Home

Sony HDC-900 User's Manual

1. Command Monitor Waveform Vector Video Monitor Scope Character sl exeo 1 CNU 700 1 12 CNU 700 2 1 21 HDCU 950 lt E 13 F 1 rag 1 MSU 700A 1 e 14 E 133 18 Down Con 1 i Outputs I i 1 1 19 1 l 1 Ri VCS 700 4 BP 3 i i z VCS 700 3 it bag m Outputs rag i E i i 1 1 1 1 1 Note With the addition of an external camera selector switching panel a 1 upto 96 cameras with 8 CNU 700s with BKP 7930 installed 7005 ___________ be controlled from a single MSU 700A 4 oa 1 1 1 RCP 700 Series HDC 900 950 930 Series Product Information Manual Chapter 4 Control System 54 Figure 4 4 Multi NISU 0peration Example 1 HDC 900 HDCU 900 ENGINEERING ROOM MSU 700A VCS 700 Jeps Down Con oO Outputs
2. Monitor HDC 900 Down Con Waveform Vector 1 I Wat HDCU 900 Outputs Monitor Scope s PEE l O _ i VCS 700 2 diaz 5 eu 5 B W monitor 4 l for character display d Gem gt gt gt is BKP 7930 1 or E FEX CNU 700 PAL ES 1 1 1 HDC 950 i HDCU 950 7 3 i Down Con Outputs 1 i 5 1 1 8 MSU 700A 1 L 4 9 li ENDE FE 4 10 J 1 1 i 11 4 i i 12 H I m om 1 I L L T L e eee Command Video Character RCP 700 Series HDC 900 950 930 Series Product Information Manual Chapter 4 Control System 53 Figure 4 3 CNU 700 Maximum System Configurations expandable to 96 cameras HDC 900 Down Con 1 HDCU 900 Outputs VCS 700 1 VCS 700 2 Bis ENE ca T 1 1 1 1 1 B W monitor 1 1 1 1 Down Con Outputs for character display
3. ANALOG COMPOSITE VIDEO SIGNAL 4 VBS OUT oy PROMPTER e CANERA EN qui T V NS om OB NG 8 5 v l lo Gee HDCU 950 SD SYNC REFERENCE SIGNAL 49YNC OUT ANALOG RETURN VIDEO SIGNAL 1103 ANALOG COMPONENT VIDEO SIGNAL zm GUT ANALOG COMPOSITE VIDEO SIGNAL Sy C PROMPTER 8 A T ei amr e 9 2 ex O w an e e Exe w Q O 6 Gy oral ese ON IO Oe Oe re HDCU 950 Co WF 2 Next HDCU 950 Ea SD ANALOG VIDEO SIGNAL SD REFERENCE SIGNAL VCS VCS 700 Ix 1 919 2000000 OOO e WF1 PIXA REMOTE WFA CNU 700 Terminated at 75 HDC 900 950 930 Series Product Information Manual Chapter 2 Total System 38 2 8 Rack Mounting of System Equipment 19 inch size equipment 2 Secure the inner members to both sides of the unit The HDCU 900 Camera Control Unit CNU 700 and with the screws B4 x 8 Use the screws removed CNU 500 Camera Command Network Units and VCS from or supplied with the unit 700 Video Selector can be mounted in a 19 inch standard EIA rack These
4. No Signal lO Specifications INCOM HKC T950 10 TRK PGM X OUT 20 dBu unbal SP FEMALE SP MALE anced 11 NC No connection 12 G TALLY OUT ON 5 V Open 5 Collector d 3 3 OFF 0 V Open O Collector 13 INC No connection External view External view 14 RX DATA 0 TRUNK DATA RS232 C No Signal lO Specifications 15 RX DATA 1 TRUNK DATA 1 INCOM MIC Y IN 20 dBu CAR RS232 C BON MIC 16 INE No connection 2 INCOM MIC X IN 60 dBu 17 No connection DYNAMIC MIC 18 TX DATA 0 OUT TRUNK DATA OUT 3 GND INCOM RS232 C PGM 19 TX DATA 1 OUT TRUNK DATA OUT 4 INCOM RECEIVE OUT 0 dBu RS232 C 5 PGM OUT 0 dBu 20 GND 0 dBu 0 775 Vrms 0 dBu 0 775 Vrms HKC T950 FRONT 3P FEMALE HDC 950 930 20P FEMALE External view No Signal 1 0 Specifications External view 1 CHU MIC G _ DE m 50 dBu No Signal 1 0 Specifications 2 CHU MIC X IN 30 dBu 20 dBu 1 S DATA N TTL level selectable OUT 3 CHUMIC Y IN High impedance 2 NC No connection Balanced 3 C No connection 0 dBu 0 775 Vrms 4 SCK OUT TTL level MANU 0 V or OPEN MIC HKC T950 5 C No connection FEMALE
5. MSU 700A Supervisory MSU t E HDC 900 950 930 Series Product Information Manual Chapter 4 Control System 56 The RCP 750 751 Remote Control Panel is newly designed for remote control of the Sony BVP HDC Series Color Video Camera via the CCU HDCU Series Camera Control Unit The panel is connected to the CCU HDCU Series Camera Control Unit or the CNU series Camera Command Network Unit which is connected to the CCU HDCU Series by a special cable of up to 200 m 656 feet in length The RCP 750 and RCP 751 are completely identical in their functions except with respect to the iris and master black adjustments for which the RCP 750 uses a joystick type control while the RCP 751 uses rotary knobs The RCP 750 751 has the following features Optimal control arrangement for basic camera operation This remote control panel is provided with essential control functions for basic operation of a BVP HDC Series camera The buttons knobs and other controls have been arranged according to their functions and with consideration to their frequency of use Indicators and buttons light or flash to indicate the status of the system operation Also guard frames are provided to protect against accidental use of those buttons vital to camera operatio
6. HDC 900 WAVEFORM MONITOR MODE FOR RCP RGB Component ANALOG COMPONENT VIDEO SIGNAL VES OUT ANALOG COMPOSITE VIDEO SIGNAL eo es e e e ef mS gt os 9 _ e e P e Jo e Jo e HDCU 900 WF OUT For MSU SYNC OUT SD SYNC REFERENCE SIGNAL PIX OUT For MSU RET INPUT 1 to 4 IRE UTE ANALOG RETURN VIDEO SIGNAL gt a PICTURE MONITOR OUTPUT FOR RCP WE OUT For RCE WAVEFORM MONITOR OUTPUT FOR RCP HDC 900 WF MODE ForRCP WAVEFORM MONITOR MODE FOR RCP RGB Component ANALOG COMPONENT VIDEO SIGNAL VESQUE ANALOG COMPOSITE VIDEO SIGNAL eo V XS e e e amp 9 Or eor BOX X22222 Q9 6 p D D D ns 577 p D e OKC Old OS T mo SEE e le o e Jo e M 0 HDCU 900 SD SYNC OUT SD SYNC REFERENCE SIGNAL ms PIX OUT For MSU SD REFERENCE SIGNAL NEGET SD ANALOG VIDEO SIGNAL VCS Next HDCU 900 VCS 700 ek l e 5 REMOTE PIX A m WEA gt CNU 700 HDC 900 950 930 Series Product Information Manual Terminated at 75 Chapter 2 Total System 29 7 o HDC 900 HDC 950 Combination of boards HDCU 900 HKCU 901 HKCU
