Home

犬腫瘍における L-type amino acid transporter

image

Contents

1. HELE FRE POT CR RE SP Se A LT TE PB BS RR PRI 66 1 Abraham J A Hornicek F J Kaufman A M Harmon D C Springfield D S Raskin K A Mankin H J Kirsch D G Rosenberg A E Nielsen G P Desphpande V Suit H D DeLaney T F and Yoon S S 2007 Treatment and outc
2. 42 80 42 80 L 1 L type amino acid transporter 1 LATI Na JE 12 1 35 39 49 57 62 70 75 92
3. 69 4F2 LATI mRNA 7472 mRNA 4F2 mRNA 4F2 LATI LAT2 LATI mRNA LAT2 mRNA 4F2 mRNA 4F2 LAT1 LAT2 RNN 4F2 5 LATI LAT2
4. LATI mRNA LATI mRNA 3 4F2 mRNA 4 LATI mRNA 4F2 mRNA LAT2mRNA 4F2 mRNA LATI 272 mRNA we SAE COO LIL LATI mRNA 45 LATI
5. LATI mRNA 7477 mRNA LAT1 PET LATI 4F2 mRNA 21 26 35 93 43 LATI mRNA
6. 20 2 7472 mRNA LAT2 mRNA 0 090 0 14 0 34 0 31 4 1 Ed 9 0 043 0 076 0 102 0 11 0 050 0 051 0 010 0 0076 0 18 0 30 0 20 0 32 0 076 0 082 0 19 0 16 0 076 0 032 0 080 0 026 0 081 0 057 P lt 0 05 10 1 3 1 4 1 8
7. 3 0 1N NaOH LSC 6000B Hitachi Aloka Medical Ltd Tokyo Japan H L LAT1 BCH LPM 1ICso 3 WST 8 CHM M LATI 96 5x10 DMEM 2mM L 10 FBS 37C 3 CO gt 24 DMEM BCH LPM
8. LATI LATI mRNA 30 MALLT OF mRNA qRTrPCR Nakanishi LAT1 LAT1 79 1 52 2 LATI mRNA 65 2 65 1 mRNA 7477 mRNA
9. SD SB Eg 25 to o e m morb LO OO 4 tn tn QN CON 10 2 4 10 4 16 61 21 SD T1 T2 T3 26 5 3 0 2 6cm 2 0cm 0 5 11cm 45 21 10 7 42 3 22 17 41 21 17 1 1 1 41 19 22 Fe 6 F27 EZ SD
10. LATI mRNA tem LAT1 Eg 82 EAE LATI LAT2 mRNA LAT1 REG VOTER EB LAT1 5
11. LATI mRNA BM Cl LATI 64 LAT1 BHC melphalan vitro in vivo LATI mitoxantrone melphalan LATI
12. NN OA ee 1 48 ICz gt ICs BHC 30 000 melphalan 100 ICs 300 BCH melphalan BCH LAT1 LAT2 62 39 85 9 CHM M LAT2 LATI melphalan LATI LAT2 LAT LATI
13. 4F2 mRNA 1 0 1 1 0 79 0 49 4F2 mRNA 16 WIRE EHH zT a 0 81 0 42 0 76 0 54 P lt 0 05 Bd 16 0 97 0 51 0 58 0 25 P lt 0 05 E16 22 4 7477 7472 4F2 mRNA LATI 4F2 mRNA 7472 4F2 mRNA LATI LAT mRNA OED HOF
14. Tamoxifen HER2 Trastuzumab 83 LATI 21 LAT1 LATI LATI ICso BCH melphalan 1 6 0 05 uM 0 16 0 05 uM LAT1 ICs BCH melphalan 48 2 3 5 mM 18 9 234M ICs
15. 33 39 49 57 62 70 75 92 LATI Ue aA AA A VO yy eae i 3 e 7S 23 A 29 87 LATI LAT1 17 27 29 74 LATI
16. 11 7472 mRNA ROC Youden index LAT2 mRNA REL 0 071 78 S 81 5 79 5 9 7472 mRNA 0 049 0 096 0 03740 053 7472 mRNA K 12 0 038 0 073 0 035 0 025 LAT2 mRNA
17. LATI mRNA LATI mRNA Thompson LAT1 LAT2 LAT1 LATI mRNA LAT2 mRNA 4F2 mRNA ies 2 LAT2 mRNA LATI mRNA 44
18. 4F2 mRNA Nor MGT MM HSA TCC TT 7477 mRNA qRT PCR 7477 mRNA REL AP79 4F2 mRNA P lt 0 05 4F2 mRNA REL REL 40 Li 18 e 5 1 6 a e 4 1 8 3 12 8 3 x I 9 1 amp os e u 2 e 06 i 04 0 02 0 0 bd e S S S 2 e 1 8 1 6 14 S e Sox i 3 0 6 e g 0 4 4 r 23 P 0 05 0 16 4F2 mRNA
19. LAT1 LAT2 4F2 LATI LAT1 Le LATI mRNA LATI mRNA LAT2 4F2 LATI 7477 mRNA 4F2 mRNA
20. LAT1 LAT1 VED we 65 ERE
21. LAT1 BCH melphalan LATI ICs P lt 0 05 11 LAT1 BCH LATI LAT2 39 85 92 BCH in vivo LAT2 14 doxorubicin 10 cyclophosphamide vincristine vinblastine 91 WRO in vivo LATI melphalan mitoxantrone melphalan mitoxantrone
22. 4F2 mRNA 3 71 ES 36 73 87 LATI 4F2 mRNA X 17 23 3 an 3 83 25 15 10 7 6 3 4 5 ALPS Se heise 5 SD 9 8 3 0 107 4 17 80 40 27 21 24 4 gt FJ
23. 3 mRNA 7477 7472 4F2 mRNA 1 qRT PCR ETIT UE 4 LAT1 LAT2 4F2 1 LATI LAT2 4F2 mRNA OU 0 05 7 LATI LAT2 4F2 mRNA ROC Youden index 7477 7472 4F2 mRNA 7477 7472 18 4F2 mRNA LATI LAT2 4F2 mRNA
24. Lane 1 MCF 7 Lane 2 Lane 3 Lane 4 Lane 5 AJE Lane 6 HIRIS Lane 7 Lane 8 Lane 9 Lane 10 Lane 11 Lane 12 mock control 29 2 1 10 109 S P lt 0 01 2 D 10 103 104 e 105 T EA SS lt 5 LATI mRNA Nor TT 7477 mRNA qRT PCR 7477 mRNA REL AP7 LATI mRNA P lt 0 01 Q REL REL 30 10 Hm 109 9 i 10 J jo e 103 107 e 105 S S dw gv vA X o SLPS LL sg v a 6 idi kok kk kk k e i e e 8 e e 9 e e P lt 01 A y v LATI mRNA Nor LAT mRNA
25. crc melphalan DNA DNA LATI 4F2 melpahaln melpahlan LAT1 24 melpahlan LAT1 BHC 5 1
26. Gb R LATI LAT1 LAT1 LAT1 1 LATI 2 LATI 1 LATI 3 LATI LATI
27. CHM M RCM KI RCM SA RCM Mc RCM Mp CHM M 31 31 RCM KI RCM SA RCM Mc RCM Mp II 46 50 DMEM Life Technologies 2 mM L glutamine 10 50 IU mL 50 ugm 5 CO 37 C 10cm 70 80 PBS 0 25 Trypsin EDTA Iml 37C 5 CO 5 9ml 10ml
28. 22 81 50 22 50 4 78 LAT1 LATI LAT1 2 1
29. 7472 BE MT IV LAT mRNA ND PT LAT2 mRNA AT REL REL 37 10 t 109 E 5 x 10 lt 0 05 S e X 13 4F2 mRNA Nor TT 4F2 mRNA qRT PCR 4F2 mRNA REL AP79 4F2 mRNA i P 0 05 REL REL 38 10 8 o 1 6 3 2 oe 10 5 3 oe ts
30. 14 92 LAT1 LATI LAT1 _ 1 LATI LAT2 4F2 2 2 1 RE 4 6 SH n 4 5 n 6 n 6 n 6 n 6 n 6 n 6 n 6
31. LAT2 4F2 Ed 4 3 LATI LAT2 4F2 mRNA 1 LAT mRNA 477 mRNA 0 84 1 1 0 124 0 27 6 P lt 0 01 Ed 5 0 026 0 027 32 P lt 0 01 19 0 70 0 91 0 45 0 43 2 12 3 0 9740 94 0 52 0 51 0 334 0 34 0 84 0 74 0 88 0 55 0 82 0 52 1 2 0 50 0 67 0 57 P lt 0 0
32. Aum LATI LAT2 4F2 mRNA OU U P 0 05 2010 SSRI IC Origin 7 software Origin Lab 3 1 LAT1 LAT2 4F2 1 LATI LAT2 4F2 mRNA LATI LAT2 4F2 mRNA Te LATI mRNA 0 026 0 038
33. LAT Nakada 2013 35 LATI LAT1 35 LAT1 LATI LATI LAT1 LATI 4F2 34 LATI
34. 121 C 15 mitoxantrone melphalan mitoxantrone Smg m IV 3 melphalan 0 1mg kg PO SID 30 90 3 10mg kg 4 4 HE HE 8 50
