Home
C1000 Touch™サーマルサイクラー - Bio-Rad
Contents
1. 79 C1000 TouchTW 95 1
2. 80 C1000 Touch
3. C1000 Touch MHT T VOR BHI VORILZSAWIS Yw o ttt Y ROT E
4. 1 2 Cancel 1 Cancel EE 4 100
5. USERS USERS USERS USERS 1 Log In 70 C1000 TouchYM New User User Name Password Email Address e
6. 16 C1000 TouchTV 1 6 is An bLA 6 2 3 1 2
7. 95 C 3 98 C 30 950C 30 92 C 1 700C 20 1 T Calculator T T standard T 56 C1000 TouchYM T T T gt 4C T 2 T 2 4 C Tn lt 4 C T T 4C T 14
8. C1000 TouchTW
9. T T T 25 C1000 TouchTW Ta Calculator Forward Primer CTG GAG CCT TCA GTT GCA G r GAAGATGGTGATGGGATTTC KOJ Cancel 25 Tn EFS Tn T 53 C1000 TouchYV T 4C Ta T 2C T iTaq DNA T 5 OK 54
10. 1 Options 29 C1000 TouchYV 2 Gradient 14 Step Options Cancel 14 Step Options 3 1 24 C CFT Extend Increment Beep Ramp Rate 4 OK 5
11. 1 32 Options C1000 TouchTW Extend OK Options Step Options Extend Back 33 34 6 C1000 TouchYV OK 1 2 Options
12. A is Ass
13. 1 Save 2 File Name 3 38 C1000 TouchYM 17 Adam New Folder File Name Location New Folder 17 Adam 4 Save 39 C1000 TouchTM 3
14. 8 Pete CC006622 Idle put New Protocol ECCINGGZZ dle 8 C1000 Touch New Protocol 11 Protocol AutoWriter 27 Saved Files 33 o 18 C1000 TouchYV Incubate 25 Tools 40 Log in C1000 Touch
15. CFX ManagerrW 2 1 2 1000 1 4 12 C1000 TouchTW 1 2 cm eT ee ee 4
16. C1000 TouchTVM Confirm all blocks individually OK 41 42 C1000 TouchTM 18 Select block s to run on LP Dual 48 Well Block A ie Bocke tale wmaupdemawew 9 OK Select All Cancel 18 Sample Volume 0 Sample Volume
17. C1000 Touch C1000 TouchrM 6 6 1000 ER 96 well Fast 1 10 50 ul 50 ul ERR 96 well Deep 1 10 125 ul 125 ul EBR Dual 48 48 well Fast 2 10 50 ul 50 ul 384 well 1 3 30 ul 30 ul ERR
18. USB S1000 C1000 Touch 62 Saved Files 8 Saved Files C1000 Touch 12 S1000 8 8 Folder Options Copy
19. X X NEW NEW X gt Y Y MAIN gt RUN MAIN RUN C1000 Touch 3 3
20. 12 New Protocol Jan 7 2010 00 18 12 25 26 C1000 TouchYV C1000 TouchTM 1 Saved Files 2 13 User ADMIN Saved Files Jan 27 2010 23 22 Locations Folders Files Preview i ay WE Method Cale Recent lt Root gt Lid 105 C Volume 30 fam SC005016 Pete1 1 95 C 3 00 Tial RealTime Data 2 95 C 0 30 F 3 55 C 0 30 gjo ADMIN 4 12C 1 00 ma 5 Goto 2 34X 9 Pete 6 72 C 5 00 7 12 C 0 00 USB Drive New Folder Folder Options File Options 13 3 Edit 4 5
21. C1000 Touch 1 2 C1000 TouchrM 3 PCR 30
22. 1 INCUBATE 47 48 C1000 TouchYV C1000 TouchYV Incubate 23 Block temperature Hold time Lid temperature 105 C 23 30C 31 C Block temperature Hold time Lid temperature Run
23. 21 23 24 25 25 25 40 Run Run Run C1000 Touch W Select All
24. 4 f C1000 TouchTV C1000 Touch 4 4 A C1000 Touch A
25. 33 C1000 Touch 2 3 C1000 TouchYV 140 0002 2 2 24 20F Tel 03 6361 7000 Fax 03 5463 8480 532 0025 1 14 11 Tel 06 6308 6568 Fax 06 6308 3064 812 0013 2 5 28 Tel 092 475 4856 Fax 092 474 5580 Tel 03 6404 0331 Fax 03 6404 0334 Mail life_ps jp bio rad com M10377 1107A
26. 1 2 3 4 C1000 Touch 14 C1000 TouchYV
27. 6 7 Name 8 Run Save 27 C1000 TouchYM 7 7 C1000 Touch Temperature Temperature in C 0 1C 0 0 100 0C Hold time