7. No Signal yo Specifications D 25P Mal Su oP Mae 9 INC No connection 1 13 10 S DATA IN OUT TTL level 22 27 11 R TALLY IN ON 5 V 14 25 OFF 0 V 12 INC No connection External view 13 NC No connection Pin mE 14 Y VIDEO GND GND for Y VIDEO No Signal 1 0 Specifications 15 S CK IN TTL level YVIDEO IN 1 0 V p p Zi 75 16 ING No connection Ohms 17 CHASSIS GND for CHASSIS 2 PRvDEO GND for PR VIDEO GND GND 18 G TALLY IN ON 5 V PR VIDEO X IN 0 7 V p p Zi 75 OFF GND Ohms 19 UNREG GND for UNREG 4 PB VIDEO GND for PB VIDEO 20 UNREG GND for UNREG GND 21 COLOR BW OUT BW GND 5 PB VIDEO X IN 0 7 V p p Zi 75 COLOR OPEN Ohms 22 HEXPAND No connection 6 PEAKING OUT ON 5 V 23 C No connection EE OFF GND 24 C No connection 7 UNREG IN 10 5 to 17 V 25 No connection 8 UNREG IN 10 5 to 17 V 8 12 HDVF C750W HD Electronic Viewfinder 8 12 1 Connector Input Output Signals pin 777 Signal Specifications VF 20P Male 12 Y VIDEO IN 10 V p p Zi 75 Ohms 13 VIDEOGND GND for VIDEO 14 PB VIDEO IN 0 7 V p p Zi 75 Ohms 15 PR VIDEO IN 0 7 V p p Zi 75 E ba Ohms 16 INC No connection Pin EN 17 R TALLY IN ON 45 V No Signal yo Specifications OFF GND 1 S DATA IN OUT TTL level 18 No connection 2 NC No connection 9 UNR
8. 9 SC OU 1080 29 97 PsF tri level SYNC SIGNAL SYNC OUT PROMPTER IN 1080 59 941 tri level SYNC SIGNAL HDC 900 SERIAL OUTPUT 1 153 PROMPTER SIGNAL HD SDI SIGNAL eo EXXX e e m 99292929S 52222270 e ef 2 Soo HDCU 900 SERIAL RET INPUT 1 to 4 Toca HD SDI RETURN VIDEO SIGNAL 8 SYNC OUT 7 1080 29 97 tri level SYNC SIGNAL SYNC OUT 1080 59 941 tri level SYNC SIGNAL HDC 900 SERIAL OUTPUT 1 to HD SDI SIGNAL eo e D ER e e ef AA ved lt 222 p T p 7 k 94400444 10 OJOO 222220 e alc als Sec te HDCU 900 SD REFERENCE SIGNAL Next HDCU 900 SD ANALOG VIDEO SIGNAL HD SDI Monitor HD SDI Monitor EN LJ O o LJ o ee dccus CNU 700 PIX 1 PIX2 VCS 700 Terminated at 75 Q Q p gt OOO OPO WF 1 WF 2 REMOTE PIX A WFA HDC 900 950 930 Series Product Information Manual Chapter 2 Total System 24 Required boards Figure 2 7 1 3 Example of connection using HDCU 900 3 System format 1080 59 941 Analog Slot to be installed siot leg on ihe taai Remarks Top most slot DPR 163 SDI 54A HDCU 900 Second slot from the top RC 86 DIF 102 HDCU 900 Third slot from the top Blank ADA 59 HKCU 902 j REFERENC
9. SD COMPONENT SDI RETURN VIDEO SIGNAL REFERENCE SIGNAL SD REFERENCE SIGNAL PROMPTER SIGNAL SD COMPONENT SDI SIGNAL z umm LA LL CHARACTER OUTPUT SERIAL RET INPUT 1104 SYNC OUT SERIAL OUTPUT 1 to 4 NX 9000 HDCU 900 Picture Monitor Waveform Monitor HDC 900 950 930 Series Product Information Manual Next HDCU 900 Picture Monitor SD ANALOG VIDEO SIGNAL SD COMPONENT SDI RETURN VIDEO SIGNAL SD REFERENCE SIGNAL SD COMPONENT SDI SIGNAL SD REFERENCE SIGNAL SD ANALOG VIDEO SIGNAL Waveform Monitor jou CNU 700 ooo ooo Terminated at 75 Chapter 2 Total System 27 Figure 2 7 1 5 Example of connection using HDCU 900 5 System format 525 29 97 PsF SDI Film Like Required boards Slot to be Installed Slots the iront e ihe taai Remarks Top most slot DPR 163 SDI 54A HDCU 900 Second slot from the top FC 83 SDI 54B HKCU 903 Third slot from the top RC 86 DIF 102 HDCU 900 D 1 zia a SD COMPONENT SDI RETURN VIDEO SIGNAL 72 ic REFERENCE IN REFERENCE SIGNAL YN T HDC 900 Sno cu SD REFERENCE SIGNAL PROMPTER IN _ PROMPTER SIGNAL SERIAL OUTPUT 1 to 4 SD COMPONENT SDI SIGNAL
10. MSU 700A MSU 750 RCP 750 751 RM B750 Secondary Menu Menu Sub Menu Control Item Menu Direct Menu Direct Menu Direct menu Direct Button Button Button Button CAM Mode Set 1 2 White Setup Mode v v OHB Matrix Correct Mode v on off 2 2 V Detail Creation Mode v v V Detail Control Mode v v Preset Matrix v v v 16 9 24 3 Crop On v v v CCU Mode CCU Set 1 2 BARS Character on off v v 2 2 Return Letter Box Mode v v Gen Lock Mode v v BARS Char Bars Characters v v Set Return Setting Return 1 2 3 4 v v Multi Format System v v Output 1 2 3 v v cnu RCP v v Assign MSU v v Assign MSU or RCP or Adjusting Buzzer Call Touchy Sten v v v v Master RM Call Buzzer Touch Click Switch Click All Off 4 4 E K LED Bright Switch Tally Other LED v T v v Master Date Time Date Year Month Day v v v v Time Hour Minute Second v v v v Engineer Security Mode on off v v v Status Ref Enable on off v v v Lens Enable on off v v OHB Enable on off v v v Crop Enable on off v v v Full Lock on off v v View Mode on off v v Paint Only on off v v Code Change v v Information v v v v MSU MSU Adjusting EL Bright Level v v LED Disp Bright Level v MSU SW Set 1 2 PIX WF Syncro on off v v PIX WF Mode on off v v PIX WF Control Mode v v Screen Saver v v TestSW Mode Saw v 3step 10step 2 2 Extended Call Mode v v Shutter Angle Mode on v v off H
11. 4 Select the control mode SUPERVISER MSU mode To control the cameras connected to the entire CNU Camera Network Unit in the same system LOCALMSU mode To control the cameras connected to only the CNU Camera Network Unit connected to the MSU 700A 750 being operated Selection can be linked between the camera select buttons on the MSU 700A 750 and the HD router MP 1007 and routing switcher DVS V1201 In this case 9 pin cables are needed to connect between the MP 1007 and DVS V1201 Move the cursor to the mode in OFF status and press Set on the MSU Assignment menu to switch between modes When the SUPERVISER mode is active you can select the setting display for each camera group in the same system from the lower rows on the character display of the CNU 700 Select the camera group to be set In LOCAL MSU mode only the group of cameras 1 through 12 standard can be selected Pressing Set on the MSU Assignment menu with the cursor on NEXT calls up the setting display for the selected camera group Example Setting display in LOCAL MSU mode MSU assignment LOCAL EB ee E T m HI cum sm ms Select the control functions for each camera Camera Select Selection by the corresponding camera select button on the MSU 700A 750 Active Para Control from the MSU 700A 750 in Panel Active Parallel mode Each
