accura-expRACE KIT
Contents
1. 8 5X RTase Buffer 2 ul 10 mM dNTP 1 ul M MLV RTase 50 U ul 1 ul Total volume 10 ul 9 10 C 11 42C 1 12 2 3 13 Second Strand cDNA IV Second Strand cDNA Second Strand cDNA RNaseH coli DNA Polymerase coli DNA Ligase RNA DNA RNA Second Strand cDNA 1 2 RACE LU 7c Double Stranded ds cDNA T4 DNA Polymerase Ff ds cD2. accura expRACE KIT amp kjuro ikspr i s EI Plain Institute Revolutionary Tools for Continual Discovery Code No EPIOO1 Lot No 0001 Storage 20 C HX A First Strand cDNA B Second Strand cDNA C D RACE PCR ll Ill First Strand cDNA IV Second Strand cDNA V Rapid Amplification of cDNA Ends RACE A RACE PCR B DNA C mTfrc 5b 3 amp 0 3 RACE D RACE PCR RT PCR E RACE cDNA VI A ds cDNA B RACE C RACE D Genomic DNA VI RACE VIII Conclusion IX
3. 3 DNA 1 cDNA cDNA 3 gt Terminal Inverted Repeat 9 10 11 12 13 2 ds cDNA PCR 5 RACE 3 RACE 4 304 350 5 U S patent No 7 504 240 DNA DNA 1st cycle denature S annealing gene specific primer J synthesis 3 end synthesis by
4. 5 RACE cDNA DF Template switching 3 RACE 3 RACE PCR RT PCR 1 RT PCR LL Z M A Hindlll digestion 2 11 5 RACE PCR 2 5 1 RACE 6 cDNA 1 10 8 7 8 cDNA 1 2 1 5 4 9 10 11 cDNA 1 2 4 RACE Tm RACE PCR 1 2C RACE PCR 1 2C RACE PCR 1
5. 1g poly A RNA cDNA TE pH8 0 ds cDNA RACE poly A RNA 15A cDNA 10 B RACE RACE PCR RACE 1 ds cDNA 1 2 1 5 1 10 2 ds cDNA 2 3 3 RNACE RACE PCR RACE
6. 111 0033 1 12 2 TEL 03 6231 6605 Email contact elplain com 13 accura expRACE KIT amp kjuro ikspr i s El Plain Institute Revolutionary Tools for Continual Discovery For Research Use Only Not for use in diagnostic or therapeutic procedures Code No EPIOO1 EX Lot No 0001 Storage 20 C Contents I Kit Components A First Strand cDNA Synthesis B Second Strand cDNA Synthesis C Other Reagents D RACE PCR ll Other Materials Required Ill First Strand cDNA Synthesis IV Second Strand cDNA Synthesis V Rapid Amplification of cDNA Ends RACE A RACE PCR B Cloning and DNA Sequencing C How to Use Control m Tfrc 5 and 3 RACE Primers D Example of RACE PCR and RT PCR Experiments Using Control Primers E Procedure for Obtaining Longer cDNA by RACE VI Troubleshooting A ds cDNA Synthesis B RACE C RACE of Rare Transcripts D Accidental Amplification of the Genomic DNA VII Significant Advantages of the Single Primer RACE Method and Its Applications VIII Conclusion IX References X Lo ree Se ee E oe p cu A A 0 0 MN MN PM MN O 0 0 NY oO PR FP PW WW 0 User Manual This kit contains reagents for five double stranded ds cDNA synthesis reactions and control primers for 5 and 3 RACE PCR A thermostable DNA polymerase for PCR is not included in the kit Preparation of poly A RNA is required
7. RACE cDNA poly A RNA DNA poly A RNA total RNA RNase DNase DNA poly A RNA total RNA DNase RNase DNase poly A RNA total RNA DNasse RNA total RNA RACE VI RACE 1 5 RACE
8. RACE cDNA Tm RACE E RACE cDNA RACE cDNA DNA cDNA cDNA cDNA RACE cDNA ds cDNA DNA cDNA
9. PCR PCR RACE C RACE ds cDNA cDNA cDNA RACE PCR RACE PCR 5 10 2 PCR V E RACE cDNA RACE PCR 2 3 8 10 4 RACE D Genomic DNA
10. 11 VIII Conclusion accura expRACE KIT RACE cDNA IX 1 Okayama H amp Berg P 1982 High efficiency cloning of full length cDNA Mol Cell Biol 2 161 170 2 Gubler U amp Hoffman B J 1983 A simple and very effective method for generating cDNA libraries Gene 25 263 269 3 Frohman M A Dush M K amp Martin G R 1988 Rapid production of full length cDNAs from rare transcripts amplification using a single gene specific oligonucleotide primer Proc Natl Acad Sci USA 85 8998 9002 4 Chenchik A Diachenko L Moqadam F Tarabykin V Lukyanov S amp Siebert P D 1996 Full length cDNA cloning and determination of mRNA 5 and 3 ends by amplification of adaptor ligated cDNA BioTechniques 21 526 534 5 Hirano M 2004 RACE using only a gene specific primer application of a template switching model Mol Biotechnol 27 179 186 6 Levene S D amp Crothers D M 1986 Ring closure probabilities for DNA fragments by Monte Carlo simulation J Mol Biol 189 61 72 7 Cloutier T E amp Widom J
11. 14 15 DNA cDNA TE pH8 0 RACE PCR RACE PCR 2 3 8 10 4 RACE 3 6 8 PCR VI A ds cDNA poly A RNA ds cDNA total RNA rRNA 28S RNA 18S RNA tRNA 5S rRNA poly A RNA poly A RNA total RNA 1 poly A RNA 14 poly A RNA
12. 0 0 0 RR 00000 Ww D D SS SH 000 Oo 5 cDNA RACE PCR DNA poly A RNA l A First Strand cDNA 1 100 ul 5XRTase Reverse Transcriptase Buffer 250 mM Tris HCl pH 8 3 375 mM KCI 15 mM MgCl 2 10 ul Oligo dT Primer 10 uM 3 5 5 ul M MLV Moloney Murine Leukemia Virus Reverse Transcriptase 50 U ul B Second Strand cDNA 4 200 ul 5XSecond Strand Synthesis Buffer 100 mM Tris HCl pH 7 5 500 mM KCl 25 mM MgCL 50 mM NH4 SO Ammonium Sulfate 5 mM Dithiothreitol DTT 0 25 mg ml Bovine Serum Albumin BSA 0 75 mM B Nicotinamide Adenine Dinucleotide 8 NAD 5 55 ul E coli RNase H 1 U ul 6 5 5 ul E coli DNA Ligase 5 U ul 7 11 ul E coli DNA Polymerase 12 U ul 8 300 ul EDTA 0 5 M EDTA pH 8 0 C 9 40 ul 10 mM dNTP Mix 10 mM each of dATP dCTP dGTP dTTP 10 500 ul 7 5 M Ammonium Acetate 11 1 7ml MAK Distilled Water