28. 9 21 View Clock 22 44 C1000 TouchYV View Status Si i dan 31 20100333 AVED 6 sco05016 A 96 C 72 C G 72 C 56 C 0 0 Step 2 21 UNSAVED Remaining fi on View Status 22 C1000 Touch 1 Paus
29. e Calculated Block 0 Ul C1000 Touch C1000 Touch C1000 Touch 96 well Dual 4
30. A FCC 15 B FCC 47 CFR 15 103 c EMC A AFCC 1000 USB 184 8000 C1000 TouchTM 0 ji i AME Fe Br E Rees aes ae Ore E A ce en Me Te Pies ji e e 2 ji 1 C1000 TouchTWM
31. 1 Saved Files 2 3 Folder Options 4 Delete 5 Yes 1 Saved Files 2 3 Folder Options 4 Rename 5 6 OK 1 Saved Files 2 3 File Options 4 Copy 5
32. GOTO 1 2 Insert 3 Temperature Gradient goto GOTO 4 50 30 0 30 1 2 Delete
33. File Options Rename OK 67 68 C1000 TouchYV C1000 TouchYV 69 C1000 TouchTM 6 C1000 TouchTWM C1000 Touch 39 40 e C1000 Touch 41 e C1000 Touch S1000 W 42 C1000 Touch C1000 Touch New User
34. C1000 Touch iii C1000 Touch 81 82 C1000 TouchYM 2 33 1
35. 7 3 1 4 1 2 1 44 1 3
36. C1000 Touch
37. C1000 TouchTW 7 C1000 TouchrM 1 184 9000 1
38. Log Off 39 Status 23 o C1000 TouchTW C1000 Touch C1000 Touch C1000 Touch 1 Tools Tools About Name 9 2 3 OK User Pete About Jan 27 2010 23 06 e SN SC005016 lame SCUUSU16 ock SN RNO15784 Block Type 36 Well PXA27D 1 101 250 128 HC12 1 0 158 0 FX2 1 35 00 Total Hours 23899
39. Options Step Options Ramp Rate Back 6 OK 1 Options 2 Increment 3 4 OK 5 Options Step Options Increment Back 6 OK
40. User Management Email Settings e Firmware Update USB Thumb Key Test USB e Touchscreen Calibration System Backup and Restore USB Diagnostic Test C1000 Touch C1000 Touch 74 C1000 TouchrM USB A USB USB
41. DNA iTaq iProof Other iTaq iProof DNA standard fast ultrafast T 1 1
42. 15 Gradient Editor 15 he iid 30 C1000 Touch WM 1 Options Step Options 2 Gradient 31 C1000 TouchYM OK C1000 Touch 1 Options 2 Ramp Rate 3 4 OK 5
43. OO 54 TILA Ore a gt ce aes ee aa ee e a te IS ee eee eee nt ee 56 5 DFA WE DAWES J oavcccccccecssessecseessecsecssecsesseessessnessersnesecsnssseners 60 ATE SS Pt eA JTBE ad sts Socata bce ede ho i ede eat 60 9 PA ARETA aes ae cs eI any RO ee es 62 i FFF IRE oes E scree ME EAEE S EEE sive ack os eee ee te 70 C1000 Touch 70 BI ii 72 C1000 Touch 74 C1000 Touch S1000TVM 76 T cee ie eee 77 C1000 Touch 77 LAEE E A Ei E 80 C1000 TouchYV viii C1000 TouchTM 1 C1000 TouchTM C1000 Touch 1 2 C1000 Touch
44. 1 Lid 2 3 OK 1 Name 2 3 OK C1000 Touch 12 37 C1000 TouchYM
45. 4 31C 319C C1000 Touch 1 C1000 Touch
46. T AH AS R Ln DNA DNA DNA DNA B form DNA ADERI 5 kcal 3 4 kcal Sugimoto 1996 T T AH 5 KCal K Mole AS R In 1 16 6 logi 1 M NaC 1 logj pH 7 0 T 1 G C C1000 TouchYM 14 14 26 INTER ACTION delta H delta
47. USB Delete Rename File Options Copy Delete Rename New Folder C1000 Touch S1000 USB Home C1000 Touch 1 Saved Files 2 Location 63 C1000 TouchTV 28 C1000 Touch SC005016 Saved Files Jan 31 2010 03 42 Locations Folders Files Preview R PCR2 Method Cale a Recent lt Root Lid 105 C Volume 30u gS SC005016 Bio Rad PCR F TITE 3 00 fal RealTime Data Bio Rad qPCR 2 95 C 0 30
48. 3 4 6 C1000 Touch 7 e 7 C1000 Touch 1 PCR USB A USB C1000 TouchYM pE es J USB A a J
49. ENTER 7 C1000 Touch W C1000 Touch 40 45 C1000 Touch C1000 Touch 77 78 C1000 TouchYV C1000 Touch
