture di C taylorii isolando cellule vegetative della microalga in campioni naturali di acqua e materiale epilitico raccolti nei mesi estivi del 2013 e del 2014 nell Area Marina Protetta Tavolara Punta Coda Cavallo dove la specie sembra essersi insediata stabilmente Caronni et al 2009 Le colture sono state realizzate in MNK No l et al 2004 terreno particolarmente adatto per la crescita della specie Rumi et al 2012 rinnovate regolarmente e monitorate nel tempo osservando al microscopio ottico 400x ogni 15 giorni circa un aliquota di ciascuna coltura 20 uL per individuare l eventuale presenza di cellule di C taylorii morfologicamente differenziate sulla base dei caratteri descritti da Lewis e Bryan 1941 Risultati Ad oggi nelle colture analizzate sono state complessivamente identificate cellule attribuibili a
456. rie in quanto le fanerogame trapiantate potrebbero aver perso le foglie a causa dello stress da trapianto o per l elevata presenza di Ulvaceae ma mantenuto intatta la parte ipogea che potrebbe rivegetare durante la prossima stagione come gi stato osservato nel monitoraggio invernale e in particolare nella stazione 12 Bibliografia SCAPIN L FACCA C ZUCCHETTA M BONOMETTO A OSELLADORE F BOSCOLO R FRANZOI P SFRISO A in stampa First assessment of the ecological status in seagrass restoration sites of the northern Venice lagoon application of macrophyte macrozoobenthos and fish indices Biol Mar Mediterr 22 1 SFRISO A FACCA C 2007 Distribution and production of macrophytes in the lagoon of Venice Comparison of actual and past abundance Hydrobiologia 577 71 85 SFRISO A FACCA C BUOSI A CENTANNI E BERTO D RAMPAZZO F GION C BONOMETTO A BOSCOLO R in stampa Stato trofico e stato ecologico dell area settentrionale della laguna veneta Biol Mar Mediterr 22 1 Il progetto ha il contributo finanziario LIFE dell Unione Europea e si colloca nell ambito della rete Natura 2000 SIC IT3250031 Laguna di Venezia settentrionale 112 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 E C LA MARCA G FRANZITTA E CAPRUZZI M MILAZZO R CHEMELLO Dipartimento di Scienze della Terra e del Mare Universita di Palermo Via Archirafi
457. rispetto a quelle classiche ritrovate in ambiente naturale durante le fioriture era gi stata descritta da Rumi et al 2012 nel corso di altre ricerche sulla specie recentemente condotte in laboratorio Particolarmente interessante apparsa invece la presenza nelle colture realizzate per questo studio di numerose cellule descritte da Lewis e Bryan 1941 come aplanospore sia in formazione sia in divisione 3 4 sporangi in rottura 5 e zigospore libere 6 corrispondenti a stadi del ciclo vitale mai osservati prima d ora nel ceppo mediterraneo della microalga Dal punto di vista ecologico i risultati ottenuti seppur preliminari forniscono informazioni utili ad individuare le zone serbatoio della microalga in cui essa presente anche in forma di spora presumibilmente nei mesi in cui le condizioni ambientali ne impediscono la proliferazione come gi osservato per altre microalghe Fryxell 1983 e da cui hanno inizio le sue fioriture estive Bibliografia AKTAN Y TOPALOGLU B 2011 First record of Chrysophaeum taylorii Lewis amp Bryan and their benthic mucilaginous aggregates in the Aegean Sea Eastern Mediterranean J Black Sea Mediterr Env 17 2 159 170 BLASI F DELARIA M CARONNI S 2013 Prima segnalazione della microalga bentonica Chrysophaeum taylorii Lewis amp Bryan lungo le coste laziali Biol Mar Mediterr 20 1 120 121 CARONNI S CASU D CECCHERELLI G LUGLIE A NAVONE A OCCHIPINTI AMB
458. rnire alcune informazioni sulla ricchezza in specie di teleostei ed elasmobranchi pescati nelle 18 GSA coinvolte in MEDITS e di confrontarle con alcuni dati pregressi in particolare peri mari italiani Materiali e metodi I dati provengono dalla TM list in cui sono riportati e codificati tutti i taxa animali e vegetali pescati durante le 20 campagne in ciascuna GSA tra il 1994 e il 2013 la lista completa che ormai ha superato i 1450 taxa solo specie pi grandi di 1 cm consultabile sul sito della SIBM www sibm it Per la descrizione dell attrezzo utilizzato e delle procedure si veda il Manuale di Istruzioni Medits versione 5 Relini et al 2008 Una versione aggiornata disponibile sul sito della SIBM Risultati In totale nelle 18 GSA partecipanti a MEDITS sono state segnalate 344 specie di Osteitti appartenenti a 101 famiglie e 50 di elasmobranchi 22 squaliformi 27 raiformi 1 olocefalo Nella Tab 1 sono riportati i valori per singola GSA Il pi alto numero di Osteitti stato ritrovato nelle GSA 6 e 22 con 218 e 217 specie rispettivamente il pi basso nella GSA 23 con 103 per i selaci il valore pi alto 40 stato trovato nella GSA 16 La ricchezza specifica Tab 1 cambia se si tiene conto del numero delle cale o della superficie indice di ricchezza n totale delle specie diviso n di cale o superficie x 100 Dei 14 teleostei alieni ben 12 sono stati segnalati nella GSA 25 e di questi solo 9 a Cipro Delle 101 fa
459. rno possibile trovare anche colonie millenarie come ha recentemente dimostrato un indagine al radiocarbonio condotta in una popolazione di coralli neri nelle acque della Sardegna Bo et al 2015 9 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 La pianificazione spaziale marittima Le comunita coralligene sono ambienti chiave per la conservazione della biodiversita mediterranea ma al tempo stesso sono anche sottoposti a una pressione antropica spesso insostenibile tutto cid ne fa un soggetto di grande interesse nell ambito di una corretta pianificazione spaziale marittima La base per una razionale strategia di pianificazione spaziale un dettagliato data base sulla distribuzione geografica e batimetrica di queste comunit realizzato attraverso accurate mappature possibilmente a livello di bacino Per ci che riguarda i banchi del coralligeno costiero entro 50 m di profondit sono stati recentemente analizzati i dati di distribuzione ottenuti da diciassette paesi del Mediterraneo Queste informazioni sono state utilizzate come base per la predisposizione di un modello predittivo della distribuzione spaziale del coralligeno a scala di bacino Martin et al 2014 Tuttavia il livello di copertura molto variabile in Italia mappe di dettaglio almeno in scala 1 10 000 sono disponibili solo per la Liguria la Puglia e la Sicilia Questa cartografia sovrapposta alla distrib
460. rom small tributary rivers by water draining from the surrounding agricultural soils and by 34 freshwater springs locally called Citri Mussel farming is one of the main economic activities and the local mussels have been known for their quality since the early 900s Caroppo et al 2012 As the photoautotrophs represent a high proportion of the mussels diet the aim of this study was to investigate their abundance seasonal succession and primary production Materials and methods Samplings were carried out in June and October 2013 and in February and March April 2014 Surface and bottom water samples were collected using acid rinsed 5 L Niskin bottles Six stations St 1G 40 498 N 17 263 E St 1E 40 496 N 17 236 E St 1B 40 469 N 17 249 E St 1I 40 476 N 17 259 E St 2B 40 478 N 17 282 E St 2C 40 478 N 17 299E with two sampling depths were chosen four located in the First and two in the Second Inlet For the sample processing analysis and determination of picophytoplankton nanophytoplankton and microphytoplankton the methods described by Karuza et al 2012 Di Poi et al 2013 Zingone et al 2010 were followed respectively For the nanoplankton fraction we used different shapes circle cone ellipse cylinder within six standard cell sizes 2 5 um 5 8 um 8 11 um 11 14 um 14 17 um 17 20 um Primary production PP was estimated in situ by the TE technique as described by Fonda 177 Volume pre print 46 Cong
461. rom the case of O edulis in November 14 5 Fig 1 120 90 7 a Bao DI 100 E 30 E 80 60 50 60 D E 40 S 40 g 30 5 pod i 5 2 0 o 2 SIE ESG e E E S E S S X X S S i S 3 3 3 g 3 t 13 g od 242 3 2 3 2 47 3 gt 3 5 5 3 3 2b s iz E 2 2 Ostrea edulis Crassostrea gigas Ostrea edulis Crassostrea gigas 12 9 a 2 10 o 81 ri e 6 3 B 24 E x 3 8 2 gt 2 z 31 H x d E E E z So do a sla na dla a n i i E E E E E E E E 2 g e a e ale sg n STES F F S x S x S x S x Co a fi I hi 3 S a 2 S 8 gt 5 3 22 5 lee 28 ae e S 3 S sf 3 z z Ostrea edulis Crassostrea gigas Osirea sdis Crassostrea gigas re uli if re Ig Fig 1 a Average shell length mm n 100 b average whole wet weight n 100 c average percentage contribution of the soft edible parts to the whole weight n 10 and d average percentage mortality n 100 of O edulis and C gigas farmed at two depth treatments from June 2013 to May 2014 a Lunghezza media delle valve mm n 100 b peso totale medio g n 100 c contributo medio in peso delle parti molli al peso totale n 10 e d mortalit percentuale media n 100 di O edulis e C gigas allevate a due profondit da giugno 2013 a maggio 2014 Conclusions Both oysters reached a legal size for commercialization
462. rontabili con quelli riportati recentemente per le coste degli Stati Uniti Arthur et al 2014 Inoltre queste valutazioni per quanto preliminari suggeriscono che nel golfo di Venezia la presenza di reti fantasma sia un fenomeno quantitativamente rilevante considerato sia l elevato numero di imbarcazioni da pesca attive nell area che la morfologia dei fondali dove risultano segnalate almeno 3000 aree di tegn a Borme et al 2010 Bench il danno da pesca fantasma appaia da questi dati preliminari non particolarmente importante il possibile impatto sul biota causato dalla dispersione di plastiche e microplastiche conseguente alla degradazione delle reti ed i danni arrecati ai fondali suggeriscono la necessit di adozione di pratiche gestionali che considerino possibili misure preventive e di ripristino Bibliografia ARTHUR C SUTTON GRIER A E MURPHY P BAMFORD H 2014 Out of sight but not out of mind harmful effects of derelict traps in selected U S coastal waters Mar Pollut Bull 86 19 28 BORME D CIBIC T CARESSA S CIRIACO S FALACE A FARESI L GARDINI E ODORICO R MAROCCO R POLONIATO D KELEB S 2010 Trezze o grebeni biotopi e geotopi dell Alto Adriatico Regione Friuli Venezia Giulia 245 pp MACFADYEN G HUNTINGTON T CAPPEL R 2009 Abandoned lost or otherwise discarded fishing gear UNEP Regional Seas Reports and Studies n 185 FAO Fisheries and Aquaculture Technical Pape
463. rre e Promuovere lo sviluppo di strumenti operativi a supporto della MSP e il consolidamento di un network permanente sul tema fra Amministrazioni mondo della ricerca e portatori di interessi 19 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 M T SPEDICATO COISPA Tecnologia amp Ricerca Stazione Sperimentale per lo Studio delle Risorse del Mare Via dei trulli 18 70126 Bari Italia spedicato coispa it CRITICAL AND PROTECTED HABITATS OF THE MEDITERRANEAN SEA KNOWLEDGE FROM THE MAREA PROJECT AND INSIGHTS FOR THE MARITIME SPATIAL PLANNING HABITAT CRITICI E AREE PROTETTE DEL MEDITERRANEO CONTRIBUTO DEL PROGETTO MAREA E IMPLICAZIONI PER LA PIANIFICAZIONE DELLO SPAZIO MARITTIMO Abstract The outcomes achieved in the MAREA Framework project MARE 2009 05_LOT1 related to the mapping and modelling spatial distribution of seagrass meadows bioconstructions nursery and spawning grounds of demersal and small pelagic species fishing grounds MPAs and FRAs as well as stock units identification are outlined evidencing their relevance for the Integrated Maritime Policy and the ecosystem approach to fisheries management Key words seagrass meadows bioconstructions nursery areas fishing grounds ecosystem approach Introduction The wide and diversified demand for maritime space for different purposes energy production and exploitation maritime traffic fishing activities
464. ruolo dei biologi marini dovr rimanere centrale perch solo la capacit di integrazione dell informazione garantita dal giudizio esperto potr supportare valutazioni efficaci Da questo punto di vista di conseguenza bisogner resistere alla tentazione di sovrasemplificare problemi tanto complessi quanto mal definiti magari utilizzando l indice multimetrico di turno o affidandosi ciecamente a tecniche di ottimizzazione certamente utili come supporto decisionale ma mai del tutto risolutive Quello che servir per affrontare le sfide poste dal MSP e per tutte le altre azioni legate alla PMI sar la capacit di integrare un ampio spettro di informazioni di natura diversa spesso incomplete e non sempre del tutto affidabili Ci non potr non comportare un ampio uso dei supporti metodologici e tecnologici pi opportuni dai GIS al telerilevamento e dalla modellistica alla sensoristica ambientale ma le valutazioni critiche dovranno sempre rimanere saldamente nelle mani di biologi marini capaci di operare senza preconcetti e di assumersi meglio se con un lavoro di gruppo le responsabilit del caso Solo questa attitudine infatti potr consentire un confronto fattivo con gli attori del MSP e supportare politiche efficaci non solo a difesa dei nostri mari ma anche del nostro tessuto sociale e della nostra economia 6 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 INTERVENTI PROG
465. ruppi fisiologici nelle acque e nel sedimento della zona di estuario del fiume Pasvik I risultati ottenuti hanno evidenziato variazioni stagionali significative sia nell analisi quantitativa e qualitativa che nei profili enzimatici dei ceppi isolati confermando come l espressione enzimatica risenta di diversi fattori biotici ed abiotici La prosecuzione delle ricerche potr permettere di valutare meglio la variabilit della struttura e funzione della flora batterica ed approfondire le conoscenze sulle risposte di questo ecosistema artico ai forzanti ambientali Bibliografia GARCIA MORENO M L LANDGRAF M 1998 Virulence factors and pathogenicity of Vibrio vulnificus strains isolated from seafood J Appl Microbiol 84 747 751 KIM S J HOPPE H G 1986 Microbial extracellular enzyme detection on agar plates by means of fluorogenic methylumbelliferyl substrates 2 Colloque Int de Bacteriologie marine GERBAM CNRS Actes de Colloques 3 175 183 MARTINEZ J SMITH D C STEWARD G F AZAM F 1996 Variability in ectohydrolytic enzyme activities of pelagic marine bacteria and its significance for substrate processing in the sea Aquat Microb Ecol 10 223 230 Ricerca finanziata dal progetto Sponge POP Sponge associated culturable microbiome able to degrade POP along the Pasvik River and the Bokfjorden Arctic Norway nell ambito del progetto EU INTERACT 172 Volume pre print 46 Congresso della Societa Italia