13. template switching of Taq DNA polymerase 3 end Stan 2nd cycle sequences complementary template DNA to a gene specific pri denature aa annealing synthesis 32 RACE DNA 5 DNA 5 Template switching RACE cDNA Terminal Inverted Repeat 24 34 bp 5 68C ds cDNA 40 bp DNA GC 24 mer cDNA PCR 24 34 bp
14. cDNA First Strand cDNA GC RNA 42C First Strand cDNA cDNA CDNA First Strand cDNA 5X RTase Buffer 2 ul 10 mM dNTP 1 ul 10 uM Oligo dT 4 1 ul poly A RNA 1 ug 1 5 ul M MLV RTase 50 U ul Tul 4 0 ul Total volume 10 ul 1 poly A RNA Oligo dT 0 5 ml 5X RTase Buffer 10 mM ANTP Mix 2 1 ug O poly A RNA 1 5 ul amp Oligo dT Primer 1 ul 0 5 ml 3 6 ul 4 4C 5 70C 3 6 3 7 4C
15. Terminal Inverted Repeat cDNA A RACE PCR RT PCR RACE PCR PCR PCR PCR Tm 60C 65C Thermal Cycling DNA Polymerase RT PCR 5 10 Template switching 6 RT PCR 1 2 RACE PCR Bi 50 PCR 29 ul 10X PCR Buffer 5 ul Gene specific RACE Primer 10 pmol ul 5 ul 2 mM dNTP 5 ul ds cDNA 5 ul 1 2 ng DNA 1 U l 1 ul Total volume 50 ul Thermal
16. 3 RACE cDNA 2 PCR RT PCR PCR RACE 3 cDNA 4 ds cDNA X cDNA 5 1 RACE PCR cDNA 6 in vitro DNA 5 3 RACE cDNA 7 TA DNA ds cDNA cDNA cDNA T4 DNA mRNA 16 17 cDNA 18
17. I Kit Components A First Strand cDNA Synthesis 1 100 ul 5X RTase Reverse Transcriptase Buffer 250 mM Tris HCl pH 8 3 375 mM KCI 15 mM MgCl 2 10 ul Oligo dT 2o Primer 10 uM 3 5 5 ul M MLV Moloney Murine Leukemia Virus Reverse Transcriptase Advanced Type 50 U ul Source An E coli strain carrying a recombinant plasmid B Second Strand cDNA Synthesis 4 200 ul 5X Second Strand Synthesis Buffer 100 mM Tris HCl pH 7 5 500 mM KCI 25 mM MgCl 50 mM NH4 2SO4 Ammonium Sulfate 5 mM Dithiothreitol DTT 0 25 mg ml Bovine Serum Albumin BSA 0 75 mM B Nicotinamide Adenine Dinucleotide B NAD 5 5 5 ul E coli RNase H 1 U ul Source An E coli strain carrying a recombinant plasmid 6 5 5 ul E coli DNA ligase 5 U ul Source An E coli strain carrying a recombinant plasmid 7 11 pl E coli DNA polymerase 12 U ul Source An E colistrain carrying a recombinant plasmid 8 300 ul EDTA 0 5 M EDTA pH 8 0 C Other Reagents 9 40 ul 10 mM dNTP Mix 10 mM each of dATP dCTP dGTP dTTP 10 500 ul 7 5 M Ammonium Acetate 11 1 7 ml Distilled Water Deionized Sterile 12 1 6ml TE pH 8 0 10 mM Tris HCl pH 8 0 1 mM EDTA pH 8 0 BioMag mRNA Purification Kit Polysciences NucleoTrape mRNA MACHEREY NAGEL FastTrack amp 2 0 mRNA Isolation Kit Life Technologies Absolutely mRNA Purification Kit Agilent Technologies etc can be used for preparation of poly A RNA D RACE PCR Control 5 and 3 RACE Primers
18. 2004 Spontaneous sharp bending of double stranded DNA Molec Cell 14 355 362 8 Du Q Smith C Shiffeldrim N Vologodskaia M amp Vologodskii A 2005 Cyclization of short DNA fragments and bending fluctuations of the double helix Proc Natl Acad Sci USA 102 5397 5402 9 Panganiban A T amp Temin H M 1983 The terminal nucleotides of retrovirus DNA are required for integration but not virus production Nature 306 155 160 10 Wang K amp Pearson G D 1985 Adenovirus sequences required for replication in vivo Nucleic Acids Res 13 5173 5187 11 Olasz F Farkas T Kiss J Arini A amp Arber W 1997 Terminal inverted repeats of insertion sequence IS30 serve as targets for transposition J Bacteriol 179 7551 7558 12 Calvi B R Hong T J Findley S D amp Gelbart W M 1991 Evidence for a common evolutionary origin of inverted repeat transposons in Drosophila and plants hobo Activator and Tam3 Cell 66 465 471 13 Morgan G T 1995 Identification in the human genome of mobile elements spread by DNA mediated transposition J Mol Biol 254 1 5 14 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A amp Struhl K Eds 1994 Current Protocols in Molecular Biology John Wiley amp Sons Inc New York 15 Sambrook J Fritsch EF amp Maniatis T 1989 Molecular Cloning A Laboratory Manual 2nd ed Cold Spring Harbor Laboratory Press
19. 13 200 ul Mouse Transferrin Receptor Tfrc 5 RACE Primer 10 pmol ul 5 TTCTCAGGTGGCAGCTTTGAACT 3 Tm 62 58 C 14 200 ul Mouse Transferrin Receptor Tfrc 3 RACE Primer 10 pmol ul 5 CGTGGAGACTACTTCCGTGCTAC 8 Tm 62 55 C Full length cDNA 4 9 kb Note Kit components are arranged in a row from left to right according to the approximate order of use in an experiment ll Other Materials Required 1 Thermostable DNA polymerase for PCR PrimeSTAR TaKaRa KOD TOYOBO Pfu Thermo Fisher Scientific Phusion New England Biolabs etc 2 Phenol TE pH 8 0 saturated 3 95 Ethanol 4 75 Ethanol 5 TE pH 8 0 Ill First Strand cDNA Synthesis This procedure is a method for synthesizing first strand cDNA by the use of an advanced type M MLV Moloney Murine Leukemia Virus Reverse Transcriptase Because this enzyme has very high extension ability it can effectively synthesize long first strand cDNA Even if the RNA which tends to form a large secondary structure is used as a template this enzyme is able to synthesize the first strand cDNA efficiently at the usual reverse transcription temperature 42 C This enzyme is suitable for the synthesis of long cDNA and construction of a cDNA library containing a high proportion of full length cDNA Conditions of First Strand cDNA Synthesis Reaction 5X RTase Buffer 2 ul 10 mM dNTP 1 ul 10 uM oligo dT 20 1ul poly A RNA 1 ug 1 5 ul M MLV RTase Advanced Ty