35. 4F2 mRNA qRT PCR 4F2 mRNA REL AP79 472 BE MT RE IV ND 4F2 mRNA PT 4F2 mRNA AT P lt 0 05 REL REL 41 LAT2 REL 0 2 6 8 LATI REL 4F2 REL 32 U9 4 UA OS oosc a 4F2 REL 0 0 2 0 4 0 6 0 8 1 1 2 LAT2 REL d 17 7477 7472 4F2 mRNA LATI LAT2 4F2 mRNA qRT PCR LATI mRNA
36. r477 mRNA LAT2 41 65 75 LAT2 LAT2 ee 1 r 472 mRNA LATI LAT2 LATI LAT2
37. 1 melphalan mitoxantrone 52 CHM M 100mm 31 melpahalan mitoxantrone melphalan mitoxantrone 4 242 1 153 mm 1 399 512mm 322 277mm 67 67mm P lt 0 01 22 mitoxantrone melphalan mitoxantrone melphalan mitoxantrone P lt 0 05 22 melphalan mitoxantrone 2
38. 42 60 90 5 cDNA cDNA PCR 80C 3 RT PCR qRT PCR qRT PCR mRNA PCR Accession number 1 qRT PCR Quantitect SYBR Green PCR kit Qiagen iQS MyiQ Single Color Bio Rad Laboratories pSTBlue 1 Novagen 105 10 38k O3 10 mRNA
39. 5 72 F i jm jm FAOK basic fetoprotein Es E 21 FER 688 AJE FARE MEERI 2 6 19 20 28 59 a fetoprotein 19 8 16 30 37 45 52 1 5 79 3 2 225 b
40. 72 C for 30sec 72 C for 30sec 72 C for 30sec 72 C for 30sec Accession No XM_ 845083 dog AF 104032 human XM_ 540898 dog AF 171669 human XM 540898 dog AB018010 human XM_538673 dog NM 001022 human Protein Antibody Protein size KDa Dilution rate LATI Primary antibody rabbit antihuman LATI polyclonal IgG 39 Primary 1 1 000 Cell Signaling Technology Secondary 1 30 000 LAT2 Primary antibody rabbit antihuman LAT2 polyclonal IgG 58 Primary 1 500 Abcam Secondary 1 20 000 4F2 Primary antibody rabbit antihuman 4F2 polyclonal IgG 98 Primary 1 1 500 Abcam Secondary 1 20 000 IgG Secondary antibody goat antirabbit IgG HPE IgG Cell Signaling Technology KDa kilodalton HPE Horseradish peroxidase labeled 3 1 7477 7472 4F2 mRNA LATI mRNA BFS 0 84 0 21 0 79 0 18 0 064 0 022 0 056 0 024 0 031 0 035 0 022 0 018 0 017 0 015 0 0093 0 0081 0 0062 0 0026 0 012 0 0082 0 0372 0 024 0 0066 0 0023 0 0021 0 0023 0 026 0 038 LATI mRNA P lt 0 05
41. 0 25 Trypsin EDTA 1ml 37C 5 CO 5 9ml 10ml 1 0x 10 37C 5 CO 3 1 total RNA tRNA RNeasy Mini kit QIAGEN RNase free DNase kit QIAGEN tRNA tRNA cDNA 80C 2 cDNA tRNA biospecnano SHIMADZ tRNA ug ul lpg total RNA HE BAT ZAIRE MilliQ I2 5xReaction Buffer Toyobo 4 10mM dNTP Takara 2ul OligodT Toyobo lul ReverTra Ace Toyobo lul 20ul
42. 2 2010 SSRI 3 1 83 25 1 10 7 6 S 3 4 5 5 9 84 3 0 me 10 4 17 80 40 27 21 X 3 4 6 2 LATI LAT2 4F2 LAT1 LAT2 4F2 LAT1
43. BE 45 ALTOJ 11 D ROR HE JOD TER 72 80
44. L type amino acid transporter 1 LAT1 LAT1 L type amino acid transporter 1 LAT1 LAT1 dE 2013 1 EET 2 4 I LATI 5 16 1 5 2 5 9 3 10 13 4 GR 14 15 5 15 16 I LATI 17 45 1 FRX 17 2 17 19 3 19 42 4 BR 43 44 5 44 45 AM LATI 46 63 1 FRSC 46 2 46 51 3 51 60 4 AER 61 63 5 63 64 65 66 67 79 JE EB OD FEARS 10
45. LAT2 AM HEIN EU e 4F2 10 cell membrane 4F2 LAT lor2 1 LATI LAT2 4F2 LATI LAT2 12 4F2 36 73 87 11 10 73 P lt 0 05 107 e e tle Hin 2 4 10 E 8 ps ry L a ee ee 10 e e i 107 RR O5 X RFA oo See ee ee M 10 10 e 9 si eeee a e 2 10 ve e s 8 e H 10 REL e e joo op o ee EN BTOM oh X DOE WOSB o A OW Om m xr WOW M m 2 LATI LAT2 4F2 mRNA 7477 7472 4F2 mRNA qRT PCR LATI LAT2 4F2 mRNA REL AP79 LAT mRNA 30
46. n 4 BIET n 6 n 6 n 4 n 4 nm 6 RNA 4 RNAlater Applied Biosystems RNAlater 80C 80C 2 LAT1 LAT2 4F2 MCF 7 American Type Culture Collection 73 76 84 DMEM Life Technologies 2 mM L glutamine 10 50 IU mL 50 ug mL 5 CO 37 C METIS 10cm 70 80 1ml 0 25 Trypsin EDTA GIBCO 0 25 Trypsin EDTA
47. Ed 2 30 LAT2 mRNA 0 23 0 19 0 72 0 19 0 11 0 10 0 120 032 0 32 0 12 0 162 0 16 0 65 0 24 0 74 0 26 0 12 0 074 0 18 HR BUS BR NER FERKO BIS 0 069 0 83 0 17 0 150 11 0 079 0 023 13 EU 0 057 0 039 4F2 mRNA ATIR ER a 2 0 702 0 30 0 783 0 25 0 362 0 29 0 28 0 29 0 36 0 19 0 20 0 21 0 70 0 25 0 79 50 22 0 150 065 0 18 0 069 0 30 0 29 0 92 0 14 0 40 0 26 0 43 0 19 2 2 LAT1 LAT2 4F2 fal 3 3 LAT1
48. I LATI 1 FFX L LAT1 LAT2 2 4F2 36 73 87 Ed 1 4F2 1 36 73 87 LAT1 Hi VER oos 33 39 49 57 62 70 75 92 LAT2 14 LAT2 LATI LAT2
49. melphalan mitoxantrone 23 melpahaln mitoxantrone melphalan mitoxantrone 10096 2096 09613 0 melphalan 23 53 K 11 LAT1 Anti cancer drugs Single use Combination with Combination with BCH LPM Carboplatin uM 0 47 0 15 0 21 0 02 0 18 0 03 Cyclophosphamide mM 20 3 2 7 8 7 x 0 81 7 8 x 0 94 Doxorubicin uM 2 25 0 34 1 14 0 11 1 02 0 10 Mitoxantrone uM 1 28 0 22 0 56 0 05 0 50 0 07 Vinblastine uM 1 14 0 11 0 04 0 01 0 03 0 01 Vincristine uM 1 27 0 14 0 47 0 04 0 42 0 03 P 0 05 Vs smgle use BCH 2 amino 2 norbornane carboxylic acids LPM melphalan numbers indicate ICso of each drugs 54 LATI LAT2 5 FE 14 4 P 0 01 j D 3 rr id 8 0 8
50. a LAT1 PIETA LATI LAT2 4F2 LAT1 LAT2 4F2 LATI LAT2 4F2 LAT1 LAT2 4F2
51. LATI 4F2 mRNA CHM M RCM KI RCM SA RCM Mc RCM Mp LAT 4F2 LAT2 RCM KD 2 CHM M LAT1 BHC melphalan 3 LATI Carbplatin Cyclophosphamide Doxorubicin Mitoxantrone Vinblastine Vincristine 4 LAT1 melphalan LAT1 mitoxantrone LATI 63
52. 29 61 74 2002 PET LAT1 17 PET 2009 PET PET 3 44 PET FDG 3 44 LATI PET 27
53. 48 BCH 0 1 0 3 1 3 10 30 100 mM LPM 1 3 10 30 100 300 1 000 uM WST 8 DOJIN Kumamoto Japan LATI BCH LPM 48 ICs 6 Y 6 LAT1 2 LATI CHM M FAV WST 8 carboplatin cyclophosphamide doxorubicin mitoxantrone vinblastine P KU vincristine Carboplatin 0 0 1 0 3 1 3
