pNI DNA - Clontech Laboratories, Inc.
Contents
1. 10mM Tris HCI pH8 0 1 mM EDTA E Py ts 5 055b 23 2R pNIDNA AAGGCGCCGCAACTTTTGATTCGCTCAGGCGTTTAATAGGATGTAATTGTGAGCGGATAA 120 P2 35 P2 10 lac operator co Pst pees tee CAATTATTCTGCATGGCTTTCCTGCGAAAGGAGGTGACACGCGCCATGGCTTTCGCTGCA 180 SD1 Start codon Cloning site BamH oan Xba 0 EcoR Keni Sma ete Cla mee III a ree es se z I een eee aah GGATCCGTCGACTCTAGACTCGAGGAATTCGGTACCCCGGGTTCGAAATCGATAAGCTTC 240 GGCATTATAG v202. pNIDNA PRED L39 Brevibacillus Expression System pNI DNA Brevibacillus 1 sae NESS Brevibacillus 2 pNI P2 3 P2 amp grevibacillus
3. 1307 TaKaRa 64343097
4. Brevibacillus Expression vector pNI DNA Code No HB131 Size 10 ug 0 2 OD Shipping at 20 C Store at 20 C 2 years from date of receipt under proper storage conditions Lot No Concentration 0 2 ug l Volume 50 ul Regarding protocol please refer to the product manual supplied with this vector Description pNI is a shuttle vector of B choshinensis and E coli and this vector is an intracellular expression vector Expression plasmid can be constructed by using coli as the host then transfered into B choshinensis cells The pNI contains P2 promoter derived from the host cell wall protein HWP as its expression promoter and does not work in coli In B choshinensis cells P2 promoter works as very strong promoter enabling efficient protein production Form 10 mM Tris HCl pH8 0 1 mM EDTA Base pairs 5 055 bp Usage This is a vector for protein intracellular expression using Brevibacillus Expression System a shuttle vector between B choshinensis and E coli Cloning sites of pNI DNA Please refer to the other side of this sheet Map of pNI DNA Lac operator P2 promoter P ori ai cloning site O ColE1 ori rep Amp Nmr NOTICE TO PURCHASER LIMITED LICENSE L39 Brevibacillus Expression System 1 Brevibacillus Expression System related products were developed and manufactured by Higeta Shoyu Co Ltd and sold by TAKARA BIO INC 2 The
5. use of this product is allowed for research use only 3 All rights of intellectual property related to this product are owned by Higeta Shoyu Co Ltd Note This product is for research use only It is not intended for use in therapeutic or diagnostic procedures for humans or animals Also do not use this product as food cosmetic or household item etc Takara products may not be resold or transferred modified for resale or transfer or used to manufacture commercial products without written approval from TAKARA BIO INC If you require licenses for other use please contact us by phone at 81 77 543 7247 or from our website at www takara bio com Your use of this product is also subject to compliance with any applicable licensing requirements described on the product web page It is your responsibility to review understand and adhere to any restrictions imposed by such statements All trademarks are the property of their respective owners Certain trademarks may not be registered in all jurisdictions v201307 pNIDNA Code No HB131 Size 10 ug 0 2 OD Shipping at 20 C Store at 20 C 2 Lot No Brevibacillus
Download Pdf Manuals
Related Search