Troubleshooting coupled in vitro transcription–translation system
Contents
1. c E Total GFP Active GFP E4 i 2 0 0 5 10 15 20 Time hours Figure 1 Quality criteria for the determination of synthesized reporter protein GFP a An aliquot from kinetics of the GFP synthesis in the RTS 500 reaction mix was applied on SDS PAGE Asterisk S30 band was used to normalize input per lane b A sister aliquot was applied to a native PAGE and the fluorescence of GFP was monitored c GFP synthesis in the course of 20 h incubation Blue squares total synthesis of GFP SDS PAGE green squares active GFP native PAGE expressed in E coli Roche The input variations per lane were normalized by scanning of a well defined band from the S30 pattern asterisk in Figure la taking into account the respective pixel numbers Usually amounts of 0 3 0 7 mg ml of total GFP were produced in 10 h in the RTS 100 reactions volume 10 ul Fluorometric analysis of GFP The active GFP present in each reaction sample was calcu lated by measuring the fluorescence of the GFP at 430 580 nm in the native PAGE for details see also the above mentioned Bio rad information After a maturation period of at least 8 h at 4 C under the conditions of the reaction mix ture 1 5 ul from a 10 ul reaction was mixed together with the native loading buffer and directly applied to the 15 PAGE for analysis under the native conditions 9 A longer matura tion period of up to 30 h did not improve the active fractio2. 725 741 Jewett M C and Swartz J R 2004 Substrate replenishment extends protein synthesis with an in vitro translation system designed to mimic the cytoplasm Biotechnol Bioeng 87 465 472 Underwood K A Swartz J R and Puglisi J D 2005 Quantitative polysome analysis identifies limitations in bacterial cell free protein synthesis Biotechnol Bioeng 91 425 435 Srivastava A K and Schlessinger D 1990 Mechanism and regulation of bacterial ribosomal RNA processing Annu Rev Microbiol 44 105 129
3. authors postulated an interference of GFP with adjacent domains during folding due to the particular topology of the B barrel GFP structure In the same paper evidence was presented that the solubility nicely corresponds to the active fraction of GFP regardless of whether GFP has been synthesized in yeast or E coli Figure 3 in Ref 18 The fact that the commercially available GFP is perfectly soluble therefore justifies our assumption that it has 100 activity Furthermore under optimized conditions reported here the activity of the synthesized GFP could be raised to 100 but never significantly above this value This observation adds further credit to the assumption of 100 activity of the reference GFP and indicates that the low active fraction observed in E coli is not an intrinsic feature of bacterial systems but rather might have reasons additional to those mentioned in Ref 18 namely the unfavorable usage of T7 polymerase routinely employed for inducing gene expres sion in E coli see below We can calculate the active fraction of synthesized GFP from both the amount of active GFP and the total amount synthesized SDS gel According to this procedure the active fraction was not higher than 30 in the experiment shown in Figure 1c and 50 20 on average see e g Ref 20 and PAGE 5 OF 9 Figure 1b in Ref 18 With the help of these quality criteria we aimed to improve the GFP active fraction up to 100 Sync
4. 1392 1395 Tsien R Y 1998 The green fluorescent protein Annu Rev Biochem 67 509 544 Ward W W and Bokman S H 1982 Reversible denaturation of Aequorea green fluorescent protein physical separation and characterization of the renatured protein Biochemistry 21 4535 4540 Makino Y Amada K Taguchi H and Yoshida M 1997 Chaperonin mediated folding of green fluorescent protein J Biol Chem 272 12468 12474 Ogawa H Inouye S Tsuji F I Yasuda K and Umesono K 1995 Localization trafficking and temperature dependence of the Aequorea green fluorescent protein in cultured vertebrate cells Proc Natl Acad Sci USA 92 11899 11903 Kerner M J Naylor D J Ishihama Y Maier T Chang H C Stines A P Georgopoulos C Frishman D Hayer Hartl M Mann M et al 2005 Proteome wide analysis of chaperonin dependent protein folding in Escherichia coli Cell 122 209 220 Chang H C Kaiser C M Hartl F U and Barral J M 2005 De novo folding of GFP fusion proteins high efficiency in eukaryotes but not in bacteria J Mol Biol 353 397 409 Sacchetti A Cappetti V Marra P Dell Arciprete R El Sewedy T Crescenzi C and Alberti S 2001 Green fluorescent protein variants fold differentially in prokaryotic and eukaryotic cells J Cell Biochem 81 117 128 Dinos G Wilson D N Teraoka Y Szaflarski W Fucini P Kalpaxis D and Nierhaus K H 2004 Dissecting the ribosomal inhibition me
5. 2b and Sa The results suggest that the rate of T7 polymerase is more affected by the lower temperature than the translation rate of ribosomes thus re establishing the coupling of transcription and translation and causing the beneficial effects observed Furthermore lowering the incubation temperature and thus the elongation rate has two beneficial effects on the active fraction 1 The aggregation of synthesized GFP is prevented thus increasing the active fraction as has been demonstrated at lower temperatures in vivo 28 The reason is that overex pression of proteins at 37 C in vivo might allow contacts of unfolded proteins and these contacts of hydrophobic patches of unfolded proteins lead to aggregations and inclusion bodies 11 We are dealing with a second effect not seen pre viously with in vivo studies Slowing down the elongation rate at 20 C improves the accuracy since with the higher elongation rates at 30 C we observe a low active fraction of 50 right from the very beginning of kinetic measure ments 30 min Figure la c where aggregation has not yet occurred Increasing the total protein yield Two additional parameters might influence the yield of the synthesized protein the stability of mRNA and the availabil ity of building units such as NTP s and amino acids These parameters are analyzed in this section The half lives of bac terial mRNAs at 37 C measure 1 most labile mRNAs to 7 5 min ribosomal prot
