Home
熊本大学学術リポジトリ Kumamoto University Repository System
Contents
1. 42 Ses 9 Pcid2 mRNA M422 B 43 10 Baker D J Jeganathan K B Cameron J D Thompson M Juneja S Kopecka A Kumar R Jenkins R B de Groen P C Roche P and van Deursen J M 2004 BubR1 insufficiency causes early onset of agingassociated phenotypes and infertility in mice Nat Genet 36 744 749 Ballas N and Mandel G 2005 The many faces of REST oversee epigenetic programming of neuronal genes Curr Opin Neurobiol 15 500 506 Campbell M S Chan G K and Yen T J 2001 Mitotic checkpoint proteins HsMAD1 and HsMAD2 are associated with nuclear pore complexes in interphase J Cell Sci 114 953 963 Casali P Pal Z Xu Z and Zan H 2006 DNA repair in antibody somatic hypermutation Trends Immunol 27 313 321 Ch vez S Beilharz T Rond n A G Erdjument Bromage H Tempst P Svejstrup J Q Lithgow T and Aguilera A 2000 A protein complex containing Tho2 Hprl Mftl and a novel protein Thp
2. lt 0 001 p 0 001 9 ua Peiaatrvctn 100 100 Pcid2 Cre 80 80 i amp amp 60 60 3 3 N i 40 40 20 20 0 0 PcidZ Pcid2 PcidZ Pcidg h AnnexinV th Cre ti Cre 22 ere ZPcid2 floxed BRERA Clk Peid243 X OWADZO mRNAB ILE FL 7g B LPS bug ml 24 zze the B Pc7g 1 Ct 1 Pc7g B Pc7g 1 Cre P cze B RNA c722 4 2 mRNA RT PCR CB ere B LPS 5u g ml 48 Annexin V T 36 B cr7
3. HeLa siRNA MAD2 M Kops et al 2004 M 5 1 3 MAD2 REST VE MAD REST RE1 Silencing Transcription factor Guardavaccaro et al 2008 REST XRepressor Element l RED 23 Ballas amp Mandel 2005 HeLa LAD 26 46 RE1 REST REST G1 S MAD2 G2 M REST
4. MAD2 MAD2 c722 siRNA MG132 4 6 MAD2 MAD2 16 2 REST Guardavaccaro et al 2008 REST z7 siRNA REST 16 4 6 siCtrl siPcid2 DMSO MG132 DMSO MG132 MAD2 NE S siCtrl siPcid2 siCtrl siPcid2 siCtrl siPcid2 siCtrl si Pcid2 i REST MANN M Mad G actin ee octin We 16 HeLa 722 siRNA MG132 MAD2 REST GR Pcid siRNA
5. mRNA Farny et al 2008 MAD2 MAD2 X MADI ZS FICS VY CERIBEEL OO AN ZZ y pE Campbell et al 2001 BARILD ANAT y b HEH MAD2 MAD1 mRNA 41 M 8 4 Pcid2 mRNA Z2 B Ig Pcid2 MAD2
6. Ch Pcid siRNA HeLa 3 25 Pcid2 siRNA HeLa PI 11 M Kops et al 2004 z7g2siRNA HeLa M z792 siRNA 40 8N 11 z72 M
7. DNA M DNA DNA DNA DNA DNA 1 G1 S G2 M S MHF ay 7d A M 4 E TIR REPEATER ASA BE AX 10 E MAD2 APC C anaphase promoting complex cyclosome
8. MAD2 MAD2 mRNA M Bj4 REST MAD2 G1 SHB G2 M REST REST RE7 MAD2 RE7 MAD2 4 RESTICE 5 MAD2 Guardavanccaro et al 2008 FE MAD 7 REST G1 S M4 2 G2 M REST M2 12 5 1 4 mRNA DNA pre mRNA mRNA
9. Mex67 TREX Fischer et al 2002 Gallardo et al 2003 Lei et al 2003 Luna et al 2008 5 Y mRNA 5 mRNA Luna ez al 20084 9 KB THO Tho2 Hpr1 Mft1 Thp2 4 mRNA THO RNAPII Sub2 Yral TREX mRNP 2 Mex67 Mtr2 TREX2 Sac3 Thp1 Cdc31 Sus1 SAGA Spt Ada Gen5 Acetyltransferase RNAPII RNA polymerase II Nup nucleoporin mRNA GANP HeLa Szgos 7 7 Sgo7 mRNA Okamoto etal 2010 GANP mRNA
10. 34 mw Bu m Ad OBI Poi dZKT8 v v AD HMBC TE B220 Thyl MOMA1 IgM Alexa488 1gG Alexa594 B 7c7g2 T B220 Bd21a b MOMA1 IgM MOMA1 B 7Z2 Bd21e d 722 B Pc B Pcid2 21 B Peid2 X1B8 OA B Pcid a b IRDA ZcB220 Thy1 c d M
11. 6 6 3 PBS PE 3 mAb BD Pharmingen FACSCalibur F1owJo HeLa siRNA 6 7 6 siRNA LT PI 0 5 pg ml PBS 0 29 TritonX 100 TAL un 6 8 TNE 1x SDS SDS PAGE PROTORAN 1 30 MAD2 BUB3 BD Transduction Laboratories MAD1 p55CDC cyclin A CDK1 Santa Cruz Biotechnology BUBR1 MBL CENP E Abcam cyclin
12. 7e7g siRNA 2 mRNA c722 SICtrl SIPcid2 Merged Merged 15 HeLafWulcox 3 2 Pcid siRNAMLER CK AMIGA MAD mRNA 4D2 mRNA BUBS mRNA Hoechst33258 DNA HeLa 2 mRNA Pczd2siRNA HeLa M4D2mRNA Pcid siRNA HeLa 2 mRNA 3 x400 5 pm o 30 Pcid2 siRNA 4M4 2 mRNA MAD2
13. 7 siRNA SICtrl SI c 2 1500 1500 Colcemid 1000 1000 500 500 0 0 1500 1500 Colcemid 1000 e 500 0 siCtri siPcid2 24816 N 24816 N gt PI 11 HeLa Peid2 siRNA Pcid2 siRNA HeLa PI Suc a RUE 40052 AR Peid2 siRNA 48 HeLa 40 PI 8N 3 26 siRNA Pezd2 M