50. 3 1 95 98 C 30 180 2 95 98 C 5 30 3 T 10 30 2 T Proof T 3C 4 3 720
51. Beep Beep OK Options FLET Step Options Beep OK GOTO GOTO 1 PCR 16 GOTO 1 34 New Protocol den 2010 01 10 16 GOTO 1 34 GOTO 1 GOTO
52. File Name 6 30 Location Folder 66 C1000 TouchYM File Name test12 Location CC006622 fed 30 New Folder 7 Save 1 2 Saved Files File Options Delete Yes 1 2 Saved Files
53. C1000 Touch CFX Manager 2 1 PC C1000 Touch S1000 S1000 S1000 C1000 Touch S1000 3 C1000 Touch 1 S1000 USB B USB 2 USB C1000 Touch USB A C1000 Touch S1000 C1000 Touch S1000
54. Set as Default 10 User ADMIN _ Outgoing Mail SMTP Server Settings _ Jan 27 2010 23 09 Mail Servers Set As Default Mail Server Address smtp gmail com Mail Server Port Authentication Required Use SSL User Name Password Remove Server New Server E 10 GMAIL 10 22 Save Test Email Test Email Address e Attachment Size in MB 0 5 5 MB 0 e Send Email
55. e WWW Dbio rad com PCR PCR 1 1 b www bio rad com www bio rad com Documents 1 800 424
56. USB B C1000 Touch USB A 4 S1000 3 USB 75 C1000 TouchYV C1000 Touch S1000 76 S1000 3 C1000 Touch S1000 C1000 Touch USB A C1000 Touch C1000 Touch S1000 C1000 Touch
57. 5 5 100 240 VAC 50 60 Hz 850 W II 10 A 250 V 5 x 20 mm 2 15 31C 809 HEGEL 000 2 C1000 TouchYM IEC 61010 1 2001 1 IEC 61010 2 010 2003 2 010 e IEC 61010 2 081 2001 A1 2003 2 081 e CAN CSA C22 2 NO 61010 1 04 1
58. LED C1000 TouchYM LED d SO naa til 3 96well Fast C1000 Touch C1000 Touch e 1000 Touch USB 1 fa C1000 Touch C1000 Touch
59. Cancel 49 C1000 TouchTM 4 27 29 e T 30 1 Protocol AutoWriter 2 iTaq W DNA iProofTM DNA iProof iProof iProof T 3C Other
60. e e Cancel Tools Back C1000 TouchTV 1 New Server B11 User ADMIN Outgoing Mail SMTP Server Settings Jan 27 2010 23 16 Mail Servers Set As Default Mail Server Address Mail Server Port Authentication Required Use SSL User Name Password Remove Server lew Server Test Email 11 New Server 2 Mail Server Address 3 Mail Server Port 4 Setas Default 5 Authentication required Use SSL User Name Password
61. C1000 Touch 1 Tools Tools Jan 31 2010 03 46 About Systern Logs Run Reports Gradient Calculator RealTime FCR Demo E 31 User User About System Logs System Messages Log System Usage Log di Run Reports 72 C1000 TouchYV USB e Gradient Calculator Administrator 2
62. Step C1000 TouchYV GOTO Repeat Times OK 35 C1000 TouchYV 36 C1000 Touch 2 18 21 C1000 Touch 2
63. 0 19 10 uu 105 C OK Run UNSAVED on Multiple Blocks Lid Temp 105 C Additional Settings m r OK Cancel 19 6 Additional Settings e e ID 20 C1000 Touch DNA Engine C1000 TouchYV DNA
64. 6 Save Mail Servers 7 GMAIL 5 10 7 1 Mail Servers 2 Remove Server 3 Yes 23 24 C1000 TouchYV C1000 TouchTV 2 11 18 19 19 1 New Protocol
65. 1 18 ce Gradient range Lower 0 1 30 0 lt 99 0C Upper 100C 24 0 C Time 1 18 e Increment 0 1 C 1 10 0 10 0C Ramp rate 1
66. 9 9 RY i ve a r sc a Ie eR NN RR 10 C1000 Touch 12 ee 14 18 C1000 Touch 20 e lt 20 2 25 25 RR RAR RR 28 ar VEA A ES A ep ee Ne CN 36 PERS HJ eth RS wets Site cece tes edhe ead ee eee bh Soe le 37 Fe a Fees ag TS Aa ae a ae Rn eT ee eee ee nme 38 3 Li 40 PAn Em ed LOD id I eS 40 FF Bat Cod Oo EE EE TEE NR te a ee 44 ki 45 FERS SILO CR TD BS E A tcc Nl i 47 47 ES 47 4 RPP PT CPE PPR Ee 50 kk 50