20. RACE primer 2109 2131 4358 4380 M A ds cDNA total RNA poly A RNA VI A ds cDNA 7frc 8 actin D RACE PCR RT PCR ds cDNA 1 IV 20 1 250 mTfre RACE 5 RACE PCR RT PCR DNA KOD Plus Neo TOYOBO Thermal Cycling O amp A E RACE PCR 26 ul 10X PCR Buffer 5 ul Tfrc 5 RAC
21. RNA 1 ul cDNA 1 1 2 ds cDNA M A Hindlll digestion 1 ug poly A RNA 0 2 1 ug ds cDNA V Rapid Amplification of cDNA Ends RACE 3 4 RACE 1 cDNA 5 2 p7 2 ASK DNA 4 cos PCR 68 C DNA 6 7 8 DNA HO 5 RE DNA DNA 5 Template switching
22. amp Pardee A 1992 Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction Science 257 967 970 23 Yates L A Norbury C J amp Gilbert R J C 2013 Long and short of microRNA Cell 153 516 519 24 Numata K Kanai A Saito R Kondo S Adachi J Wilming L G Hume D A Hayashizaki Y amp Tomita M 2003 Identification of putative noncoding RNAs among the RIKEN mouse full length cDNA collection Genome Res 13 1301 1306 25 Nam J W amp Bartel DP 2012 Long noncoding RNAs in C elegans Genome Res 22 2529 2540 15 Note After this kit is used the box found inside can be used as a tube stand If you have any questions or any opinions about the accura expRACE KIT please contact us by email at contact elplain com Technical Support Email tech elplain com El Plain Institute products may not be resold modified for resale or used to manufacture commercial products without written approval of El Plain Institute A company name or a brand name mentioned in this manual is a trade name of each company or a registered or unregistered trademark and these belong to each owner The single primer method is covered by U S Patent 7 504 240 and Japanese Patent 4 304 350 2013 EI Plain Institute Inc All rights reserved EI Plain Institute Inc 1 12 2 Hanakawado Taito ku Tokyo 111 0033 Japan Email contact elplain com 16
23. 5 12 20 1 13 15 000 rpm LCT 20 14 15 20 C 759 400 ul 16 15 000 rpm 4 C 5 17 18 5 10 19 10 ul O TE pH 8 0 20 1 ul ds cDNA 0 2 0 4 qg ml 250 500 ul O TE pH 8 0 cDNA a P dCTP cDNA 19 10 ul TE pH 8 0 1 ul ds cDNA 1 E 1 ds cDNA ds cDNA poly A
24. 5S rRNA are not degraded high quality poly A RNA can be prepared from this total RNA About 1 of total RNA is collected as poly A RNA 14 It is important to measure the concentration of prepared poly A RNA Although it is not always necessary to use 1 ug of poly A RNA for cDNA synthesis in that case it is necessary to change the dilution rate of ds cDNA by TE pH 8 0 To raise the accuracy of the RACE experiments we recommend performing cDNA synthesis whenever possible after determining the concentration of poly A RNA a simple method may be used 15A B RACE If you cannot obtain a good result of RACE through several replications of experiments for example amplifying nonspecific products or amplifying no product attempt the next modification 1 If excessive non specific products were observed reduce ds cDNA for RACE PCR to 1 2 1 5 or 1 10 etc 2 If no product was observed increase ds cDNA for RACE PCR to 2 3 or 5 fold etc 3 If undesirable results were obtained change the amount of a gene specific primer used for RACE PCR Generally reduce a gene specific primer These modifications should produce good results If a nonspecific product is amplified after these modifications try to perform the hot start method or touchdown PCR This might improve the RACE results C RACE of Rare Transcripts If the content of the target cDNA contained in the ds cDNA synthesized by this kit is very low the RACE product might
25. Cold Spring Harbor New York 16 Kapranov P Cheng J Dike S Nix D A Duttagupta R Willingham A T Stadler P F Hertel J Hackerm ller J Hofacker I L Bell Cheung E Drenkow J Dumais E Patel S Helt G Ganesh M Ghosh S Piccolboni A Sementchenko V Tammana H amp Gingeras T R 2007 RNA maps reveal new RNA classes and a possible function for pervasive transcription Science 316 1484 1488 17 Mercer T R Gerhardt D J Dinger M E Crawford J Trapnell C Jeddeloh J A Mattick J S amp Rinn J L 2012 Targeted RNA sequencing reveals the deep complexity of the human transcriptome Nature Biotechnol 30 99 104 18 Hirano M amp Noda T 2004 Genomic organization of the mouse Msh4 gene producing bicistronic chimeric and antisense mRNA Gene 342 165 177 19 Hirano M 2008 Natural Grp78 antisense RNA induces apoptosis by creating a chimeric mRNA with Msh4 pre mRNA In A G Hernandes Ed Antisense Elements Genetics Research Focus pp 27 69 Nova Science Publishers Inc New York 20 Sikela J M amp Auffray C 1993 Finding new genes faster than ever Nature Genet 3 189 191 21 Velculescu V E Zhang L Vogelstein B amp Kinzler K W 1995 Serial analysis of gene expression Science 270 484 487 22 Liang P amp Pardee A 1992 Differential display of eukaryotic messenger RNA by means of the polymerase chain reaction Science 257 967 970 23