54. qRT PCR 7477 mRNA REL AP79 MGT MM HSA TCC MCT FS OSA TT LAC HCC ASC SENS e REL 31 P lt 0 01 LATI mRNA REL I 1 LS e 1 8 1 6 1 6 e e 1 4 1 4 a 1 2 p 0 0 4 1 2 P lt 0 01 amp 1 B x e Sos 8 0 8 e 0 6 0 6 0 4 0 4 1 0 2 0 2 0 lt f 1 S G 8 3 f 7 e e 25 6 e a a5 e 2 d m4 15 LI P lt 0 01 x P lt 0 01 9 2 e e 05 i 9 l 0 AS S S 1 6 1 4 1 2 do 0 8 0 6 gt 0 4 e 0 2 x 1 AS S 7 FURE EVER CJ MEAE LATI mRNA MGT MM HSA 77 LE BOR TCC TT
55. 1 0x10 37C S CO MCF 7 Total RNA 0 25 Trypsin EDTA 1 0x105 8 000Xg 3 4C RNAlater Applied Biosystems 30 RNAlater 80 80C 2 1 qRT PCR 7477 7472 4F2 mRNA 3 I LAT1 LAT2 4F2 4 LAT1 BCH 2 amino 2 norbornane carboxylic acids LPM
56. TCC TT 7472 mRNA qRT PCR 7472 mRNA REL AP79 LAT2 mRNA P lt 0 05 LAT2 mRNA REL REL 36 0 4 e 0 3 0 35 03 e a 0 25 amp 025 T 02 x 5 2 o amp 0 15 0 15 0 1 H i 0 05 0 05 8 0 i 0 em cr T amp S S lt 05 0 45 e 04 0 35 n 03 e amp 0 25 amp 92 0 15 v 01 i 0 05 e i o 12 LAT2 mRNA 7472 mRNA qRT PCR 7472 mRNA REL AP79
57. 2 3x10 0 3ml VUADA BABS Fic 23 TERUMO 1ml TERUMO 0 3ml 5 PL 49 melphalan 5 VE mitoxantrone 5 VE melphalan mitoxantrone 5 100mm L mm RY HME W mm 3 mm mm 0 5xLx Wz SEOBiT 1 3 io Y 30kGy CE 2
58. 85 496 100 89 6 8 IRE LATI mRNA 0 584044 0 48 0 49 7477 mRNA 8 0 58 0 60 0 30 0 30 PK lt 0 05 8 0 56 0 45 0 22 0 19 P lt 0 05 Ed 8 3 71 7477 mRNA
59. LPM Mit P lt 0 05 59 T i gt s LINRA RN Kearns gt gt 23 CHM M Cont melphalan mitoxantrone LPM Mit B Z3307 2 HE BERT Cont LPM Mit A B E F HE C D G H HE A C E G LPMHTMit B D TF H Cont A B C D 200nm E F GEO H 50um 60 4 LATI LAT1 LAT1 21 39 58 68 LAT1
60. 7477 BE MT IV LATI mRNA NI P lt 0 05 PT TO LATI mRNA AT P lt 0 05 REL REL 38 10 109 m 10 e 102 e E T P lt 0 05 10 AS S d 9 LAT2 mRNA Nor TT 7472 mRNA qRT PCR 7472 mRNA NEL AP79 LAT2 mRNA P 0 05 REL REL 34 10 10 e 10 techies ses i 9
61. LAT2 mRNA 7472 mRNA 4F2 mRNA 7477 mRNA 4F2 mRNA 7477 mRNA 72 mRNA 7472 mRNA 472 mRNA R 0 97 lt 0 001 42 4 W 23 33 6 13 67 77 26 57 LAT
62. LATI W 61 LAT1 mitoxantrone LAT1 LATI mitoxantrone mitoxantrone LAT1 10 20 HER2 83
63. i z s Ser 8 lt 10 10 g P 0 05 107 ew wa s S g d Ko lt JE amp E x 10 LAT2 mRNA 7472 mRNA qRT PCR Nor 7472 mRNA NEL AP79 P lt 0 05 7472mRNA MGT MM HSA TCC MCT FS OSA TT LAC HCC ASC Jeu REL REL 35 0 45 0 4 1 0 35 03 3 0 8 m 0 25 een occo we e un ee amem oc io o 0 15 P lt 0 05 P lt 0 05 11 7472 mRNA Nor MGT MM HSA
64. 1 1 HI LAT1 1 LATI LAT1 17 29 38 LAT1 LATI LAT1 MEERI 2 6 19 20 28 59 72 80
65. JOkDa LAT2 MENSEM 58kDa 4F2 95kDa 19 LAT1 LAT2 4F2 EHAO LAT1 LAT2 4F2 LATI 4F2 LAT2 EHAO RCM KI MCF 7 LAT1 LAT2 4F2 56 melphalan 100 100 80 80 60 60 40 40 20 20 0 0 1 3 10 30 100 0 10 30 100 Concentrations mM ee uM H L Leucine uptake uptake x 20 LAT1 HIL CHM M CHM M PH L 1 nM BCH melphalan PH L 1ICso BCH 1 6 0 05 uM melphalan 0 16 0 05 uM H IL 100 57 BCH melphalan 100 100 80 80 60 60 40 40 20 20 Proliferation activities 0 ot 0 0 0 10 31 3
66. LATI 9 57 LAT2 LAT2 14 7472 mRNA Rossier 69 LAT2 14 MUI BIST HD Fe DIC Ot bles COAL lt lt TRO TWA LHR CXS EK HH LAT LAT2 LAT2 LAT 10 L LATI 1 10 69 LATI LAT2
67. SD Tl T2 T3 27 4 tA R PP R RA o o d 11 3 2 10m 57162 4 12 K 7 LATI mRNA LATI 0 302 10 138 148 LATI 0 30 lt 66 30 96 76 168 244 K 8 LAT 7mRNA LAT 0 152 0 141 141 LATI 0 15 lt 66 24 90 66 165 231 9 LAT2 mRNA HECHO lt JBL LAT2 00712 62 44 106 LAT2 0 071 lt 14 132 146 76 168 244 10 4F2 mRNA 4F2 0 712 23 115 138 4F2 0 71 lt 53 53 106 A 76 168 244 28 1 2 3 4 5 6 7 8 9 10 11 12 LATI Ba JEET UNE boka 58kDa 4F2 m OSkDa 4 LAT1 LAT2 AF2 MCF 7 LAT1 LAT2 4F2 LTR LAT1 LAT2 4E2
68. 19 RP19 mRNA 3 meantSD RP19 A wm B It 250 mM sucrose 2 mM EGTA 3 mM NaN 20 mM Hepes pH 7 4 1ml Nakalai 200l 20 31 000g 4C 1 Modified Lowery Protein Assay Kit Thermo
69. LAT1 47 HI L leucine Nihon Medi Physics Co Ltd Tokyo Japan LAT1 125 mM choline Cl 4 8 mM KCl 1 3 mM CaCb 1 2mM MgSO4 25 mM HEPES 1 2 mM KHz2PO4 5 6 mM glucose pH 7 4 24 1 1x10 37C 5 CO 24 85 95 3 37 10 1 500u 1uM HIL leucine BCH 0 1 3 10 30 100 uM LPM 0 0 1 0 3 1 3 10UM LAT1 39 941 1 37C 3 CO
70. 0 70 0 91 1 9 1 9 P 0 01 18 77 LAT2 mRNA 0 043 0 076 0 24 0 53 0 057 057 18 4F2 mRNA LATI mRNA 0 3040 29 0 90 0 87 BE 3 1 1 6 P lt 0 01 18 LAT mRNA REL 0 2 1 8 CHM M REL 1 2 2 LATI LAT2 4F2 LATI LAT2 4F2 LAT1 4F2 CHM M RCM KI RCM SA RCM Mc RCM Mp LAT2 RCM KI
71. Bd 12 0 059 0 034 0 16 0 14 Bd 12 7472 mRNA 21 3 71 3 4F2 mRNA 4F2 mRNA 1 1 1 1 0 48 0 33 2 P lt 0 05 Ed 13 0 90 0 87 0 77 0 44
72. LATI mRNA qRT PCR Nor LATI mRNA REL AP79 7477 mRNA P lt 0 01 7477 mRNA REL REL 32 E 2 1 4 n 8 18 gt 1 2 1 6 a 1 i 14 1 fos 12 P lt 0 05 e 0 6 8 1 z 0 8 EI 04 amp o 0 6 e 0 2 i 04 m 0 D ee x 02 T lt S 0 4 F 5 S 1 8 l 1 6 x 14 d P lt 0 05 1 8 amp os 0 6 e 0 4 e T e 0 2 s 8 Y es 8 LAT mRNA 7477 mRNA qRT PCR 7477 mRNA REL AP79
73. 4F2 mRNA PCR 1 LAT1 2 LAT2 YEAR BRS EOF Mi CHEELDSGBRD 5 IVI 3 4F2 S HER BIR ON Pe KOLAR 4 mRNA LAT1 15 LAT2 4F2 16 PIR LAT 1 1 LATI 87
74. Ti FR 356 88 cyclophosphamide vincristine vinblastine doxorubicin carboplatin 9 18 53 64 86 V us 42 80