67. 1 C1000 Touch C1000 Touch 2 e USBB C1000 Touch USB A 3 S1000 C1000 Touch USB C1000 Touch USB B USB A 2 C1000 Touch 10 C1000 Touch 1000 4 96 well Fast 96 well Deep Dual 48 well Fast 384 well
68. e CAN CSA C22 2 NO 61010 2 010 04 2 010 e CAN CSA C22 2 NO 61010 2 081 04 2 081 e EN61010 1 2001 1 e EN 61010 2 010 2003 2 010 e EN 61010 2 081 2002 A1 2003 2 081 UL 61010 1 2004 R2008 1 e UL61010A 2 010 2002 2 EMC IEC61326 1 2005 EMC A EN
69. 0 1 5 C Extend 1 60 60 Beep 28 C1000 Touch 1 2
70. C1000 TouchTM 2 5 C1000 Touch 5 3 4 ii 5 C1000 Touch
71. Tm w A x T 2 y G z C 4 w x y z A T G C 14 bp 57 C1000 TouchYM AH AG T AS AH CalMole K T Kelvin AS CalMole K AG CalMole K 26 Breslauer 1986 AG R T In DNA DNA R 1 986 CalMole K 2 G T
72. Hot Start Activation 24 50 C1000 TouchTW Amplicon Length Temperature Gradient Range Hot Start Lee Activation Final Extension 24 Other 3 Amplicon Length bp 51 52 4 5 C1000 TouchTW Annealing Temperature T T 4 Tn 2 Tm 6 Next 1
73. e e Create User 71 C1000 TouchYV C1000 Touch 1 Log In 2 OK 3 Log Out User 31
74. Folders Files Preview ic WH Method Calc ma Recent lt Roots Lid 105 C Volume 10l 80005016 Bio Rad PCR IFRF1RB 1 98 C 0 30 Bio Rad qPCR IPRF8kKB 2 98 C 0 05 ISCRIFT TAQFST NESTPR3 60 C1000 TouchrM 27 C1000 Touch PCR Bio Rad PCR CFX96TM CFX384TM qPCR Bio Rad qPCR 61 C1000 TouchYV e Recent Locations Real Time Data Locations 100 PCR
75. 3 C1000 Touch S1000 3 1 2 C1000 TouchYM C1000 Touch S1000 C1000 Touch S1000 S1000 SCREEN e PAUSE S1000 e CANCEL S1000 e ENTER CFX Manager
76. PCR LEY GOTO standard fast ultrafast PCR 2
77. 9 Name e e C1000 Touch e 1 Log In Log Out 2 Tools Tools 3 Admin Email Settings 20 C1000 TouchYV GMAIL GMAIL GMAIL 1 Mail Server GMAIL 2 GMAIL 21 3 C1000 TouchTV
78. C1000 TouchTW 184 1100 185 1138 185 1148 185 1196 185 1197 Copyright Bio Rad Laboratories Inc Bio Rad Laboratories Inc Gmail Google Inc LICENSE NOTICE TO PURCHASER This base unit Serial No in combination with its immediately attached Bio Rad sample block module s constitutes a thermal cycler whose purchase conveys a limited non transferable immunity from suit for the purchaser s own internal research and development and for use in Human In Vitro Diagnostics and in applied fields under one or more of U S Patents Nos 5 656 493 5 333 675 5 475 610 claims 1 44 158 160 163 and 167 only and 6 703 236 claims 1 7 only or corresponding claims in their non U S counterparts owned by Applera Corporation No right is conveyed expressly by implication or by estoppel under any other patent claim such as claims to apparatus reagents kits or methods such as 5 nuclease methods Further information on purchasing licenses may be obtained by contacting the Director of Licensing Applied Biosystems 850 Lincoln Centre Drive Foster City California 94404 USA This C1000 TouchTM thermal cycler when combined with a CFX96 detection module bearing a valid label license under U S
79. 100 959
80. 6723 C1000 TouchTV C1000 Touch KETAR 2 2 2 C1000 TouchYV 2