26. Deionized Sterile 12 1 6ml TE pH 8 0 10 mM Tris HCI pH 8 0 1 mM EDTA pH 8 0 D RACE PCR Control 5 and 3 RACE Primers 13 200 ul Mouse Transferrin Receptor 7frc 5 RACE Primer 10 pmol ul 5 TTCTCAGGTGGCAGCTTTGAACT 3 Tm 62 58 C 14 200 ul Mouse Transferrin Receptor Tfrc 3 RACE Primer 10 pmol ul 5 CGTGGAGACTACTTCCGTGCTAC 3 Tm 62 55 C Full length cDNA 4 9 kb E Bul BioMage mRNA Polysciences NucleoTrap mRNA MACHEREY NAGEL FastTrack 2 0 mRNA Isolation Kit Life Technologies Absolutely mRNA Purification Kit Agilent Technologies poly A RNA I 1 DNA Polymerase PrimeSTAR TaKaRa KOD TOYOBO Pfu Thermo Fisher Scientific Phusion New England Biolabs etc 2 Phenol TE pH 8 0 3 99 5 Ethanol 4 75 Ethanol 5 TE pH 8 0 lll First Strand cDNA M MLV RTase Moloney Murine Leukemia Virus Reverse Transcriptase
27. RACE in which template switching has occurred appropriately is limited to one or a few molecules in the initial few cycles of PCR In the case of 5 RACE several bands will be observed when template switching has occurred in several cDNAs of different sizes In the case of 3 RACE the product size is generally identical 1 M 2 3 4 5 6 7 8 9 10 ll Figure 3 Results of 5 RACE and RT PCR Lane 1 RT PCR Lane M Hindlll digested DNA Lanes 2 11 5 RACE PCR Lanes 2 5 Results of a single RACE experiment Lane 6 Extension time set to 8 min cDNA was diluted 10 fold Lanes 7 8 Extension time set to 4 min cDNA was diluted 2 and 5 fold respectively Lane 9 Same conditions as above Lanes 10 11 Extension time set to 4 min cDNA was diluted 2 fold In general the first RACE experiment is performed at the Tm temperature of the RACE primer s If any of the RACE products cannot be observed we suggest that the RACE experiment be performed at an annealing temperature of 1 2 C lower To observe nonspecific products we suggest that the RACE experiment be performed at an annealing temperature of 1 2 C higher A RACE product that becomes almost a single band is likely to be the true product This is the key to successful RACE experiments Generally if the designed PCR primer is appropriate for the RACE experiment you may expect to obtain good results at or near the Tm temperature E Procedure for Obtaining Longer cDNA by RACE L
28. Yates L A Norbury C J amp Gilbert R J C 2013 Long and short of microRNA Cell 153 516 519 24 Numata K Kanai A Saito R Kondo S Adachi J Wilming L G Hume D A Hayashizaki Y amp Tomita M 2003 Identification of putative noncoding RNAs among the RIKEN mouse full length cDNA collection Genome Res 13 1301 1306 25 Nam J W amp Bartel DP 2012 Long noncoding RNAs in C elegans Genome Res 22 2529 2540 12 AX accra expRACE KIT Email contact elplain com Email tech elplain com 4 304 350 U S patent No 7 504 240
29. for the next RACE experiment The RACE experiment can be performed as soon as the second strand cDNA synthesis is finished 1 5X Second strand buffer dNTP mix and sterile water should be thawed on ice 2 Add the following into the first strand reaction tube First Strand Mixture 10 ul Distilled water 48 4 ul 5X Second Strand Buffer 16 ul dNTP Mix 10 mM 1 6 ul Mix by vortexing and add enzymes E co7RNaseH 1U 1 ul E coli DNA ligase 5U 1 ul E coli DNA polymerase 24U 2 ul Total volume 80 ul 3 Mix gently by pipetting 4 Briefly spin down the contents in a microcentrifuge at 4 C 5 Incubate the tube at 16 C for 1 5 hr 6 Add 1 6 ul of 0 5 M EDTA pH 8 0 to stop the reaction 7 Add 80 ul of TE saturated phenol pH 8 0 and vortex thoroughly 8 Spin the tube at maximum speed in a microcentrifuge for 10 min at room temperature 9 Transfer the aqueous phase to a sterile 0 5 ml microcentrifuge tube 10 Add 29 ul of 7 5 M ammonium acetate final concentration 2 M 11 Add 2 5 volumes of 95 ethanol 272 5 ul and mix thoroughly 12 Place the tube at 20 C for 1 hr 13 Spin the tube at maximum speed in a microcentrifuge for 20 min at 4 C 14 Carefully remove the supernatant 15 Add 400 ul of prechilled 75 ethanol at 20 C 16 Spin the tube at maximum speed in a microcentrifuge for 5 min at 4 C 17 Carefully remove the supernatant 18 Dry the pellet for 5 10 min 19 Dissolve the pellet in 10 ul
30. 19 8 RACE Expressed Sequence Tag EST 20 Serial Analysis of Gene Expression SAGE 21 Differential Display 22 RNA cDNA 9 microRNA pri miRNA 23 IncRNA 24 25 cDNA RACE KE 8 10 DNA insertional mutagenesis DNA DNA DNA DNA