466. s Materials and methods During three scientific expeditions carried out from 2008 to 2010 experimental observations on the surface predatory behaviour of great white shark have been gathered at Dyer Island Nature Reserve South Africa using a 12 m boat and a floating cage The decoy used for the surveys was designed around a double layer of floating plastic and blown with polyurethane foam in order to get a three dimensional ellipsoid shape and coloured using non toxic paints The dimensions were as close as possible to those of a juvenile sea lion Arctocephalus pusillus pusillus 70 cm long 32 cm wide with a diameter of about 60 cm Seal shaped decoys and tuna piece floating baits were the tested targets The data recorded included also specific biological information like sex total length sexual maturity stage distinguishing marks of identification re sightings and number of approaches to the decoy Approaches to the targets were classified as horizontal 0 30 between the body of the shark and the surface of the water diagonal 31 60 and vertical 61 90 the starting time of the event and its duration were also recorded Shark total length TL was estimated to the nearest 0 5 m based on the observations of the sharks next to the 5 0 m 160 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 observation vessel or a decoy in close proximity to the observation vessel Accordin
467. s Charonia lampas lampas gastropod triton reproduction Introduzione Il tritone mediterraneo Charonia lampas lampas Linnaeus 1758 un mollusco gasteropode appartenente alla famiglia Ranellidae Beu 1985 1987 presente nel Mar Mediterraneo e nell Atlantico orientale Nonostante l importanza ecologica le informazioni sulla sua biologia e sui processi riproduttivi sono ad oggi molto limitate La specie oggetto del presente studio una delle 17 protette dalla convenzione di Berna del 1979 ed considerata come specie a rischio di estinzione Secondo il D L n 73 2005 art 3 sarebbe auspicabile la creazione di programmi di riproduzione in cattivit quali strumenti di supporto per la conservazione della specie e per il suo eventuale ripopolamento Il presente lavoro riporta le osservazioni compiute sul comportamento riproduttivo di tre esemplari di tritone mediterraneo due femmine e un maschio mantenuti in cattivit presso 1 Acquario Comunale di Messina Sono state effettuate osservazioni sulla deposizione delle uova sulla loro schiusa e sul comportamento delle larve nei primi stadi di sviluppo Materiali e metodi Gli esemplari di tritone sono stati raccolti in periodi diversi su un fondale sabbioso a circa 35 metri lungo la costa prospiciente la penisola di S Raineri nello Stretto di Messina e sono stati mantenuti in acquario in un sistema a circuito aperto a T di 15 2 C pH 8 0 con nitriti assenti e nitrati 6 mg l Al
468. s an important factor limiting the distribution and the width of the reef structure at small spatial scale Chemello 2009 Furthermore D petraeum is subjected to different levels of wave motion according to its position in the reef inner edge outer edge However little is known about the relationship between hydrodynamic regime and local recruitment of D petraeum Overall recruitment dynamics vary in space and time Watson and Barnes 2004 in relation to the reproductive capacity of the species and the larval mortality Marshall et al 2009 This work aims to evaluate the recruitment rate of D petraeum examining the density of recruits in two different portions of the reef inner and the outer edge in relation to different hydrodynamic conditions Materials and methods The study was carried out in the Gulf of Cofano TP in the north west coast of Sicily Ten photographic replicates 10x10 cm have been collected monthly from June to September 2012 during the peak recruitment period Calvo et al 1998 Four localities with different exposure and reef extent have been selected Tonnara del Cofano TDC Scaru Zu Asparu SZA Isolidda SLD and Tonnara del Secco TDS with a prevailing exposition to north east north west west and east respectively For each locality the average hydrodynamism has been 60 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015
469. s was consistently documented around Ischia only Key words distribution Delphinus delphis common dolphin Mediterranean Sea Introduction The short beaked common dolphin Delphinus delphis Linnaeus 1758 is a small odontocete found worldwide Currently its abundance is in steep decline throughout the central and eastern Mediterranean Bearzi et al 2003 with the only notable population remaining in the Alboran Sea Cafiadas and Hammond 2008 This drop during the last few decades raised conservation problems and in 2003 the Mediterranean short beaked common dolphin subpopulation was listed as endangered in the IUCN Red List of Threatened Animals So far in Italian waters this species was reported to be regularly present in very low numbers around Ischia about 50 individuals and Lampedusa Islands lt 250 individuals and rare in all other seas including the Adriatic Habitat Directive Reporting 2014 Bearzi et al 2003 Here pooled data on presence distribution group size and association with other species is presented thanks to a common effort carried out by different research groups in Italy Materials and methods Data on D delphis groups were collected over 2000 2014 period within P lagos Sanctuary PS central CT and southern ST Tyrrhenian sea Sicily Channel SC and western Ionian Sea WI Dedicated visual surveys with structured sampling design were conducted by trained observers in good weather condition B
470. sa labilit ad es aminoacidi ed acidi umici Conclusioni I risultati qui riportati parte di una indagine pi ampia ancora in corso mostrano come le caratteristiche di biodisponibilit della DOM possano variare significativamente tra le diverse taglie molecolari appartenenti allo stesso insieme Di queste differenze determinate dalla tipologia stessa del campione necessario tener conto per una corretta interpretazione del destino della sostanza organica Fattori ambientali come la limitazione da nutrienti possono controllare i processi di rimozione anche di quelle frazioni risultate in prima analisi meno biodisponibili Pettine er al 2001 Zoppini et al 1998 Bibliografia CARLSON C HANSELL D A 2015 DOM sources sinks Reactivity and budgets In Hansell D A Carlson C A eds Biogeochemistry of marine dissolved organic matter Academic Press Publications Elsevier London 65 109 GUO L SANTSCHI P H 2007 Ultrafiltration and its applications to sampling and characterisation of aquatic colloids In Wilkinson K J Lead J R eds Environmental colloids and particles behaviour separation and characterisation Vol 10 John Wiley amp Sons Ltd Chichester UK 159 221 PETTINE M CAPRI S MANGANELLI M PATROLECCO L PUDDU A ZOPPINI A 2001 The dynamics of DOM in the Northern Adriatic Sea Estuar Coast Shelf S 52 4 471 489 SHANK G C ZEPP R G WHITEHEAD R F MORAN M A 2005 Variations in
471. scribed for other pollutants Santos et al 2014 References AU DWT 2004 The application of histo cytopathological biomarkers in marine pollution monitoring a review Mar Pollut Bull 48 817 834 SANTOS H C A GOMES V PASSOS M G ROCHA AJ S SALAROLI R B VAN NGAN P 2014 Histopathological alterations in gills of juvenile Florida pompano Trachinotus carolinus Perciformes Carangidae following sublethal acute and chronic exposure to naphthalene Pan American Journal of Aquatic Sciences 6 109 120 TRIEBSKORN R TELCEAN I CASPER H FARKAS A SANDU C STAN G COLARESCU O DORI T KOHLER H R 2008 Monitoring pollution in River Mures Romania part II metal accumulation and histopathology in fish Environ Monit Assess 141 177 188 Research Project RF 2009 1536185 Food and environmental safety the problem of the endocrine disruptors funded by the Italian Ministry of Health 203 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 S RizzuTo S CASINI D COPPOLA M GIANNETTI M C Fossi H VAN WYK E SPERONE S TRIPEPI P MICARELLI L MARSILI Dipartimento di Scienze Fisiche della Terra e dell Ambiente Universita di Siena Via Mattioli 4 53100 Siena Italia Stellenbosch University Sud Africa rizzutosimone86 gmail com 3Dip di Biologia Ecologia e Scienze della Terra Universit della Calabria Arcavacata Rend
472. scuna serie sono sfalsati di tre mesi per valutare l eventuale variabilit temporale delle modalit di colonizzazione Gli organismi presenti sui pannelli sono stati identificati al pi basso livello tassonomico possibile e ne stata valutata la copertura mediante software di analisi di immagine Risultati Complessivamente sono stati identificati 62 taxa di cui 18 comuni ai due siti 10 esclusivi di Gaeta e 34 rinvenuti solo a Taranto I pannelli prelevati a Taranto presentano una maggiore ricchezza in specie rispetto ai campioni di Gaeta con un massimo di 27 taxa identificati nel periodo estivo a fronte dei 14 rinvenuti a Gaeta nello stesso periodo In entrambi i siti sono presenti specie di interesse per la biorimediazione quali policheti sabellidi dei generi Branchiomma e Sabella e 78 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 ascidiacei del genere Styela La composizione delle comunita rilevate dopo tre mesi a Taranto e a Gaeta risultata differente come evidenziato nell ordinamento ottenuto con nMDS Fig 1 in cui i punti relativi ai campioni pugliesi risultano distintamente separati sul primo asse da quelli laziali Le differenze riconducibili alla stagione di immersione sono evidenziate lungo il secondo asse con una buona distinzione tra i pannelli posti in acqua nel periodo estivo e nel periodo invernale Coordinate 2 o a gt gt T T T T
473. se compromettere I fatti per hanno dimostrato che questa contrapposizione non solo si dimostrata perdente in molti casi ma non stata mai funzionale al raggiungimento di quei compromessi ottimali fra usi diversi del mare che sono invece alla base del MSP Dunque in futuro sar necessario affinare capacit diagnostiche e previsionali non poggiate su preconcetti ma sviluppate in maniera rigorosa e soprattutto adeguatamente validate ovvio che ci richiede la disponibilit di dati e conoscenze che troppo spesso e troppo facilmente si danno per gi acquisiti da parte di alcuni soggetti per giustificare la mancanza di investimenti adeguati e da parte di altri per mostrare di possedere capacit che in realt non si hanno Un aiuto all avanzamento delle nostre conoscenze nell assoluta mancanza di investimenti sulla ricerca di base potr forse venire da quanto sar prodotto nell ambito del monitoraggio previsto dalla Marine Strategy ma sar un aiuto parziale e limitato ad alcune componenti e sar presto evidente che il gap conoscitivo invece di chiudersi grazie alle nuove acquisizioni si allargher sotto la spinta delle cresciute esigenze diagnostiche e previsionali alle quali siamo inutile negarlo non del tutto preparati Questo non un problema soltanto italiano sia chiaro ma riguarda pi in generale una visione antropocentrica dello sviluppo in cui fra le tre componenti della sostenibilit quella ambientale cert
474. should be taken into account in the integrated coastal management Experiments on top down and bottom up mechanisms in controlling Fucales populations will enhance this research programme food choice and sediment scouring experiments will be performed The healthy state of deep populations will be further investigated both by SCUBA diving and by ROV References BUIA M C CHIARORE A MULAS M PORZIO L 2013 Historical changes in algal diversity in the Gulf of Naples In Ozhan E ed Proceedings of the Global Congress on ICM Lessons Learned to Address New Challenges EMECS 10 MEDCOAST 2013 Joint Conference Marmaris Turkey 30 Oct 3 Nov 2013 2 837 846 FUNK G 1927 Die Algenvegetation des Golfs von Neapel Pubbl Staz Zool Napoli 7 Suppl 1 507 FUNK G 1955 Meeresalgen von Neapel Pubbl Staz Zool Napoli 25 Suppl 1 178 THIBAUT T PINEDO S TORRAS X BALLESTEROS E 2005 Long term decline of the populations of Fucales Cystoseira spp and Sargassum spp in the Alberes Coast France North Western Mediterranean Mar Pollut Bull 50 1472 1489 This research is supported by the RITMARE project AK and DG have been supported by SZN PhD fellowships AC has been supported by a RITMARE fellowship 33 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 G MACRI M A DELARIA A NAVONE S CARONNI Mac Pro e GIS Via C Goldoni 7 27100 P
475. so del 2014 sono stati analizzati 23 esemplari di Caretta caretta provenienti da diverse parti della Sicilia catturati accidentalmente da pescatori e o diportisti Gli esemplari sono stati conferiti presso il Centro Regionale di Recupero per tartarughe marine della Sicilia sito nell Istituto Zooprofilattico Sperimentale della Sicilia Su ogni esemplare esaminato oltre ad avere rilevato il peso totale sono state registrate la lunghezza e larghezza curva del carapace la lunghezza del piastrone e il numero di scudi prefrontali costali vertebrali e inframarginali I caratteri morfologici utilizzati per l identificazione della specie seguono le linee guida riportate da Marquez 1990 Gli individui subito dopo il loro conferimento venivano sottoposti a controlli sanitari con relative cure del caso e stabulati al fine di garantire il ripristino delle complete funzioni organiche cos da poterli marcare e successivamente reimmettere in 192 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 natura Tutti gli individui sono stati sottoposti ad analisi genetiche attraverso il sequenziamento di un frammento di 243 bp del gene mitocondriale Citocromo b al fine di supportare l identificazione morfologica Primers TurtleF 5 CTCACCAGACATCTCCATAGC 3 TurtleR 5 CCTCATGGTAGGACGTAGCC 3 condizioni di amplificazioni e sequenziamento sono stati sviluppati dal laboratorio di Tecnologie Diagnostiche Innova