75. LATI LAT1 33 39 49 57 62 70 75 92 LATI LATI Positron emission tomography PET F FDG Computed Tomography CT 13 67 77 FDG PET 20 KG eee a 33 70
76. P lt 0 05 7472 mRNA 4F2 mRNA REL REL 12 Normal Organs 12345 6 7 8 9 1011 1213 1415 16 LAT eee 1 sokDa LAT2 ae SP gt skD 3 LATI LAT2 4F2 MCF 7 LAT1 LAT2 4F2 UE LATI LAT2 4F2 Lane 1 MCF 7 Lane 2 f Lane 3 Lane 4 Hifi Lane 5 Lane 6 Lane 7 Wl Lane 8 Lane 9 KAR Lane 10 Lane 11 MIF Lane 12 Lane 13 Lane 14 Lane 15 Lane 16 mock control 13 4
77. 3 107 EE e e 8 P 0 05 10 a vO o SELF ELC CFS EF 14 4F2 mRNA Nor 7472 mRNA qRT PCR 7472 mRNA REL AP79 P lt 0 05 4F2 mRNA MGT MM HSA TCC MCT FS OSA TT LAC HCC ASC Jel REL REL 39 6 2 ad 1 8 1 6 4 14 A 12 Zi i amp os i 1 0 6 8 1 0 4 e Pan i P 0 05 0 0 1 sS KS vd i 1 3 5 9 LJ 8 3 7 2 5 6 e a ds m e ga A T L5 _ 2 1 i 1 2 e 1 P lt 0 01 0 5 0 oS eem 0 s ag AS o C SN C R 1 8 S 1 6 1 4 T 1 2 I og e 0 6 0 4 e 0 2 3s lt d 15
78. N 4F2 ERES REM 6 e e dE 4 e i a amp 3 B e z P lt 0 05 8 l 0 NS l CY 18 LATI LAT2 4F2 mRNA Nor MGT CLN 7477 7472 4F2 mRNA qRT PCR 7477 7472 4F2 mRNA REL RPI9 mRNA data 477 mRNA P lt 0 01 LAT2 mRNA 4F2 mRNA P 0 05 e REL REL 55 SEW PO g KS os OO e LAT
79. 2006 Postoperative adjuvant treatment of invasive malignant mammary gland tumors in dogs with doxorubicin and docetaxel J vet int med 20 1184 1190 79 Smith A N 2003 Hemangiosarcoma in dogs and cats Vet cli Nor Ame Sma ani prac 33 533 552 80 Smrkovski O A Essick L Rohrbach B W and Legendre A M 2013 Masitinib mesylate for metastatic and non resectable canine cutaneous mast cell tumours Vet com onc In press 81 Sorenmo K U Kristiansen V M Cofone M A Shofer F S Breen A M Langeland M Mongil C M Grondahl A M Teige J and Goldschmidt M H 2009 Canine mammary gland tumours a histological continuum from benign to malignant clinical and histopathological evidence Vet com onc 7 162 172 82 Storey B T Fugere C Lesieur Brooks A Vaslet C and Thompson N L 2005 Adenoviral modulation of the tumor associated system L amino acid transporter LATI alters amino acid transport cell growth and 4F2 CD98 expressionwith cell type specific effects in cultured hepatic cells nt J can 117 387 397 CE 83 Timmerman L A Holton T Yuneva M Louie R J Padro M Daemen A Hu M Chan D A Ethier S P van t Veer L J Polyak K McCormick F and Gray J W 2013 Glutamine Sensitivity Analysis Identifies the xCT Antiporter as a Common Triple Negative Breast Tumor Therapeutic Target Cancer cell 24 450 465 84 Travers M T Gow I F Barber M
80. 2008 11 2013 8 tRNA 4C RNAlater Applied Biosystems RNAlater 80C 80C Ua 2 LATI LAT2 4F2 LEX MCF 7 73 76 84 1
81. 2 2 3 1 3 0 89 0 89 0 34 0 39 0 48 1 0 0 90 1 8 0 54 1 10 45 14 0 50 1 00 68 P 0 05 14 3 2 9 2 15 4F2 mRNA ROC Youden index 4F2 mRNA REL 0 71 EN 69 4 69 7 68 8 10
82. C Thomson J and Shennan D B 2004 Indoleamine 2 3 dioxygenase activity and L tryptophan transport in human breast cancer cells Biochimica et biophysica acta 1661 106 112 85 Uchino H Kanai Y Kim D K Wempe M F Chairoungdua A Morimoto E Anders M W and Endou H 2002 Transport of amino acid related compounds mediated by L type amino acid transporter 1 LAT1 insights into the mechanisms of substrate recognition Molecular pharmacology 61 729 737 86 Uramoto H Nakanishi R Nagashima A Uchiyama A Inoue M Osaki T Yoshimatsu T Sakata H Nakanishi K and Yasumoto K 2010 A randomized phase II trial of adjuvant chemotherapy with bi weekly carboplatin plus paclitaxel versus carboplatin plus gemcitabine in patients with completely resected non small cell lung cancer Anticancer research 30 4695 4699 87 Verrey F 2003 System L heteromeric exchangers of large neutral amino acids involved in directional transport Pflugers Arch 445 529 533 88 von Euler H Einarsson R Olsson U Lagerstedt A S and Eriksson S 2004 Serum thymidine kinase activity in dogs with malignant lymphoma a potent marker for prognosis and monitoring the disease J vet int med 18 696 702 89 Wachter D L Fasching P A Haeberle L Schulz Wendtland R Dimmler A Koscheck T Renner S P Lux M P Beckmann M W Hartmann A Rauh C and Schrauder M G 2013 Prognostic molecula
83. CHM M 1 LATI mRNA 2 4F2 3 LAT2 CHM M 51 18 19 2 LATI LATI BCH melphalan CHM M LATI X 20 CHM M BCH melphalan ICs 1 64 0 05 uM 0 16 0 05 uM 20 3 LATI fl LATI li BCH CHM M BCH melphalan ICs 48 2 3 5 mM 18 9 CHM M 2 3uM 21 melphalan LAT1 21 4 LATI
84. Hoes A W de Boer A Groenwold R H and Kirpensteijn J 2013 Prognostic factors of early metastasis and mortality in dogs with appendicular osteosarcoma after receiving surgery An individual patient data meta analysis Pre vet med In press 73 Segawa H Fukasawa Y Miyamoto K Takeda E Endou H and Kanai Y 1999 Identification and functional characterization of a Na independent neutral amino acid transporter with broad substrate selectivity J Biol Chem 274 19745 19751 74 Shennan D B 1994 Inhibition of system L LAT1 CD98hc reduces the growth of cultured human breast cancer cells Onc Rep 20 234 244 7 5 Shennan D B Thomson J Barber M C and Travers M T 2003 Functional and molecular characteristics of system L in human breast cancer cells Biochimica et biophysica 76 acta 1611 81 90 76 Shennan D B Thomson J Gow I F Travers M T and Barber M C 2004 L leucine transport in human breast cancer cells MCF 7 and MDA MB 231 kinetics regulation by estrogen and molecular identity of the transporter Biochimica et biophysica acta 1664 206 216 77 Shum W Y Ding H J Liang J A Yen K Y Chen S W and Kao C H 2012 Use of pretreatment metabolic tumor volumes on PET CT to predict the survival of patients with squamous cell carcinoma of esophagus treated by curative surgery Anti res 32 4163 4168 78 Simon D Schoenrock D Baumgartner W and Nolte I