12. n auggagalagagagauadadauadagaugauauiuaaduaiuauuta CAMERA POWER switch and indicator Q MAIN POWER switch and indicator CABLE ALARM indicators Red tally lamp Lights when a red tally signal is received When the CALL button on the video camera MSU 700A 750 Master Setup Unit RCP 700 series Remote Control Panel etc is pressed this lamp will go out if previously lit and light up if previously off A supplied number plate may be mounted here Green tally lamp Lights when a green tally signal is received A supplied number plate may be mounted here MIC microphone selection switch Used to select the type of headphone microphone being used or to turn the microphone input off DYNAMIC for a dynamic microphone OFF to turn the microphone input off CARBON for a carbon microphone Note The intercom line is selected via a switch on the internal AT board HDC 900 950 930 Series Product Information Manual INTERCOM intercom volume adjustment control Adjusts the intercom input level Note The program audio mix volume is adjusted using the internal AT board CABLE ALARM indicators SHORT red This indicator lights when there is a short circuit between a power supply line and the sheath of the optical fiber cable or when the two power supply lines are shorted When this indicator lights the power supply is shut off OPEN red Lights when there is not a camera
13. 165 8 8 1 1 AUX 165 8 8 12 EXT WYO z uu uer ote bey exe RE OR a wb UE Gus 165 HDC 900 950 930 Series Product Information Manual Table of Contents 5 8 8 2 Connection 165 8 9 HDVF 20A HD Electronic Viewfinder 166 8 9 1 Connector Input Output Signals 166 8 10 HDVF 700A HD Electronic 166 8 10 1 Connector Input Output 166 8 11 HDVF C700W HD Electronic Viewfinder 167 8 11 1 Connector Input Output 167 8 12 HDVF C750W HD Electronic Viewfinder 167 8 12 1 Connector Input Output 167 8 13 VCS 700 Video Selector 168 8 13 1 Connector Input Output 168 8 13 1 1 WF Mode Female 168 8 13 1 2 Remote 8P 168 8 13 1 3 1 0 Port D SUB 37P 168 8 14 CA 905L Large Lens Adaptor 169 8 14 1 Connector Input Output
14. Button MSU 700A MSU 750 RCP 750 751 RM B750 Auto Iris v v v v IRIS RELATIVE v4 SENS control v4 COARSE control v4 WHITE knobs v v R B BLACK knob i DOE v R B Master FLARE knob v PANEL ACTIVE Full Lock v4 v4 Full lt gt Part lt gt Lock v4 DETAIL knob v VTR START STOP 4 STOP 4 REW 4 PLAY 4 FF 4 REC REVIEW 4 MONITOR 4 FUNCTION Menu Mode 4 MAINTENANCE Menu Mode 4 SCENE Menu Mode v PAINT Menu Mode 4 VF DISP 384 VF MENU 73874 CANCEL E ENTER E Note 1 Available w VTR function SW selectable when in the ENG Mode in the menu 2 Available w Black knob selected from the menu 8 Available w Menu Mode buttons by pressing the MONITOR button 4 Accessible only with switches or knobs on the control panel HDC 900 950 930 Series Product Information Manual Appendix 202 Lie n metric lt 5 registered trademarks of
15. 112 7 10 RCP 750 751 Remote Control 118 7 10 1 Operation 118 7 10 2 black control block 750 121 7 10 3 Iris master black control block 751 122 721024 Connector Panel u cu vad eed 123 7 11 RCP 700 701 Remote Control 124 7 11 1 Operation 124 7 12 RM B150 Hand held Remote Control Unit 127 7 12 1 Operation 127 712 2 COMMECIOM PANG acento eee 130 7 13 RM B750 Hand held Remote Control Unit 132 7 13 1 Operation 132 T 1322 Connector 2 4254 selbe RE RR bobbed ogo UR 134 7 14 HDVF 20A HD Electronic 135 7 14 1 Appearance 135 7 15 HDVF 700A HD Electronic 136 7 15 1 Appearance 136 7 16 HDVF C700W C750W HD Electronic 138 7 16 1 Appearance
16. In CNU 700 1 RCP 700 Series VIDEO CONTROL ROOM HDC 900 950 930 Series Product Information Manual Chapter 4 Control System 55 Figure 4 5 Multi NISU 0peration Example 2 Supervising a complete system with a supervisiory MSU STUDIO 1 HDC 900 HDCU 900 VCS 700 48 MSU 700A Down Con Outputs 8 Em una 0 80600 0101010 ss CNU 700 STUDIO 2 HDC 900 ab HDCU 900 VCS 700 oo Down Con Outputs MSU 700A Mr CNU 700 STUDIO 3 HDC 900 HDCU 900 VCS 700 Down Con Outputs MSU 700A 0101010 ci 59
17. INTERCOM connector oo0o000000000000CO0O00C0O000000000000000000000000 0 uaagagagaagaaaaaagagaagoggauuaggogagauaod F OFF The intercom headset microphone is turned off The intercom audio reception level is adjusted with the INCOM EAR LEVEL control on the front of the camera INCOM intercom control Adjusts the intercom audio reception level Q CALL button When you press this button the red tally lamp of the RCP 700 series Remote Control Panel or the MSU 700A 750 Master Setup Unit will light Use to call the operator of the RCP or MSU
18. 155 8 2 1 8 INTERCOM TALLY PGM D sub 25 pin Female 155 8 2 1 9 WF MODE 4 pin Female 155 8 2 1 10 RCP CNU 8 pin 156 8 2 1 11 INTERCOM 5 pin 156 8 2 2 Cable Wiring Diagram 156 8 2 3 Connection Connectors 156 8 3 HDCU 950 HD Camera Control Unit 157 8 3 1 Connector Input Output Signals 157 8 3 1 1 BNC 157 8 3 1 2 CAMERA connector optical electrical composite connector 158 8 3 1 3 MIC1 MCI2 XLR 3 pin 158 8 3 1 4 MIC REMOTE D sub 15 pin Female 158 8 3 1 5 INTERCOM TALLY PGM D sub 25 pin Female 159 8 3 1 6 WF MODE 4 pin Female 159 8 3 1 7 RCP CNU 8 pin 159 8 3 1 8 INTERCOM 5 159 8 3 2 Connection Connectors 159 8 4 CNU 700 Camera Command Network Unit 160 8 4 1 Connector Input Output Signals 160 8 4 1 1 BNC connector 75 Ohms 160 8 4 1 2 523