14. FITC B220 mAb FITC microbeads Miltenyi Biotech autoMACS Miltenyi Biotech B220 JSAN Bay Bioscience Toda et a1 2009 B 1 5x105 95 6 2 mRNA cDNA mRNA RNeasy micro QIAGEN mRNA oligo dT 10 mM dNTP Mix Invitrogen 65 C 5 5x First Strand Buffer 0 1 M DTT Superscript III Invitrogen 50 C 1 70 C 15 cDNA RNase H Nippon Gene 37 C 20 mRNA 6 3 RT PCR LightCycler Experimental Protocol LightCycler DNA Master Mix Roche Nihon Gene Research Laboratories cDNA LightCycler Roche cDNA
15. cre c7g2177 Ctr1 B Pc7g 1 Cre B PI Peid Ctrl B Peid2 Cre B G1 B sub G1 4834 8 2 23 c ZI Ctn c 7 ZI Cre 109 10 10 103 104 10 10 10 103 104 PI 23 cze z7g2f1oxed B ere 4 Pc7g Ctr1 B Pc7g 7 re B PI cr7g 1 eeB sub G1 2334 896 2 per7g Ctr1 cr7g B Poeid2 Cre 37 B 7c722 H B Peid2 B
16. 65 z722 siRNA 66 7 Pcid2 M MAD2 Pcid2 Thp1 mRNA Fischer et al 2002 z7 mRNA nRNA 2 mRNA RT PCR 2 mRNA 7 siRNA Z2 mRNA z7 siRNA p lt 0 001 14 26 p 0 001 100 MAD2GAPDH 14 HeLa Z722 siRNA 2 mRNA Pcid siRNA 60 HeLa
17. 2001 M MAD2 DIRAE EHT AK Dobles et al 2007 Kops et al PO 7g B S 2000 Kalitsis B LS MC MAD2 Or Be C 0D 43 BE FY OST BSE H DS TI MAD2 MAD1 BUBR1 BUBB 40 2001 Wang et al 1997 TNF c 2004 Iwanaga et al Nelson et al 1999 ER Poelzl ez al 2000 WijgikvZzu7y iau B
18. Pcid siRNA MAD mRNA B 7c7 B B B B Pcid2 cre Pczd2 floxed B Pcid2 MAD2 mRNA Pcid2 mRNA M4D2 B Le DNA B Peid2 2 ui Nakaya T Kuwahara K Ohta K Kitabatake M
19. 20 PLAT E FILE 6 QON oe l amp 5 Jy7 r772 z RS 6 eze pFB IRES GFP Stratagene PLAT E cre B cre cre eze B Pcid2 FuGENE 6 Roche Diagnostics B cre gag 48 po 6 15 p lt 0 05
20. 22 Pcid2 a HeLa 24 Pold20XBB Coe eC ALIS ee ean Ai aes LU eget uber Doe 32 39 B Peid2 Lee 39 MAD2 40 IRAI MRNA AAI I E eet FE cnr es eaters at 41 Pr E A a Loe T RA Oats sca hn aR Rogie T 42 p HER TP 43 BS 44 1 BE B germinal center associated nuclear protein GANP mRNA GANP Shugoshin 1 mRNA Thp1 Pcid2 B eyes 0 B Peid2 APH ERA 2c B220 CD21 CD23 CD24 CD43 IgM IgD AA4 1 CD93 Poid2 mRNA RT PCR 2
21. M MAD2 MAD1 BUBR1 BUB3 CENP E p55CDC cyclin A cyclin B1 CDK1 LH LT MAD2 12 RT PCR MAD2 mRNA Peid2 siRNA mRNA p lt 0 003 E 12 o siCtrl siPcid2 SICtrl siPcid2 MAD2 cyclin A MAD 1 F1 cyclin EE suoni m m coc CNN on cA fractin w wee 12 FE Pcid2 siRNA 1oadi HeLa HeLa Pezq2 siRNA A 72 cyclin A cyc ng control B actin SUT 25 MAD2 mRNA 4 Z 27 H p 0 003 8 MAD2GAPDH 8 SICtrl siPcid2 MAD2 mRNA H MAD2 MAD1 BUBR1 BUB3 CENP E p55CDC M
22. CDC20 cell division cycle 20 CDC20 MAD2 open MAD2 0 MAD2 closed MAD2 C MAD2 2 0 MAD2 C MAD2 Sironi et al 2002 Luo et al 2004 MAD2 C MAD2 MAD1 0 MAD2 CDC20 C MAD2 CDC20 0 MAD2 C MAD2 MAD1 C MAD2 CDC20 0 MAD2 CDC20 C MAD2 BUBR1 BUB3 APC C APC C seculin seculin separase
23. IgM TIgD T1B ITgD IgM T2B gD TgM FO B MZ B AA4 1 B220 B220 AA4 1 CD21 CD23 LC FO B CD21 CD23 MZ B CD21 CD23 7 7 B C57BL 6 B B220 CD43 TgM LgD AA4 1 CD21 CD23 B Hardy 23 Pcid2 mRNA RT PCR 9 B 1 00 B 13 5 B 18 0 T1B 29 0 FO B 30 0 T2B 6 5 MZB 4 5 B B B Pecid2 8 30 c 3 25 2
24. TT2 BRILL ER PRA L 6418 ZPczd2 DNA PCR 2 eo 7oxP Peid2 floxed 72 cze B zz 6 13 Peid2 floxed B Pczd2 0CT 80 8 unDWERS GT A 7 RFF A EIC B220 Serotec Alexa 488 IgG Invitrogen TIgM Thy1 2 Alexa 594 Invitrogen
25. I 5 zdIII TT2 G418 Pczd2 7 DNA PCR 2 zeo 7oxP Zczd2 floxed 17 79 cre B Zc7g2 AR kb 4 fva 1 kb 9 0 lt J Sal E H BH Sph H Xb Ext Genmline allele Probe B Ex Exil 3 Sal H E Pst SphH Xb Targeted allele p Neo E Xb digestion loxP loxP loxP Probe B 17 B Pczg2 XEMBL3 DNA C57BL 6 Peid2 DNA Peid2 IT II neo 7o
26. B 2 B 7z7 MADZ Pcid2 B 8 1 B Pcid2 B Ig Jung et al 2006 GC SHM CSR Honjo et al 2002 0degard amp Schatz 2006 Di Noia amp Neuberger 2007 DNA H L B B B 7g B B von B hmer amp Melchers
