MultiBac Expression System User Manual
Contents
1. M is located in between the p10 and polh promoters The transfer vector pUCDM has an identical expression cassette including a multiplication module as pFBDM This expression cassette is flanked by a LoxP inverted repeat Vector pUCDM contains a chloramphenicol resistance marker and a conditional R6Ky MultiBac System Berger Fitzgerald Richmond VI origin of replication which makes its propagation dependent on the expression of the pir gene in the prokaryotic host pUCDM BstZ171 Spel Clal Nrul AAGGTCCGTATACTAGTATCGATTCGCGACCractcce Multiplication Module M MCS1 Figure 3 Transfer vector pUCDM The circle map of pUCDM shows promoters polh p10 terminators SV40 HSVtk multiple cloning sites MCS1 MCS2 the inverted repeat for cre lox site specific recombination LoxP and a resistance marker chloramphenicol Genes of interest are cloned into MCS1 or MCS2 using unique restriction sites The multiplication module M is located in between the p10 and polh promoters B 2 Generating multigene expression cassettes Our vectors pFBDM and pUCDM are particularly suited for generating multigene expression cassettes due to the multiplication module inserted in between the two promoters The logic of multiplication is illustrated below The only prerequisite for assembling multigene expression cassettes is that the restriction enzymes used for multiplication e g Pmel Avrll Spel and either BstZ17I or Nrul are uniqu2. while BstZ17I Nrul and Pmel are blunt cutters Multigene derivatives of pUCDM can be generated following the same logic MultiBac System Berger Fitzgerald Richmond VIII B 3 Baculovirus engineered for improved protein production We modified the baculovirus genome to obtain improved protein production properties Two baculoviral genes v cath and chiA were disrupted which leads to improved maintenance of cellular compartments during infection and protein production The v cath gene encodes for a viral protease V CATH which is activated upon cell death by a process dependent on a juxtaposed gene on the viral DNA chiA which encodes for a chitinase We disrupted both genes to eliminate V CATH activity and to gain the option of utilizing chitin affinity chromatography for purification without interference from the chiA gene product The quality of proteins produced by our MultiBac baculovirus is significantly improved through a reduction of viral dependent proteolytic activity and reduced cell lysis In place of the disrupted viral DNA sequence we placed a LoxP sequence for cre lox site specific recombination MultiBac mini attTn7 Figure 5 MultiBac baculoviral DNA The modified viral genome is shown in a schematic representation The Tn7 attachment site is located within a LacZa gene insertion of Tn7 elements from pFBDM derivatives therefore produces a white phenotype when plated on agar containing BluoGal and IPTG In plac
3. NsiI SphI KpnI TGGTGCTAGCAGCTGATGCATAGCATGCGGTACCGGGAGATGGGGGAGGCTAACTG Enzymes that cut pFBDM once 229 Nael 4304 SphI 4487 Clal 4695 SacI 1107 Pvul 4311 Nsil 4487 Bsp1061 4705 NotI 1253 Fspl 4315 Pvull 4494 Nrul 4714 BstBI 1955 AlwNI 4318 NheI 4647 BamHI 4719 XbaI 2809 MluNI 4325 NcoI 4654 RsrII 4731 PstI 2817 BstXI 4331 XhoI 4662 BssHII 4740 HindIII 2925 EcoRV 4339 XmaI 4669 EcoRI 4855 Mfel 3992 PmeI 4341 Smal 4679 Stul 4868 Hpal 4298 KpnI 4345 BbsI 4685 SalI 5019 AvrII 4304 Pael 4478 BstZ171I Enzymes that cut pFBDM twice 876 XmnI 2810 StyI 1 3901 XmnI 4755 Scal 995 Scal 3117 BglII 4480 Spel 4856 BsmI 2647 BglII 3700 StyI 1 4697 Spel 4949 BsmI 2810 Sty1 2 3700 Sty1 2 Enzymes that do not cut pFBDM AflII Agel Apal Bell BstEII Mlul Narl NdeI Sfil SnaBI MultiBac System Berger Fitzgerald Richmond XIV E 2 Restriction