19. DCCU CNU REMOTE connector AUX REMOTE connector POWER switch Turns the power on and off of this unit AC IN AC power input connector Connect to an AC power source using an optional AC power cord The power cord can be fixed to this unit using an optional plug retainer HDC 900 950 930 Series Product Information Manual AUX REMOTE auxiliary remote connector 8 pin CCU CNU REMOTE camera control unit camera command network unit remote connector 8 pin Connect to the RCP CNU connector of the CCU or the MSU connector of the CNU Chapter 8 Connectors and Cables 164 8 8 RCP 750 751 Remote Control Panel 8 8 1 Connector Input Output Signals 8 8 1 1 AUX REMOTE CCU CNU REMOTE 8P Female OCA 9 6 26 External view No Signal Specifications 1 RCP SERIAL 2 TX 3 RX CCU CNU AUX 4 SERIAL DATA 5 TX GND GND for TX 6 POWER IN RCP POWER 10 V to 30 V 7 POWER IN GND for POWER 8 SPARE CHASSIS GND CHASSIS GND 8 8 1 2 EXT 1 0 9P Female 5 1 OOOOO 9 6 External view No Signal Specifications 1 PREVIEW S1 CONTACT X Modification is required for some units 2 PREVIEW S2 CONTACT Y Modification is required for some units 3 I O CMOS LEVEL 3 3 HI ACTIVE PORT 1 Assignable 4 SPARE I O
20. C C C 2 C 2 C C 01 02 03 04 05 06 720 5905 PANEL button Press and light up this button to permit the cameras selected with the camera select buttons to be controlled from this unit The IRIS MB ACTIVE button also lights up If you press the button when lit it goes dark and the operation panel of this unit is locked PARA parallel mode button Press and light up this button to activate Parallel mode which enables concurrent operation with another control panel If you press the button when lit it goes dark and the Parallel mode is canceled 3 EXPAND button Press to select the group to be selected with the camera select buttons Cameras 1 through 12 can be selected when this button is not lit and cameras 13 through 24 can be selected when this button is lit Note An appropriate camera command network unit CNU 700 etc is required to control multiple cameras using the camera select function MULTI indicators Show the Master Slave status of the corresponding cameras 1 through 12 when the EXPAND button is not lit or 13 through 24 when the EXPAND button is lit The indicator for the camera which is specified as the master for Master Slave mode lights in green The indicators for the slave cameras light in orange They light in red during the auto setup of the corresponding cameras If an error occurs during the aut
21. SDI HDCU 900 with A D board INI IN2 HDCU 900 with A D board HDCU 900 with A D board S BUS BNC 5 Video BNC HDC 900 950 930 Series Product Information Manual Router DVS V3232 etc Primary Station 9 lo z jel n rina 5 Inn ooooo n oo PIX SDI Monitor from MSU camera select Chapter 4 Control System 60 Interlocking the RCP Assignment and WFM PIX is also automatically changed to follow the new Assignment arrangement When the assignment of any RCP is changed from the MSU 700A 750 the picture and waveform monitoring Figure 4 9 Interlocking RCP and monitor assignment 1CAM monitor 2CAM monitor 3CAM monitor 4CAM monitor 5CAM monitor 1 1 1 1 1 5 monitor monitor 3CAM monitor 2CAM monitor 1CAM monitor PIX WFM PIX WFM PIX WFM PIX WFM H Control ICAM Control 2CAM Control 3CAM Control 4CAM Control 5CAM 1 1 1 1 1 Control 5CAM Control 4CAM Control 3CAM Control 2
22. 4 138 7 17 CA 905L Large Lens 140 7 17 1 Lens Attachment Section Front and Connectors 140 7 17 2 Camera mounting Section Inner Base and the Optional BKP 9057 Viewfinder Saddle 141 7 17 3 Rear control panel 141 Chapter 8 Connectors and 142 8 1 HDC 900 950 930 and HKC T950 HD Color Video Camera and HD CCD Black Adaptor 143 8 1 1 Connector Input Output 510 5 143 8 1 2 Wiring Diagrams for Cables 151 8 1 3 Connection Connectors Cables 152 8 2 HDCU 900 HD Camera Control Unit 153 8 2 1 Connector Input Output 510 5 153 HDC 900 950 930 Series Product Information Manual Table of Contents 4 8 2 1 1 BNC 153 8 2 1 2 CAMERA connector optical electrical connector 153 8 2 1 3 AUDIO OUTPUT CH 1 CH 2 XLR 3 pin Male 154 8 2 1 4 MIC REMOTE D sub 15 pin Female 154 8 2 1 5 WF REMOTE D sub 15 pin Female 154 8 2 1 6 TRUNK LINE D sub 9 pin Female 155 8 2 1 7 I O PORT D sub 15 pin
23. 60 4 6 Control Priority and Parallel Mode 60 4 1 S BUS 60 Chapter 5 Optical Fiber Connector Cable 63 5 1 Optical Fiber Overview 64 5 2 Cleaning of the Connector and Cable 64 Chapter 6 A Quick Lesson on Camera Settings 66 6 1 Case 1 for situations requiring minimal camera operator experience 67 6 2 2 for general operations 67 6 3 Initial Settings for the Control 68 HDC 900 950 930 Series Product Information Manual Table of Contents 2 6 3 1 Specifying the Security 68 6 3 1 1 To set a new security 68 6 3 1 2 To change the security 69 6 3 1 3 To enable to cancel the security code 69 6 3 2 Setting the Security Status 70 6 3 3 MSU Assignment 71 6 3 3 1 To restore operations of the 50 700 750 72 6 3 4 Setting the Operating Conditions of the 0 72 6 3 4 1 To display the MSU Configurationmenu
24. External tally dimmer control CAMERA connector Mounting wedge HDC 900 950 930 Series Product Information Manual Chapter 7 Location and Function of Parts and Controls 136 PEAKING control When the PEAKING switch is set to ON this control can be used to sharpen the edges in the picture Turning the control clockwise will increase the sharpness The peaking can be adjusted from 0 to 18 aB PEAKING switch When this switch is set to ON peaking can be adjusted using the PEAKING control When the switch is set to OFF the PEAKING control is disabled and the peaking value will be 0 dB Friction adjustment knob Used to adjust the amount of friction in the tilting mechanism Lift lock release knob The viewfinder height can be adjusted while pulling this knob By releasing the knob after adjusting the height to the standard low middle position or top position the viewfinder will remain fixed at that height Q POWER switch Turns the power supply from the camera to the viewfinder on and off Q 7 attention indicator This indicator lights when the camera detects certain conditions The particular conditions which cause the indicator to light up are set by the camera For information on how to set up and verify the conditions under which the indicator will light refer to the manual for the camera being used Q Green tally lamps Light up when the camera receives a g