31. Cycling 94C 2 min 98C 10 sec Tm C 30 sec 35 40 cycles 68C 4min DNA PCR 5 10 ul amp DNA RACE B DNA RACE PCR TA DNA cDNA Direct DNA Sequencing RACE PCR 1 lt 5 RACE product Tet Sequencing primer 5 RACE primer C m7 c 5 3 RACE RACE m7
32. E Primer 10 pmol ul 5 ul 2 mM dNTP 5 ul 25 mM MgSO 3 ul ds cDNA 5 ul KOD Plus Neo 1 U ul 1 ul Total volume 50 ul RT PCR 28 ul 10X PCR Buffer 5 ul Tfrc 3 RACE Primer 10 pmol l forward 1 5 ul Tfrc 5 RACE Primer 10 pmol 4l reverse 1 5 ul 2 mM dNTP 5 ul 25 mM MgSO 3 ul ds cDNA 5 ul KOD Plus Neo 1 U ul 1 ul Total volume 50 ul Thermal Cycling 94 C 2 min 98 C 10 sec 63 C 30 sec 40 cycles 68 C 4 min RACE PCR 10ul 8 kU RT PCR 2ul 1 3 3 p10 4 4 kb 3 kb 2 4 kb 5 RACE 2 1 1 2 3 kb RT PCR 1 5 RACE 3 RACE 4 RACE RT PCR Template switching cDNA
33. NA gs cDNA RACE 1 5X Second Strand Buffer dNTP Mix MAKKA TRDI 2 First Strand cDNA First Strand Mix MAK 5X Second Strand Buffer dNTP Mix 10 mM 10 ul 48 4 ul 16 ul 1 6 ul Vortex E coliRNase H 1U E coli DNA Ligase 5U lul lul E coli DNA Polymerase 24U 2 ul Total volume ON DOO 9 0 5ml 80 ul 4C 16C 1 5 1 6 ul 0 5 M EDTA pH 8 0 80 TE pH 8 0 Vortex 15 000 rpm 10 10 7 5 M Ammonium Acetate 29 2M 11 2 5 99 5 272
34. TE pH 8 0 20 Dilute 1 ul of ds cDNA with 250 500 ul of TE pH 8 0 to a concentration of 0 2 0 4 ug ml Instead of monitoring cDNA synthesis by labeling with a P dCTP you can check an aliquot 1 ul of ds cDNA products 10 ul TE pH 8 0 solution by agarose gel electrophoresis Figure 1 Figure 1 Result of ds cDNA Synthesis ds cDNA synthesis was performed using mouse testis poly A RNA 1 ul of ds cDNA 19 on page 5 was used for 1 agarose gel electrophoresis Lanes 1 2 Different kits were used Lane M Hindlll digested A DNA Anticipated Results It is expected that 0 2 1 ug of ds cDNA will be obtained from 1 ug of poly A RNA V Rapid Amplification of cDNA Ends RACE 3 4 In RACE PCR by the single primer method using this kit an adaptor primer or an anchor primer is not used The targeted cDNA is amplified with only a gene specific primer 5 The basis for its mechanism Figure 2 is that the terminal region of the ds DNA is partially denatured at 68 C for the extension reaction as is observed at the cohesive end of the A phage and that the linear DNA molecule tends to be circular 6 7 8 Upon reaching the 5 end of the template DNA under these circumstances a thermostable DNA polymerase switches the template to the 5 terminal region on the newly synthesized daughter strand at a certain probability The DNA polymerase continues synthesizing DNA sequences complementary to the gene specific primer occasionally
35. adding several nucleotides from the 3 flanking sequence Using this daughter strand as a template the targeted cDNA is accurately amplified by PCR using only a gene specific primer It is through this process that the resultant cDNA likely obtains its characteristic terminal inverted repeat 9 10 11 12 13 Figure 2 legend The single primer method is covered by U S patent No 7504240 and Japanese patent No 4304350 The exact frequency is currently unknown It is assumed that the frequency is different according to the size of the DNA fragments It is also assumed that it is different according to the thermostable DNA polymerase used 3 end synthesis by template switching of Taq DNA polymerase 1st cycle denature 5 M 3 annealing gene specific primer ss Pes synthesis M 2nd cycle 5 en sequences complementary template DNA to a gene specific primer ee denature annealing synthesis Figure 2 Mechanism of RACE Reactions Using a Single Gene Specific Primer The template switching event probably occurs at a variety of positions However the length of the terminal inverted repeat falls in the range of 24 34 bp in every obtained cDNA clone 1 and data not shown Possible reasons for this fact are as follows A region that dissociates from dsDNA by heat denaturation may be limited within the first 40 bp or less at the DNA end at 68 C The length of denaturation
36. brook J Fritsch E F amp Maniatis T 1989 Molecular Cloning A Laboratory Manual 2nd ed Cold Spring Harbor Laboratory Press Cold Spring Harbor New York 16 Kapranov P Cheng J Dike S Nix D A Duttagupta R Willingham A T Stadler P F Hertel J Hackermuller J Hofacker I L Bell Cheung E Drenkow J Dumais E Patel S Helt G Ganesh M Ghosh S Piccolboni A Sementchenko V Tammana H amp Gingeras T R 2007 RNA maps reveal new RNA classes and a possible function for pervasive transcription Science 316 1484 1488 17 Mercer T R Gerhardt D J Dinger M E Crawford J Trapnell C Jeddeloh J A Mattick J S amp Rinn J L 2012 Targeted RNA sequencing reveals the deep complexity of the human transcriptome Nature Biotechnol 30 99 104 18 Hirano M amp Noda T 2004 Genomic organization of the mouse Msh4 gene producing bicistronic chimeric and antisense mRNA Gene 342 165 177 14 19 Hirano M 2008 Natural Grp78 antisense RNA induces apoptosis by creating a chimeric MRNA with Msh4 pre mRNA In A G Hernandes Ed Antisense Elements Genetics Research Focus pp 27 69 Nova Science Publishers Inc New York 20 Sikela J M amp Auffray C 1993 Finding new genes faster than ever Nature Genet 3 189 191 21 Velculescu V E Zhang L Vogelstein B amp Kinzler K W 1995 Serial analysis of gene expression Science 270 484 487 22 Liang P