6. polymerase we had to con stitute our own S30 system derived from E coli BL21 The concentrations were adapted to those published by Ref 6 and are summarized in Table 1 The yield of synthesized Table 1 Final concentrations in the batch cell free system for protein synthesis Component Final concentrations according to Ref 6 PAGE 2 OF 9 Final concentrations in our reaction mix HEPES KOH pH 8 2 57 2 mM 60 mM Ammonium acetate 80 mM 80 mM Potassium glutamate 200 mM 230 mM Sodium oxalate 2 7 mM 3 mM DTT 1 76 mM 2 mM Cycle AMP 0 67 mM 0 7 mM Folinic acid 34 ug ml 35 ug ml tRNAs 340 ug ml 350 ug ml NADH 0 33 mM 0 35 mM Coenzyme A 0 27 mM 0 3 mM ATP 1 2 mM 1 5 mM CTP 0 86 mM 1 mM GTP 0 86 mM 1 mM UTP 0 86 mM 1 mM PEG 8000 2 w v 2 wiv Methionine 2 mM 2 mM 19 Amino acids 0 5 mM 2 mM PEP 33 mM 35 mM Magnesium acetate 15 mM 12 mM T7 RNAP 30 ug ml 100 ug ml E coli S30 cell lysate 4 6 A260 Plasmid DNA 4 ug 60 ul Rifampicin 10 ug ml H Leu 1 2 uM 35S Met 1 5 uM The reaction mix had a final volume of 1 ml to fit into the reaction chamber of the RTS 500 device with a volume of the feeding chamber of 10 ml see section about RTS 500 E coli HY Kit GFP in our homemade system was comparable with that of the commercially available one Roche RTS but for unknown reasons the active fraction was only half that of the latter Quantification of the GFP amount in SDS PAGE As a standard GFP reporter protein we u
7. that NTPs are not limiting the reaction of transcription which altogether confirm that neither synthesis of mRNA nor its half life are limiting fac tors for protein synthesis in the bacterial cell free system However a shortage of amino acids could be the reason for a reduction of protein synthesis since according to Jewett and Swartz 34 some amino acids are metabolized during the reaction of the cell free system e g cysteine serine threo nine glutamine and asparagine Therefore we added a mix ture of all 20 amino acids in the middle of the incubation time A little increase of total synthesis was observed in the batch system upon amino acid addition whereas the amount of the active GFP remained unchanged aa Figure 5a A strikingly different response to a second amino acid addition was seen in the semi continuous system 1 ml reac tion volume At 30 C the total GFP was almost doubled without a concomitant increase of the active GFP thus redu cing the active fraction to 36 Figure 5b However the amounts synthesized at 20 C were a surprise since they were larger than the corresponding 30 C values with and without a second addition of amino acids incubation time 20 h but with an active fraction of 90 95 The best results 1 8 A mRNA E Total GFP _ a 2 Oo 1 35 0 9 0 45 GFP nmol ml jwu jouu WNYW d4j5 0 10 20 Time hours Figure 4 Synthesis of GFP mRNA and GFP in the
8. Chem 269 25120 25128 Makarova O V Makarov E M Sousa R and Dreyfus M 1995 Transcribing of Escherichia coli genes with mutant T7 RNA polymerases stability of lacZ mRNA inversely correlates with polymerase speed Proc Natl Acad Sci USA 92 12250 12254 Schlieker C Bukau B and Mogk A 2002 Prevention and reversion of protein aggregation by molecular chaperones in the E coli cytosol implications for their applicability in biotechnology J Biotechnol 96 13 21 PAGE 9 OF 9 29 Mohanty B K and Kushner S R 1999 Analysis of the function of Escherichia coli poly A polymerase I in RNA metabolism Mol Microbiol 34 1094 1108 30 Selinger D W Saxena R M Cheung K J Church G M and Rosenow C 2003 Global RNA half life analysis in Escherichia coli reveals positional patterns of transcript degradation Genome Res 13 216 223 31 Liiv A Tenson T and Remme J 1996 Analysis of the ribosome large subunit assembly and 23S rRNA stability in vivo J Mol Biol 263 396 410 32 Carpousis A J and Dreyfus M 2004 In Nierhaus K H and Wilson D N eds Protein Synthesis and Ribosome Structure Wiley VCH Verlag GmbH amp Co Weinheim pp 185 206 ik 34 35 36 Nucleic Acids Research 2006 Vol 34 No 19 e135 Liiv A and Remme J 2004 Importance of transient structures during post transcriptional refolding of the pre 23S rRNA and ribosomal large subunit assembly J Mol Biol 342
9. Published online 11 October 2006 Nucleic Acids Research 2006 Vol 34 No 19 e135 doi 10 1093 nar gkl462 Troubleshooting coupled in vitro transcription translation system derived from Escherichia coli cells synthesis of high yield fully active proteins Madina B Iskakova Witold Szaflarski Marc Dreyfus Jaanus Remme and Knud H Nierhaus Max Planck Institut f r Molekulare Genetik AG Ribosomen Ihnestrasse 73 D 14195 Berlin Germany Laboratoire de Genetique Moleculaire Centre National de la Recherche Scientifique UMR8541 Ecole Normale Superieure 46 Rue d Ulm 75230 Paris Cedex 05 France and Department of Molecular Biology Institute of Molecular and Cell Biology Tartu University Riia 23 51010 Tartu Estonia Received January 30 2006 Revised May 9 2006 Accepted June 15 2006 ABSTRACT Cell free coupled transcription translation systems with bacterial lysates are widely used to synthesize recombinant proteins in amounts of several mg per ml By using reporter green fluorescence protein GFP we demonstrate that proteins are synthesized with an unsatisfyingly low active frac tion of 50 20 One reason is probably the T7 polymerase used being up to eight times faster than the intrinsic transcriptase and thus breaking the coupling between transcription and translation in bacterial systems The active fraction of the synthe sized protein was improved by using either a slower T7 transcriptase mutan