85. 1 6 26 17 79 EBIT ERT 26 7 LATI mRNA ROC Youden index 7477 mRNA REL 0 30 82 196 86 8 83 6 7 7477 015
86. 10 30 100uM cyclophosphamid 0 0 1 0 3 1 3 10 30 100mM doxorubicin 0 0 1 0 3 1 3 10 30 100uM mitoxantrone 0 0 1 0 3 1 3 10 30 100uM vinblastine 0 0 1 0 3 1 3 10 30 100uM vincristine O0 0 1 0 3 1 3 10 30 100uM BCH LPM Iso 7 melphalan mitoxantrone 1 X A BALB cAJc 1 nu nunu X RE X HF 320 SHIMADZU 300kv 10mA 1 0mmCu 1 0mmAl 0 9Gy min 4Gy FR LE HU tx RVD AREF EY AEH PHA CAM 3 BRE
87. 10 30100 0 0 10 31 3 10 30100 Concentrations mM Concentrations uM 21 LAT1 CHM M CHM M BCH melphalan WST 8 ICso BCH 48 2 3 5 mM melphalan 18 9 2 3uM 100 58 4000 Cont LPM 4 Mit 3 2500 P 0 05 2 1 LPM Mit 1000 Start of chemotherapy 0 10 20 30 Days after injection Volumes of tumor mm 22 CHM M LATI LATI EEAO in vivo CHM M 5x 10 100mm CHM M 14 melpahlan mitoxantrone Cont melphalan LPM mitoxantrone Mit melphalan mitoxantrone LPM Mit LPM Mit
88. 16 1 KATES 1 7 63 30 12 23 89 50 60 15 48 Shennan MCF 7 MDA MB 231 LAT1 BCH melphalan 74 LATI 43 54
89. 32 FDG LAT1 LAT1 FDG 40 60 95 LATI LAT1 21 26 35 93 UL CULE 1 LAT1 LAT2 4F2 LAT1 2 1 17
90. 33 43 20 Fukumoto S Hanazono K Fu D R Endo Y Kadosawa T Iwano H and Uchide T 2013 A new treatment for human malignant melanoma targeting L type amino acid transporter 1 LAT1 A pilot study in a canine model Bio bio res com 439 103 108 21 Furuya M Horiguchi J Nakajima H Kanai Y and Oyama T 2012 Correlation of L type amino acid transporter 1 and CD98 expression with triple negative breast cancer prognosis Cancer science 103 382 389 22 Gilbertson S R Kurzman I D Zachrau R E Hurvitz A I and Black M M 1983 Canine mammary epithelial neoplasms biologic implications of morphologic characteristics assessed in 232 dogs Vet path 20 127 142 23 Gradishar W J Kaklamani V Sahoo T P Lokanatha D Raina V Bondarde S Jain 69 M Ro S K Lokker N A and Schwartzberg L 2013 A double blind randomised placebo controlled phase 2b study evaluating sorafenib in combination with paclitaxel as a first line therapy in patients with HER2 negative advanced breast cancer Eur J Can 49 312 322 24 Harada N Nagasaki A Hata H Matsuzaki H Matsuno F and Mitsuya H 2000 Down regulation of CD98 in melphalan resistant myeloma cells with reduced drug uptake Acta haematologica 103 144 151 25 Herold Mende C Steiner H H Andl T Riede D Buttler A Reisser C Fusenig N E and Mueller M M 1999 Expression and functional significance of vasc
91. Fisher Scientific 1 20ug 10 SDS PAGE 1 2 2 n KEII ECL2 Amersham LATI LAT2 272 mRNA U P 0 05 LATI LAT2 4F2 mRNA 2 2010 SSRI 1 Gene Nucleotide sequence 5 to 3 Amplicons bp LAT F CTGGATCGAGCTGCTCATCATC 273 R ACATCACCCTTCCCGATCTGG LAT2 F TITCCIGACTICCTTCGIGCC 233 R CGTGGGTCTTCATTCTGGCT 4F2 F GGAGTTTTGGCTGCAAGCTG 239 R TGCTCCCCAGTAGAACCAG RP19 F CCTTCCTCAAAAAGTCTGCG 95 R GITCTCATCGTAGGGAGC F forward R reverse bp base pair E 1 PCR Conditions 95 C for 30sec 63 C for 30sec 95 C for 30sec 61 C for 30sec 95 C for 30sec 60 C for 30sec 95 C for 30sec 60 C for 30sec 2
92. and characterization of four canine melanoma cell lines J vet med sci 66 1437 1440 32 Jadvar H Desai B Ji L Conti P S Dorff T B Groshen S G Gross M E Pinski J K and Quinn D I 2012 Prospective evaluation of 18F NaF and 18F FDG PET CT in detection of occult metastatic disease in biochemical recurrence of prostate cancer Clin Nuc Med 37 637 643 33 Jia W Gao X J Zhang Z D Yang Z X and Zhang G 2013 S100A4 silencing suppresses proliferation angiogenesis and invasion of thyroid cancer cells through downregulation of MMP 9 and VEGF Eu rev medi pha sci 17 1495 1508 34 Kageyama T Imura T Matsuo A Minato N and Shimohama S 2000 Distribution of the 4F2 light chain LATI in the mouse brain Neuroreport 11 3663 3666 35 Kaira K Oriuchi N Imai H Shimizu K Yanagitani N Sunaga N Hisada T Tanaka S Ishizuka T Kanai Y Endou H Nakajima T and Mori M 2008 Prognostic significance of L type amino acid transporter 1 expression in resectable stage I III nonsmall cell lung cancer Bri J can 98 742 748 36 Kanai Y Segawa H Miyamoto K Uchino H Takeda E and Endou H 1998 Expression cloning and characterization of a transporter for large neutral amino acids activated by the heavy chain of 4F2 antigen CD98 J Biol Chem 273 23629 23632 37 Kaneko Y Imoto S and Kasakura S 1995 Study for clinical usefulness of CEA TPA CA1S 3 an