endonuclease sites in pUCDM MCS1 ofpUCDM BamHI RsrII BssHIIl CCGGATTATTCATACCGTCCCACCATCGGGCGCGGAT CCCGGT CCGAAGCGCGCGG StuI SalI SacI XbaI AATTCAAAGGCCTACGTCGACGAGCTCACTAGTCGCGGCCGCTTTCGAATCTAGAG PstI CCTGCAGTCTCGACAAGCTTGTCGAGAAGTACTAGAGGATCATAATCAGCCATACC MCS2 of pUCDM Smal BbsI Xmal ACTATACTGTAAATTACATTTTATTTACAATCACTCGACGAAGACTTGATCACCCG Pael XhoI Nhel Nsil SphI GGATCTCGAGCCATGGTGCTAGCAGCTGATGCATAGCATGCGGTACCGGGAGATGG Enzymes that cut pUCDM once 358 SnaBl 792 Smal 1105 RsrIl 1306 Mfel 755 Pael 796 BbsI 1 13 BssHII 1319 Hpal 755 SphI 929 BstZ171I 1130 Stul 1551 Sty1 2
4. 762 Nsil 938 Bsp1l061 1136 Sall 1551 StyI 1 769 NheI 938 Clal 1146 SacI 2408 MluNI 782 XhoI 945 NruI 1170 XbaI 2745 AgeI 790 XmaI 1098 BamHI 1182 PstI 2870 AlwNI 453 PmeI 1581 Avril Enzymes that cut pUCDM twice 114 HindIII 776 NcoI 1156 Bagl 2141 EcoRI 402 EagI 931 SpeI 1165 BstBI 2442 NcoI 402 NotI 1120 EcoRI 11971 HindIII 2558 Scal 413 KpnI 1148 SpeI 1206 Scal 2671 BstBI 749 KpnI 1156 NotI Enzymes that do not cut pUCDM AflII Apal Bell BglII BstEIl BstxI ECORV Fspl Mlul Nael Narl NdeI Pvul Sfil XmnI MultiBac System Berger Fitzgerald Richmond XV E 3 Generation of DH10MultiBac electro competent cells Expression of Cre Recombinase protein and generation of electro competent DH10MultiBac cells 1 20 21 Electroporate pBADZ His6Cre plasmid into DH10MultiBac cells 25 microFD 2 0 kV 200 Ohm grow in 2xTY medium for 4h at 37 C Plate on LS plates Low Salt Medium Agar with antibiotics Kan Tet Zeocin and BluoGal IPTG Grow a 500 ml LS Low Salt culture from one blue colony Antibiotics Kan Tet Zeo Temp 37 C or RT Grow to ODs00 0 25 at 37 C or RT Take 500 ul sample Minus probe Add L Arabinose to 0 1 0 5 g in 500 ml Grow to ODgso0 0 5 Take 250 ul sample Plus probe Cool culture on ice for 15 min Resuspend in 500 ml ICE COLD STERILE 10 glycerol sol Centrifuge at 4000rpm 4 C 15 min Resuspend in 250 ml ICE COLD STERILE 10 glycerol
5. BW23474 BW23474 cells pFBDM vector pUCDM vector control plasmid for Tn7 transposition control plasmid for cre lox site specific recombination a generic transfectant reagent E coli strains expression the pir gene for propagation of pUCDM derivatives any other strain with pir background can be used In our experiments we used vectors carrying genes for fluorescent proteins ECFP and EYFP as controls These genes are marketed under license by Molecular Probes They are particularly useful as controls since the observation of fluorescence either by fluorescent microscopy or by using a fluorescence spectrophotometer is entirely straight forward However any type of control plasmid carrying a gene encoding for a protein that can be identified with ease glucurodinase catechol dioxygenase XylE luciferase etc can be utilized For example CellFECTIN Invitrogen LipoTAXI Transfection Reagent Stratagene etc MultiBac System Berger Fitzgerald Richmond XIII E Supplementary Information E 1 Restriction endonuclease sites in pFBDM MCS1 of pFBDM BamHI RsrII BssHII EcoRI ATTCATACCGTCCCACCATCGGGCGCGGAT CCCGGT CCGAAGCGCGCGGAATT CA StuI SalI SacI NotI BstBI XbaI AAGGCCTACGTCGACGAGCTCACTAGTCGCGGCCGCTTTCGAATCTAGAGCCTGC PstI HindIII AGTCTCGACAAGCTTGTCGAGAAGTACTAGAGGAT CATAATCAGCCATACCACAT MCS2 of pFBDM Smal BbsI Xmal XhoI NcoI TTACATTTTATTTACAATCACTCGACGAAGACTTGATCACCCGGGATCTCGAGCCA NheI PvuII