10. RTS 500 system 1 ml reaction Open triangles amounts of GFP mRNA synthesized and deter mined by Northern blotting closed squares total GFP synthesized Nucleic Acids Research 2006 Vol 34 No 19 e135 were obtained with a second addition of amino acids after 10 h at 20 C incubation Figure 5b and c Kinetic analyses revealed that at 20 C the initial rate of GFP synthesis was slower but the total amount even exceeded that at 30 C after 15 h incubation reaching values twice as large as the corresponding 30 C values Figure 5c A possible reason is that metabolization of amino acids runs faster at 30 C leading to a shortage of amino acids after 10 15 h in contrast to the situation at 20 C a Batch system 10 ul E Total GFP a 0 5 E 64 58 E Active GFP 79 a i 98 E 7 LL 30 C 30 C 20 C 20 C aa aa aa aa b Semi continuous system 1 ml E Total GFP E 4 E Active GFP 90 36 95 a 7 54 LL 30 C 30 C 20 C 20 C aa aa aa aa c Semi continuous system 1 ml E dD Oo TE O g O Time hours Figure 5 GFP synthesis at 30 and 20 C with and without a second amino acid addition a Batch system 10 ul Blue bars total GFP green bars active GFP values above bars b Synthesis of GFP and active fraction after an incubation of 20 h c Kinetics of GFP synthesis at 30 C red triangles and 20 C blue squares thick line Closed symbols amino
11. a 23S rRNA 16S rRNA IN gs 9 1 3 3 gt 5 645 4 e7 SpacertRNA 5S rRNA goed Distal tRNA 5 14 fpd Lif Saal Kan wa 3 Ava Ava T7 promoter pT7 3 GFP stable pBR322 ori Amp b b GFP A unstable O stable o oO LL 0 10 20 Time hours Figure 3 Various mRNA constructs in the coupled transcription translation system a Upper panel stability elements of rRNA genes Schematic representation of an rrn operon and major processing steps of the 16S and 23S rRNA The drawing is not to scale Primary processing cleavages by RNase III lanes 3 7 and secondary processing to produce the mature termini of 16S rRNA lane 1 5 end lane 2 3 end and 23S rRNA lane 8 5 end lane 9 3 end Solid lines indicate mature RNAs modified 36 a Lower panel map of a plasmid used for mRNA stability test derivative of a vector that contained a fragment of the rrnB operon including intergenic spacers GFP was incorporated into the 23S rRNA sequence at Aval cleavage sites into a position between nt 250 and 2773 E coli numbering starting from 5 end of 23S rRNA Restriction sites and 7rnB operon elements are indicated b Total GFP synthesis from different plasmid DNA constructs semi continuous system reaction volume ml Squares GFP mRNA flanked by the 23S rRNA stability elements stable triangles same as squares but with destroyed stability elements unstabl
12. acid additions arrows after 7 and 10 h at 30 and 20 C respectively Open symbols no amino acid addition e135 Nucleic Acids Research 2006 Vol 34 No 19 CONCLUSIONS We show here that the efficiency of in vitro protein synthesis in a coupled transcription translation system can be signifi cantly increased to several mg per ml by incubating the reac tion mix in a semi continuous system at 20 C for 15 h and adding an amino acid mix after 10 h of the incubation The protein synthesized 1s virtually 100 active and therefore the low cost bacterial system can be used under these conditions i for structural analysis such as crystallography or NMR after incorporation of for example C and N isotopes dur ing the incubation and 11 for folding and functional studies The optimization of the coupled system as it stands after these analyses can still be pushed forward Let us compare the efficiency of the RTS Roche used here with that of an E coli cell The reaction mix before synthesis contains 40 mg ml total protein and after 10 h the amount of GFP synthe sized approaches 10 of the total protein 4 mg ml Figure 1c A continuation of this synthesis rate would lead to a doubling of the protein content in the reaction mixture total proteins plus synthesized GFP after 100 h E coli has a doubling time of 20 min under rich medium conditions where it doubles the total protein synthesized and distributes it over the two da
13. al protein synthesis and active GFP The results are summarized in Figure 2b from which it is clear that at low temperature in a batch system the total yield is a E Total GFP PI Active GFP D A LL O P266L P266L 8105s i8140 WI b 0 8 W Total GFP E Active GFP GFP mg ml Oo oO D D N 37 C 30 C 25 C 20 C Figure 2 Total and active GFP synthesized at various conditions Blue bars total GFP synthesis green bars active GFP a GFP synthesized after 20 h at 30 C of incubation in the presence of mutant T7 transcriptases and our reaction mix preparation semi continuous system 1 ml reaction volume see Materials and Methods the unusually low active fraction of almost 20 might be due to our preparation procedure of the S30 lysate b GFP synthesis after 12 h in the RTS 100 batch system 10 ul reaction volume wild type T7 polymerase at various incubation temperatures e135 Nucleic Acids Research 2006 Vol 34 No 19 two to three times reduced but that the active fraction approaches 100 at 20 C In order to test whether the bene ficial effects of lowering the incubation temperature from 30 to 20 C is not restricted to the protein GFP and might be valid for other proteins as well we performed a control experiment with luciferase The results Table 2 show that the specific activity of luciferase activity per mass unit is increased 2 fold similar to the effects seen with GFP in Figures