93. ashita G Negishi A Oriuchi N Higuchi T 74 Tsushima Y Kanai Y Yokoo S and Oyama T 2013 Diagnostic usefulness of 18 F FAMT PET and L type amino acid transporter 1 LAT1 expression in oral squamous cell carcinoma Eur j nuc med mol ima 40 1692 1700 61 Oda K Hosoda N Endo H Saito K Tsujihara K Yamamura M Sakata T Anzai N Wempe M F Kanai Y and Endou H 2010 L type amino acid transporter 1 inhibitors inhibit tumor cell growth Cancer science 101 173 179 62 Ohkame H Masuda H Ishii Y and Kanai Y 2001 Expression of L type amino acid transporter 1 LAT1 and 4F2 heavy chain 4F2hc in liver tumor lesions of rat models J Surg Oncol 78 265 271 63 Ohsumi S and Shimozuma K 2013 Current status and future perspectives of patient reported outcome research in clinical trials for patients with breast cancer in Japan Breast cancer 20 296 301 64 Osman A M Bayoumi H M Al Harthi S E Damanhouri Z A Elshal M F 2012 Modulation of doxorubicin cytotoxicity by resveratrol in a human breast cancer cell line Can cell int 12 47 49 65 Park N S Kim S G Kim H K Moon S Y Kim C S Cho S H Kanai Y Endou H and Kim do K 2008 Characterization of amino acid transport system L in HTB 41 human salivary gland epidermoid carcinoma cells Anti res 28 2649 2655 66 Pinto V Pinho M J and Soares da Silva P 2013 Renal amino acid transport sy
94. d BCA225 in breast cancer Rinsho byori Jap J clin path 43 696 702 38 Kim C S Moon I S Park J H Shin W C Chun H S Lee S Y Kook J K Kim H J Park J C Endou H Kanai Y Lee B K and Kim do K 2010 Inhibition of L type 71 amino acid transporter modulates the expression of cell cycle regulatory factors in KB oral cancer cells Biol Pharm Bull 33 1117 1121 39 Kim D K Kanai Y Choi H W Tangtrongsup S Chairoungdua A Babu E Tachampa K Anzai N Iribe Y and Endou H 2002 Characterization of the system L amino acid transporter in T24 human bladder carcinoma cells Bioc bio acta 1565 112 121 40 Kim M Higuchi T Arisaka Y Achmad A Tokue A Tominaga H Miyashita G Miyazaki H Negishi A Yokoo S and Tsushima Y 2013 Clinical significance of 1 8 F alpha methyl tyrosine PET CT for the detection of bone marrow invasion in patients with oral squamous cell carcinoma comparison with 1 8 F FDG PET CT and MRI An nuc med 27 423 430 41 Kim S G Kim H H Kim H K Kim C H Chun H S Kanai Y Endou H and Kim do K 2006 Differential expression and functional characterization of system L amino acid transporters in human normal osteoblast cells and osteogenic sarcoma cells Anti res 26 1989 1996 42 Kobayashi M Sugisaki O Ishii N Yamada O Ito K Kuroki S Sasaki Y Ono K Washizu T and Bonkobara M 2012 Canine
95. he oncologist 17 469 475 49 McGivan J D and Pastor Anglada M 1994 Regulatory and molecular aspects of mammalian amino acid transport Biochem J 299 321 334 50 Member B Helson L Helson C Erlandson R and Hajdu S I 1985 Human meningeal sarcoma heterotransplants in Nu Nu mice treated with L phenylalanine mustard L PAM and dianhydrogalactitol DAG Anti res 5 559 564 51 Miyajima N Watanabe M Ohashi E Mochizuki M Nishimura R Ogawa H Sugano S and Sasaki N 2006 Relationship between retinoic acid receptor alpha gene expression and growth inhibitory effect of all trans retinoic acid on canine tumor cells J vet int med 20 348 354 52 Morimoto M Numata K Nozaki A Kondo M Moriya S Taguri M Morita S Konno M Sugo A Miyajima E Maeda S and Tanaka K 2012 Novel Lens culinaris agglutinin reactive fraction of alpha fetoprotein a biomarker of hepatocellular carcinoma recurrence in patients with low alpha fetoprotein concentrations Int J clin onc 17 373 379 73 53 Morris P G Iyengar N M Patil S Chen C Abbruzzi A Lehman R Steingart R Oeffinger K C Lin N Moy B Come S E Winer E P Norton L Hudis C A and Dang C T 2013 Long term cardiac safety and outcomes of dose dense doxorubicin and cyclophosphamide followed by paclitaxel and trastuzumab with and without lapatinib in patients with early breast cancer Cancer In
96. i A and Yliperttula M 2008 Pharmacokinetic role of L type amino acid transporters LAT1 and LAT2 Eur J Pharm Sci 35 161 174 15 Dittrich C Solska E Manikhas A Eniu A Tjulandin S Anghel R Musib L Frimodt Moller B Liu Y Krejcy K and Lang I 2012 A phase II multicenter study of two different dosages of pemetrexed given in combination with cyclophosphamide as first line 68 treatment in patients with locally advanced or metastatic breast cancer Can Inve 30 309 316 16 Esteban J M Felder B Ahn C Simpson J F Battifora H and Shively J E 1994 Prognostic relevance of carcinoembryonic antigen and estrogen receptor status in breast cancer patients Cancer 74 1575 1583 17 Fan X Ross D D Arakawa H Ganapathy V Tamai I and Nakanishi T 2010 Impact of system L amino acid transporter 1 LAT1 on proliferation of human ovarian cancer cells a possible target for combination therapy with anti proliferative aminopeptidase inhibitors Bio Phar 80 811 818 18 Fesler M J Osman M Glauber J and Petruska P J 2011 C MOPP the forgotten regimen plus Rituximab for untreated and relapsed follicular lymphoma Ame J blo res 1 204 214 19 Frazier S A Johns S M Ortega J Zwingenberger A L Kent M S Hammond G M Rodriguez C O Steffey M A and Skorupski K A 2012 Outcome in dogs with surgically resected oral fibrosarcoma 1997 2008 Vet com onc 10