476. sp Paracalanus sp Oithona tenuis Cymbasoma longicaudatus Rhincalanus nasutus Pontella sp Oithona sp Monstrilla sp Conclusioni Sulla comunit a Copepodi si apprezzano minime variazioni di abbondanza e composizione specifica riconducibili alla naturale variazione interannuale dei popolamenti zooplanctonici Razouls e Kouwenberg 1993 I dati raccolti nell impossibilit di un confronto con una fase di controllo ex ante rappresentano l unico riferimento iniziale per le successive valutazioni d impatto riconducibili alla presenza del relitto La differente distribuzione verticale dei Copepodi pu essere associata al significativo aumento nella fascia superficiale della colonna d acqua di Doliolidi e Salpidi Thalia democratica 6 21 ind m attivamente predati dal genere Sapphirina Takahashi e Ichikawa 2013 Bibliografia HAYS G C RICHARDSON A J ROBINSON C 2005 Climate change and marine plankton Trends Ecol Evol 20 337 344 RAZOULS C KOUWENBERG H M 1993 Spatial distribution and seasonal variation of mesozooplankton biomass in the Gulf of Lions Oceanol Acta 16 393 402 TAKAHASHI K ICHIKAWA T 2013 Sapphirinid copepods as predators of doliolids their role in Doliolid mortality and sinking flux Limnol Oceanogr 58 6 1972 1984 TAYLOR A H ALLEN J I CLARCK P A 2002 Extraction of a week climatic signal by an eco system Nature 416 629 632 168 Volume pre
477. specially in the perspective of improving the integration between the remote sensing techniques and in situ laboratory advanced measuring methods are very promising to map the distribution of aquatic alien species in shallow water bodies subject to both anthropic pressure and climate changes effects Therefore the abovementioned technology could be a useful tool for the sustainable management of these environments Fig 1 Thematic map of Hypnea cornuta from Landsat 8 OLI data acquired on August 2014 Mappa tematica di Hypnea cornuta ottenuta da dati Landsat 8 OLI acquisiti nell agosto 2014 References BORFECCHIA F DE CECCO L MARTINI S CERIOLA G BOLLANOS S VLACHOPOULOS G VALIANTE L M BELMONTE A MICHELI C 2013a Posidonia oceanica genetic and biometry mapping through high resolution satellite spectral vegetation indices and sea truth calibration Int J Remote Sens 34 13 4680 4701 BORFECCHIA F MICHELI C CARLI F COGNETTI DE MARTIS S GNISCI V PIERMATTEI V BELMONTE A DE CECCO L MARTINI S MARCELLI M 2013b Mapping Spatial Patterns of Posidonia oceanica meadows by Means of Daedalus ATM Airborne Sensor in the Coastal Area of Civitavecchia Central Tyrrhenian Sea Italy Remote Sens 5 10 4877 4899 CECERE E PETROCELLI A VERLAQUE M 2004 Morphology and vegetative reproduction of the introduced species Hypnea cornuta Rhodophyta Gigartinales in the Mar Piccolo of Taranto Italy Mediterra
478. specie pi comune e anche pi minacciata del Mediterraneo a causa di ferite e catture accidentali da parte di pescatori o di altri fattori quali l intenso traffico nautico e la crescente antropizzazione delle coste una specie inserita nella Red List of Threatened Species dell International Union for Conservation of Nature IUCN 2012 Sebbene sia molto studiata poco si conosce sulla variabilit di alcuni caratteri morfologici utilizzati ai fini identificativi In particolare il numero di piastre cornee presenti sul carapace e sul piastrone vengono utilizzate per identificare le 4 specie di cheloni presenti nel Mediterraneo Marquez 1990 Negli ultimi anni segnalazioni relative a differenze nel numero di queste piastre sono state riscontrate in individui osservati in alcune aree del Mediterraneo orientale Turkozan ef al 2001 Margaritoulis e Chiras 2011 e settentrionale Oliver 2014 Tuttavia dati relativi alla variabilit di questi caratteri in individui recuperati lungo le coste italiane sono raramente riportati L unico studio in Italia risale a Capocaccia 1966 che ha preso in esame prevalentemente reperti museali L obiettivo del presente contributo quello di fornire per la prima volta in individui catturati accidentalmente in acque siciliane informazioni sulla variabilit del numero di piastre presenti sul carapace e di migliorare le conoscenze su queste variazioni ai fini identificativi Materiali e metodi Nel cor
479. stati casualmente distribuiti in 45 contenitori forati allocati in 9 vaschette sperimentali alimentate in maniera indipendente da un flusso d acqua di mare in continuo Ad ogni vaschetta stato assegnato in maniera casuale un mangime A B e C per un totale di 3 repliche somministrato ad ogni riccio 1 g individuo ogni 2 giorni A distanza di 1 2 e 4 mesi 43 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 dall inizio dell esperimento diametro e peso totale di ciascun individuo sono stati nuovamente misurati Al termine dell esperimento i ricci sono stati dissezionati per misurare il peso delle gonadi I diametri e i pesi totali sono stati convertiti in percentuali di crescita per ciascun intervallo e analizzati tramite ANOVA Differenze nelle dimensioni relative delle gonadi sono state testate tramite ANCOVA utilizzando la taglia come covariata Risultati Si notata una pi rapida dissoluzione di tutti i mangimi a 24 C rispetto a 19 C Si nota una minore stabilit del mangime B ad entrambe le temperature Fig 1 Per ciascun tempo di campionamento le percentuali di crescita in relazione al diametro non differiscono significativamente in base al mangime usato Il peso relativo delle gonadi Fig 2 risulta significativamente maggiore per i mangimi A e C rispetto al B e rispetto all inizio dell esperimento tempo 0 p lt 0 01 mentre A e C non differiscono p 0 14
480. stigations dealt with microbial dynamics in these areas little is known about microbial presence and activity in dense waters Viruses and heterotrophic prokaryotes hereinafter called bacteria were investigated as they constitute the most pervasive component of marine plankton with dynamics and activity that are tightly coupled with the water masses circulation Materials and methods The study was carried out onboard R V OGS Explora in March 21 to 28 2013 At two Adriatic pits the middle one Pomo 42 52 650 N 14 43 790 E 270 m deep and the south one SAP 41 32 010 N 18 5 100 E 1200 m deep water samples were collected for physico chemical and microbial characterization at eight depths by a Rosette sampler for 24 Niskin 10 L bottles equipped with SBE 911 CTD probe The abundance of bacteria and viruses was determined by fluorescence microscopy according to Patel et al 2007 Bacterial Carbon Production BCP was assayed by the incorporation of H Leu while respiration rates ETS were estimated according to Packard and Williams 1981 Bacterial Growth Efficiency BGE was calculated according to Cole et al 1988 Virus Bacterium Ratio as a proxy of the relationship between these two components was obtained by dividing the abundance of viruses by the bacterial one 179 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 Results The physicochemical
481. stituire una formazione lenticolare il secondo si presenta come uno strato pi ampio di cellule disposte in cordoni che avvolge completamente il primo Tra la camera fotogena e la lente si osserva un sottile strato di tessuto connettivo che separa i due compartimenti dell organo luminoso Il corpo gelatinoso disposto nella parte pi distale dell intero apparato aderisce alle cellule della lente ed appare come un tessuto fortemente idratato Lo strato pigmentato circonda l intero organo camera fotogena e lente e si presenta di colore scuro all analisi microscopica Fig 1 Pa Fig 1 Sezione longitudinale del fotoforo di D holti ematossilina eosina 10x Longitudinal section of a D holti s photophore haematoxylin eosin x10 Conclusioni La struttura microscopica dei fotofori di D holti presenta caratteristiche peculiari infatti la camera fotogena presenta un cavit interna nella quale i fotociti riversano il loro secreto che funge da substrato per la reazione luminosa Gli annessi diottrici lente strato pigmentato e corpo gelatinoso sono strutturati per garantire il loro importante coinvolgimento nell articolata funzione di convogliare i raggi luminosi verso l esterno dell organo in specifiche direzioni ed in modo da concentrarli e non farli disperdere Sembra inoltre mancare un ulteriore annesso diottrico denominato in altre specie riflettore che si trova generalmente interposto tra lo strato pigmen
482. studiate dove non forma mai aggregazioni dense in Sicilia era presente nel 62 delle stazioni osservate con una densit media di 14 9 5 9 polipi per 100 minuti di video track in Campania questa specie stata osservata nel 73 delle stazioni con densit di 14 1 4 3 polipi per 100 minuti di video track mentre in Liguria nel 70 dei siti campionati con densit medie di 5 1 1 6 polipi per 100 minuti di video track Questa specie vive sia su fondi mobili che in patch sabbiosi o anfratti su fondi duri e sembra presentare una differenza nella colorazione dei tentacoli marginali che sono prevalentemente biancastri negli esemplari siciliani verdi in quelli del Golfo di Napoli mentre in Liguria sono presenti entrambi i fenotipi P dohrni stato osservato sia in Campania dove forma aggregazioni su fondi fangosi che possono raggiungere 60 polipi per 100 minuti di video track e in Sicilia con massimi di 389 polipi per 100 minuti In generale i polipi liguri sono di dimensioni minori rispetto a quelli delle regioni meridionali lunghezza dei tentacoli marginali 5 0 8 cm 13 2 2 cm 10 0 6 cm rispettivamente per Liguria Campania e Sicilia P solitarius stato rinvenuto solo in Liguria dove non supera i 20 polipi per 100 minuti di video track A oligopodus una piccola specie che stata osservata solo in una stazione del Golfo di Napoli La Montagna con densit di oltre 1200 esemplari per 100 minuti di video track Conclusioni Per diverse ragioni r
483. sun compass orientation We tested intact and operated antennaeless without the first and or the second antennae individuals kept under an L D 12 12 cycle either in phase with the natural one or advanced by 6 hours We didn t observe any statistically significant difference between the control intact and the experimental antennaeless animals in their behaviour Therefore our preliminary studies demonstrated that antennae do not have a primary role in the solar orientation of this species Key words antennae circadian rhythms ecological zonation migration orientation behaviour Introduction The nocturnal supralittoral sandhopper Talitrus saltator Montagu 1808 is known to use several cues to return to the band of damp sand on the beach where it lives during the day following the shortest route the sea land axis The sun is the main cue used in zonal recovery by this species Pardi and Papi 1953 even though it involves the compensation for its apparent movement Talitrus saltator also exhibits an endogenous rhythm of locomotor activity with a circadian periodicity entrained by the natural L D photoperiod Bregazzi and Naylor 1972 The chronometric mechanism involved in the regulation of the activity rhythm is the same that permits the compensation for the azimuthal variations of the sun Ugolini et al 2007 In Talitrus saltator the sun compass has been investigated especially from a behavioural point of view Ugolini et al 20
484. surveys from five different areas along with satellite environmental and bathymetry data were compiled Generalized additive models were applied in a presence absence approach using the available datasets along with satellite environmental e g Sea Surface Temperature Chlorophyll Sea Level Anomaly and bathymetry data Annual habitat suitability maps over the period 2000 2010 and addressing different life stages i e adults juveniles and eggs of the target species were obtained Based on these annual maps habitat persistency maps were produced using GIS techniques where persistent and occasional locations suitable for nurseries and spawning grounds were identified Giannoulaki et al 2013 Nursery areas of demersal species The analysis of the time series of MEDITS bottom trawl survey data was carried out in the European Mediterranean waters to estimate the distribution of nursery areas and spawning grounds of 12 key demersal fish and shellfish species Spatial analysis techniques were applied per species area and life stages using different modelling approaches GLM GAMs GAMMs ZiGams geostastics depending on data peculiarities Annual density probability were obtained and hot spots i e persistent nursery and spawning areas of most species identified Using MEDISEH results Colloca et al 2015 focused on the nursery of 11 demersal 21 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015
485. t di comprendere ed eventualmente modellizzare i processi che lo determinano Ad esempio ci di fondamentale importanza ai fini di una chiara distinzione fra correlazioni e relazioni causali fra grandezze e soprattutto per capire quando lecito inferire l esistenza di queste ultime sulla base delle prime e quando invece questo passo non legittimo In uno scenario in cui l interpretazione delle propriet ecologiche di un sistema dovr informare la definizione di priorit e l adozione di misure di prevenzione o di restauro un incerta valutazione delle nostre conoscenze potr avere rilevanti effetti avversi In quest ottica fondamentale per esempio capire come la profondit sia la variabile ambientale di gran lunga pi rilevante per comprendere la distribuzione delle fanerogame marine ma solo a scala spaziale sufficientemente piccola se invece si dispone di una risoluzione spaziale pi grossolana es 1 2 o 1 4 di miglio allora la profondit media non avr nessuna relazione causale con la presenza o la densit delle fanerogame e molto probabilmente la correlazione fra queste grandezze sar anch essa piuttosto debole Alla luce di ci dovr essere usata grande cautela nel considerare l importanza stimata delle variabili predittive utilizzate per un problema di habitat modelling soprattutto se si volesse supportare con tali considerazioni un esercizio di pianificazione spaziale marittima In questo senso il