14. alysis of the GFP production from the transcripts produced by either the double mutants or by WT T7 RNAPs revealed that the yield of GFP dramatically decreased using the double mutant variants and is almost Nucleic Acids Research 2006 Vol 34 No 19 e135 undetectable in the case of the P266L I810S mutant On the contrary the native PAGE analysis of active GFP produced from these transcripts allows an easy detection of the GFP band in all cases including the P266L I810S double mutant summarized in Figure 2a In spite of the low yield we can conclude that a reduction in the rate of transcription signifi cantly improves the active fraction of the synthesized protein probably by re establishing the coupling of transcription and translation Another way of slowing down the T7 RNAP is by lowering the incubation temperature A beneficial effect can be expected if the reduced temperature slows down the transla tional rate to a lesser extent than the transcriptional rate thus also improving the coupling of transcription and translation In fact in a similar case lowering the growth temperature from 37 to 25 C improved dramatically the T7 transcribed rRNA fraction assembled into active ribosomes from 15 to 60 respectively which indicated that the rate of T7 RNAP goes down faster than the assembly rate 25 GFP was synthesized at various temperatures 37 30 25 and 20 C 12 h incubation batch system to examine the effect on both tot
15. chanisms of edeine and pactamycin the universally conserved residues G693 and C795 regulate P site tRNA binding Mol Cell 13 113 124 Bremer H and Dennis P P 1996 Modulation of chemical composition and other parameters of the cell by growth rate In Neidhardt F C Curtiss R III Ingraham J L Lin E C C Low K B Magasanik B Reznikow W S Riley M Schaechter M and Umbarger H E eds Escherichia coli and Salmonella 2nd edn ASM Press Washington DC Vol 2 pp 1553 1569 Gowrishankar J and Harinarayanan R 2004 Why is transcription coupled to translation in bacteria Mol Microbiol 54 598 603 Iost I and Dreyfus M 1995 The stability of Escherichia coli lacZ mRNA depends upon the simultaneity of its synthesis and translation EMBO J 14 3252 3261 Chamberlin M and Ring J 1973 Characterization of T7 specific ribonucleic acid polymerase 1 General properties of the enzymatic reaction and the template specificity of the enzyme J Biol Chem 248 2235 2244 Lewicki B T U Margus T Remme J and Nierhaus K H 1993 Coupling of rRNA transcription and ribosomal assembly in vivo formation of active ribosomal subunits in Escherichia coli requires transcription of rRNA genes by host RNA polymerase which cannot be replaced by bacteriophage T7 RNA polymerase J Mol Biol 231 581 593 Bonner G Lafer E M and Sousa R 1994 Characterization of a set of T7 RNA polymerase active site mutants J Biol
16. e closed diamonds standard expression vector for GFP synthesis GFP For further explanations see text PAGE 7 OF 9 RNAs 32 As a control we used the same mRNA except that the mutation in the 5 flanking region disrupts the comple mentarity and thus pseudo circularized mRNA fails to be pro duced unstable GFP mRNA The latter in contrast to the former has been shown to be resistant against in vitro RNase III cleavage which is specific for secondary structures thus revealing that no secondary structure has been formed 33 With both constructs however we observed levels of GFP production that were two times less than from our usual con struct for GFP expression Figure 3b Owing to the low yield of GFP synthesis we did not pursue further the question whether indeed the stable construct provided a more stable mRNA To test directly whether the mRNA stability in the coupled transcription translation system is an issue we determined the amount of GFP mRNA present during 25 h synthesis at 30 C via Northern blot hybridization and simultaneously the amount of synthesized GFP The kinetics are shown in Figure 4 The rate of mRNA synthesis peaks after 1 h demon strating the speed of T7 RNAP and then decreases whereas the rate of GFP synthesis is maximal until the seventh hour of incubation When the GFP synthesis ceases after the seventh hour the amount of GFP mRNA recovers again These observations clearly indicate