27. DNA DNA M DNA DNA M 2 M 2 M MAD2 mitotic arrest deficient 2 Pangilinan amp Spencer 1996 gt DNA 2 M E DNA DN M M
28. 2 5 1 4 diazabicyclo 2 2 2 octan 80 BZ 8000 Keyence 6 14 cze B Pcid eze pFB IRES GFP Stratagene FuGENE 6 Roche Diagnostics PLAT E V Bde 48 1ipopolysaccharide LPS 24 7z7g fl1oxed B 8 ug ml Sigma B 48 JSAN eze 6GFP B 24 PE Annexin V BD Biosciences FACSCalibur
29. 2 Tanaka amp Hirota 2009 3 E seculin l separase MAD2 e A d Re amp i A t w 3 KERERE MAD2 Tanaka amp Hirota 2009 MAD2 open MAD2 0 MAD2 closed MAD2 C MAD2 C MAD2 MAD1 0 MAD2 CDC20 C MAD2 CDC20 0 MAD2 CDC20 C MAD2 BUBR1 BUB3 APC C 0 MAD2 open MAD2 C MAD2 closed MAD2 CDC20 cell division cycle protein 20 APC C anaphase promoting complex cyclosome 11 M
30. RNA RT PCR ZIV ENO MAD mRNA ZZ N C 5 29 HeLa Pczd2 siRNA 4D2 mRNA MAD2 VAT M4D2 mRNA mRNA zm situ RNA Peid2 siRNA HeLa M4D2 mRNA DNA M4 2mRNA 15 Pezd2 siRNA M4 2mRNA 15 Peid2 siRNA BUB3
31. GAPDH Peid2 MAD2 Peid2 MAD2 GAPDH Primer name Forward 5 3 Reverse 5 3 Real time PCR hPcid2 hPcid2 donor probe hPcid2 acceptor probe hMAD2 hMAD 2 donor probe hMAD2 acceptor probe GAPDH for human GAPDH donor probe GAPDH acceptor probe mPcid2 mPcid2 donor probe mPcid2 acceptor probe mMAD2 mMAD donor probe mMAD acceptor probe GAPDH for mouse GAPDH donor probe GAPDH acceptor probe CAAACCCACGACTTCAAATG CTCCAGAGGAGAAGTGTCAACAAGTCTTGGAA CCCCTTATGATGAAATGTTTGCAGCTCATT CAGACAGATCACAGCTACG AAATGGGAAGAGTCGGGACCACAGTTTATTAC AATTCTGAGGAAGTCCGCCTTCGTTCATTT CAGCCTCAAGATCATCAGC GGTCATCCATGACAACTTTGGTATCGTGGAA GACTCATGACCACAGTCCATGCCATCACTG GCATTCCAGGCTCACAAA GCCTGTCATGTATGCAGTAGCACTTGACCTT GGATATTTGCCAATAATGCAGACCAGCAGTT GTCCTTGAAAGATGGCAGTT TTTCATCCTGTATGGCTTTCTGGGACTTTTCT TACGAACACCTTCCTCTTTTGCAGTTTTGTCA GTTCCTACCCCCAATGTGTC CGCCTGGAGAAACCTGCCAAGTATGATG CATCAAGAAGGTGGTGAAGCAGGCATCT 6 4 siRNA TCACGGTCTGGCACTTGTAT GGCCACCATGCTATTTAC GGCCATCCACAGTCTTCT TTCCAGCATGTCTCCAAC GGCAGAAATGTCACAGTAGC GTCCTCAGTGTAGCCCAAGA HeLa 2 mML 50 uM 2 Wako Che
32. H V D 3 1 Di J Vi D H B B 7g L Dr V L B B H L B pre BCR H B L V BCR B L Ig B Monroe amp Dorshkind 2007
33. FOB AID 7g SHM CSR T2B MZB 7 FOB 39 FOB Peid MAD2 DNA HeLa Peid23 amp 342e3 UT 6 MAD2 M siRNA M M B Pcid2 MAD2 Pcid2 MAD2
34. 22 mRNA c7g 24 RT PCR B B Pc7Z2 B x 24 d Pe B lt 0 02 P 100 80 amp 60 3 tu i 40 20 Pcid2 B Pcid2 i380 Z MAD2 mRNA c7 22 B MAD2 mRNA z722 MAD2mRNA B HeLa 38 8 B 7 Peid2737 x B B Peid2 crg2 siRNA MAD mRNA Pcid2 B
35. CB Flag 722 HeLa 722 siRNA 60 1oading control UT B actin 24 Pcid2 siRNA HeLa PI 10 EH 3 10 gazp Okamoto ez ag7 2010 MAD2 BUBR1 M Kops et al 2004 SICtrl SIPcid2 SICtrl slPcid2 x5 day 2 0 0 10 10 10 103 104 100 10 10 10 103 Active caspase 3 X 10 HeLa Peid2 siRNA Peid2 siRNA HeLa PI
36. czq2 B 33 BAMBA 2 EE EC ERDER BVO AO PHB KORA BEC C6 38 Eam Ab T B PcidZ KiR v cu CEBERESABAWUS TgM IgD T1B CD21 CD24 T2B MZB CD21 CD24 FOB CD21 CD24 CD21 7CD23 MZB CD21 CD23 20 x109 3 lgM IgM TI T2 FO MZ IgD IgD MZ 20 B 722 B B 7c722 B220 mAb CD43 mAb IgM mAb TgD mAb IgM mAb HilgD mAb CD21 mAb CD23 mAb CD24 mAb B 722 B IgM IgD TIB CD21 CD24 T2B MZB CD21 CD24 FOB CD21P CD24 CD21 CD23 MZB CD21PCD23
37. Mantel amp Broxmeyer 2007 8 3 mRNA Pcid2 mRNA Z2 B siRNA GANP HeLa go7 mRNA GANP mRNA Sgol Okamoto et al 2010 mRNA mRNA mRNA 1 dmPcid2 Drosophila melanogaster PCI domain containing protein 2 mRNP
38. Sac3 Thp1 mRNA GANP Sgo7 mRNA Thp1 Pcid2 B 6 6 1 C57BL 6 CD16 CD32 Fc fluorescein isothiocyanate FITC phycoerythrin PE mAb 2 PerCP GE Healthcare FACSCalibur BD Biosciences UL FlowJo Tree Star mAb X B220 CD21 CD23 CD24 IgM IgD AA4 1 CD93 eBioscience CD43 BD Biosciences