486. t Adriatic Sea Pagellus erythrinus Introduction Common pandora Pagellus erythrinus Linnaeus 1758 is a target species for the fishery data collection protocols EC Reg N 199 and 665 2008 and a protogynous hermaphroditic species Information on its diet is scarce in recent decades Larraneta 1964 Spain Rosecchi 1983 France Caragitsou amp Papaconstantinou 1988 Greece Ardizzone amp Messina 1983 Tyrrhenian Sea particularly in the Adriatic Sea and it regards a very limited area off Croatian eastern middle Adriatic Sea Santic et al 2011 P erythrinus is essentially carnivorous and feeds on crustaceans worms and other marine invertebrates The goal of this paper is to analyse the diet of P erythrinus in Adriatic Sea according to size in order to increase the knowledge on this species Materials and methods A total of 1148 specimens of P erythrinus ranging from 50 to 217 mm TL were collected in the northern middle Adriatic Sea by bottom trawl surveys 2005 2006 Specimens were measured to the nearest mm total length and weighed to the nearest 0 1 g Sex and gonad maturity were defined according to protocol used in the European MEDITS project The fishes sampled were subdivided into two size groups juveniles sex not distinguished TL lt 110 mm and adults TL 110 mm on the basis of the macroscopic analysis of gonads and of the smallest size at maturity Samples were dissected and stomachs were removed and pres
487. t sampling 41 55 679 N 015 08 497 E end sampling 41 55 628 N 015 08 703 E in proximity of the river Saccione mouth The community was characterized by the dominance of both the bivalves D semistriatus and Lentidium mediterraneum O G Costa 1830 together with the presence of juveniles of the bivalve Chamelea gallina Linnaeus 1758 the polychaetes Owenia fusiformis Delle Chiaje 1844 and Glycera unicornis Savigny in Lamarck 1818 the crustaceans Diogenes pugilator Roux 1829 Liocarcinus 66 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 navigator Herbst 1794 and Liocarcinus pusillus Leach 1816 as well as the fishes Callionymus festivus Pallas 1814 and Lepidotrigla cavillone Lacep de 1801 A total of 133520 specimens of D semistriatus were collected within the SFS biocenosis with an estimated standardized density of 222533 N km The length frequency distribution showed a range of size between 5 and 18 mm SL Fig 1 The mean value was 8 72 0 004 mm SL the median and mode values were 9 and 8 mm SL respectively The kurtosis coefficient was 3 750 leptokurtic distribution while the skewness resulted 1 037 positive skew Donax semistriatus Mean mm 8 72 0000 PA a pia 34553 Standard error 0 004 pi 35000 4 Median mm 9 amp 30000 4 Mode mm 8 Y 2 25000 Kurtosis 3 750 2 20000 iosa 1 037 lt A Min mm gt 7 15000 Max mm 18
488. t scale J Shell Res 17 5 1523 1531 GUIDETTI P TERLIZZI A BOERO F 2004 Effects of the edible sea urchin P lividus fishery along the Apulian rocky coast SE Italy Mediterranean Sea Fish Res 66 287 297 PAIS A CHESSA L A SERRA S RUIU A MELONI G DONNO Y 2007 The impact of commercial and recreational harvesting for Paracentrotus lividus on shallow rocky reef sea urchin communities in North western Sardinia Italy Estuar Coast Shelf Sci 73 589 597 46 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 A PAGLIARANI F CIMA V VENTRELLA M FABBRI S NESCI P SERRATORE E VOLPE S CIULLI Dipartimento di Scienze Mediche Veterinarie DIMEVET Universit di Bologna Via Tolara di Sopra 50 40064 Ozzano Emilia BO Italia alessandra pagliarani unibo it Dipartimento di Biologia Universit di Padova Via Ugo Bassi 58 B 35131 Padova Italia VALUTAZIONE DELLO STRESS OSSIDATIVO DA IMPIEGO DI UN GERMICIDA COMMERCIALE PER LA DEPURAZIONE DI VENERUPIS TAPES PHILIPPINARUM EVALUATION OF OXIDATIVE STRESS UPON TREATMENT WITH A COMMERCIAL GERMICIDE FOR THE DEPURATION OF VENERUPIS TAPES PHILIPPINARUM Abstract Although the bactericidal properties of the germicide employed on clams are tightly linked to its oxidative power confirmed by the oxidative stress detected in in vitro treated haemocytes the similarity of VOC profiles and TBARs lev
489. tato e la superficie del fotoforo Cavallaro et al 2004 Tale ipotesi dovr comunque essere supportata dallo studio ultrastrutturale in corso L analisi morfologica del sistema fotogeno di D holti pone inoltre in evidenza un importante fenomeno di convergenza adattativa relativamente al confronto con la struttura degli organi luminosi di altre specie di pesci mesopelagici spiaggiati lungo le coste dello Stretto di Messina Cavallaro et al 2004 Bibliografia ANCTIL M 1972 Luminescent organs of Myctophid fishes structural and histochemical aspects Can J Zool 50 233 237 BATTAGLIA P ANDALORO F CONSOLI P ESPOSITO V MALARA D MUSOLINO S PEDA C ROMEO T 2010 Feeding habits of the Atlantic bluefin tuna Thunnus thynnus L 1758 in the central Mediterranean Sea Strait of Messina Helgol Mar Res doi 10 1007 s10152 012 0307 2 CAVALLARO M MAMMOLA C VERDIGLIONE R 2004 Structural and ultrastructural comparison of photophores of two species of deep sea fishes Argyropelecus hemigymnus and Maurolicus muelleri J Fish Biol 64 1552 1567 TORTONESE E 1957 Fauna d Italia Osteichthyes Edizioni Calderini Bologna 565 pp WHITEHEAD P J P BAUCHOT M L HUREAU J C NIELSEN J TORTONESE E 1984 Fishes of the north eastern Atlantic and the Mediterranean Vol 1 UNESCO Paris 510 pp 195 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015
490. tegrata dello spazio marittimo PMI 2014 89 UE Tale approccio contempera usi antropici del territorio e peculiarit naturalistiche nell ambito di analisi spaziali e multiscenario Di Donato et al 2012 integrabili poi con analisi di contabilit ambientale basata su servizi ecosistemici Franzese et al 2008 al fine di supportare le attivit di pianificazione e gestione di una riserva Nell AMP di Ventotene e Santo Stefano sono stati raccolti e geo referenziati sia dati sull uso antropico del territorio marittimo siti di balneazione diportismo pesca immersioni e rotte sia sulla distribuzione degli habitat elaborati poi con l applicativo Marxan Ball e Possingham 2002 che attraverso il simulated annealing seleziona siti che consentono di raggiungere gli obiettivi di conservazione al minor costo possibile Materiali e metodi L area di studio stata suddivisa in esagoni di 0 25 ha Unit di Pianificazione UP ed in ciascuno di essi sono stati individuati gli habitat marini rilevanti per la conservazione conservation feature e l ammontare minimo di superficie da tutelare in base alle raccomandazioni dell IUCN del codice RAC SPA e della direttiva Habitat 92 43 CEE Posidonieti 40 Scogliere 30 Sabbie Fini 20 Detritico Costiero 10 A ciascuna UP stato assegnato un rango rappresentativo di tutte le attivit antropiche tenendo conto dell impatto delle attivit sulle conservation feature Il software
491. teristiche intrinseche delle strutture influenzano la capacit di attrazione sulla stenella consentendo di classificare le montagne per importanza attrattivit montagna specifica I risultati ottenuti permettono di colmare le lacune relative a queste strutture in Mar Tirreno aprendo la via allo sviluppo di piani di gestione di aree di mare aperto tema prioritario delle politiche di governance internazionale EBSA Bibliografia BREIMAN L 2001 Random forest Mach Learn 45 5 32 HALPIN P N READ AJ FUJIOKA E BEST B D DONNELLY B HAZEN L J KOT C URIAN K LABRECQUE E DIMATTEO A CLEARY J GOOD C CROWDER L B HYRENBACH K D 2009 OBIS SEAMAP The world data center for marine mammal sea bird and sea turtle distributions Oceanography 22 2 104 115 MORATO T CHEUNG W W L PITCHER T J 2006 Vulnerability of seamount fish to fishing fuzzy analysis of life history attributes J Fish Biol 68 209 221 MORATO T HOYLE S D ALLAIN V NICOL S J 2010 Seamounts are hotspots of pelagic biodiversity in the open ocean Proc Natl Acad Sci USA 107 21 9707 9711 MORATO T VARKEY D A DAMASO C MACHETE M SANTOS M PRIETO R SANTOS R S PITCHER T J 2008 Evidence of a seamount effect on aggregating visitors Mar Ecol Progr Ser 357 23 32 221 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 C MARINI F FossA M BELLINGERI
492. ters using a qPCR based assay Mar Pollut Bull 88 102 109 DAVID H LAZA MARTINEZ A MIGUEL I ORIVE E 2013 Ostreopsis cf siamensis and Ostreopsis cf ovata from the Atlantic Iberian Peninsula morphological and phylogenetic characterization Harmful Algae 30 44 55 PENNA A BATTOCCHI C CAPELLACCI S FRAGA S ALIGIZAKI K LEMEE R VERNESI C 2014 Mitochondrial but not rDNA genes fail to discriminate dinoflagellate species in the genus Ostreopsis Harmful Algae 40 40 50 PENNA A FRAGA S BATTOCCHI C CASABIANCA S RIOBO P GIACOBBE M G VERNESI C 2010 A phylogeography study of the toxic benthic genus Ostreopsis Schmidt J Biogeogr 37 830 841 176 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 T CIBIC C CAROPPO E DI POI A KARUZA M ROGELJA P DEL NEGRO OGS Istituto Nazionale di Oceanografia e Geofisica Sperimentale di Oceanografia Sezione Oceanografia Via A Piccard 54 34151 Trieste Italy pdelnegro ogs trieste it Consiglio Nazionale delle Ricerche CNR Istituto per 1 Ambiente Marino Costiero IAMC Taranto Italy PRIMARY PRODUCTION AND SEASONAL SUCCESSION OF DIFFERENT PHOTOAUTOTROPHS PICO NANO AND MICROPLANKTON IN THE MAR PICCOLO OF TARANTO PRODUZIONE PRIMARIA E SUCCESSIONE STAGIONALE DEI DIVERSI ORGANISMI FOTOAUTOTROFI PICO NANO E MICROPLANCTON NEL MAR PICCOLO DI TARANTO Abstract In order to detect
493. th a trend almost significant p 0 055 Fig 1g h In general with the exception of bony fish which displayed an oscillating pattern the behavior of catch rates of the taxonomic groups seems in line with the reduction of fishing effort in the GSA 16 occurred in the last years STECF 2013 bony fish bony fish cephalopods cephalopods a a 3 Booo a 8 i 3 n E pil g a dl o 8 ji al E o 2 2 8 4 2 0 j00 o n 38 o 9 3 3 p 8 o o E S 8 8 E R q 2 EN i Bo i T T T 8 a T T T T T T T E T A ai 1995 2000 2005 2010 2015 1995 2000 2005 2010 2015 1995 2000 2005 2010 2015 1995 2000 2005 2010 2015 elasmobranches elasmobranches crustaceans crustaceans E 8 3 8 a 87 S SN o la x 9 g 9 9 N a ER Bs S E E oo o o 5 o 7 BS ge o 2g 0 E 28 00 E ES 5 5 E 9 a T T T T Si B ni y T T T T T T 1995 2000 2005 2010 2015 1995 2000 2005 2010 2015 1995 2000 2005 2010 2015 1995 2000 2005 2010 2015 Fig 1 Biomass and density time series trends and forecasts of bony fish cartilaginous fish cephalopods and crustaceans in the Strait of Sicily GSA 16 Trend e previsioni delle serie storiche degli indici di biomassa e densit di pesci ossei pesci cartilaginei cefalopodi e crostacei nello Stretto di Sicilia GSA 16 References BERTRAND J A GIL DE SOLA L PAPACONSTANTINOU C RELINI G SOUPLET A 2000 A international bottom trawl survey in the Mediterranean the MEDIT
494. the Mediterranean Sea a look at habitat changes Nova Science Publ New York 413 443 UGOLINI A UNGHERESE G SOMIGLI S GALANTI G BARONI D BORGHINI F CIPRIANI N NEBBIAI M PASSAPONTI M FOCARDI S 2008 The amphipod Talitrus saltator as bioindicator of human trampling on sandy beaches Mar Environ Res 65 349 357 Ricerca eseguita con fondi Progetto Regione Autonoma Sardegna Legge 7 2007 ann 2010 resp scient M Schintu e fondi locali ex 60 Universit di Firenze assegnatario A Ugolini 213 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 M VAZZANA M CELI D RUSSO N PARRINELLO V ARIZZA Dipartimento Scienze e Tecnologie Biologiche Chimiche e Farmaceutiche STEBICEF Universita di Palermo Via Archirafi 18 90123 Palermo Italia vincenzo arizza unipa it CYTOTOXIC ACTIVITY OF HOLOTHURIA TUBULOSA ECHINODERMATA COELOMOCYTES ATTIVITA CITOTOSSICA DEI CELOMOCITI DI HOLOTHURIA TUBULOSA ECHINODERMATA Abstract In the present paper we showed that the coelomic fluid from the sea cucumber Holothuria tubulosa Gmelin 1788 contains coelomocytes able to kill in vitro rabbit and sheep red blood cells in a calcium independent manner A similar activity was found in coelomocyte lysate supernatant indicating that hemolytic factors are probably produced and stored by circulating coelomocytes and then released By plaque forming assay is shown that the effect
495. the Mediterranean sea using conservation planning tools Biol Mar Mediterr 21 1 159 162 FIORENTINO F MASSUT E TINTI F SOMARAKIS S GAROFALO G RUSSO T FACCHINI M T CARBONARA P KAPIRIS K TUGORES P CANNAS R 23 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 TSIGENOPOULOS C PATTI B COLLOCA F SBRANA M MIFSUD R VALAVANIS V SPEDICATO M T 2015 Stock units Identification of distinct biological units stock units for different fish and shellfish species and among different GFCM GSA STOCKMED Deliverable 03 Final Report January 2015 310 pp GAME E T GRANTHAM H S 2008 Marxan User Manual For Marxan version 1 8 10 University of Queensland St Lucia Queensland Australia and Pacific Marine Analysis and Research Association Vancouver British Columbia Canada Available online at http www uq edu au marxan docs Marxan_User_Manual_2008 pdf GIANNOULAKI M BELLUSCIO A COLLOCA F FRASCHETTI S SCARDI M SMITH C PANAYOTIDIS P VALAVANIS V SPEDICATO M T eds 2013 Mediterranean Sensitive Habitats Contract SI2 600741 Final Report 557 pp GIANNOULAKI M IGLESIAS M TUGORES P PYROUNAKI M M LEONORI 1 CAMPANELLA F BONANNO A PATTI B BIGOT J L SARAUX C DE FELICE A TICINA V BASILONE G MACHIAS A SOMARAKIS S SCHISMENOU E SIAPATIS A TSERPES G CUTTITTA A VALAVANIS V PAPADOPOULOU N NIKOLOPOULOU M GRISTIN
496. the spectral properties of freshwater and estuarine CDOM caused by partitioning onto river and estuarine sediments Estuar Coast Shelf S 65 1 289 301 SHARP J H CARLSON C A PELTZER E T CASTLE WARD D M SAVIDGE K B RINKER K R 2002 Final dissolved organic carbon broad community intercalibration and preliminary use of DOC reference materials Mar Chem 77 4 239 253 SPENCER R G AHAD J M BAKER A COWIE G L GANESHRAM R UPSTILL GODDARD R C UHER G 2007 The estuarine mixing behaviour of peatland derived dissolved organic carbon and its relationship to chromophoric dissolved organic matter in two North Sea estuaries UK Estuar Coast Shelf S 74 1 131 144 ZOPPINI A AZZARO M DEL NEGRO P LA FERLA R PUGNETTI A 2010 Respirazione planctonica In Socal G Buttino I Cabrini M Mangoni O Penna A Totti C eds Metodologie di studio del plancton marino ISPRA Manuali e Linee Guida 56 185 194 ZOPPINI A BACCI C FAZI S PETTIN M TANDOI V 1998 Bacterial utilization of different DOC size classes and demand for inorganic nutrients in the northern Adriatic sea Fresen Environ Bull 7 1A 2A 42 50 186 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 POSTER SESSIONE VARI 187 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 K F A ABDELRHMAN G BACCI C MANCUSI A M