25. 169 8 14 1 1 REMOTE 8P Male 169 8 14 1 2 LENS 12 Male 169 8 14 1 3 LENS 36 Female 169 8 14 1 4 VF 20 Male 9057 170 8 14 1 5 VF 25P Female 9057 170 Chapter 9 Glossary Terms and Definitions 172 nC ATP S a Te ee ee ee 173 PER 175 9 3 Camera 5 176 Chapter 10 Specifications 177 10 1 HDC 900 HD Color Video Camera 178 10 2 HDC 950 HD Color Video Camera 179 10 3 HDC 930 HD Color Video Camera 180 10 4 HDCU 900 HD Camera Control Unit 182 10 5 HDCU 950 HD Camera Control Unit 183 10 6 CNU 700 Camera Command Network Unit 185 10 7 CNU 500 Camera Command Network Unit 185 10 8 VCS 700 Video 185 10 9 MSU 700A Master Setup 186 10 10 MSU 750 Master Setup 186 10 11 RCP 750 7
26. HDC 900 950 930 Series Product Information Manual Appendix 194 Function comparison chart Maintenance MSU 700A MSU 750 RCP 750 751 RM B750 Secondary Menu Sub Menu Control Item i i i i Menu Menu Direct Menu Direct Menu Direct Menu Direct Button Button Button Button H saw H Adjusting 1 2 Shading R G V Saw V Para v v v v Auto B Shading v v v v BIk Shd Off v v White H saw H Para Shading GB V Saw V Para si E v d Auto W Shading v v v v White R G B v v AWB v v v v v v Black Set Black Set R G B v v Gain Bounce on v v off Black R G B Master v v ABB v v v v OHB Matrix 1 R G G B B R v v Matrix Off OHB Matrix Off ud d 2 R B G R B G v v Matrix Off OHB Matrix Off V d Multi Phase Hue T v Saturation Matrix Off OHB Matrix Off v v All Clear Phase H H Step usec v v v v H Coarse v v v v SC SC v v v v Y Sync VBS Level VBSLevel 1 Black Q Black v v Chroma SC VBS Level 2 Quad v v Q Level Y C Level Y R Y B Y v v Y C Black Y R Y B Y v v Monitor Output Skin Gate v v Mod Level v v 4 3 Marker on off v v 4 3 Mod on off v v Cam SW Camera Fan Setting Mode K Auto Setup Auto White v v v v v v v Auto Black v v v v v v v Auto Level v v v v v v Auto Hue Skin Detail 1 2 3 v v 1 v v 1 v Auto W
27. Control Priority Parallel Mode etc are centralized and distributed to the respective HDCUs of the studio system They furnished with an RS 232C port to provide interface capability to external systems such as ISR Interactive Status Reporting external PC or modem and robotics control systems They can be mounted in a 19 inch standard rack 3U height for the CNU 700 and 1U height for the CNU 500 Through the modem or PC camera data files can be transferred from a master camera in a studio to cameras at several remote sites during a live broadcast By employing a RISC based microprocessor in the CNU 700 and CNU 500 the communication speed has been greatly improved Consequently real time control and instant response to the MSU 700A 750 or RCP 700 Series commands have been made possible With the combination of one VCS 700 Video Selector with a CNU 700 or CNU 500 each of six pictures and six waveform monitoring video signals can be handled and expanded to 96 of each with eight CNU 700 units Through a CNU 700 or CNU 500 one RCP can control one HDCU while one MSU is able to control multiple HDCUS All units connected to the CNU can easily communicate with each other Because of this useful new function simultaneous control of multi cameras file transfer between multi cameras and control from an external device are now possible As a convenient tool for system set up and maintenance both MSU control routi
28. Production Format 480 60i 480 30P 576 501 Camera Head Capture 1080 1080 1080 Format 60i 50i HDCU 900 950 Output Format 1080 1080 1080 HD SDI Reserved slot 30P Down converted SDI 480 480 576 Removable slot 60i 5o HKCU 903 953 Frame Converter Optional HKCU 904 Line Con verter Optional HKCU 901 951 SD T Optional MTS NTSG PAL Monitoring quality only Entries printed in blue are recommended choices HDC 930 only supports interlace formats Optical Fiber Digital Transmission The cable connecting the HDCU 900 950 CCU to an HDC 900 or HDC 950 930 camera uses two single mode optical fiber lines two control lines and two power lines to carry digitized video audio control signals and power to the camera An extremely high quality all digital bi directional video and audio signal can be transmitted up to a distance of 3 km 1 86 miles with the HDCU 900 and up to 1 2 km 0 75 miles with the HDCU 950 This cable and connector conforms to the SMPTE standard When supplying power to the camera via the optical fiber cable the maximum cable length varies with the camera system configuration and lens type the size of the optical fiber cable and the number of cable connectors Safety Oriented Power Supply As Safety is a major design concept of every Sony design the HDCU 900 950 continuously checks the camera
29. 5 50 55 5 sone HDCU 900 VBS OUT ANALOG COMPOSITE VIDEO SIGNAL WF OUT For MSU RGB Component OUT ANALOG COMPONENT VIDEO SIGNAL RET INPUT 1 to 4 SERIAL RET INPUT 1 to 4 PIX OUT For RCP WF OUT For RCP WF MODE For RCP SERIAL OUTPUT 1 to 3 ANALOG RETURN VIDEO SIGNAL HD SDI RETURN VIDEO SIGNAL PICTURE MONITOR OUTPUT FOR RCP WAVEFORM MONITOR OUTPUT FOR RCP WAVEFORM MONITOR MODE FOR RCP HD SDI SIGNAL VBS OUT RGB Component OUT ANALOG COMPOSITE VIDEO SIGNAL D SYNC OUT ANALOG COMPONENT VIDEO SIGNAL SD SYNC REFERENCE SIGNAL SD ANALOG VIDEO SIGNAL WF OUT For MSU WE 2 VCS VCS 700 WF 1 REMOTE CNU 700 WEA Terminated at 75 Q SD REFERENCE SIGNAL HDC 900 950 930 Series Product Information Manual Chapter 2 Total System 33 2 7 2 Setting the System Format using HDCU 950 For a system using the HDCU 950 the output signal format must be set Normally the Multi Format is set from the RM MSU or a device that is connected externally However it can also be set by the switches on the AT 149 board or FC 88 HKCU 953 board 1 Setting the HD SDI output Set the output signal format as the HD SDI signal At the same time this setting becomes the shooting mode of the camera 1 Set the field frequency coefficient Setup switch S420 on the AT 149 board Factory setting REMOTE 1 001