17. e was washed twice with 2x SSC 0 3 M NaCl and 30 mM Na citrate and 0 1 SDS at 65 C for 30 min Radioactivity was detected in the PhosphorImager system with an exposition time of 3 5 h Data were processed as described above in vitro transcribed GFP mRNA served as a reference Second addition of a mixture of 20 amino acids The amino acid mixture was prepared as follows lyophilized 19 amino acids supplied with the Roche RTS 500 kit were reconstituted by the kit reconstitution buffer to a volume of 1 5 ml and mixed with the reconstituted methionine solution of 0 9 ml After 7 h of incubation 2 4 ml was removed from the feeding solution chamber and substituted with this freshly prepared mixture of 20 amino acids e135 Nucleic Acids Research 2006 Vol 34 No 19 In case of the RTS 100 we used a reaction volume of 50 ul and added 6 ul amino acid mixture in reconstitution buffer after 8 and 10 h 30 and 20 C incubation temperature respectively RESULTS AND DISCUSSION GFP as reporter protein and quality criteria for judgment of expression levels We used the GFP as a reporter GFP is a fluorescent molecule of 238 amino acids and discovered in the jellyfish Aequorea victoria The protein has a unique structure consisting of 11 strands B barrel B Can forming a cylinder with a central and almost coaxial o helix that forms autocatalytically a fluorophore from the tri peptide sequence Ser65 Tyr66 Gly67 11 12 Once folded the flu
18. ee sys tems Depending on the reactors in which the reaction is per formed several types of cell free systems can be distin guished batch system continuous flow 1 semi continuous system 2 and hollow fiber membrane reactors 3 In the batch system the reaction mix contains all the necessary com ponents for transcription and translation as well as the synthe sized products In the course of our study with the bacterial Escherichia coli system we used both a batch system and semi continuous reactors RTS 500 E coli HY Kit Roche ProteoMaster The latter contains two chambers for the reac tion and for the feeding mix respectively separated by a semi permeable membrane The reaction chamber houses the machinery for mRNA and protein production together with the DNA template The chamber with the feeding mix is 10 vol larger than that of the reaction and supplies nucleotide triphosphates NTPs and amino acids and removes by products The final product the protein accumu lates in the reaction chamber The essential component of the system is the cell free extract containing most of the cellular cytoplasmic To whom correspondence should be addressed Tel 49 30 8413 1700 Fax 49 30 8413 1594 Email nierhaus molgen mpg de The authors wish it to be known that in their opinion the first two authors should be regarded as joint First Authors 2006 The Author s This is an Open Access article distributed under the terms o
19. eins mRNA 29 with 2 3 min on aver age for most of the mRNAs in E coli 30 To test whether an increased mRNA stability improves the protein yield we exploited the enormous stability of the ribo somal precursor RNA due to the long complementary sequences flanking the mature rRNA 31 upper panel in Figure 3a We constructed a GFP mRNA that is flanked by the highly conserved sequences enclosing the 23S rRNA and forms a strong base paired stem resulting in a pseudo circularization of the mRNA similar to that of the precursor Table 2 Luciferase expression in a coupled transcription translation system at 20 and 30 C gt S Met Luciferase Specific activity Relative incorporation activity lumino units activity pixels lumino units S Met pixels x 1000 20 C 299 899 10 47175 2 157 3 100 30 C 1 103 493 3 94 515 2 85 7 54 S Met incorporation was determined by a PhosphorImager screen as the radioactivity in the luciferase band of a 15 PAGE and the luciferase activity as described by the manufacturer Promega For details see Materials and Methods GFP expression was determined as a control and showed about the same strong expression as seen in Figure 2b PAGE 6 OF 9 rRNA stable GFP mRNA lower panel in Figure 3a We expected a prolonged mRNA half life since the endo RNase E prefers substrates with unpaired 5 ends and the exo PNPase and RNase II are specific for single stranded
20. f the Creative Commons Attribution Non Commercial License http creativecommons org licenses by nc 2 0 uk which permits unrestricted non commercial use distribution and reproduction in any medium provided the original work is properly cited e135 Nucleic Acids Research 2006 Vol 34 No 19 compounds necessary for protein synthesis such as ribosomes translational factors tRNA synthetases and tRNAs Further more usually the RNA polymerase RNAP from the T7 bac teriophage is used The gene of interest flanked by a T7 RNAP promoter and terminator is introduced into the system on a plasmid or as linearized double stranded DNA Besides the above mentioned advantages of the in vitro system there are certain difficulties to express genes in the prokaryotic based systems A major drawback is as shown here the unsatisfyingly low activity of the synthesized protein seen for the well soluble green fluorescence protein GFP which ranges between 30 and 70 and impairs therefore subsequent structural and functional studies In this work we solve this major in vitro expression problem and report conditions under which high yields of synthesized proteins with up to 100 activity are achieved MATERIALS AND METHODS Mutants of T7 RNAP Plasmids encoding the T7 RNAP double mutants P266L I810S and P266L I81ON were obtained from M Dreyfus and collaborators Recently these authors have described a genetic screen that led to the isolation