497. their application in scientific research Our experience indicates the use of FAD buoys can help fishermen to find them and to decrease their number and the environmental impact Biomass echo sounder analysis for scientific purposes still needs a more accurate and specific setting from producer Key words FADs echo sounder buoys aggregation dolphinfish Introduzione La pesca della lampuga Coryphaena hippurus Linnaeus 1758 mediante l utilizzo dei FADs Fish Aggregating Devices una tecnica molto diffusa nei mari siciliani durante la stagione autunnale I FADs noti in Sicilia come cannizzi sono sistemi galleggianti costituiti da foglie di palma sugheri o bidoni in pvc ancorati su fondali anche di 1000 m tramite cavi in polipropilene e massi di elevato peso I FADs sfruttano il principio per cui diverse specie ittiche sono attratte da oggetti galleggianti in mare aperto Andaloro er al 2007 Attualmente i pescatori utilizzano centinaia di cannizzi per imbarcazione disposti in lunghi filari che partono dalla costa e si allontanano anche per 20 miglia Questo modus operandi che facilita il ritrovamento dei FADs durante la navigazione Morales Nin et al 2000 comporta uno svantaggio sia economico con un dispendio di attrezzature e maggiori spese di carburante sia ambientale con maggiori rilasci di zavorre e cordami in mare Inoltre stato osservato che molti FADs non sono produttivi ed il loro elevato numero non darebbe benefi
498. ti Pearson con i dati idrologici e saggiati mediante analisi della varianza ANOVA raggruppando le stazioni in 4 zone Stretto di Gibilterra 2 stazioni Sardegna 3 stazioni due aree intermedie con 4 stazioni ciascuna Risultati I risultati sono stati riportati come valori medi misurati negli strati epi 0 100 m meso 100 1000 m e bati pelagici gt 1000 m della colonna d acqua Tab 1 173 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 La densita di batteri eterotrofi MA variata fra 0 e 5 86x10 CFU ml con maggiori concentrazioni nella zona centrale del transetto a livello epi e batipelagico La componente luminosa SWC oscillata fra 0 e 2 9x10 CFU 100 ml ed ha presentato concentrazioni crescenti verso est e maggiori densit nell epipelago Tab 1 Valori medi s d di batteri eterotrofi MA e luminosi SWC tassi di attivit leucin aminopeptidasica LAP e fosfatasica AP e correlazioni r osservate negli strati epi meso e batipelagico Mean values s d of heterotrophic bacteria MA and luminous SWC bacteria and rates of leucine aminopeptidase LAP and alkaline phosphatase AP and relationships r found at epi meso and bathypelagic layers MA r SWC e esi i a EI nmol I h cpr 3474331 asi O osim 1 89 41 19 SWC 0 74 EPI MESO 312 746 6 7 3 51 4 69 1 34 1 35 BATI 463 803 AP 0 40 3 4 3 49 3 38 NO 0
499. tion Cartilaginous fish cephalopods and crustaceans displayed an increasing trend both in biomass and number whereas bony fish exhibited an oscillating pattern The behavior of catch rates of the examined taxonomic groups seems in line with the reduction of fishing effort in the GSA 16 occurred in the last years Key words abundance time series trends demersal resources South of Sicily Introduction Trend throughout time of surveys catch rates is an important source of fishery independent information on dynamics of exploited resources In the present study survey abundance time series of bony fish cartilaginous fish cephalopods and crustaceans in the South of Sicily GSA 16 were modeled to assess trends across the last 20 years and provide short time predictions Materials and methods We analyzed 20 years 1994 2013 of MEDITS survey Bertrand et al 2000 2002 indices of density n km and biomass kg km for the main taxonomic groups of demersal species bony fish cartilaginous fish cephalopods and crustaceans in the South of Sicily GSA 16 To describe the temporal pattern a polynomial model was estimated using the ordinary squares method OLS Because the analyzed time series did not show a cyclical component that is having cycles that are repeated over time any further non linear fluctuation was attributed to the trend component and estimated by polynomials Model selection was performed on the grounds of both adjusted
500. tions on S coeruleoalba samples Tab 1 Primers and PCR conditions using for genetic molecular analysis Primer e condizioni di PCR utilizzate per le analisi genetico molecolari MICROSATELLITE ANALYSIS Primer name Primer sequence 5 to3 Repeat sequences Ta C Range bp Ttr 63 F R Hex CAG CTT ACA GCC AAA TGA GAG CA u 60 83 151 GTT TCT CCA TGG CTG AGT CAT CA Ttr 04 F R 6 Fam CTG ACC AGG CAC TTT CCA C CA s 62 99 123 GTT TGT TTC CCA GGA TTT TAG TGC Ttr 19 F R 6 Fam TGG GTG GAC CTC ATC AAA TC CA 60 171 213 GTT TAA GGG CTG TAA GAGG D 18 F R 6 Fam CCC AAA ACC GAC AGA CAG AC CA 3 TA CA gt 1 56 90 GAT CTG GGG ATG CAG G D 22 F R Hex GGA AAT GCT CTG AGA AGG TC CA 3 TA CA 21 56 135 CCA GAG CAC CTA TGT GGA C EV37Mn 6 Fam AGC TTG ATT TGG AAG TCA TGA AC y 63 178 224 TAG TAG TGC CGT GAT AAA GTGC SEX DETERMINATION Primer name Primer sequence 5 to3 Primer localization Ta C Range bp ZFY X0582F ATA GGT CTG CAG ACT CTT CTA ZFX ZFY genes 56 382 226 ZFY00767R TTT GTG TGA ACT GAA ATT ACA ZFY gene 56 382 ZFX0923R AGA ATA TGG CGA CTT AGA ACG ZFX gene 56 226 SRYF R GAG AAT CCC CAA ATG CAA AAC TCA GA SRY gene 60 1000 GGA ATT GAG TTG CAA ATG GCA GCA A MITOCHONDRIAL ANALYSIS Primer name Primer sequence 5 to3 Primer localization Ta C Range bp FicytB TAA CAG TCA TGG CCA CTG CATT cytB gene 60 250 300 F2cytB CCA ACC TCT TAT CAG CAA TC cytB gene 60 250 300 RicytB AGG GTG GAA TGG AAT TAT GTC T cytB g
501. tivamente in funzione della temperatura p 0 0254 ma non della pCO p 0 6557 Infine la biomassa algale non mostra alcuna differenza significativa sia per il fattore pCO p 0 1214 sia per il fattore temperatura p 0 1764 In tutti i confronti l interazione pCO xT non mostra differenze p gt 0 05 Conclusioni Dai risultati ottenuti si evince che la temperatura determina cambiamenti nella copertura percentuale totale dei primi stadi di reclutamento della comunit bentonica intertidale mentre ricchezza in OTU e biomassa non sembrano variare tra i fattori considerati In generale dopo quattro mesi l intertidale sembra essere dominato da cianobatteri a patina e filamentosi in condizioni di alta pCO e da alghe rosse filamentose nelle condizioni di controllo Indipendentemente dai valori di pCO sono state osservate differenze significative nella C dei gruppi algali tra i differenti trattamenti di temperatura bianco vs nero con un significativo incremento sulle superfici di reclutamento bianche rispetto alle nere in accordo con i risultati ottenuti in esperimenti di mesocosmo da Russell et al 2013 Questo studio fornisce un primo contributo per definire il ruolo che i principali driver di cambiamento climatico in mare potranno avere nella successione di comunit intertidali pur non evidenziandone un effetto interattivo In uno scenario di cambiamento globale temperatura pH e concentrazione di CO disciolta sono importanti fattori da c
502. tive IZSSI Palermo Risultati Le sequenze nucleotidiche del Citocromo b ottenute dai 23 individui sono state confrontate con quelle presenti nel database GenBank e sono risultate tutte identiche ed attribuibili alla specie Caretta caretta Venti esemplari analizzati mostravano tutti i caratteri morfologici tipici di Caretta caretta mentre tre esemplari presentavano una lunghezza del carapace rispettivamente di 58 57 e 33 cm ed una certa variabilit dei caratteri standard tipici della specie In particolare i tre esemplari mostravano una variazione del numero di piastre costali vertebrali prefrontali e inframarginali Il primo esemplare 58 cm si presentava con una combinazione di 6 5 piastre costali 4 3 inframarginali 6 vertebrali e 5 prefrontali il secondo 57 cm con 4 4 piastre costali 3 3 inframarginali 5 vertebrali e 4 prefrontali il terzo 33 cm con 4 4 piastre costali 3 4 inframarginali 6 vertebrali e 5 prefrontali Questi dati si discostano da quanto riportato da Marquez 1990 rendendo ad una prima analisi non facile l attribuzione dei tre individui alla specie C caretta Conclusioni I nostri dati hanno mostrato che la variabilit dei caratteri presi in esame talvolta non favorisce l immediata identificazione della specie e che occorrerebbe ove possibile utilizzare anche analisi genetiche La variabilit numerica di queste piastre era stata gi osservata da Capocaccia 1966 in reperti museali anche se dall in
503. to LEVUCELL SB20 ceppo CNCM I 1079 fornito da Lallemand sas Blagnac France pari a 0 G1 100 G2 e 300 G3 mg kg di S boulardii Dopo 21 giorni di alimentazione le orate sono state infettate con un ceppo patogeno di V anguillarum O1 Il ceppo stato seminato su Marine Agar per 24h a 24 C ed stata calcolata la curva di crescita batterica La concentrazione di Vibrio scelta per l infezione sperimentale era pari a 3 10 cell ml I pesci sono stati anestetizzati con MS222 0 1 g L e 0 1 ml di sospensione batterica stata inoculata per via intraperitoneale ad un campione del gruppo controllo G1 n 12 e dei due gruppi sperimentali G2 n 12 e G3 n 12 Dopo 7 giorni di infezione le orate sono state sacrificate e i campioni prelevati per i saggi batteriologici e istologici Gli intestini porzioni prossimale media e distale sono stati fissati in Bouin per 48h inclusi in 39 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 paraffina tagliati in sezioni di 5 um colorati con Ematossilina Eosina ed osservati al microscopio ottico I campioni di sangue renale prossimale sono stati seminati in Marine Broth ed incubati a 24 C per 24h Successivamente delle aliquote sono state seminate su TCBS e su Marine Agar ed incubate a 24 C per 24h Le colonie cresciute sono state isolate in coltura pura e sono state identificate mediante API 20 E Risultati Il patogeno inoculato ad una c
504. to ad un rapporto casuale o ad una relazione simbiotica Bibliografia ABECASIS D ABECASIS A R 2015 First report of cleaning behavior in white sea bream Diplodus sargus Mar Fresh Behav Phys 48 1 71 75 CHENEY K L COTE I M 2003 Do ectoparasites determine cleaner fish abundance Evidence on two spatial scales Mar Ecol Prog Ser 263 189 196 ISMAIL N OHTSUKA S VENMATHI MARAN B A TASUMI S ZALEHA K YAMASHITA H 2013 Complete life cycle of a pennellid Peniculus minuticaudae Shiino 1956 Copepoda Siphonostomatoida infecting cultured threadsail filefish Stephanolepis cirrhifer Parasite 20 42 MARIANI S 2001 Cleaning behaviour in Diplodus spp chance o choice A hint for future investigations J Mar Biol Ass UK 81 715 716 ROSECCHI E 1987 L alimentation de Diplodus annularis Diplodus sargus Diplodus vulgaris et Sparus aurata Pisces Sparidae dans le Golfe du Lion et les lagunes littorals Rev Trav Peches marit 49 3 4 125 141 SCHOFIELD G KATSELIDIS K A DIMOPOULOS P PANTIS J D HAYS G C 2006 Behaviour analysis of the loggerhead sea turtle Caretta caretta from direct in water observation Endang Species Res 2 71 79 WEITZMANN B MERCADER L 2012 First report of cleaning activity of Lepadogaster candolii Gobiesocidae in the Mediterranean Sea Cybium 36 487 488 165 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12
505. to della marineria di Jesolo VE che conta 56 imbarcazioni di cui 39 dedite alla piccola pesca costiera con prima licenza per reti da posta dati Fleet Register UE Al fine di studiare le strategie di pesca e le catture nell anno 2014 gennaio dicembre stata realizzata una raccolta dati attraverso osservazioni a bordo ricavando informazioni sulla composizione quali quantitativa del pescato per tipologia di attrezzo Ad ognuna delle specie pescate poi stata associata la classe di affinit termica secondo quanto proposto in Pranovi et al 2013 Ci ha permesso l identificazione di tre gruppi principali ad affinit fredda distribuzione media oltre il 45 N temperata distribuzione media compresa tra 30 e 45 N e calda distribuzione media inferiore a 30 N nonch tre gruppi intermedi temperato fredde temperato calde e ubiquitarie Risultati Durante il periodo di studio stato possibile osservare 4 tecniche di pesca con attrezzi fissi nasse da seppie nassini da canoce destinati alla cattura della specie Squilla mantis rete ad imbrocco e tremaglio Nelle nasse da seppie la specie target Sepia officinalis rappresenta il 99 63 del pescato Nei nassini per canoce la specie target S mantis rappresenta 188 della biomassa totale Il pescato totale delle reti ad imbrocco invece composto da 78 specie di cui 7 target Solea solea S mantis Chelidonichthys lucerna Lithognathus mormyrus Sparus aurata Umbrina
506. to the climatic affinity of each species Tipologia specie specie specie specie specie specie di attrezzo fredde temperato fredde temperate temperato calde calde ubiquitarie Imbrocco 56 01 0 65 30 66 0 26 2 56 9 84 Tremaglio 80 76 1 20 8 94 1 02 3 01 5 07 In relazione alle classi di affinit termica delle singole specie il pescato di tutte e quattro le tipologie di attrezzo analizzate risulta composto per la maggior parte da specie fredde e temperate che sono quelle maggiormente esposte agli effetti di variazione della temperatura Conclusioni In relazione alla composizione in termini di gruppi di affinit climatiche i risultati sembrano confermare da un lato l ipotesi che il nord Adriatico rappresenti una sorta di refugium per le specie fredde dall altro la vulnerabilit della piccola pesca costiera ai possibili effetti legati al cambiamento della struttura della comunit nectonica a seguito delle variazioni climatiche Ovviamente tali possibili effetti negativi recentemente descritti anche per la pesca in laguna di Venezia Pranovi et al 2013 e in mare oltre le 3 mn Caccin et al 2014 non tengono conto della capacit di adattamento dei pescatori alle mutate condizioni come ad esempio l arrivo di specie termofile di interesse commerciale Bibliografia BEN RAIS LASRAM F GUILHAUMON F ALBOUY C SOMOT S THUILLER W MOUILLOT D 2010 The Mediterranean Sea as a