30. 20 dBs balanced Output connectors TEST OUT BNC type 1 1 0 Vp p 75 ohm terminated PROMPTER BNC type 1 1 0 Vp p 75 ohm terminated AC OUT 100 V AC 1 HD SERIAL OUT 1 5 Gbps 1 VF D sub 25 pin 1 DC OUT 4 pin 1 DC 12V 5 W Input output connectors CCU Electro optical connector 1 VTR 26 pin 1 TRACKER 20 pin 1 REMOTE 8 pin multi connector 1 INTERCOM 1 and 2 XLR 5 pin 1 each Supplied accessories Angle adjustment brackets 2 Front cover 1 Number plates for up tally 1 set for side panel 2 sets for back tally 1 set Cable clamp 2 Operation manual 1 Installation amp maintenance manual 1 Optional accessories HDVF 700A HD Electronic Viewfinder 7 type monochrome HDVF C700W HD Electronic Viewfinder 6 type color VFH 770 Outdoor Hood BKP 7911 Script Holder with script light CAC 6 Return Video Selector Maintenance manual CD ROM version Chapter 10 Specifications 178 Dimensions Unit mm inches 463 18 1 4 368 14 1 2 w 388 15 3 8 ry Of ID m E Ir gx e 69 2 18201 gt e UP ee oes 9 e am e 000 09006 cn 169 5 5 25 99 6505 LJ 80 392 15 1 2 NS 3 1 4 442 17 1 2
31. 99 7 4 10 Internal Switches and Internal Boards DRX Board 100 HDC 900 950 930 Series Product Information Manual Table of Contents 3 7 4 11 Internal Switches and Internal Boards RC Board 100 7 4 12 Internal Switches and Internal Boards EN Board Internal board of the optional HKCU 951 uus sede ger ed p eade md Ea hw RR RUE 100 7 4 13 Internal Switches and Internal Boards FC Board Internal board of the optional 953 101 7 5 CNU 700 Camera Command Network Unit 102 7 5 1 Front and Rear Panels 102 7 6 CNU 500 Camera Command Network Unit 103 7 6 1 Front and Rear Panels 103 7 6 2 Internal Board aes ek ee wh eR praaki x u s hua das 104 7 7 NCS 700 Video 105 7 7 1 Front and Rear Panels 105 7 8 MSU 700A Master Setup Unit 106 7 8 1 Operation Panel i odes REP eb bebe PR eed dees RE Red 106 7 8 2 Operation Panel in use with HD Equipment 111 75823 Connector Panel svo de Exe Sd RA PG ERES PR 111 7 9 MSU 750 Master Setup Unit 112 7 9 1 Operation
32. Chapter 6 A Quick Lesson on Camera Settings 67 box For this adjustment a White Chart exposed to a uniform light is also needed Black shading Execute AUTO BLK SHADING for the models that have this function For manual adjustment adjust in 12 3x 2 x 2 different combinations R G B channels 3 vertical V and horizontal H 2 for each of them SAW wave and PARA wave 2 White shading Select a lens file V SAW in white shading changes according to the exit pupil of the lens The exit pupil also changes according to the zoom position when using a zoom lens The change caused by the exit pupil appears on the G channel For that a MOD V SAW adjustment should be carried out Sometimes the color matching between the cameras may still not be in line even after a gray scale adjustment In most cases this is because the white shading is out of line 2 3 For system using the MSU 700A 750 you need to parameters for control of your system from the MSU 700A 750 as well as the operating conditions of the MSU 700A 750 The MSU 700A 750 has an Engineer Mode which allows you to assign cameras to be controlled from the MSU 700A 750 and to limit the operations on the MSU 700A 750 To authorize specific persons to use this Engineer Mode specify a security code in advance Once the security code is set the MSU 700A 750 will enter into the Engineer Mode when this security code is input 6 3 1 Specifyi
33. For CNU MSU RCP BKP 7900 Extender Board for CNU 700 500 BKP 7930 Expansion Board for system expansion up to 12 cameras for the CNU 700 BKP 7932 BVP 370 Series Interface Board for the CNU 700 BKP 7933 S Bus Interface Board for CNU 700 CCA 5 Cables 8p 8p cables for the CNU 700 500 MSU 700A 750 VCS 700 and RCP 700 Series CCA 5 3 3m CCA 5 10 10m CCA 5 30 30m The slots to which the circuit boards are inserted and the internal switches of the unit differ depending upon the system used They need to be set according to the system used Board name Board name 4 Model name Slots on the front Slots on the rear Slot to installed DPR 163 SDI 54A Fixed to the top most slot HDCU 900 RC 86 DIF 102 Second or third slot from the top AT 141 _ Fixed to the bottom most slot SD Analog Interface Unit 1 2 HKCU 901 IF 789A 789P VDA 57 Third slot from the top HD Analog Interface Unit I HKCU 902 ADA 59 Second or third slot from the top Frame Rate Converter Unit HKCU 903 FC 83 SDI 54B Second slot from the top Line Converter Unit HKCU 904 LC 41 SDI 54C Second or third slot from the top 1 for the USA and Canada 2 for the countries other than the USA and Canada Note Be sure to install the HKCU 901 of the same regional location as the HDCU 900 When the HKCU 901 is going to be installed confirm beforehand that the RC 86 board is installed in the second slot from the t