6. MultiBac Expression System User Manual I Berger D J Fitzgerald T J Richmond Imre Berger PhD Daniel J Fitzgerald PhD Prof Timothy J Richmond PhD are at the Institute for Molecular Biology and Biophysics ETH Honggerberg HPK CH 8093 Ziirich Switzerland Z rich October11 2004 MultiBac System Berger Fitzgerald Richmond I A Synopsis IH B New Baculovirus Tools for Multigene Applications V B 1 Transfer vectors pFBDM and pUCDM V B 2 Generating multigene expression cassettes VI B 3 Baculovirus engineered for improved protein production IX C Protocols IX C 1 Cloning into pFBDM or pUCDM transfer vectors Ix C 2 Cre lox site specific recombination protocol X C 3 Transposition protocol for pFBDM derivatives X C 4 One step transposition cre lox site specific recombination X C 5 Preparation of cre lox integrands for Tn7 transposition XI C 6 Bacmid preparation and infection of insect cells XII D The MultiBac System Kit XII E Supplementary Information XII E 1 Restriction endonuclease sites in pFBDM XII E 2 Restriction endonuclease sites in pUCDM XIV E 3 Generation of DH10MultiBac electro competent cells XV E 4 Efficiency of cre lox site specific recombination into MultiBac XVI E 5 Effect of chiA and v cath deletion in MultiBac XVII E 6 Production of a 275 kDa protein complex using MultiBac XVII Illustrations Figure 1 The MultiBac system in a schematic view IV Figure 2 Transfer vecto
7. competent MultiBac derivative is then incubated in 500 ml 2xTY medium containing chloramphenicol 25 ug ml kanamycin 50 ug ml ampicillin 50 ug ml and tetracyclin 10 ug ml at 37 C until OD oo reaches 0 5 The culture is then cooled on ice 15 min and centrifuged 4000 rpm 8 min The cell pellet is resuspended in 250 ml ice cold 10 glycerol solution sterile and centrifuged 4000 rpm 8 min The cell pellet is then resuspended in 200 ml ice cold 10 glycerol solution sterile and centrifuged again 4000 rpm 8 min Then the cell pellet is resuspended in 50 ml ice cold 10 glycerol solution sterile and finally after centrifugation in 1 ml 10 glycerol solution sterile Cells are frozen in 50 100 ul aliquots in liquid nitrogen and stored at 80 C For transposition of pFBDM derivatives proceed as described in C 3 MultiBac System Berger Fitzgerald Richmond XII C 6 Bacmid preparation and infection of insect cells Preparation of bacmid DNA infection of insect cells and protein expression is carried out according to established protocols e g O Reilly D R Miller L K amp Luckow V A Baculovirus expression vectors A laboratory manual Oxford University Press New York Oxford 1994 Bac to Bac Baculoviorus Expression Systems Manual Invitrogen Life Technologies Incorporated 2000 D The MultiBac System Kit Reagents to be supplied in a MultiBac system kit DH10MultiBac cells
8. d integration of pUCDM derivative Transposition and site specific recombination are carried out either sequentially or alternatively concomitantly in a one step reaction Bacmid DNA is prepared from selected clones and used to transfect insect cells for protein production MultiBac System Berger Fitzgerald Richmond V B New Baculovirus Tools for Multigene Applications B 1 Transfer vectors pFBDM and pUCDM The transfer vector pFBDM contains two expression cassettes in a head to head arrangement with multiple cloning sites MCS1 and MCS2 flanked by polh or p10 promoters and SV40 or HSVtk polyA signal sequences respectively Multiplication module M is located in between the promoter sequences The sequences used for Tn7 transposition Tn7L and Tn7R encompass the expression cassettes and a gentamycin resistance marker BstZz171 Spel Clal Nrul AAGGTCCGTATACTAGTATCGATTCGCGACCractcce Multiplication Module M ee eee Ncol IN MCS2 Dis MCS1 vu Nsil Sphl Pst Kpnl YL e Bonn _ Hindlll HSVtk P10 polh i svao Tny Au pFBDM 5279bp gt Pvul Fspl AlwNI Figure 2 Transfer vector pFBDM The circle map of pFBDM shows promoters polh p10 terminators SV40 HSVtk multiple coling sites MCS1 MCS2 transposon elements Tn7L Tn7R and resistance markers ampicillin and gentamycin Genes of interest are cloned into MCS1 or MCS2 using unique restriction sites The multiplication module