39. 21 env Student 7 7 7 1 B Pcid mRNA B z7o2mRNA B RT PCR C57BL 6 B220 mAb CD43 mAb 1gM mAb tlgD mAb TIgM B220 B220 TgM CD43 B220 B B220 TgMCD43 B B220 IgM CD43 B TgM B220 B220 TgM IgM TIgD B B220 TgM IgD BAT B220 mAb TgM mAb TgD mAb AA4 1 mAb CD21 mAb CD23 mAb T1B T2B AA4 1 B220 B220 AA4 1
40. DNA SHM CSR ATD DNA NHEJ nonhomologous end joining Puebla 0sorio amp Zhu 200 A r1 8 NHEJ DNA DNA G1 5 Rothkamm et al 2003 p53 Zhu et aL 2002 B DNA DNA Tus CD19 220 B 6 i 3 Pre BCR lgMPlgD IgM ilgDhi IgMYlgD CD21 CD23 B B 1 e Xp Nub e e o 6 6 _ amp lt IgH 38 rg CSR IgM D
41. B 7c722 MPcid mRNA B GPeidZ B B 18 CD19 B 7g2 o Pro B eu Pre B Immature B 100 100 100 l eo T so so 3 60 8 60 8 60 3 P Q Q Q E 2 E 20 E 20 0 0 0 Pcidz B Pcid2 Pcidd B Pcid2 Pcidd B Pcid2 18 B Pczd2 Zcezd2 B 7gd2 Pcid2 mRNA B B B B 722 B220 B220 19 x107 Peiddt 1 H B 2cia2 Total Non B B 19 BA REEERJPoidZ KiH 7 AICBU 2 BRE Ja BAILE EE Pe idZIK 8 v 7 AD EURO ARA Total B220 Non B B220 B B
42. B M B B 8 2 M MAD2 et al M BUBRI MAD2 siRNA ML fe M 2004 Kalitsis ez al 2007 MAD2 0 Neill etal 2000 Baker et al MAD2 MAD1 BUBR1 BUB3 WM 2004 Iwanaga et al Michel et al 2000 Michel et al
43. mRNP mRNA ribonucleo protein complexes mRNA Luna et al 2008 mRNP THO THO Tho2 Hpr1 Mft1 Thp2 4 RNA II Ch vez et al 2000 Jimeno et al 2002 Luna et al 2005 THO mRNA RNA ATP Sub2 mRNA Yral TREX Transcription EXport complex Strasser et al 2002 TREX Sub2 mRNA mRNA Le Hir et al 2001 mRNA Yra1 mRNA Mex67 mRNP Stutz et al 2000 mRN
44. 1 Ig KA BANU HS d 0 HI LL TEAS 60 X class switch recombinetion CSR somatic hypermutation SHM 7 activation induced 8 cytidine deaminase AID DNA Dudley et al 2005 Casali et al 2006 GC B 7zs7 C Cp Cy Cg Co Cj 5 TRI DNA CSR DNA Honjo et al 2002 SHM 0degard amp Schatz 2006 REN COV D J RAG
45. 48 HeLa MG132 10uM DMSO 10uM 4 6 MAD2 1oading controle UT B actin CR Pcid2 siRNA 60 HeLa MAD2 REST loading control B actin M4 2 mRNA MAD2 Z2 REST situ RNA z7g2 2mRNA MAD2 31 7 3 Pcid2O BANAL RIETER Pezd2 B B Pczd2 Zezd2 I II neo 7oxP neo
46. in B1 CDK1 CH RT PCR 722 siRNA L348 CAR Pcid siRNA siRNA 65 siRNA MAD25 BUBRI amp FE S Bil U MU 4 HeLa 7 32 103 31 496 c722siRNA 66 18 102 17 596 13 Kops ez al 2004 MAD2 CTRL siRNA 25 zi 20 m 15 10 9 0 P Ka of o od 6938 o D Wo 35 gt Pc d2 siRNA 25 z 20 10 5 0 SISO o odo amp 6 o JS Eo dba US P 13 HeLa 722 siRNA 7g2siRNA 4 HeLa
47. 5go7 mRNA GANP Sgo7 GANP Sac3 GANP GANP Sac3 Sgo7 mRNA GANP mRNA Mex67 NXF1 gazz mRNA Wickramasinghe et al 2010 14 TA Sac3 GANP mRNA 5 2 B GANP Kuwahara et al 2000
48. T2 B 6 5 B 4 5 B B Ig Pcid2 Peid2 siRNA HeLa MAD M MAD2 MAD mRNA Perd2 siRNA MAD2 M4D2 mRNA Suppressor of actin 3 Sac3 Tho phenotype 1 Thp1 3 insituRNA
49. MADI increases the incidence of tumors in mice Cancer Res 67 160 166 Jimeno S Rond n A G Luna R and Aguilera A 2002 The yeast THO complex and mRNA export factors link RNA metabolism with transcription and genome instability EMBO J 21 3526 3535 Jung D Giallourakis C Mostoslavsky R and Alt F W 2006 Mechanism and control of V D J recombination at the immunoglobulin heavy chain locus Annu Rev Immunol 24 541 570 Kalitsis P Earle E Fowler K J and Choo K H 2000 Bub3 gene disruption in mice reveals essential mitotic spindle checkpoint function during early embryogenesis Genes Dev 14 2211 2282 Kondo E Nakamura S Onoue H Matsuo Y Yoshino T Aoki H Hayashi K Takahashi K Minowada J Nomura S and Akagi T 1992 Detection of bcl 2 protein and bcl 2 messenger RNA in normal and neoplastic lymphoid tissues by immunohistochemistry and in situ hybridization Blood 80 2044 2051 46 Kops G J Foltz D R and Cleveland D W 2004 Lethality to human cancer cells through massive chromosome loss by inhibition of the mitotic checkpoint Proc Natl Acad Sci USA 101 8699 8704 Krege J H Hodgin J B Couse J F Enmark E Warner M Mahler J F Sar M Korach K S Gustafsson J A and Smithies 0 1998 Generation and reproductive phenotypes of mice lacking estrogen receptorB Proc Natl Acad Sci USA 96 15677 15682 Kuwahara