507. tono numerose definizioni dei servizi ambientali che mettono in luce i loro diversi aspetti A livello internazionale consolidato l accordo sulla definizione del Millenium Ecosystem Assessment secondo il quale i servizi ecosistemici sono i benefici multipli forniti dagli ecosistemi al genere umano MEA 2005 2 Il valore economico di beni e servizi ambientali I servizi ambientali sono connaturati al funzionamento del sistema della vita sulla terra e contribuiscono sia direttamente che indirettamente al prodotto economico mondiale Secondo una valutazione per difetto date le numerose incertezze per la valutazione di molti di questi servizi stato stimato un loro valore approssimativo medio globale di 33 trilioni di US annui a fronte di un prodotto nazionale lordo globale di circa 18 trilioni di US Costanza et al 1997 Studi pi recenti hanno stimato un valore 15 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 globale dei servizi ecosistemici ancora maggiore de Groot et al 2012 Costanza et al 2014 La natura fornisce a ciascun individuo numerosi beni e servizi ambientali che costituiscono parte integrante del suo benessere Molti di questi beni e servizi sono dei beni pubblici i cosiddetti Commons per i quali non vi rivalita ed esclusivita nel consumo Ulgiati et al 2011 Questo implica che non esiste per loro nemmeno un prezzo o un mercato e quindi visi
508. trait OE SICILY it aan ili 84 MUNARI C BOCCHI N BORAZIO M MISTRI M Epifauna associata a Ulva rigida in una laguna del Delta del Po n 86 MUNARI C BOCCHI N MISTRI M Epifauna associata a Gracilaria vermiculophylla in una laguna del Delta del Po 88 PADIGLIA A CADEDDU B BERTOLINO M DEMURTAS D MANCONI R PRONZATO R Spugne di praterie di Posidonia oceanica in due aree marine protette Mar di Sardegna n 90 RUBINO F CECERE E PETROCELLI A CASALE A CASALE V PASSARELLI S Recent observations of Pinna nobilis Mollusca Bivalvia in the Mar Piccolo basin Gulf of Taranto Mediterranean S alzano ii dai I ia see 92 SCHIMMENTI E LO BRUTTO S BADALAMENTI F GIANGRANDE A MIKAC B MUSCO L DNA barcoding to solve the tricky case of co occurring Sabellaria Annelida species in the Mediterranean Sea iii 94 UNGARO N PASTORELLI A M Percnon gibbesi H Milne Edwards 1853 Crustacea Graspidae una ulteriore segnalazione per IOZAE LS E 10100 PRPPCRTRRICA PETRI VOSEOIPO TSO a aeaa EEEE Ea EO AEE EE Eeesti 96 VALVASSORI G MASSA GALLUCCI A GAMBI M C Reappraisal of Platynereis massiliensis Moquin Tandon Annelida Nereididae a neglected sibling species of Platynereis dumerilii Audouin amp Milne Edwards nine dla iaia 98 ZENONE A BADALAMENTI F CARTA G DI STEFANO G FRONGIA C GIACALONE V M MUNTONI M MURENU
509. trato per processi chemiosintetici Martin et al 2008 Pi di 200 hydrothermal vents sono stati individuati dalla fine degli anni 70 Tra i pi importanti fattori che influenzano la struttura delle comunit che si instaurano intorno alle risorgenze hanno rilevanza le dimensioni della sorgente la profondit la temperatura dell acqua che fuoriesce la diversit e stabilit dell habitat le fasi della successione ecologica Diversamente dalle sorgenti idrotermali profonde in quelle pi superficiali le biocenosi associate sono generalmente composte da specie non esclusive di questi ambienti Tarasov et al 2005 Nel Nord Sulawesi una delle principali aree geotermiche indonesiane le sorgenti idrotermali sono diffuse lungo le coste in acque poco profonde Oggetto di questo studio sono le comunit a spugne insediate attorno a due sorgenti situate sulla costa dell Isola di Bangka presso il sito d immersione denominato Paradise L estremit settentrionale del Nord Sulawesi situata al centro del cosiddetto triangolo dei coralli un area considerata uno dei principali hot spot di biodiversit marina Materiali e metodi Le sorgenti studiate si trovano su un fondo sabbioso a 20 e 25 m di profondit Per ciascun sito sono stati effettuati in immersione 4 transetti fotografici lunghi 20 m centrati sulla sorgente calda Con l ausilio di una bindella di riferimento sono stati effettuati rilievi fotografici su quadrati di
510. trattamento di depurazione dei molluschi bivalvi Atti della Societa Italiana delle Scienze Veterinarie Grado 23 25 settembre 2004 58 196 198 Il lavoro parte di un progetto finanziato dal DIMEVET Universita di Bologna progetti competitivi ricercatori 48 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 D PECORINO L FANCIULLI M CHIANTORE Dipartimento di Scienze della Terra dell Ambiente e della Vita DISTAV Universita di Genova Corso Europa 26 16132 Genova Italia danilo pecorino edu unige it OYSTER FARMING IN THE LIGURIAN SEA AN INTEGRATED MULTITROPHIC AQUACULTURE IMTA APPROACH ACQUACOLTURA DI OSTRICHE NEL MAR LIGURE UN APPROCCIO CON ACQUACOLTURA MULTITROFICA INTEGRATA IMTA Abstract Production of commercially profitable oysters in the Ligurian Sea is challenging due to the oligotrophic conditions here found Within the framework of the project FP7 IDREEM we tested the hypothesis that integrated multitrophic aquaculture techniques could help in overcome this limit and lead to the production of commercially attractive oysters Results show that within one year of deployment oysters have reached commercial size and medium class 3 weight making them suitable for commercialization Key words oysters IMTA aquaculture Ostrea edulis Crassostrea gigas Introduction Oyster farming is a commercial activity for which medium to high concentrations
511. tribution of 652 marine organisms in the Italian seas Based on continuously updated scientific information Pinneggiando is available at Play Store since January 2014 now reaching more than 1200 downloads with a feedback of 4 65 5 Thanks to this new tool knowledge on the geographical distribution of many organisms has been expanded by a citizen science approach Given the rapid success of the initiative the app will be improved by connecting it to an online database acting as a shared repository of information for an unceasing census of marine flora and fauna Key words application citizen science science outreach marine species Italian seas Introduzione Le App abbreviazione dell inglese application applicazione sono software ormai entrati a far parte della quotidianit App scaricabili su tutti i dispositivi portatili sono utilizzate in qualsiasi campo dalla medicina al tempo libero interessando anche il mondo della biologia marina Reef Check Med MeteoMeduse e AppliFish sono alcuni esempi di app legate al mondo marino ognuna con obiettivi diversi dal monitoraggio e raccolta dati alla divulgazione scientifica favorendo l interazione tra mondo scientifico e cittadini comuni nell ottica della citizen science La nostra idea nasce dall esigenza di far conoscere a tutti in modo semplice e divertente gli organismi che popolano i nostri mari e quindi la biodiversit del Mar Mediterraneo meno conosciuta dalla m
512. triqueter Linnaeus 1758 e Vermiliopsis infundibulum Philippi 1844 Mentre alcune specie sono equamente distribuite tra le diverse stazioni come H pseudouncinatus P militaris S concharum e S vermicularis altre come S polytrema e S triqueter sono maggiormente abbondanti a minor profondit mentre S crenata Serpula lobiancoi e V infundibulum sono pi frequenti in profondit Tutte le specie analizzate concorrono all accrescimento della biocostruzione ricoprendo il ruolo di constructors sensu Fagerstrom 1991 seppur secondariamente rispetto a taxa come briozoi e corallinacee come gi evidenziato da Rosso e Sanfilippo 2009 per le biocostruzioni a coralli profondi Tuttavia bisogna distinguere tra specie con tubi piccoli e specie che presentano i tubi di taglia maggiore quali S vermicularis S lobiancoi Protula sp e V infundibulum queste ultime offrono un apporto carbonatico tutt altro che secondario al frame work Conclusioni Lo studio dei Serpulidae associati alle biocostruzioni coralligene mediterranee contribuisce innanzitutto alla conoscenza della biodiversit di questi popolamenti Infatti nonostante le indagini sul coralligeno siano aumentate in questi ultimi dieci anni una delle principali lacune proprio la lista delle specie associate a tale habitat Ballesteros 2006 Agnesi et al 2009 Emerge inoltre l importanza che questi vermi tubicoli calcarei hanno in termini numerici e l apporto che
513. ts to obtain the byssus filaments Cerruti 1939 The main objective of this study was to make a first census of the population density after the many sightings testifying the return of this species to Mar Piccolo Materials and methods The survey was conducted in December 2014 by underwater visual observations along strip transects Four sites were chosen in Mar Piccolo on the basis of historical data on the presence of P nobilis one supplementary site was fixed in Mar Grande basin near mussel farm plants At each site 3 transects 20 m long and 4 m wide were carried out The presence of both alive and dead specimens was detected Results Pinna nobilis individuals were observed at all the sampling sites even if with very variable densities A total of 74 alive and 21 dead specimens were counted with a mean density of 6 2 live ind ha and a maximum of 20 4 ind ha at one of the stations located in the western sub basin of Mar Piccolo At the Mar Grande site a density of 3 8 ind ha was registered Normally the number of dead specimens was very low 92 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 except along one transect conducted at the most abundant station where as many as 19 specimens were dead vs 33 alive Conclusions Pinna nobilis has been for many decades an important resource in Mar Piccolo of Taranto heavily exploited by local fishermen During the last decades this s
514. tto che in Mediterraneo vengono usati esclusivamente FADs ancorati La registrazione di un elevato numero di segnali durante le ore notturne ha fornito una indicazione ecologica dell uso dei FADs da parte delle lampughe aprendo un nuovo scenario sull uso di dispositivi per la comprensione del fenomeno dell attrazione di specie ittiche esercitata dai FADs Dempster e Taquet 2004 Il settaggio dell attrezzatura in tonnellate costituisce un importante limite visto che le biomasse di lampughe associate ai FADs in Mediterraneo sono mediamente nell ordine dei quintali Un corretto settaggio dell attrezzatura da parte della casa produttrice potr consentire una maggiore e pi efficace applicabilit sia da parte degli operatori della pesca che per scopi scientifici Bibliografia ANDALORO F CAMPO D CASTRIOTA L SINOPOLI M 2007 Annual trend of fish assemblages associated with FADs in the southern Tyrrhenian Sea J Appl Ichthyol 23 258 263 DEMPSTER T TAQUET M 2004 Fish aggregation device FAD research gaps in current knowledge and future directions for ecological studies Rev Fish Biol Fisher 14 21 42 LOPEZA J MORENOA G SANCRISTOBALA I MURUA J 2014 Evolution and current state of the technology of echo sounder buoys used by Spanish tropical tuna purse seiners in the Atlantic Indian and Pacific Oceans Fish Res 155 127 137 MORALES NIN B CANNIZZARO L MASSUTI E POTOSCHI A ANDALORO F 2000
515. tural one Their directional choices were recorded The statistical analysis of the directions was carried out using circular statistics methods Batschelet 1981 Results In all these experiments the average directional choices were statistically consistent with the expected ones considering the chronometric mechanism of sun compass as regards both the intact and the antennaeless individuals without either the second or all the antennae The clock shifted animals showed the expected 90 deflection in their orientation compared with the directions of sandhoppers kept in phase with the natural photoperiod Similar results were achieved in the releases of both intact and antennaeless individuals Finally the experiments carried out using animals without the right antennae also have not pointed out any difference in the directions chosen between intact and operated Conclusions Our results demonstrated that antennae do not have a primary role in the solar orientation of Talitrus saltator This is in contrast with their major role in the sun compass orientation mechanism revealed in the monarch butterfly In fact the removal of the antennae does not influence the capacity of solar orientation in this species the directional choices of both intact and antennaeless individuals are not statistically different and are consistent with the directions expected for the correct use of the sun as a cue References BATSCHELET E 1981 Circular statistic
516. u Crustacea Amphipoda UGOLINI A NISTRI A SCHINTU M ABDELRHMAN K F A MENGONI A Nuovi dati sulla distribuzione di Talorchestia ugolinii Bellan Santini e Ruffo 1991 e Sardorchestia pelecaniformis Bellan Sanin e R uffo 1985 aa aaa a a E oes VAZZANA M CELI M RUSSO D PARRINELLO N ARIZZA V Cytotoxic activity of Holothuria tubulosa Echinodermata coelomocytes ia e aaie e e ie e ae eee ei Workshop Progressi nella ricerca sui cetacei mediterranei Comunicazioni ARCANGELI A AZZOLIN M CAMPANA I CASTELLI A GIACOMA C LUPERINI C MARINI L PARABOSCHI M PELLEGRINO G RUVOLO A TRINGALI M VETRUGNO A CROSTI R Cetaceans at risk by plastic debris first results from the Fixed Line Transect Mediterranean monitoring network FIORI C ALESSI J MANDICH A PAOLI C VASSALLO P Indagine sul potere attrattivo delle montagne sottomarine tirreniche su Stenella coer leoalba siideri oe se3 oes aenea e uh hn ARS TERE MARINI C FOSSA F BELLINGERI M GNONE G DHERMAIN F NUTI S AIROLDI S PORTUNATO N DAVID L DI MEGLIO N BONELLI P TRUCCHI R LARAN S LABACH H SANTONI M C VASSALLO P Modello predittivo di distribuzione del tursiope Tursiops truncatus Montagu 1821 nel Santuario Pelagos attraverso la tecnica di Random Forest i ORSI RELINI L RELINI G Balaenoptera physalus L 1758 nel Santuario Pelagos trends di popolazio
517. u Biol Mar Mediterr 20 0 in July 2012 and July 2013 Acartia negligens Subeucalanus monacus Scolecithricella dentata Oncaea curta Acartia sp Eucalanus elongatus Temora stylifera Oncaea media Calanus helgolandicus Lucicutia flavicornis Corycaeus brehmi Oncaea scottodicarloi Mesocalanus tenuicornis Lucicutia sp Corycaeus clausi Oncaea venusta Nannocalanus minor Mecynocera clausi Corycaeus flaccus Oncaea sp Neocalanus gracilis Mecynocera tenuis Corycaeus giesbrechti Sapphirina angusta Candacia armata Pleuromamma abdominalis Corycaeus limbatus Sapphirina intestinata Candacia giesbrechti Pleuromamma gracilis Corycaeus ovalis Sapphirina metallina Candacia elongata Calocalanus contractus Corycaeus typicus Sapphirina nigromaculata Candacia longimana Calocalanus plumulosus Corycaeus sp Sapphirina ovatolanceolata Centropages ponticus Calocalanus neptunus Farranula rostrata Vettoria longifurca Centropages typicus Calocalanus tenuis Oithona decipiens Microsetella norvegica Centropages violaceus Calocalanus sp Oithona nana Microsetella rosea Clausocalanus furcatus Paracalanus denudatus Oithona plumifera Distioculus minor Clausocalanus lividus Paracalanus nanus Oithona setigera Clytemnestra scutellata Clausocalanus pergens Paracalanus parvus Oithona similis Euterpina acutifrons Clausocalanus