9. e which can be easily accomplished for instance by site directed mutagenesis prior to multigene cassette assembly Genes are cloned into MCS1 and MCS2 of pFBDM The entire expression cassette is then excised by Pmel and Avrll digestion The resulting fragment is placed into the multiplication module of a pFBDM derivative containing further sets of genes via either SpeI BstZ17I or Spel Nrul sites Spel produces a cohesive end compatible with Avrll while BstZ17I Nrul and Pmel are blunt MultiBac System Berger Fitzgerald Richmond VII cutters The restriction sites involved are eliminated in the process and multiplication can be repeated iteratively using the module present in the inserted cassette The same logic applies also for generation of pUCDM derivatives with multigene expression cassettes Also promoter and terminator sequences can be easily modified if desired using appropriate restriction sites in our vectors pFBDM cd BstZ171 Spel digestion Ligation oFBDN abed Figure 4 Assembling multigene expression cassettes The logic of multiplication is shown for pFBDM The expression cassette containing two genes of choice denoted a b is excised by digestion with AvrII and Pmel boxed and placed into a multiplication module of a construct containing further genes c d via BstZ17I Spel or alternatively Nrul Spel sites present in the multiplication module M Spel produces a cohesive end compatible with Avrll
10. e of the disrupted v cath and chiA viral genes a LoxP sequence was inserted to accept pUCDM derivatives by Cre catalysis producing a chloramphenicol resistant phenotype MultiBac System Berger Fitzgerald Richmond C Protocols C 1 Cloning into pFBDM or pUCDM transfer vectors Reagents Restriction endonucleases DNA ligase E coli competent cells Ampicillin Chloramphenicol The genes of choice are cloned using standard cloning procedures into the multiple cloning sites MCS1 or MCS2 see Supplementary Information of pFBDM and pUCDM Ligation reactions for pFBDM derivatives are transformed into standard E coli cells for cloning such as TOP10 DH5a HB101 and plated on agar containing ampicillin 100 ug ml Ligation reactions for pUCDM derivatives are transformed into E coli cells expressing the pir gene such as BW23473 BW23474 and plated on agar containing chloramphenicol 25 ug ml Correct clones are selected based on specific restriction digest and DNA sequencing of the inserts C 2 Cre lox site specific recombination protocol Reagents Electro competent DH 10MultiBac cells Ampicillin Kanamycin Chloramphenicol Approximately 5 10 ng of the sequenced pUCDM derivative is incubated on ice 15 min with 50 100 ul electro competent DH10MultiBac cells Following electroporation 200 ohms 25 uF 1 8 kV pulse cells are incubated at 37 C for 8 hours and plated on agar containing kanamycin 50 ug m
11. f 32 of the specimens showed strong fluorescence emission indicating expression of the EYFP protein Table below E 5 Effect of chiA and v cath deletion in MultiBac During heterologous protein production using a commercially available baculovirus expression system we observed viral dependent proteolytic breakdown consistent with the action of a cysteine protease The baculoviral v cath gene encodes for a cysteine protease which is directly involved in liquefaction of the insect cell host V CATH is activated upon cell death by a process dependent on a juxtaposed gene on the viral DNA chiA which encodes for a chitinase We disrupted both genes to eliminate V CATH activity and to gain the option of utilizing chitin affinity chromatography for purification without interference from the chiA gene product We assayed the effect of the disruption by comparing samples from cells infected with MultiBac virus to cells infected with a commercially available baculovirus carrying v cath and chiA We observed strongly reduced proteolytic activity in lysate from cells infected with MultiBac MultiBac System Berger Fitzgerald Richmond XVIII E 6 Production of a 275 kD protein complex using MultiBac In a test experiment we expressed the yeast Isw2 chromatin remodeling complex consisting of the 130 kDa Isw2p and the 145 kDa Itclp proteins We created one version of MultiBac with both proteins integrated at the attIn7 site and a second version w