97. intestinal mast cell tumor with c kit exon 8 mutation responsive to imatinib therapy Vet J 193 264 267 43 Kumaraguruparan R Prathiba D and Nagini S 2006 Of humans and canines Immunohistochemical analysis of PCNA Bcl 2 p53 cytokeratin and ER in mammary tumours Res vet sci 81 218 224 44 Lawrence J Rohren E and Provenzale J 2010 PET CT today and tomorrow in veterinary cancer diagnosis and monitoring fundamentals early results and future perspectives Vet com onc 8 163 187 45 Lee S Lee C Y Kim D J Hong D J Lee J G and Chung K Y 2013 Pathologic correlation of serum carcinoembryonic antigen and cytokeratin 19 fragment in resected 72 nonsmall cell lung cancer Kor J tho card sur 46 192 196 46 Lerman H Bar On S Helpman L Even Sapir E and Grisaru D 2012 Estrogen dependent variations in 18F fluorodeoxyglucose uptake in uterine leiomyomas Intl J gyn can 22 1187 1191 47 Lewerenz J Klein M and Methner A 2006 Cooperative action of glutamate transporters and cystine glutamate antiporter system Xc protects from oxidative glutamate toxicity J Neu 98 916 925 48 Martin M Makhson A Gligorov J Lichinitser M Lluch A Semiglazov V Scotto N Mitchell L and Tjulandin S 2012 Phase II study of bevacizumab in combination with trastuzumab and capecitabine as first line treatment for HER 2 positive locally recurrent or metastatic breast cancer T
98. ome of 82 patients with angiosarcoma Ann Sur Onc 14 1953 1967 2 Alvarez F J Hosoya K Lara Garcia A Kisseberth W and Couto G 2013 VAC Protocol for Treatment of Dogs with Stage III Hemangiosarcoma J Amer Ani Hos Asso in press 3 Ballegeer E A Hollinger C and Kunst C M 2013 Imaging diagnosis multicentric lymphoma of granular lymphocytes imaged with FDG PET CT in a dog Vet radio ultra 54 75 80 4 Baumann D Hauser B Hubler M and Fluckiger M 2004 Signs of metastatic disease on thoracic radiographs of dogs suffering from mammary gland tumours a retrospective study 1990 1998 Schwe Archiv fur Tier 146 431 435 5 Bergman P J 2007 Canine oral melanoma Clin Tech Small Anim Pract 22 55 60 6 Best M P and Fry D R 2013 Incidence of sterile hemorrhagic cystitis in dogs receiving cyclophosphamide orally for three days without concurrent furosemide as part of a chemotherapeutic treatment for lymphoma 57 cases 2007 2012 J Ame Vet Med Ass 243 1025 1029 7 Biesheuvel C Weigel S and Heindel W 2011 Mammography Screening Evidence History and Current Practice in Germany and Other European Countries Breast care Basel Switzerland 6 104 109 8 Bokhorst L P Bangma C H van Leenders G J Lous J J Moss S M Schroder F H and Roobol M J 2013 Prostate specific Antigen Based Prostate Cancer Screening 67 Reduction of Prostate Cancer Mortality After Cor
99. ou H and Kim D K 2004 Expression and functional characterization of the system L amino acid transporter in KB human oral epidermoid carcinoma cells Cancer letters 205 215 226 95 Youland R S Kitange G J Peterson T E Pafundi D H Ramiscal J A Pokorny J L Giannini C Laack N N Parney I F Lowe V J Brinkmann D H and Sarkaria J N 2013 The role of LAT1 in 18 F DOPA uptake in malignant gliomas J neuro oncology 111 11 18 79
100. press 54 Mottolese M Morelli L Agrimi U Benevolo M Sciarretta F Antonucci G and Natali P G 1994 Spontaneous canine mammary tumors A model for monoclonal antibody diagnosis and treatment of human breast cancer Laboratory investigation J tech meth path 71 182 187 55 Nakada N Mikami T Hana K Ichinoe M Yanagisawa N Yoshida T Endou H and Okayasu I 2013 Unique and selective expression of L amino acid transporter 1 in human tissue as well as being an aspect of oncofetal protein Histo hist In press 56 Nakamura N Momoi Y Watari T Yoshino T Tsujimoto H and Hasegawa A 1997 Plasma thymidine kinase activity in dogs with lymphoma and leukemia J vet med sci 59 957 960 57 Nakanishi K Matsuo H Kanai Y Endou H Hiroi S Tominaga S Mukai M Ikeda E Ozeki Y Aida S and Kawai T 2006 LAT1 expression in normal lung and in atypical adenomatous hyperplasia and adenocarcinoma of the lung Virchows Arch 448 142 150 58 Nawashiro H Otani N Shinomiya N Fukui S Ooigawa H Shima K Matsuo H Kanai Y and Endou H 2006 L type amino acid transporter 1 as a potential molecular target in human astrocytic tumors Int J Cancer 119 484 492 59 Nemec A Murphy B G Jordan R C Kass P H and Verstraete F J 2013 Oral Papillary Squamous Cell Carcinoma in Twelve Dogs J com path In press 60 Nobusawa A Kim M Kaira K Miy