21. hronizing the reactions of transcription and translation A tight coupling of the transcription and translation processes exists in bacteria The E coli RNAP proceeds with a speed of 60 nt per second and a ribosomes initiating translation on the nascent chain of mRNA proceeds with a speed of 20 amino acids per second 21 corresponding to 20 codons or equally to 60 nt per second It follows that the first ribosome pursues directly the transcriptase causing the tight coupling of transcription and translation and leaving no room for a significant gap between the transcriptase and the following ribosome Therefore the nascent mRNA chain cannot form secondary structures and thus complicate or even block translation elongation or transcription via R loop formation 22 Moreover the presence of ribosomes also protects the mRNA against endonucleolytic degrada tion 23 One of the general problems of in vitro transcription translation in bacterial cell free systems is the uncoupling of the naturally coupled processes of transcription and trans lation This results from the use of bacteriophage T7 RNAP at 37 C instead of E coli RNAP 24 The T7 RNAP is five to eight times faster than E coli RNAP thus breaking the tight coupling between transcription and _translation ribosome assembly with two unfavorable consequences 1 Strong sec ondary RNA structures can form that hinder the path of the translating ribosome over the mRNA probably impa
22. iring the co translational folding and thus the yield of active pro teins 11 R loops can be formed where nascent RNAs emer ging from the RNAP exit channel can form heteroduplices with the upstream region of the template DNA strand These heteroduplices can interfere not only with translation assembly but also with the next round of transcription or even with replication for a review see Ref 22 The result is that only a tiny fraction within a few percent of the mRNA transcripts are used for translation 23 Similarly only a minor fraction of T7 RNAP transcripts of rRNA is used for the assembly of 50S subunits 25 The use of E coli RNAP together with E coli promoters is not an easy way to overcome this drawback since most of the E coli tran scriptases are removed with the membranes and the addition of the multi subunit E coli RNAP is a demanding task in terms of isolation and maintaining activity Therefore using the monomeric T7 polymerase with its high processivity is the decision of choice A number of slow T7 RNAP mutants have been reported 26 27 and from these mutants we utilized a double mutant P266L I810S that has a reduced transcription rate and yet still retains high processivity The latter mutation slows the transcriptase and the former improves the processivity 4 27 Another double mutant P266L I8ION used is 2 5 times slower than the WT T7 RNAP J Guillerez and M Dreyfus unpublished data The SDS PAGE an
23. l the total amount of the protein synthesized in vitro can be easily assessed by a densitometry analysis of the GFP band in comparison with defined amounts of purified reference GFP added to the same gel Furthermore one stable S30 band was exploited to normalize the input variations of the S30 reaction mixture per lane Figure la With GFP we can determine not only the total yield but also the active fraction of the synthesized protein by measuring its fluorescence After the GFP synthesis is fin ished its fluorophore has to be folded properly which is a cri terion to detect active GFP by fluorescence using ultraviolet UV light excitation GFP can emit green light even after electrophoresis under non denaturing conditions i e in the absence of SDS Figure 1b which allows an estimation of the amount of active molecules by comparing with a com mercially available recombinant GFP reference that was in vivo expressed and assumed to be 100 active Materials and Methods The assumption that the commercially available GFP is 100 active requires a more detailed consideration GFP synthesized in vivo shows strikingly different active fractions depending on the organism namely whether GFP has been synthesized in E coli or yeast 18 The low active fraction in E coli has been explained by the constraints on de novo folding which is consistent with the assumption that the fold ing pathways of bacteria are largely post translational The
24. l Acad Sci USA 102 5958 5963 5 He B Rong M Lyakhov D Gartenstein H Diaz G Castagna R McAllister W T and Durbin R K 1997 Rapid mutagenesis and purification of phage RNA polymerases Protein Express Purif 9 142 151 6 Kim D M and Swartz J R 2000 Prolonging cell free protein synthesis by selective reagent additions Biotechnol Prog 16 385 390 7 Crameri A Whitehorn E A Tate E and Stemmer W P 1996 Improved green fluorescent protein by molecular evolution using DNA shuffling Nat Biotechnol 14 315 319 oO O 10 11 12 gt 14 1S 16 17 18 19 20 2 n 22 23 24 23 26 21 28 PAGE 8 OF 9 Laemmli U K and Favre M 1973 Maturation of the head of bacteriophage T4 I DNA packaging events J Mol Biol 80 575 599 Maniatis R B Fritsch E F and Sambrook J 1982 Molecular Cloning A Laboratory Manual Cold Spring Harbour Laboratory Press Cold Spring Harbour NY Sambrook J Fritsch E F and Maniatis T 1989 Molecular Cloning A Laboratory Manual 2nd edn Cold Spring Harbour Laboratory Press Cold Spring Harbour NY Yang F Moss L G and Phillips G N Jr 1996 The molecular structure of green fluorescent protein Nat Biotechnol 14 1246 1251 Ormo M Cubitt A B Kallio K Gross L A Tsien R Y and Remington S J 1996 Crystal structure of the Aequorea victoria green fluorescent protein Science 273