12. ion with one plasmid only significantly larger amounts of DNA have to be utilized in this reaction Approximately 2 4 ug of the pFBDM derivative and 2 4 ug of the pUCDM derivative of choice are incubated on ice 15 Cre min with 50 100 ul electro competent DH10MultiBac cells Following electroporation MultiBac System Berger Fitzgerald Richmond XI 200 ohms 25 uF 1 8 kV pulse cells are incubated at 37 C for 8 hours and plated on agar containing chloramphenicol 25 ug ml kanamycin 50 ug ml gentamycin 7 ug ml tetracyclin 10 ug ml BluoGal 100 ug ml and IPTG 40 ug ml White colonies are selected after incubation at 37 C 18 24 hours Proceed to bacmid preparation for insect cell infection C 6 C 5 Preparation of cre lox integrands for Tn7 transposition Reagents DH10MultiBac cells with integrated pUCDM derivative Ampicillin Kanamycin Tetracyclin Chloramphenicol BluoGal IPTG 2xTY medium glycerol For certain applications it can be advantageous to add protein genes for expression to a MultiBac baculoviral DNA which already carries a set of foreign genes integrated by Cre catalysis Then the DH10MultiBac cells harboring recombinant MultiBac with an integrated pUCDM derivative see C 2 are restreaked on agar containing chloramphenicol 25 ug ml kanamycin 50 ug ml ampicillin 100 ug ml tetracyclin 10 ug ml BluoGal 100 ug ml and IPTG 40 ug ml A blue colony with a transposition
13. ith Isw2p integrated at the attTn7 site and Itclp inserted at the LoxP site Spatial decoupling of the two genes on the virus did not adversely affect either relative production levels of the subunits or functional assembly of the Isw2 complex in insect cells exemplifying the utility of both Cre lox and Tn7 sites for simultaneous integration and expression of proteins gt gt Ra Ky Figure 8 Expression of the 275 kDa N OR NS N N chromatin remodeling complex Isw2 using Ne x amp MultiBac Isw2 complex was expressed from S gt QX the attTn7 site or alternatively from the rt attIn7 and LoxP sites of MultiBac Oo P Itc1p BacLoxP Cell lysate as well as protein E n complex purified from both composite Isw2p bacmids exhibits virtually identical protein production levels Sample from uninfected Sf21 cells is included as a control MultiBac System Berger Fitzgerald Richmond
14. l chloramphenicol 25 ug ml and ampicillin 100 ug ml Colonies appear after incubation at 37 C 12 15 hours Proceed to bacmid preparation for insect cell infection see C 6 or prepare clones for integration of a pFBDM derivative by Tn7 transposition see C 5 MultiBac System Berger Fitzgerald Richmond X C 3 Transposition protocol for pFBDM derivatives Reagents Ce cells Electro competent DH10MultiBac Ampicillin Kanamycin Tetracyclin Gentamycin BluoGal IPTG Approximately 5 10 ng of the sequenced pFBDM derivative is incubated on ice 15 min with 50 100 ul electro competent DH10MultiBac cells Following electroporation 200 ohms 25 uF 1 8 kV pulse cells are incubated at 37 C for 8 hours and plated on agar containing kanamycin 50 ug ml gentamycin 7 ug ml ampicillin 100 ug ml tetracyclin 10 ug ml BluoGal 100 ug ml and IPTG 40 ug ml White colonies are selected after incubation at 37 C 18 24 hours Proceed to bacmid preparation for insect cell infection C 6 C 4 One step transposition cre lox site specific recombination Reagents Cre cells Electro competent DH10MultiBac Kanamycin Tetracyclin Gentamycin Chloramphenicol BluoGal IPTG Cre lox site specific recombination and Tn7 transposition can be carried out simultaneously in DH10MultiBac cells if desired Since the efficacy of a double transformation is reduced as compared to transformat