101. r markers and neoadjuvant therapy response in anthracycline treated breast cancer patients Archives of gynecology and obstetrics 287 337 344 78 90 Wiedemann G Mella O Roszinski S Weiss C and Wagner T 1992 Hyperthermia enhances mitoxantrone cytotoxicity on human breast carcinoma and sarcoma xenografts in nude mice Inter J rad onc biology physics 24 669 673 91 Yamashita A Maruo K Suzuki K Shirota K Kobayashi K and Hioki K 2001 Experimental chemotherapy against canine mammary cancer xenograft in SCID mice and its prediction of clinical effect J vet med sci 63 83 1 836 92 Yanagida O Kanai Y Chairoungdua A Kim D K Segawa H Nii T Cha S H Matsuo H Fukushima J Fukasawa Y Tani Y Taketani Y Uchino H Kim J Y Inatomi J Okayasu I Miyamoto K Takeda E Goya T and Endou H 2001 Human L type amino acid transporter 1 LAT1 characterization of function and expression in tumor cell lines Biochimica et biophysica acta 1514 291 302 93 Yanagisawa N Ichinoe M Mikami T Nakada N Hana K Koizumi W Endou H aand Okayasu I 2012 High expression of L type amino acid transporter 1 LAT 1 predicts poor prognosis in pancreatic ductal adenocarcinomas J cli path 65 1019 1023 94 Yoon J H Kim Y B Kim M S Park J C Kook J K Jung H M Kim S G Yoo H Ko Y M Lee S H Kim B Y Chun H S Kanai Y End
102. rection for Nonattendance and Contamination in the Rotterdam Section of the European Randomized Study of Screening for Prostate Can Euro uro In press 9 Boll B Bredenfeld H Gorgen H Halbsguth T Eich H T Soekler M Markova J Keller U Graeven U Kremers S Geissler M Trenn G Fuchs M von Tresckow B Eichenauer D A Borchmann P and Engert A 2011 Phase 2 study of PVAG prednisone vinblastine doxorubicin gemcitabine in elderly patients with early unfavorable or advanced stage Hodgkin lymphoma Blood 118 6292 6298 10 Bossa R Galatulas I and Mantovani E 1977 Cardio toxicity of Daunomycin and Adriamycin Neoplasma 24 405 409 11 Bronson R T 1982 Variation in age at death of dogs of different sexes and breeds Ame J vet res 43 2057 2059 12 Cybulska Stopa B Ziobro M Skoczek M Kojs Pasinska E Cedrych I and Brandys A 2013 Evaluation of vinorelbine based chemotherapy as the second or further line treatment in patients with metastatic breast cancer Contemporary oncology Poznan Poland 17 78 82 13 De Bruyne S Van Damme N Smeets P Ferdinande L Ceelen W Mertens J Van de Wiele C Troisi R Libbrecht L Laurent S Geboes K and Peeters M 2012 Value of DCE MRI and FDG PET CT in the prediction of response to preoperative chemotherapy with bevacizumab for colorectal liver metastases Bri J Can 106 1926 1933 14 del Amo E M Urtt
103. stems and essential hypertension FASEB J 27 2927 2938 67 Rebiere M Verburg FA Palmowski M Krohn T Pietsch H Kuhl CK Mottaghy FM Behrendt FF 2012 Multiphase CT scanning and different intravenous contrast media concentrations in combined F 18 FDG PET CT Effect on quantitative and clinical assessment Eur J rad 81 862 869 75 68 Ring B Z Seitz R S Beck R Shasteen W J Tarr S M Cheang M C Yoder B J Budd G T Nielsen T O Hicks D G Estopinal N C and Ross D T 2006 Novel prognostic immunohistochemical biomarker panel for estrogen receptor positive breast cancer J Clin Oncol 24 3039 3047 69 Rossier G Meier C Bauch C Summa V Sordat B Verrey F and Kuhn L C 1999 LAT2 a new basolateral 4F2hc CD98 associated amino acid transporter of kidney and intestine J bio chem 274 34948 34954 70 Sang J Lim Y P Panzica M Finch P and Thompson N L 1995 TA1 a highly conserved oncofetal complementary DNA from rat hepatoma encodes an integral membrane protein associated with liver development carcinogenesis and cell activation Cancer research 55 1152 1159 71 Santos A A Lopes C C Ribeiro J R Martins L R Santos J C Amorim I F Gartner F and Matos A J 2013 Identification of prognostic factors in canine mammary malignant tumours a multivariable survival study BMC vet res In press 72 Schmidt A F Nielen M Klungel O H
104. ular endothelial growth factor receptors in human tumor cells Lab Inve J Tec Met Pat 79 1573 1582 26 Ichinoe M Mikami T Yoshida T Igawa I Tsuruta T Nakada N Anzai N Suzuki Y Endou H and Okayasu I 2011 High expression of L type amino acid transporter 1 LAT1 in gastric carcinomas comparison with non cancerous lesions Pat Inter 61 281 289 27 Ikotun O F Marquez B V Huang C Masuko K Daiji M Masuko T McConathy J and Lapi S E 2013 Imaging the L Type Amino Acid Transporter 1 LAT1 with Zr 89 ImmunoPET PloS In press 28 Im K S Kim N H Lim H Y Kim H W Shin J I and Sur J H 2013 Analysis of a New Histological and Molecular Based Classification of Canine Mammary Neoplasia Vet Path In press 29 Imai H Kaira K Oriuchi N Shimizu K Tominaga H Yanagitani N Sunaga N Ishizuka T Nagamori S Promchan K Nakajima T Yamamoto N Mori M and Kanai Y 2010 Inhibition of L type amino acid transporter 1 has antitumor activity in non small cell lung cancer Anti Res 30 4819 4828 30 Imamura M Inoue K Megumi Y Nishimura M Ohmori K and Nishimura K 2000 Clinical evaluation of urinary basic fetoprotein and the BTA test for detection of bladder 70 cancer Hin ki Acta urol Jap 46 705 709 31 Inoue K Ohashi E Kadosawa T Hong S H Matsunaga S Mochizuki M Nishimura R and Sasaki N 2004 Establishment

Download Pdf Manuals

image

Related Search

Related Contents

  Ferplast Cayman 110 Open User's Manual  T12VRHD- 12V Li-ion SDS Rotary Hammer Drill  Manual RP 350  ASUS P4S533-MX User's Manual  Accounts Payable e5 user guide  TM250HD  Valvelon® - AW Chesterton Company  

Copyright © All rights reserved.
Failed to retrieve file