25. n of GFP Native PAGE loading and running buffers were pre pared without SDS Conditions for electrophoresis were 75 V for 10 min 150 V for 2 3 h The fluorescence was measured directly in the gel with a Fluorlmager 595 dual excitation laser induced fluorescence scanner Amersham Biosciences The images were analyzed using the ImageQuant software The reference GFP commercially available and synthesized in vivo Was arbitrarily assigned as 100 and the relative Nucleic Acids Research 2006 Vol 34 No 19 e135 activity of the newly translated GFP was calculated On average the activity of the GFP from the coupled in vitro sys tem was 50 20 of that of the reference GFP Luciferase expression and quantification The luciferase T7 Control DNA and the luciferase substrate Steady Glo Luciferase Assay System were purchased from Promega The expression of luciferase and GFPcyc3 as a control was performed for 6 h at 20 or 30 C in the RTS 100 reaction according to Roche protocol for S Met incorporation in a volume of 25 ul After incubation samples of 2 and 1 5 ul from the same tube were taken for measure ments of active and total luciferase expression respectively The former sample active luciferase was mixed with H20oM6K150 buffer 20 mM HEPES 6 mM magnesium acet ate 150 mM potassium acetate pH 7 6 at 0 C and then added to a solution containing the luciferase substrate After 45 min in the dark at room temperatu
26. ncrease of GroEL ES in vivo the solubility increased 2 to 3 fold 17 However a direct involvement of chaperones in the folding of GFP has yet to been shown 111 Differences in modes of folding and kinds of chaperones between bacteria and eukaryotes Here the observation is pertinent that a significantly higher yield of soluble GFP was observed in Saccharomyces cerevisiae 90 of the totally synthesized GFP than in E coli 60 18 similar to the amount seen in our experiments The authors put forward the explanation that this difference reflects the co translational folding process in eukar yotes in contrast to the prevailing post translational folding mode in bacteria see below Another non mutually exclusive explanation is the fact that the different chaperone systems of the eukaryotic cell are superior in supporting the folding of the eukaryotic GFP PAGE 4 OF 9 protein as compared with the bacterial chaperones In agreement Sacchetti et al 19 suggested that the different expression of GFP variants in E coli and mammalian cells was caused by different chaperone sets in these organisms iv A different relationship between transcription and translation in bacteria and eukaryotes In this article we present evidence that the loss of the bacterial coupling of transcription and translation also impairs the output of active and stable GFP Since the GFP band hardly overlaps with any of the S30 extract bands in an SDS ge
27. of the P266L I810S and the I8SION T7 RNAPs The P266L mutation was intro duced into the I810N single mutant yielding the P266L I81ON double mutant as described in Ref 4 for the wild type enzyme Finally plasmids encoding His tagged versions of the P266L I810S and P266L I810N polymerases were obtained by inserting the AlwNI AlwNI fragment carrying most of the T7 RNAP coding sequence into the same sites of pBH161 5 The mutant polymerases were affinity purified as in He et al 5 Rapid translation system RTS 100 E coli High Yield Kit Roche The preparation followed the protocol of the manufacturer except that a reaction volume of 10 ul was used instead of the suggested 50 ul Standard incubation temperature was 30 C Samples were introduced into ProteoMaster instrument Roche and incubated according to the assay requirements 1 5 ul was applied to either the SDS gel or to the native gel see below RTS 500 E coli HY Kit Roche The preparation and incubation followed the RTS 500 Kit protocol The reaction solution was loaded into the ml reac tion compartment of the supplied reaction device and the feeding solution into the feeding compartment with care avoiding air bubbles The filled reaction device was intro duced into ProteoMaster instrument and incubated at 30 C if not otherwise indicated Incubation time was up to 12 h for RTS 100 reactions and up to 40 h for RTS 500 reactions For the assays with mutant T7
28. orescent protein is very stable and for example resists heat up to 65 C and tolerates a pH up to 11 for a review see 13 The folding and the oxidation process forming the fluoro phore is slow maturation in E coli requires an overnight incubation at 4 C Folding of GFP denatured by acidic pH or 6 M guanidine hydrochloride occurs within 1 5 min 14 15 suggesting that most of the maturation time is used for the fluorophore formation A mutant used here also carries three mutations namely at positions 100 154 and 164 The mutations improve the folding efficiency reduce the maturation times to 3 4 h and improve the yield of stable active recombinant GFP not only in E coli but also in eukaryotic Chinese hamster ovary CHO cells 7 13 The latter observation indicates that the active fraction of GFP can be improved by accelerating the intrinsically slow folding of this protein via mutations The active fraction of GFP can also be influenced by other factors They are as follows i Temperature wild type GFP showed a sharply decrea sed active fraction when synthesized at 37 C a tem perature much higher than that of the cold pacific water habitat of A victoria 16 1 Chaperone concentrations This was demonstrated pre viously with proteins essential for the E coli cell and dependent on GroEL ES for successful folding 17 When these proteins were overexpressed in E coli up to 70 were insoluble whereas upon an 5 fold i