15. r pFBDM V Figure 3 Transfer Vector pUCDM VI Figure 4 Assembling multigene expression cassettes VI Figure 5 MultiBac baculoviral DNA IX Figure 6 Efficiency of cre lox site specific recombination in MultiBac XVI Figure 7 Expression of the 275 kDa remodeling complex Isw2 using MultiBac XVII MultiBac System Berger Fitzgerald Richmond Ill A Synopsis We describe here in detail new baculovirus transfer vectors constructed specifically for multigene applications We present a modified recipient baculovirus DNA for these transfer vectors engineered for improved protein production and a simple and rapid method to integrate genes via two access sites attTn7 and LoxP into this baculoviral DNA in E coli cells tailored for this purpose An intense focus of biological research efforts in the post genomic era is the elucidation of protein interaction networks interactome Since many of the identified multiprotein complexes are not present in sufficient quantities in their native cells for detailed molecular biological analysis their study is dependent on recombinant technologies for large scale heterologous protein production Currently recombinant expression methods require a disproportionate investment in both labor and materials prior to multiprotein expression and subsequent to expression do not provide flexibility for rapidly altering the multiprotein components for revised expression studies Our invention using the bac
16. sol Centrifuge at 4000rpm 4 C 15 min Resuspend in 10 ml ICE COLD STERILE 10 glycerol sol Centrifuge at 4000rpm 4 C 15 min Resuspend in 1 ml ICE COLD STERILE 10 glycerol sol Prepare 80 ul aliquots sterile Eppendorfs Shock freeze in liq nitrogen store at 70 C Centrifuge Minus probe und Plus probe 14 krpm 5 min RT Resuspend in 150 ul PGLB Analyze by 15 SDS PAGE load 5 10 ul A strong induced band at around 35 kDa shows presence of Cre protein Strong Cre expression is mandatory for successful integration of pUCDM derivatives MultiBac System Berger Fitzgerald Richmond XVI Low Salt Medium A gar for Zeocin cultures LS culture medium Low Salt 10 g Tryptone 5g NaCl 5g Yeast Extract Water dd to 950 ml pH to 7 5 with IN NaOH Add water dd to 1L For plates add 15g L agar Autoclave liquid cycle Add Zeocin to 25 ug ml below 55 C same for other antibiotics BlouGal 100mg ml stock 1000x IPTG 0 5 M stock 1000x Store plates at 4 C in the dark BluoGal is light sensitive E 4 Efficiency of cre lox site specific recombination into MultiBac The propagation of MultiBac in DH10MultiBac cells is dependent on the presence of the F replicon on the bacmid A function of the F replicon is the tight control of the copy number one or two reducing the potential for undesired recombination Introduction of pFBDM derivatives into MultiBac disrup