37. diluted and control mTfrc RACE primers contained in this kit we performed 5 RACE and RT PCR experiments We used KOD Plus Neo DNA polymerase TOYOBO not available in the US and prepared the reaction mix under the thermal cycling conditions listed below RACE PCR Distilled water 26 ul 10X PCR Buffer 5 pl Tfrc 5 RACE Primer 10 pmol ul 5 ul 2 mM dNTP 5 ul 25 mM MgSO 3 ul ds cDNA 5 ul KOD Plus Neo 1 U ul 1 ul Total volume 50 ul RT PCR Distilled water 28 ul 10X PCR Buffer 5 ul Tfrc 3 RACE Primer 10 pmol ul forward 1 5 ul Tfrc 5 RACE Primer 10 pmol ul reverse 1 5 ul 2 mM dNTP 5 ul 25 mM MgSO 3 ul ds cDNA 5 ul KOD Plus Neo 1 U ul 1 ul Total volume 50 ul Thermal Cycling 94 C 2 min 98 C 10sec 63 C 30 sec 40 cycles 68 C 4 min To characterize 5 RACE and RT PCR products 10 ul and 2 ul of the reaction mix respectively are examined by agarose gel electrophoresis As shown in Figure 3 5 RACE products of 4 4 kb 3 kb 2 4 kb etc Lanes 2 11 and RT PCR product of 2 3 kb Lane 1 were observed Shown are some of the results of three 5 RACE experiments 10 The RACE products are observed in more than half of the tubes 4 tubes were used in an experiment The ratio of obtained RACE product is thought to fluctuate according to the targeted gene The amount of RACE product is much less than that of RT PCR The reason for this is presumed to be that the template of single primer
38. e single primer method The single primer method is especially useful for identifying gene occurred insertional mutation by rescuing a DNA element used for insertional mutagenesis The single primer method can also be used to identify the insertion site of the vector DNA used for creating transgenic organisms including cells 13 VIII Conclusion It is expected that almost all existing cDNAs can be amplified by performing RACE experiments under various reaction conditions and with various primers using the accura expRACE KIT Then they can be cloned IX References E Okayama H amp Berg P 1982 High efficiency cloning of full length cDNA Mol Cell Biol 2 161 170 N Gubler U amp Hoffman B J 1983 A simple and very effective method for generating cDNA libraries Gene 25 263 269 Frohman M A Dush M K amp Martin G R 1988 Rapid production of full length cDNAs from rare transcripts amplification using a single gene specific oligonucleotide primer Proc Natl Acad Sci USA 85 8998 9002 4 Chenchik A Diachenko L Moqadam F Tarabykin V Lukyanov S amp Siebert P D 1996 Full length cDNA cloning and determination of mRNA 5 and 3 ends by amplification of adaptor ligated cDNA BioTechniques 21 526 534 5 Hirano M 2004 RACE using only a gene specific primer application of a template switching model Mol Biotechnol 27 179 186 6 Levene S D amp Crothers D M 1986 Ring cl
39. frc 5 RACE 3 RACE ds cDNA RACE m 7 c RT PCR PCR RACE PCR PCR RT PCR RT PCR 5 10 Template switching 1 RACE PCR RACE PCR RACE mTfrc cDNA 4920 bp gt lt 3 RACE primer 5
40. might also depend on the GC content In addition only the cDNA having the nucleotide sequence perfectly complementary to the gene specific primer 24 bases is then selectively amplified in the subsequent cycles of PCR These factors are thought to cause predominant amplification of cDNA having terminal inverted repeat of 24 34 bp Complementary DNA which has a terminal inverted repeat structure comprising a gene specific primer with or without several nucleotides adjacent to its 3 end is made amplified by the proposed mechanism described above By using the ds cDNA synthesized by this kit as a template for PCR both 5 RACE and 3 RACE can be performed A RACE PCR RACE PCR can easily be performed under the condition such as RT PCR Generally complicated modifications such as hot start PCR touchdown PCR and stepdown PCR are not necessary Recommended Tm is 60 C 65 C We recommend that the composition of the reaction mix and the condition of thermal cycling are prepared according to the instruction of manufacturer of thermostable DNA polymerase Cycling is needed 5 to 10 times more than that of RT PCR A longer extension time tends to increase the chance for template switching of thermostable DNA polymerase systematic studies have not yet been done see on page 7 Therefore we recommend that RACE PCR be performed for 1 2 minutes longer than that of RT PCR Example For 50 ul PCR mix the following reagents Distilled water 29