29. re the lumino units were measured with the Centro LB 960 luminometer Berthold technologies Germany The second sample 1 5 ul was applied to a 15 polyacrylamide protein SDS gel Electrophoresis was performed for 4 h at 150 V and the gel stained with Coomassie R 250 to monitor the protein separation and then dried on 3 mm Whatman paper under vacuum at 60 C for 3 h The dried gel was exposed in a Phos phorImager screen Fujifilm BAS Cassette 2325 at room temperature for 2 h scanned in the PhosphorImager STORM 820 Molecular Dynamics Amersham Biosciences and the pixels of luciferase expressions incorporation of S Met were quantified using ImageQuant software The results were normalized to 2 ul of reaction mixture Northern blot hybridization 10 Samples of 10 ul from RTS 100 or RTS 500 were withdrawn at various time intervals as indicated in Figure 4 and extracted with an equal volume of phenol From the aqueous phase 5 ul of each sample was applied to a 1 agarose gel containing 2 formaldehyde The running conditions for electrophoresis were as follows 75 V for 1 h mRNA was blotted on the Hybond N plus membrane Amersham and the membrane was pre hybridized in the presence of salmon sperm DNA Hybridization with the y P labeled primer 5 CATCTTCTTTAAAATCAATAC 3 complementary to a middle sequence of GFP mRNA was performed in the pre sence of 50 formamide and 5 dextran sulfate Sigma at 42 C overnight The membran
30. sed GFP cycle 3 The GFP cycle 3 GFPcyc3 has three point mutations that allow a fast maturation within 3 4 h whereas wild type GFP requires maturation overnight at 4 C 7 GFP was expressed from plasmid DNA for in vitro expression pIVEX2 2 with T7 promoter and contained a Strep tag at the N terminus The polyacrylamide gels were prepared with out SDS addition the loading and running buffers contained SDS which is enough for denaturing of the proteins for buf fer components and further details see Bio rad Application Guide catalog no 161 0993 From each 10 ul reaction RTS 100 1 5 ul was mixed with 3 5 ul water and 5 ul sam ple SDS buffer kept at 95 C for 5 min cooled down on ice and applied to the 15 PAGE 8 The running conditions for electrophoresis were 75 V for 10 min 150 V for 3 4 h which enabled good separation of the GFP protein band from neigh boring bands The SDS gels were stained with Coomassie R 250 Serva and scanned by the Personal Densitometer SI Molecular Dynamic Sunnyvale USA The data were pro cessed using ImageQuant image analysis software version 5 2 Molecular Dynamics Amersham Biosciences GFP bands were quantified and the total amount of GFP in each lane was determined by comparison with reference bands of known amounts of GFP catalog no 11814524001 PAGE 3 OF 9 a Time hours 005 12 5 10 20 b Time hours 0 05 1 2 5 10 20 s com eis GFP e a
31. t or lowering the incubation temperature to 20 C A drop of protein synthesis observed after 7 h incubation time was not due to a shortage of nucleotide triphosphates but rather to a shortage of amino acids Accordingly a second addition of amino acids after 10 h during an incuba tion at 20 C led to synthesis of up to 4 mg ml of GFP with virtually 100 activity INTRODUCTION Coupled in vitro transcription translation systems offer a great potential both as an analytical tool and a method for efficient production of recombinant proteins in amounts of several mg per ml Cell free protein synthesis provides advantages over conventional in vivo protein expression method First of all in vitro systems can direct most of the metabolic resources of the cell extract towards the production of one protein Although in vivo expression of proteins occurs in concert with numerous physiological activities cell free translation takes place without the need to support processes required for cell viability Second the lack of cell wall barrier is another advantage for in an open system there is the oppor tunity to create an optimal environment for expression of pro teins by directly manipulating the reaction conditions For example in vitro systems allow for incorporation of isotope labeled amino acids ON 5C for NMR studies as well as incorporation of unnatural amino acids for protein design Third cytotoxic proteins can be produced in cell fr
32. ughter cells It follows that the system used here is still 300 fold less efficient than protein synthesis in vivo in agreement with a recent report showing that the bulk protein synthesis rate in an optimized E coli based cell free system is 200 fold slower than the in vivo rate 35 ACKNOWLEDGEMENTS We thank Dr Daniel N Wilson for help and discussions This work was supported by the BMBF Project No 031 2552 Neue Anwendungspotentiale der in vitro Proteinsynthese Teilprojekt AB Gruppe Nierhaus Proteomaster and RTS are trademarks of Roche Funding to pay the Open Access publication charges for this article was provided by MPI f r Molekulare Genetik Conflict of interest statement None declared REFERENCES 1 Spirin A S Baranov V I Ryabova L A Ovodov S Y and Alakhov Y B 1988 A continuous cell free translation system capable of producing polypeptides in high yield Science 242 1162 1164 2 Kim D M and Choi C Y 1996 A semi continuous prokaryotic coupled transcription translation system using a dialysis membrane Biotechnol Progr 12 645 649 3 Jewett M C Voloshin A and Swartz J R 2002 Prokaryotic systems for in vitro expression In Weiner M P and Lu Q eds Gene Cloning and Expression Technologies BioTechniques Press Westborough MA pp 391 411 4 Guillerez J Lopez P J Proux F Launay H and Dreyfus M 2005 A mutation in T7 RNA polymerase that facilitates promoter clearance Proc Nat
Download Pdf Manuals
Related Search