50. R Jimeno S Marin M Huertas P Garc a Rubio M and Aguilera A 2005 Interdependence between transcription and mRNP processing and export and its impact on genetic stability Mol Cell 18 711 722 Mantel C R and Broxmeyer H E 2007 A new connection between the spindle checkpoint asymmetric cell division and cytokine signaling Cell Cycle 6 144 146 Michel L S Liberal V Chatterjee A Kirchwegger R Pasche B Gerald W Dobles M Sorger P K Murty V V and Benezra R 2001 MAD2 haploinsufficiency causes premature anaphase and chromosome instability in mammalian cells Nature 409 355 399 Monroe J G and Dorshkind K 2007 Fate decisions regulating bone marrow and peripheral B lymphocyte development Adv Immunol 95 1 50 Nelson K K Schl ndorff J and Blobel C P 1999 Evidence for an interaction ofthe metalloprotease disintegrin tumour necrosis factor a convertase TACE with mitotic arrest deficient 2 MAD2 and of the metalloprotease disintegrin MDC9 with a novel MAD2 related protein MAD2B Biochem J 343 673 680 Nemazee D and Hogquist K A 2003 Antigen receptor selection by editing or downregulation of V D J recombination Curr Opin Immunol 15 182 189 Odegard V H and Schatz D G 2006 Targeting of somatic hypermutation Nat Rev Immunol 6 573 583 48 Okamoto N Kuwahara K Ohta K Kitabatake M Takagi K Mizuta H Kondo E
51. Toda T Takeda N Tani T Kondo E and Sakaguchi N Critical role of Pcid2 in B cell survival through the regulation of MAD2 expression J Immunol 185 5180 5187 2010 3 Ab APC APC C DMEM FITC FO GANP GFP LPS MZ mAb nt PBS POR PE PI RT PCR Sac3 SDS PAGE Sgol siRNA Thpl antibody allophycocyanin anaphase promoting cmplex cyclosome Dulbecco s modified Eagle medium fluorescein isothiocyanate follicular germinal center associated nuclear protein green fluorescent protein lipopolysaccharide marginal zone monoclonal antibody nucleotide phosphate bufferd saline polymerase chain reaction phycoerythrin propidium iodide reverse transcription polymerese chain reaction suppressor of actin 3 sodium dodecyl sulfate pol
52. 2010 B 50 Nemazee amp Hogquist 2003 B RAG DNA UJ Ig BCR Pezd2 B MAD2 B T1 B RAG Roy et al 2005 T1 B Pczd2 TI B B MAD2 GC
53. Cell Biol 23 5706 5715 49 Roy V Chang N H Cai Y Bonventi G and Wither J 2005 Aberrant IgM signaling promotes survival of transitional TI B cells and prevents tolerance induction in lupus prone New Zealand black mice J Immunol 175 7363 7371 Sironi L Mapelli M Knapp S De Antoni A Jeang K T and Musacchio A 2002 Crystal structure of the tetrameric Madl Mad2 core complex implications of a safety belt binding mechanism for the spindle checkpoint EMBO J 21 2496 2506 Strasser K Masuda S Mason P Pfannstiel J Oppizzi M Rodriguez Navarro S Rondon A G Aguilera A Struhl K Reed R and Hurt E 2002 TREX is a conserved complex coupling transcription with messenger RNA export Nature 417 304 308 Stutz F Bachi A Doerks T Braun I C Seraphin B Wilm M Bork P and Izaurralde E 2000 REF an evolutionary conserved family of hnRNP like proteins interacts with TAP Mex67p and participates in mRNA nuclear export RNA 6 638 650 Takeda M Dohmae N Takio K Arai K and Watanabe S 2001 Cell cycle dependent interaction of Mad2 with conserved Boxl 2 region of human granulocyte macrophage colony stimulating factor receptor common fc J Biol Chem 276 41803 41809 Tanaka K and Hirota T 2009 Chromosome segregation machinery and cancer Cancer Sci 100 1158 1165 Toda T Kitabatake M Igarashi H and Sakaguchi N 2009 The im