518. ually aragonite located in the inner ear of bony fish and laid down on an organic matrix Mineralogy microstructures and chemical composition of the calcium carbonate of otoliths have been thoroughly investigated but little is known about the organic molecules Dauphin and Dufour 2003 This organic matrix is composed of proteins glycosaminoglycans and lipids Borelli et al 2001 The organic matrix plays a key role in controlling the formation of the different layers and shape of otoliths Gauldie 1999 The aim of this study is to provide more insight into the biochemical properties of otolith soluble organic matrix of some demersal bony fishes from Adriatic Sea In addition we have identified a suitable technique for extraction of protein matter Materials and methods A total of 295 otoliths sagittae were collected from 2009 to 2012 by trawling in the northern and central Adriatic Sea In particular 150 otoliths from Lepidotrigla cavillone Lacep de 1801 50 from Lepidotrigla dieuzeidei Blanc and Hureau 1973 45 from Trigloporus lastoviza Bonnaterre 1788 and 50 from Helicolenus dactylopterus Delaroche 1809 were used In a first investigation right and left otoliths were previously cleaned with 3 H202 and then in ultrasonic bath with MilliQ The samples were ground with an agate mortar into fine powders then mixed and decalcified with EDTA 100 mM according to Motta et al 2009 At a later stage we followed the protocol desc
519. uantification of O cf ovata in environmental samples seven different site specific LSU STD curves were used They showed a PCR efficiency of 98 100 a linear 175 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 regression on 5 orders of magnitude R 0 97 0 99 and a quantification limit of 0 0008 A total of 34 environmental samples were analysed and O cf ovata cells were quantified O cf ovata cells were detected in all macroalgal samples analysed with the exception of samples n 1 and 2 collected at Llavaneres Spain in June 2011 A greater abundance of O cf ovata was found in sample n 14 from Genova 1 18x10 6 33x10 cells g fw minimum abundance was found in sample n 18 from Taormina 772441 cells g fw by qPCR The abundance of O cf ovata recorded in seawater samples was generally lower than cell concentrations on macroalgae samples with the exception of the highest value observed in sample n 32 from Bari 1 90x10 8 45x10 cells I No cells were found in sample n 20 from Llavaneres Furthermore the PCR reaction of sample n 23 from Ancona in which no Ostreopsis cells were found by microscopy resulted in a positive reaction containing 1106 426 cells I Moreover there was a significant positive correlation between cell densities on macroalgal samples and in water column n 16 Spearman r 0 8386 p lt 0 0001 Furthermore a significant correlation was found between O
520. udi Byers et al 2012 suggeriscono che l alga abbia un ruolo facilitativo sulla epifauna laddove essa presente La macrofauna associata a G vermiculophylla non mai stata studiata nelle lagune adriatiche stato quindi eseguito uno studio riguardante la composizione abbondanza e diversit delle comunit macrobentoniche epifitiche associate ai talli di G vermiculophylla in una laguna nord adriatica Laguna di Marinetta Delta del Po Materiali e metodi I talli algali e la macrofauna associata sono stati campionati con frequenza pressappoco stagionale per un periodo di 5 anni 2006 2010 presso un sito 45 02 47 78 N 12 22 09 73 E nella Laguna di Marinetta Il sito presenta una profondit media di circa 1 m ed una salinit compresa nel periodo di studio tra 29 e 11 Il campionamento stato effettuato secondo McIntyre et al 1984 in 3 repliche per ciascuna data di campionamento In laboratorio gli organismi raccolti sono stati identificati al livello della specie ed assegnati ad una categoria trofica sospensivori detritivori predatori ed erbivori dei talli algali stato calcolato il peso secco in stufa 48 h a 60 C Risultati stata riscontrata Fig la una relazione significativa P lt 0 05 tra l abbondanza della fauna epifitica e la biomassa macroalgale espressa come g peso secco PS La Fig 1b mostra la composizione media della macrofauna epifitica durante il periodo di studio Associato ai talli di G v
521. uella durante la quale si sono osservati i massimi valori di temperatura dell acqua 31 C e di concentrazione di O cf ovata planctonica 8 8x10 cell L Non si potuto operare un confronto con le altre stazioni poich per tale periodo i dati in nostro possesso sono relativi alla sola stazione di Las Tronas Dalla comparazione dei dati relativi agli anni successivi emerso comunque che quest ultimo sito stato sempre caratterizzato da concentrazioni e temperature medie dell acqua inferiori rispetto alle altre due localit A conferma di ci tra il 2012 e il 2014 il superamento del limite soglia di 1 0x10 cell L stato rilevato 34 volte delle quali solo il 17 a Las Tronas il 53 nella stazione Acque dolci ed il restante 30 a La Marina Operando infine un confronto con quanto riportato in letteratura in merito ai periodi di fioritura di O cf ovata nei mari italiani Bertolotto et al 2014 si osserva che i picchi stagionali nelle coste sarde rilevati a partire dalla prima settimana di luglio sono risultati cronologicamente pi in linea con gli andamenti registrati nei mari Ligure Tirreno e Ionio fioriture tra fine luglio e agosto rispetto a quanto osservato per il Mar Adriatico massime concentrazioni tra agosto e ottobre Bibliografia BERTOLOTTO R BORRELLO P GIROLAMO I ERCOLESSI M MAGALETTI E MILANDRI A PENNA A POMPEI M SCANU G SPADA E TOTTI C UNGARO N ZINGONE A
522. ueo in acque basse mirato alla verifica della distribuzione quali quantitativa delle comunit del macrofitobenthos L attivit prevedeva l osservazione della fascia mesolitorale e della parte pi superficiale di quella infralitorale sino ad una profondit massima di 1 m percorrendo settori di 50 m paralleli alla linea di costa Risultati Nel corso dell attivit di osservazione subacquea stato riconosciuto un esemplare di Percnon gibbesi alla profondit tra 0 8 e 1 m e alle coordinate 41 06 39 6 N 16 955 47 2 E l esemplare della specie facilmente individuabile grazie alla caratteristica morfologia e alla particolare colorazione era in una fessura del substrato roccioso questo ultimo prevalentemente colonizzato dalle macroalghe Corallina elongata e Dictyota dichotoma Non stato possibile catturare l esemplare nota la particolare abilit di questo decapode a nascondersi e a sfuggire alla cattura ma disponibile una videoripresa L analisi delle immagini permette mediante il confronto con altri elementi ripresi sul fondale di stimare in maniera approssimativa le dimensioni dell individuo rendendole attribuibili a un esemplare sub adulto o adulto Conclusioni La nuova segnalazione del crostaceo decapode Percnon gibbesi di fatto innalzerebbe il limite settentrionale della sua distribuzione in Adriatico che aumenterebbe di circa 2 grado in latitudine Nord e sarebbe la prima per il versante italiano sopra
523. ugno 2015 G CARUSO M AZZARO P LAGANA A C RAPPAZZO M GRAZIANO M PAPALE A CONTE A Lo Grupice Istituto per l Ambiente Marino Costiero IAMC Consiglio Nazionale delle Ricerche Spianata S Raineri 86 98122 Messina Italia gabriella caruso iamc cnr it SBIMOF Universit di Messina Via Consolare Valeria 98121 Messina Italia 3Dip Scienze Biologiche ed Ambientali Univ di Messina V le F Stagno d Alcontr s 31 98166 Messina Italia INDAGINE QUANTI E QUALITATIVA SULLA FLORA BATTERICA ETEROTROFA AEROBIA NELLA ZONA D ESTUARIO DEL FIUME PASVIK NORVEGIA ARTICA QUANTI AND QUALITATIVE STUDY OF THE AEROBIC HETEROTROPHIC BACTERIAL FLORA IN THE ESTUARINE AREA OF THE PASVIK RIVER ARCTIC NORWAY Abstract The distribution qualitative composition and the enzymatic profiles of the heterotrophic bacterial flora inhabiting the waters and sediments of the estuarine area of an Arctic river Pasvik river were studied during two seasonal periods May and July 2014 Densities were in the order of 1 07 107 CFU ml and 10 10 CF U g in waters and sediments respectively The microflora was composed mostly by Gram negative cocci characterized by diversified metabolic spectra Key words heterotrophic bacteria enzymes decomposition metabolism Arctic Introduzione I batteri eterotrofi presenti in ambienti acquatici risultano generalmente caratterizzati da un corredo enzimatico diversificato
524. umented to be due to fission fusion dynamics where intra population kin association acts as predominant in aggregating social groups However the fragmentation and habitats loss or the alterations in distribution and availability of resources could influence dolphins aggregation through the modification of their social interactions mostly in coastal areas where marine mammals could be exposed to high levels of anthropogenic threats and no conservation measures were locally enforced as unfortunately occurred in the investigated basin Materials and methods A boat based focal group method with instantaneous scan sampling of the predominant activity Neumann 2001 was applied monitoring the behaviour of S coeruleoalba during 254 sightings carried out in the Gulf of Taranto from 2009 to 2014 The group size of the striped dolphin recorded during 3 different time periods of the day 09 00 13 00 13 01 16 00 and 16 01 18 00 was associated to the predominant observed behaviour discriminating feeding resting socializing and travelling Shane 1990 The duration of the time periods was defined aiming to encompass intervals of the day during which a kind of homogeneity in local hydrographic conditions was observed A cluster analysis was carried out on the log transformed data using the Bray Curtis similarity measure and the complete linkage method software PRIMER 6 1 The percentage of occurrence for each behaviour was 231 Volume pre print 46
525. una di Marinetta Delta del Po La comunit stata quindi confrontata con quella presente sulla Rodophyta Gracilaria vermiculophylla Ohmi Papenfuss anch essa presente nella medesima laguna Materiali e metodi I talli algali e la macrofauna associata sono stati campionati con frequenza pressappoco stagionale per un periodo di 5 anni 2006 2010 presso un sito 45 03 19 11 N 12 22 46 45 E nella Laguna di Marinetta Delta del Po settentrionale Il sito presenta una profondit media di circa 0 4 m ed una salinit compresa nel periodo di studio tra 29 e 11 Il campionamento stato effettuato secondo McIntyre et al 1984 in 3 repliche per ciascuna data di campionamento In laboratorio gli organismi raccolti sono stati identificati al livello della specie ed assegnati ad una categoria trofica sospensivori detritivori predatori ed erbivori dei talli algali stato calcolato il peso secco in stufa 48 h a 60 C Risultati stata riscontrata Fig la una relazione significativa P lt 0 05 tra l abbondanza della fauna epifitica e la biomassa macroalgale espressa come g peso secco PS La Fig 1b mostra la composizione media della macrofauna epifitica durante il periodo di studio Associato ai talli di U rigida il taxon dagli Anfipodi risultato il pi numeroso 61 del totale seguito dai Bivalvi 21 2 e dai Policheti 9 Le specie dominanti sono risultate essere Gammarus aequicauda Microdeutopus gryllotalpa e A
526. uring dedicated visual surveys by the research groups Delfini Metropolitani Acquario di Genova and CE TU S between January 2006 and December 2014 The study area from Capo Arenzano to Piombino was divided into 4 sub areas A from Capo Arenzano to Punta Chiappa B from Punta Chiappa to Punta Mesco C from Punta Mesco to Punta Bianca D from Punta Bianca to Piombino Photographic data collected during the sightings were analyzed by photo identification technique Wiirsig and Jefferson 1990 Dolphins were shared in four categories Rossi et al in prep 1 cubs lt 180 cm 0 1 year 2 calves 180 lt 220 cm 1 3 years 3 juveniles gt 220 lt 270 cm 3 7 years 4 adults gt 270 cm 7 57 years Individuals associated with cubs were considered adult females The nursery area was determined on the basis of the encounter rate of these females sightings km The fertility rate was calculated as the average annual number of offsprings produced by the females during the observation period and the calving interval was determined as the time occurring between 2 consecutive births in the study period Results Overall 37477 45 km were covered and 366 sightings were recorded 344 within the 100 m isobath 19 between the 100 and the 200 m isobaths and 3 beyond the 228 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 200 m isobath A total of 286 adult dolphins were identified 41 of whic
527. urtle Caretta caretta occurred in the Mar Piccolo of Taranto In particular four individuals were easily recognizable by the features of their carapace They were adults which swam all around the basin Since this species is listed as endangered and protected under the directive Habitat 92 43 EEC their recent sighting in the Mar Piccolo a basin subject to anthropogenic pressure is of particular interest Key words endangered species Mar Piccolo Mediterranean Sea testudines Caretta caretta Introduction The loggerhead sea turtle Caretta caretta Linnaues 1758 is widely distributed in warm temperate and subtropical oceans It is present troughout the Mediterranean Sea where it is the most common sea turtle Caretta caretta is a migratory species capable to long distance movement between the western and the eastern Mediterranean basins according to a seasonal pattern In the autumn winter months turtles move from West to East in search of warmer waters and return to the western basin in spring where food is generally more abundant So temperature and food availability seem to act as major factors triggering the species movements Bentivegna 2002 Adults migrate towards nesting localities in the reproductive period that is between June and late September Nesting sites seem mainly limited to the eastern basin even tough other nesting localities were found along the southern Italian coasts especially the Ionian coasts of Calabria a