34. J AT Ts MODE CHARACTER Fan ES EOM t SET CANCEL switch UP DOWN switch MODE switch 1 Set the MODE switch to 3 The message MSU Assignment appears on the Screen 2 Push the SET CANCEL switch S6 toward SET The same MSU Assignment display as that in step 3 on the previous page appears Each press of the UP DOWN switch S5 toward DOWN moves the cursor on the display to the right or down when it reaches the right edge of the frame Each press of the switch toward UP moves the cursor to the left or up when it reaches the left edge of the frame 3 Move the cursor to the desired position then push the SET CANCEL switch S6 toward SET 4 Repeatedly push the UP DOWN switch S5 toward UP until the cursor reaches the SAVE position outside the frame 5 Push the SET CANCEL switch S6 towards SET The assignment set in steps 3 and 4 is written to nonvolatile memory 6 Return the MODE switch to O 6 3 4 Setting the Operating Conditions of the MSU By using the MSU Configuration menu you can also set the built in clock of the MSU 700A 750 and adjust various conditions of the MSU 700A 750 such as the sound volume of the warning buzzer and the brightness of the lamp and EL display Chapter 6 A Quick Lesson on Camera Settings 72 Configuration Menu S S m Configuration Menu Camera CCU 000 E CNU su O
35. Signal yo Specifications 13 VIDEO 9 GND S DATA IN OUT TTL level 14 C 2 INC 15 C 3 POWER IN ON OPEN 16 C GND 17 RTALLY ON 5V SCK IN TTL level OFF GND 5 COLOR OUT B W GND 18 C BW COLOR OPEN 19 UNREG NC GND 7 INC 20 UNREG 10 5 V to 17 V 8 G TALLY IN 5V OFF GND 8 10 HDVF 700A HD Electronic Viewfinder 8 10 1 Connector Input Output Signals pin Signal y o Specifications D sub 25P Male 18 INC T 14 VIDEO GND 15 5 IN TTL level ic ee oe 16 BATT IN ON 5 V OFF 0 V 17 CHASSIS External view GND Pin 18 G TALLY IN ON 5 V No Signal y o Specifications OFF 0 V 19 GND 412 V 1 VIDEO IN IN 1 0 V p p 75 Ohms 20 GND 12 Vj Z NG 21 VF SEL IN BW 0 V 3 INC COLOR 5 V 4 NC 22 H EXPAND IN BW 0 V 5 INC COLOR 5 V 6 PEAKING OUT ON 5 V 23 NC ON OFF OFF 0 V 24 NC 7 12VIN N 10 5 to 20 V 25 EXPAND IN ON GND 8 12VIN N 10 5 to 20 V OFF 5 V 9 INC 10 S DATA OUT TTL level 11 R TALLY N ON 5 V OFF 0 V 12 EFFECT N ON 5 V OFF HDC 900 950 930 Series Product Information Manual Chapter 8 Connectors and Cables 166 8 11 1 Connector Input Output Signals 8 11 HDVF C700W HD Electronic Viewfinder Pin
36. gt T Dimensions Unit mm inches M 368 14 1 2 368 14 1 2 260 10 1 4 260 10 1 4 15 10 32 O g 10 2 HDC 950 HD Color Video Camera General Power consumption 25W in stand alone use without options Operating temperature 20 C to 45 4 F to 113 F Storage temperature 20 C to 50 C 4 F to 4 122 F Mass Approx 5 1 kg 112 Ib 7 oz Dimensions See below Unit mm inches Imager Imager 2 3 type frame interline transfer CCD Method 3 CCD RGB Effective resolution 1920 horizontal x 1080 vertical Electrical characteristics Sensitivity F10 0 at 2000 Ix with 89 9 reflectivity 10 lux F 1 4 12 dB gain up Image signal to noise ratio 54 dB or more typical Minimum illumination HDC 900 950 930 Series Product Information Manual Horizontal resolution 1000 TV lines Dynamic range 1080 60i mode Registration 600 Within 0 02 all zones without lens Shutter speed selection 1080 60i Gain selection Clear Scan selection Extended Clear Scan Modulation depth Smear level typical Frequency response Horizontal resolution Geometric distortion 1 100 1 125 1 250 1 500 1 1000 1 2000 s 3 0 3 6 12 dB 60 1 to 4300 Hz 30 3 to 58 3 Hz 45 or more horizontally 800 TV lines at center 27 5 MHz with typical lens 135 dB W
37. 25 1 1 39 000009 External view No Signal Specifications 1 ENG R X OUT ENG SYSTEM RECEIVE 2 ENG R Y OUT 0 dBu BALANCED 3 ENG G GND for ENG 4 ENG T X IN ENG SYSTEM TALK 5 ENG T Y IN 0 dBu BALANCED 6 PGM1 X IN 20 dBu 7 Y IN Selectable with S301 AT board 8 PGM1 0 9 GND GND for AUX 10 AUXS 11 R TALLY X IN ON 24 TTL H SHORT OFF 0 TTL L OPEN 12 R TALLY Y IN 13 GND CHASSIS GND 14 PROD R X OUT PROD SYSTEM 15 PROD R Y OUT RECEIVE 0 dBu BAL ANCED 16 PROD G GND for PROD 17 PROD T X IN PROD SYSTEM TALK 18 PROD T Y IN 0 dBu BALANCED 19 PGM2 X IN 20 dBu O dBu 20 PGM2 Y IN Selectable with S302 AT board 21 PGM2 G IN 22 AUX4 23 AUX5 24 G TALLY X IN ON 24 TTL H SHORT 25 G TALLY Y IN OFF 0 Voc TTL L OPEN 0 dBu 0 775 Vrms 8 3 1 6 WF MODE 4 pin Female External view No Signal Specifications 1 SEQ CONT OUT G OPEN COLLECTOR NPN 2 SEQ CONT OUT X Selectable with COP 1 VDA board STAIR CASE OUT X 9 HDC 900 950 930 Series Product Information Manual No Signal Specifications No Signal Specifications 14 RECALL7 R G LOW 4 STAIR
38. MALE 6 C No connection 7 C No connection 8 GTALLY OUT ON 5V OFF GND 9 C No connection 10 C No connection 11 No connection External view External view 15 VD p 13 VIDEO GND GND for VIDEO No Signal Specifications 14 NC No connection 1 AUDIO G 60 50 dBu 15 No connection 40 dBu 16 C No connection 2 AUDIO X 30 dBu 20 dBu 17 R TALLY OUT JON 5V selectable OFF GND 3 AUDIO Y IN High impedance 18 No connection Balanced 19 UNREG GND for UNREG 0 dBu 0 775 Vrms GND 20 UNREG OUT 10 5 V to 17 V HDC 900 950 930 Series Product Information Manual Chapter 8 Connectors and Cables 149 20P FEMALE External view No Signal y o Specifications 1 SDATA IN TTL level OUT 2 NC No connection 3 NC No connection 4 SCK IN TTL level MANU 0 V or OPEN 5 NC No connection 6 INC No connection 7 NC No connection 8 G TALLY IN ON 5V OFF GND 9 NC No connection 10 INC No connection 11 NC No connection 12 Y VIDEO 1 0 V p p Zo 75 Ohms 13 VIDEO GND GND for VIDEO 14 No connection 15 INC No connection 16 INC No connection 17 R TALLY IN ON 5V OFF GND 18 INC
39. z 3 m z z m L CCU CNU REMOTE connector AUX REMOTE connector VO PORT PORT connector AUX REMOTE auxiliary remote connector 8 pin I O PORT connector 50 pin Chapter 7 Location and Function of Parts and Controls 111 1 9 MSU 750 Master Setup Unit 7 9 1 Operation Panel ALL button CAM PW button VF PW button Signal output select buttons CLOSE button STANDARD button AUTO SETUP block SONY 010 ALLciCAMPW TEST AUTO LEVEL START CLOSE STANDARD ggga WHITE BLACK Q Camera CCU function ON OFF buttons OU Scene file control block 0 GJ GJ 71171 0 2200 5 3 it CHARACTER ECS SHUTTER GAMMA MASTER ND Gc Display window block ACCESS SCENE FILES Monitor output select buttons R e 8 EJ MONITOR IC card insertion block STORI IC MEMORY CARD QU PIX Menu operation block CALL button Camera select block AONE IRIS MB ACTIVE button Iris control block ALL button Press the button so it starts flashing to activate the 11 buttons located at the right from CAM PW to AUTO SETUP fo