54. K Yoshida M Kondo E Sakata A Watanabe Y Abe E Kouno Y Tomiyasu S Fujimura S Tokuhisa T Kimura H Ezaki T and Sakaguchi N 2000 A novel nuclear phosphoprotein GANP is up regulated in centrocytes of the germinal center and associated with MCM3 a protein essential for DNA replication Blood 95 2321 2328 Kuwahara K Fujimura S Takahashi Y Nakagata N Takemori T Aizawa S and Sakaguchi N 2004 Germinal center associated nuclear protein contributes to affinity maturation of B cell antigen receptor in T cell dependent responses Proc Natl Acad Sci USA 101 1010 1015 Le Hir H Gatfield D Izaurralde E and Moore M J 2001 The exon exon junction complex provides a binding platform for factors involved in mRNA export and nonsense mediated mRNA decay EMBO J 20 4987 4997 Lei E P Stern C A Fahrenkrog B Krebber H Moy T I Aebi U and Silver P A 2003 Sac3 is an mRNA export factor that localizes to cytoplasmic fibrils of nuclear pore complex Mol Biol Cell 14 836 847 Luo X Tang Z Xia G Wassmann K Matsumoto T Rizo J and Yu H 2004 The Mad2 spindle checkpoint protein has two distinct natively folded states Nat Struct Mol Biol 11 338 345 47 Luna R Gaillard H Gonz lez Aguilera C and Aguilera A 2008 Biogenesis of mRNPs integrating different processes in the eukaryotic nucleus Chromosoma 117 319 331 Luna
55. SSC mAb Roche Diagnostics 50 TIgG Jackson ImmunoResearch Laboratories 40 Hoechst33258 etal 1992 siRNA 2 6 11 BUS Hela siRNA 4 3 1 24 5 LeicaDM2000 LeicaDFC420 6 12 B z722 Peid F 7 Js DNA AEMBL3 DNA C57BL 6 vA Boe TI II neo neo 1 5 fl Hind IIL 7ox pMCDT A ATT pau
56. and Sakaguchi N 2010 Germinal center associated nuclear protein GANP is involved in mRNA export of Shugoshin 1 required for centromere cohesion and in sister chromatid exchange Genes Cells 15 471 484 O Neill T J Zhu Y and Gustafson T A 1997 Interaction of MAD2 with the carboxyl terminus of the insulin receptor but not with the IGFIR Evidence for release from the insulin receptor after activation J Biol Chem 272 10035 40 Pangilinan F and Spencer F 1996 Abnormal kinetochore structure activates the spindle assembly checkpoint in budding yeast Mol Biol Cell 7 1195 1208 Poelzl G Kasai Y Mochizuki N Shaul P W Brown M and Mendelsohn M E 2000 Specific association of estrogen receptor p with the cell cycle spindle assembly checkpoint protein MAD2 Proc Natl Acad Sci USA 97 2836 2839 Puebla Osorio N and Zhu C 2008 DNA damage and repair during lymphoid development antigen receptor diversity genomic integrity and lymphomagenesis Immunol Res 41 103 122 Rodriguez Navarro S Fischer T Luo M J Antunez 0 Brettschneider S Lechner J Perez Ortin J E Reed R and Hurt E 2004 Susl a functional component of the SAGA histone acetylase complex and the nuclear pore associated mRNA export machinery Cell 116 75 86 Rothkamm K Kruger I Thompson L H Lobrich M 2003 Pathways of DNA double strand break repair during the mammalian cell cycle Mol
57. 2 connects transcription elongation with mitotic recombination in Saccharomyces cerevisiae EMBO J 19 5824 5834 Ciccarelli F D Izaurralde E and Bork P 2003 The PAM domain a multiprotein complex associated module with an all alpha helix fold BMC Bioinformatics 4 64 Di Noia J M and Neuberger M S 2007 Molecular mechanisms of antibody somatic hypermutation Annu Rev Biochem 76 1 22 Dobles M Liberal V Scott M L Benezra R and Sorger P K 2000 Chromosome missegregation and apoptosis in mice lacking the mitotic checkpoint protein Mad2 Cell 101 635 645 44 Dudley D D Chaudhuri J Bassing C H and Alt F W 2005 Mechanism and control of V D J recombination versus class switch recombination similarities and differences Adv Immunol 86 43 112 Farny N G Hurt J A and Silver P A 2008 Definition of global and transcript specific mRNA export pathways in metazoans Genes Dev 22 06 78 Fischer T Str sser K R cz A Rodriguez Navarro S Oppizzi M Ihrig P Lechner J and Hurt E 2002 The mRNA export machinery requires the novel Sac3p Thplp complex to dock at the nucleoplasmic entrance of the nuclear pores EMBO J 21 5843 5852 Fischer T Rodriguez Navarro S Pereira G Racz A Schiebel E and Hurt E 2004 Yeast centrin Cdc31 is linked to the nuclear mRNA export machinery Nat Cell Biol 6 840 848 Gallardo M Luna R Erdjumen