528. uzione degli impatti della pesca permetterebbe la progettazione di network di aree a diverso livello di protezione disegnate secondo il principio della supply side ecology utilizzando come modello gli schemi adottati nella realizzazione delle AMP nazionali Tuttavia tenendo conto che anche le stesse AMP sono state istituite non solo a scopo di conservazione ma anche di fruizione responsabile da parte dei pescatori e dei frequentatori sar necessario valutare in un ipotetico bilancio gestionale del territorio marittimo non solo gli effetti negativi delle diverse tipologie di pesca sulle comunit coralligene ma anche i ritorni in termini socio economici Gli strumenti gestionali estesi a tutela di tutte le formazioni coralligene presenti sul territorio nazionale devono in sintesi proporre linee guida per una pesca il pi possibile sostenibile in questi ambienti anche introducendo divieti a seconda dello sforzo di pesca nell area e delle attrezzature utilizzate pur con i limiti imposti dalle inevitabili pressanti richieste degli stakeholder locali Per quanto riguarda le comunit coralligene profonde soggette a importanti problematiche legate sia all esplorazione sia alla vigilanza gli sforzi gestionali finora attuati sono molto parziali Si contano infatti poche aree di notevole importanza biologica soggette a restrizioni alla pesca come per esempio le comunit a coralli bianchi di Santa Maria di Leuca ed i canyon del Golfo del Leone
529. validated daily level of tub gurnard and the importance of developing a standard protocol adapted for this species The main difficulties encountered where related to the location of the otolith core due to a high opacity probably linked to the big amount of protein matter in the early development as reported by Vallisneri et al 2014 References AHRENHOLZ D W MORRIS J A JR 2010 Larval duration of the lionfish Pterois volitans along the Bahamian Archipelago Environ Biol Fish 88 305 309 ARNERI E MORALES NIN B 2000 Aspects of the early life history of European hake from the central Adriatic J Fish Biol 56 1368 1380 DULCIC J GRUBI I L KATAVIC I SKAKELJA N 2001 Embryonic and larval development of the tub gurnard Trigla lucerna Pisces Triglidae J Mar Biol Ass UK 81 313 316 FAO 2007 FishStat Plus Universal software for fishery statistical time series Available from ftp ftp fao org FI stat windows fishplus fst_plus zip MCBRIDE R 2002 Spawning growth and overwintering size of searobins Triglidae Prionotus carolinus and P evolans Fish Bull 100 641 647 MORALES NIN B 2000 Review of the growth regulation processes of otolith daily increment formation Fish Res 46 53 67 PADOA E 1956 Uova larve e stadi giovanili di Teleostei Fauna e Flora del Golfo Napoli 38 627 640 VALLISNERI M MONTANINI S RANDI M R REGGI M TOMMASINI S FALINI G 2014 Pr
530. valutazione di possibili unit di popolazione rimangono insoddisfacenti Un punto di riferimento molto importante sono per il Mediterraneo Centrale le banche dati degli spiaggiamenti che per Italia e Francia sono ormai basate su serie di osservazioni di campo di circa 30 e pi di 40 anni consecutivi rispettivamente In questa sessione SIBM 2015 si ricorda Luigi Cagnolaro e la nascita del Centro Studi Cetacei CSC una struttura volontaria di 16 aree costiere ciascuna collegata a una istituzione scientifica locale possibilmente un museo per la conservazione dei materiali utili a futuri studi Podest et al 1997 A Genova il riferimento era il Museo di Storia Naturale G Doria di cui Roberto Poggi 2014 ha appena pubblicato la storia dell intera raccolta cetologica 16 specie Le banche dati spiaggiamenti di Francia Monaco e Italia includono il Santuario Pelagos cio un hot spot di spiaggiamenti di B physalus per due motivi le balenottere in queste acque trovano un ricco pascolo estivo Orsi Relini e Giordano 1992 e luoghi per partorire dalla fine estate all inverno Orsi Relini 2000 Orsi Relini e Garibaldi 2013 A partire dal 1991 impegnativi campionamenti di macroplancton e micronecton profondo tra Liguria e Corsica rivelarono che gli avvistamenti di balenottera sono correlati a concentrazioni del krill Meganyctiphanes norvegica variabili nel tempo e nello spazio Relini et al 1992 e seguenti c un effetto anche sugli sp
531. views were recorded and conflicts integration participation transparency and accountability equity justice and uncertainty issues related to the MPA were analyzed Results Primary fisheries vs conservation tourism vs conservation and secondary fisheries vs tourism inter sectoral conflicts were identified Trawl small scale and recreational fisheries conflict with conservation The conflict between small scale fishery and conservation appeared less intense due to the perception that the MPA generates alternative incomes tourist fishing excursions boat trips etc A conflict between recreational fishing and conservation stemmed from the interviews but no conflict between diving and conservation emerged Boat excursions and trips were considered among the most impacting tourist activities Most interviewees expressed strong generally negative considerations against the large charter boat trips which are thought to conflict with the coastal marine environment The intra sectoral conflict between artisanal and trawl fishers is generated by illegal coastal trawling and by competition for space Catches exceeding the legal limit and sale of the catch by recreational fishers generate a conflict between artisanal and recreational fishers Low 30 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 integration and high tensions characterize the relationship among and within activities based on
532. way K L eds Fishes in Estuaries Blackwell Science Oxford 54 123 FRANCO A ELLIOTT M FRANZOI P TORRICELLI P 2008 Life strategies of fishes in European estuaries the functional guild approach Mar Ecol Prog Ser 354 219 228 MANZO C BRUGNANO C FABBROCINI A ROSELLI L D ADAMO R 2011 Recruitment Dynamics of Young of the Year Marine Fish in the Coastal Lagoon of Lesina In Brugnoli E Cavarretta G Mazzola S Trincardi F Ravaioli M Santoleri R eds Marine Research at CNR Dipartimento Terra e Ambiente DTA Rome Italy 2099 2114 MARIANI S 2006 Life history and ecosystem driven variation in composition and residence pattern of seabream species Perciformes Sparidae in two Mediterranean lagoons Mar Pollut Bull 53 121 127 VILLANI P 1998 Osservazioni sulla rimonta del pesce novello da semina nella laguna di Lesina Foggia Italia Biol Mar Mediterr 5 3 546 564 116 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 L Musco F ANDALORO G D ANNA A GIANGRANDE S LO BRUTTO B MIKAC S MIRTO C PIPITONE D SCUDERI T VEGA FERNANDEZ F BADALAMENTI CNR Istituto per l Ambiente Marino Costiero IAMC Via G da Verrazzano 17 91014 Castellammare del Golfo TP Italia luigi musco cnr it ISPRA Palermo Italia 2DiSTeBA Universit del Salento Lecce Italia 3STeBiCeF Universit di Palermo Palermo Ita
533. wed producing maps of effort distribution of the main fishing gears though sometime not strictly related to the target species VMS data were also used to assess the spatial distribution of fishing effort and the identification of the fishing grounds In addition a new approach has been developed providing an estimate of the potential fishing areas of the vessels registered in the EU ports according to the Fleet Register of the European Union Identification of Stock Units Stock unit identification is the first step for defining shared stocks among countries and fisheries thus being a crucial basic knowledge of any spatial analysis of fisheries and effort deployed at spatial scale STOCKMED project allowed to identify stock units and their boundaries by an objective and replicable approach based on integration of multidimensional data set having space as unifying descriptor These results represent the first identification of stock structure of the main target species in the Mediterranean according to an holistic approach The project outcomes highlighted that the re organization of stock units in larger areas will imply the necessity of using developing or adapting stock assessment and forecast tools taking into account the different components of the pressure in terms of catches fishing mortality and effort by fleet and gear on stock units spatial scale This knowledge is essential for setting spatial based management measure besides the convent
534. y of Turin Italy Accademia del Leviatano Viale dell Astronomia 19 Rome Italy Necton Marine Research Society Via G Gozzano 47 Catania Italy 1 Acquario di Genova Ponte Spinola Genoa Italy Dept of Earth Science University of Pisa Pisa Italy BDELPHIS Aeolian Dolphin Center Via Duca delle Grazie 22 Santa Flavia PA Italy CIMA Research Foundation Via A Magliotto 2 Savona Italy CE TU S Lungo Canale Est Viareggio LU Italy Ketos Corso Italia 58 Catania Italy Dept Informatics Bioengineering Robotics and System Engineering DIBRIS University of Genoa Italy NEW INSIGHTS ON THE PRESENCE AND DISTRIBUTION OF THE SHORT BEAKED COMMON DOLPHIN DELPHINUS DELPHIS IN ITALIAN WATERS NUOVE CONOSCENZE SULLA PRESENZA E DISTRIBUZIONE DI DELFINO COMUNE DELPHINUS DELPHIS NEI MARI ITALIANI Abstract Pooled data on the endangered short beaked common dolphin Delphinus delphis collected in the central Mediterranean Sea over 2000 2014 period by different research groups in Italy were analysed A total of 266 encounters with 4675 common dolphins was attained The species was mainly recorded in the central and southern Tyrrhenian Sea around Ischia island and Strait of Messina in both pelagic and neritic habitats Mixed groups of common dolphin with other cetacean species were observed in 78 occasions Group size ranged from 1 to gt 100 individuals with differences between study areas The presence of calve
535. yphaena hippurus Linnaeus 1758 is a cosmopolitan migratory epipelagic fish inhabiting tropical and subtropical waters Palko et al 1982 In the Mediterranean Sea the dolphinfish is considered a seasonal target of artisanal and recreational fisheries Because of its large scale distribution the dolphinfish represents an interesting model for phylogeographical studies and research aimed at the identification of stock units There are few molecular data available for Mediterranean populations Diaz Jaimes et al 2010 This study presents mtDNA based population genetic analyses of C hippurus from western and central Mediterranean Sea and the Atlanto Indian region with the aim of assessing genetic diversity among localities at both regional and oceanic scale Materials and methods A total of 61 tissue samples of dolphinfish were collected at seven sites from western and central Mediterranean Sea and one location in the Indian Ocean Majorca Spain n 10 Ancona Italy n 5 Porticello Italy n 8 Capo Passero Italy n 4 Malta n 9 Tabulbah Tunisia n 10 Tripoli Libya n 10 and Pakistan n 5 The mitochondrial NADH dehydrogenase subunit 1 ND1 was amplified and sequenced according to Diaz Jaimes et al 2010 MtDNA sequences were compared to 17 sequences from Atlantic n 15 and Indo pacific Oceans n 2 downloaded from public repositories Haplotype h and nucleotide x diversities and Tajima s D neutrality test were computed
536. zarne la frequenza temporale Il risultato del test misura la sincronicit tra le 183 Volume pre print 46 Congresso della Societa Italiana di Biologia Marina Roma 10 12 giugno 2015 serie nel tempo e la loro tendenza a covariare Per testare l effetto drifting sulle dinamiche locali del popolamento zooplanctonico stato eseguito lo stesso test per misurare la cross correlazione fra serie relative a siti diversi con un time lag multiplo di sette giorni I confronti a coppie fra i siti emiliani e quelli marchigiani sono stati in totale sedici Le matrici di similarit per il test di Mantel sono state calcolate in base all indice di Morisita particolarmente adatto a confrontare liste di taxa indipendentemente dalla dimensione del campione Risultati Dal confronto incrociato tra siti emerge che in quasi tutti i casi si ottengono valori massimi della statistica di Mantel per un lag comunque diverso da zero Con una sola eccezione i valori mostrano un ritardo di 7 14 giorni nei siti delle Marche rispetto a quelli dell Emilia Romagna infatti se si analizza la distribuzione complessiva dei valori della statistica di Mantel chiaramente visibile un andamento a campana che ha il suo massimo in corrispondenza di ag diversi da zero Questo risultato indica che al di l delle differenze faunistiche sito specifiche la dinamica stagionale del popolamento zooplanctonico ritardata procedendo da nord verso sud nell area studiata Con
537. zione ghiandolare presenti in numerose specie di pesci ossei mesopelagici appartenenti a diverse famiglie Gonostomatidae Myctophidae Sternoptychidae Stomidae Whitehead et al 1984 che regolarmente spiaggiano lungo le coste dello Stretto di Messina La loro struttura e la loro forma variano a seconda della specie di appartenenza e possono rappresentare il 12 della superficie corporea e fino al 15 del volume Anctil 1972 I fotofori mostrano a livello macroscopico organizzazione strutturale simile ma morfologia diversa quando osservati all analisi microscopica Nel presente studio si forniscono i dati preliminari sulla struttura dei fotofori di Diaphus holti Taning 1918 occhio lucente minore al fine di chiarire alcuni aspetti della biologia di questa specie che riveste ruoli trofici sempre pi importanti nella rete alimentare soprattutto per i grandi pelagici Battaglia et al 2010 Viene individuato anche un fenomeno di convergenza adattativa di questi organi comparandone la struttura con i fotofori di altre specie mesopelagiche Cavallaro et al 2004 Materiali e metodi Gli esemplari oggetto di studio sono stati rinvenuti spiaggiati lungo il litorale antistante la localita Torre Faro ME a seguito di particolari condizioni meteomarine Immediatamente dopo la raccolta sono stati fissati in liquido di Bouin per 12 ore ed inclusi in paraffina Le sezioni ottenute dello spessore di 4 um sono state colorate con i metodi ematossilina

Preprint Roma

Contents

Download Pdf Manuals

Related Search

Related Contents