81. Patent No 6 814 934 constitutes a real time thermal cycler licensed under U S Patent No 6 814 934 and corresponding claims in any Canadian counterpart patent thereof owned by Applera Corporation for use in research human in vitro diagnostics and all applied fields except veterinary in vitro diagnostics provided that the real time thermal cycler royalty fee that is applicable to said thermal cycler has been paid No rights are conveyed expressly by implication or estoppel to any patents on real time methods including but not limited to 5 nuclease assays or to any patent claiming a reagent or kit For further information on purchasing license rights contact the Director of Licensing at Applied Biosystems 850 Lincoln Centre Drive Foster City California 94404 USA This product is covered by one or more of the following U S patents their foreign counterparts or their foreign patents pending owned by Eppendorf AG US Patent Nos 6 767 512 and 7 074 367 No rights are conveyed expressly by implication or estoppel to any patents on PCR methods or to any patent claiming a reagent or kit C1000 TouchYV PCR PCR
82. 1 Back Save Run T T 1 2 Protocol AutoWriter T Calculator Forward Primer A T G C OK Reverse Primer A T G C OK BACK T
83. 1 Log In ADMIN 2 Tools Admin 73 C1000 TouchTM User Admin User Admin 32 Admin Tools User ADMIN Jan 31 2010 03 48 About System Settings System Logs User Management Run Reports Email Settings Gradient Calculator Firmware Update RealTime PCR Demo System Backup Restore USE Thumbkey Test Ba 32 Admin Admin Admin System Settings Open Login required
84. 3 55 C 0 30 4 TIC 1 00 5 Goto 2 34X 6 72 C 5 00 117C 0 00 Y USB Drive v ew amp A wm New Folder Folder Options File Options Edit Run 28 3 New Folder OK 1 Saved Files 2 3 Folder Options 4 Copy 5 Folder Name 6 29 Location 64 C1000 TouchTM FolderName Olivia Location PUSB Drive G Cancel 29 7 Save 65 C1000 TouchTW
85. 61326 1 2006 EMC A FCC 15 B 15 107 15 109 A FCC FCC 15 A vi C1000 TouchTM FCC
86. 8 well 105 C 384 well 95 C CFT 30 0 C 31 0 C C1000 TouchTW 1 Volume 2 3 OK Volume Calculated Temperature Volume 0 Block 96 well Dual 48 well 105 C 384 well 95 CF
87. Engine Ramp 43 C1000 TouchYM Additional Settings User Name PETE Email Address BIO RAD COM Sample ID TEST 20 DNA Engine e 7 OK 8 OK Status Status Dual 48 48 A B
88. S delta G AA TT 9 1 24 1 9 AT TA 8 6 23 9 1 5 AC TG AG TC TA AT TT AA TC AG TG AC CA GT CT GA CC GG CG GC GA CT GT CA GC CG GG CC 26 Breslauer 59 C1000 TouchTM 5 33 34 Saved Files Run Edit Saved Files F 27 Saved Files Jan 31 2010 03 40
89. TE 1 kbp C1000 TouchYM 60 kbp RE 25 40 1 lt 5 720 55 C1000 TouchYV PCR T T T T Th PCR
90. e 45 46 C1000 TouchYV PCR PCR C1000 TouchYV 2 Resume GOTO 1 Skip 2 Skip
Download Pdf Manuals
Related Search
Related Contents
Diamond Multimedia S9250PCI User's Manual Soluzioni per l`isolamento termico ed il risparmio energetico Disney CR-210 User's Manual 英文説明書 Manual de Operações PABX XT-100 PABX XT Always there to help you Cash Counter User Guide - Commonwealth Bank of Australia Sharp EL-6985 Owner's Manual JET 719100 Use and Care Manual Copyright © All rights reserved.
Failed to retrieve file