58. 20 Y 15 F N G tof N S gt s E Pro B Pre B Imm B Ti T2 FO MZ BM Spleen B cells w 8 B B Peid2 mRNA B 1 5x10 RNA RT PCR Ceid mRNA HEL LC GAPDH FAV Tz 23 7 2 Peid2003 amp SgntBlic k 5 HeLaBa Of at Js E c RET ROSE 7 siRNA z7 2 mRNA RT PCR 20 9 F1ag 7c7 HeLa siRNA F1ag Pcid2 9 HeLa siRNA 40 SiCtrl siPcid2 actin siCtrl siPcid2 Reve P Pcid2 GAPDH 9 HeLa Pcid siRNA mRNA siRNA 48 RT PCR 722 mRNA 4ZZ
59. A nmRNP Yral 2 Mex67 Mtr2 Gruter et al 1998 Thp1 GANP Sac3 mRNA Fischer et al 2002 Thp1 Pcid2 PAM PCI Proteasome COP9 Initiation factor PINT Proteasome Int 6 Nip 1 and TRIP 15 associated module PINT 399 Ciccarelli etal 2003 Thp1 Sac3 Cdc31 SAGA Spt Ada Gcn5 Acetyltransfe rase Sus1 TREX2 Gallardo et al 2003 Fischer et al 2004 Rodriguez Navarro et al 2004 TREX2
60. Bl Thermo Fisher Scientific B actin Sigma Aldrich 1 5 horseradish peroxidase TIgG H L Ab Zymed 1 5 ECL GE Healthcare 6 9 RNA RNA PBS 4 5 Okamoto et al 2010 2 500 rpm 5 Hx 15 000 rpm 20 RNA TRIzol Invitrogen 18 HeLa siRNA Cee L TREL 6 10 in situ RNA MAD2 261 618 nt BUB3 340 642 nt cDNA pGEM 3Z2 RNA labeling in vitro transcription kit Roche Diagnostics Kondo HeLa 4 50 C 16
61. OMA1 IgM CR Alexa488 IgG Alexa549 SAv x400 300 um o B Zczd2 cere Pcid9 floxed PcidZ B B Peid B LPS 5 pg ml 24 cze cre B B RNA RT PCR cz 6 B Peid2 mRNA e7g 7 Ctr1 B 6 22 MAD2 mRNA 7 22 Annexin V B c7g2 71 Ctr1 B c7g Cre B 22 mRNA B
62. Pcid2 c722 siRNA HeLa mRNA RT PCR in situ RNA 4 mRNA 3 Peid2 O B Pczd2 floxed 79 cre B zz B z72 mRNA cze Pcid2 floxed B B 7z7 RT PCR Peid2 MAD2 mRNA 722mRNA B 1 0 B 13 5 RZA B 18 0 T 1 B 29 0 B 30 0
63. RAG NA 1 7g B Monroe amp Dorshkind 2007 B B B B B T 1 T2 FO MZ B V D J RAG IC Ko CHAAR EA RA B CSR SM Pre BCR Pre B cell receptor RAG recombination activating gene CSR class switch recombination SHM somatic hypermutation 9 5 1 2 M MAD2 DNA M G1 nN G bo H DNA
64. Takeda et al 2001 c kit Ito et al 2007 ER oc B 2 ER B ER B Krege ez al 1998 ER B MAD2 Poelzl et al 2000 MAD2 Gorbsky et al 1998 ER B M ER B MAD2 MAD2 Ito etal 2007 Mantel MAD2 c kit DARDA Hille
65. Title LL E EL EL E ET D EE EE E Kumamoto University Repository System HHHHnRNWIHHHHHHHPed4HHHH HHH HHHHHHUHHHHH Author s OU UU Citation Issue date 2011 02 25 Type Thesis or O ssertati on htt p hdl handl e net 2298 22184 Kumamoto University ie X Doctoral Thesis mRNA Pcid22 B Identification of the mammalian mRNA export molecule Pcid2 and the study of its involvement in cell cycle regulation of B cells Teruo Nakaya Wn Au Gi mue MEKBI aM 2011 3 OF gp ue ccbet 5 1 1 5 1 2 5 1 3 5 1 4 Oat 6 1 6 2 6 3 6 4 6 5 6 6 6 7 6 8 6 9 6 10 6 11 6 12 6 13 6 14 6 15 T 1 7 2 1779 8 1 8 2 8 3 8 4 10 3 LOU RADIO 4 nP o pa EET 5 SS d 6
66. m MCCC M oa 9 Seles bad apnea Seaton ala faeries boise ate Gaede 7 MEDAR aa ee a eg Ea Ae RE Be cele ate te a Sod te Re ahha ae atk 8 8 B 8 M MAD scene iex De e eee RI 10 MAD2 REST Ocal led alee attuare entr bed ty 12 mRNA 13 Ei H rH 15 Eo poA DR MP CEN Pp 16 16 MRNA ire CDNA S DC acc cutie thie deat intent this Satie dnce prdus ae 16 pm RT PCR yee ote Metre A n the GT a dot he Rayos 16 siRNA eM esca VATA o ORE MT eae tenis tap Pg ot ier da aay 17 AETA S Eu UD RUD wx ha ob tur PORUM RES OUS POSUER Ad RP PUN 18 D RM LET 18 DEAA US AS RS ORR aM CIUS ettet a eter 18 RNA RNA OO MEUS SO Le rue RE Won PCSPTIA QUODIUY XE 18 stg RNIN 19 217 c0 NC 19 B Peia2 19 apo An rU 20 in vitro cre Bn T STE B Pezd2 20 DON iced aa Lx ege Bites dad o dra Dad e PUE estie Dada tees 22 B Pcid2 mRNA