41. not be observed by agarose gel electrophoresis In that case we recommend that a second round of PCR be carried out under the same condition using 5 10 ul of the first round sample In this experiment the RACE product may then be observed by agarose gel electrophoresis As with V E Procedure for Obtaining Longer cDNA by RACE prolonging the extension time of the initial few PCR cycles to 8 10 min increases the probability of synthesizing a rare template for the single primer RACE 12 D Accidental Amplification of the Genomic DNA The efficiency of the single primer method of RACE is very high If the targeted cDNA is not in the synthesized cDNAs the targeted gene present in a very small amount of genomic DNA contaminated through the preparation of poly A RNA is often amplified by PCR This problem is avoided by the treatment of poly A RNA or total RNA with RNase free DNase Poly A RNA or total RNA treated by RNase free DNase should be extracted with phenol and precipitated with ethanol Alternatively genomic DNA free total RNA can be prepared by commercially available columns for RNA preparation capable of DNase treatment If the exon intron structure of the targeted gene is already known this problem is solved by designing a RACE primer spanning an exon exon junction VII Significant Advantages of the Single Primer RACE Method and Its Applications 1 Both 5 and 3 RACE can be done with the same cDNA 2 Simple PCR protocol
42. ong cDNA can be amplified using the single primer RACE method However in general short DNA molecules tend to circularize more efficiently than do long DNA molecules When long target cDNA and short target cDNA are present in the same reaction mix the short cDNA is more apt to be amplified by the single primer RACE method Therefore it becomes easy to get long cDNA by performing the following manipulations Synthesized ds cDNA is fractionated by agarose gel electrophoresis The agarose gel block containing high molecular weight cDNA is cut out and eluted by electroelution 14 15 or by use of a commercially available DNA 11 elution kit The eluted cDNA is resuspended in an appropriate volume of TE pH 8 0 and used for RACE experiments The probability for synthesizing a long template for single primer RACE increases by setting the extension time to 8 10 min in the initial few PCR cycles Residual cycles are done at 4 min of extension time The probability observing several RACE product bands may also increase There have been no problems when the PCR extension time is set to 8 min in all PCR cycles as shown in Lane 6 of Figure 3 VI Troubleshooting A ds cDNA Synthesis If high quality poly A RNA is obtained ds cDNA synthesis is successful Before preparing poly A RNA examine the quality of the prepared total RNA by performing agarose gel electrophoresis using a portion of the prepared total RNA If rRNA 28S RNA and 18S RNA and tRNA
43. osure probabilities for DNA fragments by Monte Carlo simulation J Mol Biol 189 61 72 N Cloutier T E amp Widom J 2004 Spontaneous sharp bending of double stranded DNA Molec Cell 14 355 362 8 Du Q Smith C Shiffeldrim N Vologodskaia M amp Vologodskii A 2005 Cyclization of short DNA fragments and bending fluctuations of the double helix Proc Natl Acad Sci USA 102 5397 5402 9 Panganiban A T amp Temin H M 1983 The terminal nucleotides of retrovirus DNA are required for integration but not virus production Nature 306 155 160 10 Wang K amp Pearson G D 1985 Adenovirus sequences required for replication in vivo Nucleic Acids Res 13 5173 5187 11 Olasz F Farkas T Kiss J Arini A amp Arber W 1997 Terminal inverted repeats of insertion sequence IS30 serve as targets for transposition J Bacteriol 179 7551 7558 12 Calvi B R Hong T J Findley S D amp Gelbart W M 1991 Evidence for a common evolutionary origin of inverted repeat transposons in Drosophila and plants hobo Activator and Tam3 Cell 66 465 471 13 Morgan G T 1995 Identification in the human genome of mobile elements spread by DNA mediated transposition J Mol Biol 254 1 5 14 Ausubel F M Brent R Kingston R E Moore D D Seidman J G Smith J A amp Struhl K Eds 1994 Current Protocols in Molecular Biology John Wiley amp Sons Inc New York 15 Sam
44. pe 50 U ul 1 ul Distilled water 4 0 ul Total volume 10 ul 1 poly A RNA oligo dT zo primer and distilled water should be thawed on ice A sterile 0 5 ml microcentrifuge tube should be precooled on ice 5X RT buffer and 10 mM dNTP mix should also be thawed on ice 2 Add 1 ug of poly A RNA 1 5 pl and 1 ul of oligo dT 20 primer into a sterile 0 5 ml microcentrifuge tube 3 Add distilled water to a volume of 6 ul 4 Mix gently by pipetting and then spin down the contents in the microcentrifuge at 4 C 5 Incubate the tube at 70 C for 3 min 6 Immediately cool the tube on ice for 3 min 7 Briefly spin down the contents in a microcentrifuge at 4 C 8 Add the following to a reaction tube 5X RTase Buffer 2 ul 10 mM dNTP 1 ul M MLV RTase Advanced Type 50 U ul 1 ul Total volume 10 ul 9 Mix gently by pipetting 10 Briefly spin down the contents in a microcentrifuge at 4 C 11 Incubate the tube at 42 C for 1 hr 12 Cool the tube on ice for 2 3 min 13 Perform second strand synthesis continuously in the same tube IV Second Strand cDNA Synthesis Second strand cDNA synthesis is performed in the same reaction tube as first strand synthesis E coli RNase H E coli DNA polymerase and E coli DNA ligase degrade the RNA of RNA DNA hybrids and synthesize second strand cDNA 1 2 The treatment of ds cDNA with T4 DNA polymerase is not necessary with this kit because an adaptor or an anchor ligation is not necessary