17. t Tn7 transposition from pFBDM derivatives carrying multigene cassettes and LoxP site specific recombination from pUCDM derivatives carrying multigene cassettes efficiently in a single step in E coli These protocols can be used not only to integrate multigene cassettes with coding sequences for multiprotein complex subunits into MultiBac but also to integrate specific enzymes kinases acetylases etc for modifying the proteins under investigation ac e A LoxP He fe eT sl EN n LoxP AHA HA m en pFBDM fabcd pUCDMefgh a of Eemi Day 1 Tn7 LoxP Cre lox Site Transposition Specific Recombination Blue White BacLoxP Chloramphenicol DH10BACLoxP cells Bacmid Isolation Day 3 BacLoxP fabcd efgh Transfection of Insect Cells Day 4 Virus Amplification and Protein Production Figure 1 The MultiBac system in a schematic view Genes of interest are assembled into multigene expression cassettes using the multiplication module present on transfer vectors pFBDM and pUCDM The resulting vectors are introduced into MultiBac baculoviral DNA in DH10MultiBac E coli cells which contain the factors for Tn7 transposition for pFBDM derivatives and cre lox site specific recombination for pUCDM derivatives Colonies containing bacmid carrying integrated multigene cassettes are identified by blue white screening Tn7 transposition disrupts a lacZa gene and chloramphenicol resistance conferred by Cre catalyze
18. ts the lacZa gene thus allowing for unambiguous identification of cells containing only composite bacmid In case of Cre catalyzed integration of pUCDM derivatives however a co existence of one composite bacmid and one parent MultiBac molecule can not be ruled out based on chloramphenicol resistance Virus from initial transfections with MultiBac containing a gene for yellow fluorescent protein EYFP inserted by Cre catalysis was therefore clonally separated by plaque purification 29 of 32 91 plaque purified specimens expressed EYFP arguing for a cre lox site specific recombination reaction with close to saturating efficacy MultiBac System Berger Fitzgerald Richmond XVII Ex 488 nm Ex 488 nm 5000 4000 3000 2000 Fluorescence Arbitrary Units Fluorescence Arbitrary Units 520 540 560 580 600 520 540 560 580 600 Wavelength nm Wavelength nm PAll PAI7 PA22 PA27 PA32 PAl2 PAI8 PA23 PA28 PA33 PAI4 PAI9 PA24 PA29 PAIS PA20 PA25 PA30 PAl6 PA2l PA26 PA31 Figure 6 Efficiency of cre lox site specific recombination in MultiBac The gene encoding for yellow fluorescent protein EYFP was cloned into pUCDM and integrated into MultiBac by Cre catalysis Virus was clonally separated by plaque assay 32 plaques were tested for EYFP expression by fluorescence spectroscopy Excitation was at 488 nm Spectra recorded from cell lysate from viruses to 12 are shown above In this experiment 91 29 o
19. ulovirus expression system introduces three major advances which are instrumental to fully exploit the potential of this heterologous protein production system 1 New transfer vectors pFBDM and pUCDM that contain a multiplication module These vectors greatly facilitate modular combination of heterologous genes with a minimum requirement for unique restriction sites Viral promoters currently plO and polh very late promoters can be exchanged in our vectors to other promoter sequences early late mammalian if required Likewise terminator sequences currently SV40 HSVtk can be substituted 2 Engineered baculovirus genome MultiBac with improved protein production properties Two baculoviral genes were disrupted which leads to improved maintenance of cellular compartments during infection and protein production The quality of proteins produced by our system is significantly improved through a reduction of viral dependent proteolytic activity and reduced cell lysis 3 New protocol for rapid combinatorial generation of recombinant baculovirus DNA by accessing the viral genome via two specific sites In addition to the commercially available Tn7 transposon site we introduced a LoxP sequence at a separate site on the baculovirus genome which can accept multigene expression cassettes from our pUCDM plasmid by site MultiBac System Berger Fitzgerald Richmond IV specific recombination We developed a protocol for carrying ou
Download Pdf Manuals
Related Search