67. mature B cell subpopulation with low RAGI expression is increased in the autoimmune New Zealand Black mouse Eur J Immunol 39 600 611 von B hmer H and Melchers F 2010 Checkpoints in lymphocyte development and autoimmune disease Nat Immunol 11 14 20 50 Wang Q Liu T Fang Y Xie S Huang X Mahmood R Ramaswamy G Sakamoto K M Darzynkiewicz Z Xu M and Dai W 2004 BUBRI deficiency results in abnormal megakaryopoiesis Blood 103 1278 1285 Wickramasinghe V 0 McMurtrie P I Mills A D Takei Y Penrhyn Lowe S Amagase Y Main S Marr J Stewart M and Laskey R A 2010 mRNA export from mammalian cell nuclei is dependent on GANP Curr Biol 20 25 31 Zhu C Mills K D Ferguson D 0 Lee C Manis J Fleming J Gao Y Morton C C Alt F W 2002 Unrepaired DNA breaks in p53 deficient cells lead to oncogenic gene amplification subsequent to translocations Cell 109 811 821 51
68. micals 200 U ml G 0 1 mg ml Meiji Seika 1096 v v Sigma DMEM Invitrogen o siRNA Lipofectamine RNAiMAX Invitrogen Stealth RNAi duplexes Invitrogen 10 nM Stealth RNAi duplexes Primer name Forward 5 3 i Reverse 5 3 siRNA hPcid2 siRNA scrambled control siRNA 6 5 HeLa siRNA UGCACAAGAUGCUCCAUCUCUGCUG UGCGUAGAACCGUAACCUCUCUCUG 17 CAGCAGAGAUGGAGCAUCUUGUGCA CAGAGAGAGGUUACGGUUCUACGCA PBS PI YK propidium iodide 0 1 mg ml RNaseA 20 ug ml 60 FACSCalibur CHIE FlowJo siRNA 48 DO ng ml 40
69. t Bromage H Tempst P and Aguilera A 2003 Nab2p and the Thplp Sac3p complex functionally interact at the interface between transcription and mRNA metabolism J Biol Chem 278 24225 24232 Gorbsky G J Chen R H and Murray A W 1998 Microinjection of antibody to Mad2 protein into mammalian cells in mitosis induces premature anaphase J Cell Biol 141 1193 1205 Guardavaccaro D Frescas D Dorrello N V Peschiaroli A Multani A S Cardozo T Lasorella A lavarone A Chang S Hernando E and Pagano M 2008 Control of chromosome stability by the beta TrCP REST Mad2 axis Nature 452 365 369 Gruter P Tabernero C von Kobbe C Schmitt C Saavedra C Bachi A Wilm M Felber B K and Izaurralde E 1998 TAP the human homolog of Mex67p mediates CTE dependent RNA export from the nucleus Mol Cell 649 659 45 Honjo T Kinoshita K and Muramatsu M 2002 Molecular mechanism of class switch recombination linkage with somatic hypermutation Annu Rev Immunol 20 165 196 Ito S Mantel C R Han M K Basu S Fukuda S Cooper S and Broxmeyer H E 2007 Mad2 is required for optimal hematopoiesis Mad2 associates with c Kit in MO7e cells Blood 109 1923 1930 Iwanaga Y Chi Y H Miyazato A Sheleg S Haller K Peloponese J M Jr Li Y Ward J M Benezra R and Jeang K T 2007 Heterozygous deletion of mitotic arrest deficient protein 1
70. x eo 1 5 zdIIT pMCDT A ATT pau TT2 G418 Pcid2 DNA PCR 2 z eo 7ox z7 f1oxed 72 cze B 722 CR 7ox B zoRI 4 al 9 0 kb 3 5 kb E EcoRI H HindIII Xb Xbal 32 B 7g2 z722 B B B c722mRNA
71. yacrylamide gel electrophoresis shugoshin 1 small interfering RNA Tho phenotype 1 5 5 1 5 1 1 B B Ig B B B220 CD43 B B220 CD43 IgM B B220 IgWIgD COR Ws T 1 B220AA4 1 TgM TgD T2 B2207AA4 1 TgM TgD FO B220 AA4 1 TgD TgM CD21 CD23 MZ B220 AA4 1 TgD TgMCD21 CD23 B Monroe amp Dorshkind 2007 7g V D recombination activating gene RAG DNA 7g RAG B
Download Pdf Manuals
Related Search
Related Contents
"取扱説明書" Manual de Usuario Transferencias Internacionales 20 PM - PIANO DI MANUTENZIONE Typhoon Digital Multi-Media Player - Bio-Rad User manual BETSO SBOX-1N Highly accurate Time Code Screenwriter 2000 (4.x) User Manual 5330/5340 Phone User Guide e-manual Copyright © All rights reserved.
Failed to retrieve file