45. r detecting the product of 2 3 kb Next perform RACE using a control mTfrc 5 or 3 RACE primer under the same conditions as RT PCR except for thermal cycling time For RACE set the thermal cycling 5 to 10 more times than that of RT PCR As mentioned above a longer extension time tends to increase the chance of template switching of thermostable DNA polymerase We recommend that RACE PCR be performed with 1 2 minutes longer extension time than that for RT PCR If you can use these control experiments to determine the appropriate conditioning procedure of RACE PCR you will easily perform RACE experiments for various targeted genes 4920 bp gt lt 3 RACE primer 5 RACE primer 2109 2131 4358 4380 if you failed to obtain the desired results in these control experiment it is presumed that there is a problem with the prepared total RNA or poly A RNA or synthesized ds cDNA In that case confirm where the problem is by performing agarose gel electrophoresis of the prepared total RNA or poly A RNA or synthesized ds cDNA Depending on the circumstances total RNA or poly A RNA may have to be prepared again See VI A Note If the synthesized ds cDNA is not derived from mouse perform the experiment described above using control primers e g TFR B actin etc of the organism under study D Example of RACE PCR and RT PCR Experiments Using Control Primers Using mouse testis synthesized ds cDNAs above Figure 1 Lanes 1 and 2 1 250
46. s without complicated modifications are available for efficient RACE 3 Because long cDNA can be obtained the method is suitable for searching splicing variants of many genes Short cDNA can be obtained more efficiently than a longer one 4 Once double stranded cDNA is synthesized it can be used as a cDNA library without adaptor ligation or cloning into a phage vector 5 Only a single gene specific primer is necessary for screening a cDNA library using RACE PCR 6 Using the recombinant DNA method full length cDNA can easily be obtained from 5 and 3 RACE products 7 T4 DNA polymerase treatment for creating blunt ends on ds cDNA and ligation of an adaptor or an anchor DNA are not necessary for cDNA library construction Specifically the efficiency of T4 DNA polymerase treatment and ligation does not influence a library size Therefore cDNA derived from rare mRNA 16 17 can efficiently be isolated 18 19 8 By using this RACE kit full length cDNA can be isolated from short RNA sequence information based on Expressed Sequence Tag EST 20 Serial Analysis of Gene Expression SAGE 21 or Differential Display 22 analysis enabling investigation of its detailed characteristics 9 By using this RACE kit microRNA pri miRNA 23 and IncRNA 24 25 can be isolated and their characteristics analyzed Detection is possible from analyses of 8 10 Amplification of genomic DNA of various organisms can be performed using th
47. ul 10X PCR Buffer 5 ul Gene Specific RACE Primer 10 pmol ul 5 ul 2 mM dNTP 5 ul ds cDNA 5 ul 1 2 ng Thermostable DNA polymerase 1 U ul 1 ul Total volume 50 ul Start thermal cycling using the following parameters 94 C 2 min 98 C 10sec Tm C 30 sec 35 40 cycles 68 C 4 min PCR should be performed under the conditions described in the instructions used for thermostable DNA polymerase To characterize RACE products 5 10 ul of the reaction mix is examined by agarose gel electrophoresis B Cloning and DNA Sequencing It is necessary that RACE PCR products be cloned to a TA cloning vector and confirmed by DNA sequencing To perform direct DNA sequencing to confirm RACE PCR products another gene specific primer is required For 5 RACE products a primer of 3 distal region to a 5 RACE primer is required For 3 RACE products a primer of 3 distal region to a 3 RACE primer is required lt 5 RACE product ds cDNA 1 1 Sequencing primer 5 RACE primer C How to Use Control mTfrc 5 and 3 RACE Primers If you cannot detect the RACE product in several experiments performing a RACE experiment using control m Tfrc 5 and 3 RACE primers and synthesized ds cDNA may help solve the problem At first using both primers perform RT PCR of the mTfrc fo
Download Pdf Manuals
Related Search