40. CD SOS 9 8 14 1 3 LENS 36P Female 18 Nc Signal Specifications 1 INC No connection 2 INC No connection 3 IIC DATA SERIAL DATA 4 IC CLK SERIAL DATA 5 GND GND for DATA 6 POWER IN 12 V 7 POWER IN GND for 12V 8 INC VIDEO X IN CHASSIS GND CHASSIS GND 8 14 1 2 LENS 12P Male External view Signal Specifications 1 RET VIDEO OUT GND ENABLE DISABLE 5 V or OPEN 2 RET 2 ENABLE OUT ENABLE GND DISABLE 5 V or OPEN 3 GND GND 4 AUTO 5V AUTO 5 V MANU 0 V or OPEN 5 IRIS CONT IN 2 0 V to 7 0 V 3 4 V 216 6 2 V F2 8 6 INC UNREG 7 IRISPOSITION OUT 2 0 V to 7 0 V 3 4 V F16 6 2 V F2 8 8 AUTO MANU IN AUTO IRIS 0 V MANUAL IRIS 5 V 9 EXTENDER OUT EX ON 0 V ON OFF OFF 4 8 V 10 ZOOM OUT WIDE 2 V POSITION TELE 7 V 11 LAUX1 OUT LENS AUX SERIAL RXD LENS SERIAL DATA 12 LAUX1 LENS AUX SERIAL TXD LENS SERIAL DATA HDC 900 950 930 Series Product Information Manual O O 36 19 External view Pin N Signal Specifications o 1 NC No connection 2 NC No conne
41. OFF FRONT To use the microphone connected to the MIC1 IN connector without supplying a power REAR To use the microphone connected to the AUDIO IN CH 1 connector on the back Whether or not to supply a power to the microphone can be set 7 2 3 Back Left Side TALLY lamp and TALLY switch CCU connector INCOM1 and 2 connectors EARPHONE jack TRACKER connector GENLOCK IN RET IN PROMPTER OUT connector and switch AUDIO IN connectors and switches TALLY lamp and TALLY switch ON The tally lamp lights when a tally signal or a call signal generated by pressing a CALL button is received OFF The tally lamp is prevented from lighting CCU Camera Control Unit connector optical multi connector Connects to a camera control unit via an optical electro composite cable HDC 900 950 930 Series Product Information Manual gt OY Y with the exclusive microphone power switch of the AUDIO IN CH 1 connector VF viewfinder connector 20 pin Connect the viewfinder cable SHUTTER switch1 OFF An electronic shutter does not function ON An electronic shutter is activated SEL The shutter speed and shutter mode change each time the switch is set to this position INCOM EAR intercom earphone LEVEL control To adjust the intercom earphone volume level The intercom level adjustment is enabled when the INCOM 1 2 LEVEL switches on the right back panel are set to
42. To insert a card 1 Slide the cover to open the IC card insertion Menu operation block block 2 Insert the card into the slot When the card goes dark is correctly set the ACCESS indicator lights MODE in green o Note The data in the memory card is maintained by D the battery built into the card If the battery is 5 exhausted the data in the will lost You check the battery condition by the ACCESS OH indicator If the battery becomes weak replace LI the battery with a new one as soon as possible T 2 Eject button Press to eject the inserted IC card LI Note t Do not eject a card when the ACCESS indicator g is lit in red it means that the data is being read from or written to the card This may erase data stored in the card ACCESS indicator Shows the status of the IC memory card OIOIOIO MODE mode select buttons Select the menu mode If you press and light one of these buttons the menu for the selected mode appears on the EL display When the lit Off button is pressed again it goes dark and the Lit in menu on the display also disappears green MULTI Selects Multi Control menu to set the requirements for Master Slave mode to set up multiple cameras in synchronization CARD Selects IC memory card menu to initialize IC cards CONFIG Selects Configuration menu to configure this unit and the entire camera Sys
43. 00 SD SERIAL OUTPUT SYNC OUT I UU TSO n PIX OUT 2 0 WF OUT jee WF MODE Supplied accessories AC power cord 1 Power cord plug holder 1 2 pin 3 pin transformer AC plug 1 4 pin connector 1 Number plates 1 set Fuses 1 set Operation manual 1 Maintenance manual Part 1 1 Optional accessories HKCU 901 SD Analog Interface Unit HKCU 902 HD Analog Interface Unit HKCU 903 Frame Rate Converter Unit HKCU 904 Line Converter Unit CCA 5 3 Connection Cable 3 meter 10 feet CCA 5 10 Connection Cable 10 meter 33 feet Maintenance manual Part 2 Chapter 10 Specifications 182 Dimensions Unit mm inches 460 18 1 8 424 16 3 4 465 18 3 8 481 19 10 5 HDCU 950 HD Camera Control Unit General Power supply Current consumption Standby power Approx Peak inrush current Operating temperature Storage temperature Mass Approx Dimensions Unit mm inches Input output connectors CAMERA 100 to 240 V AC 50 60 Hz 3 6 A max 5 W 1 Power ON current probe method 30A 240V 8A 100V 2 Hot switching inrush current measured in accordance with European standard EN55103 1 26A 230V 10 C to 40 C 14 F to 104 F 20 C to 50 C 4 to 122 F 6 5 kg 14 Ib 5 oz See below Optical fiber connector 1 1 485 Gbps 1 4835 Gbps SDI x 2 180 V DC power supply INCOM TALLY PGM RCP CNU Input connectors
44. 19 fl JEI LED Display Brightness 3 Adjust the brightness with the leftmost control knob When the adjustment is completed Press Home to return to the MSU adjustment menu and press Exit to leave this menu 6 3 4 9 To set the screen saver The screen saver can be activated to protect the menu display when the MSU 700A 750 is not operated for a certain time The screen saver can be turned on and off as required and the time to activate it can be adjusted To set the screen saver proceed as follows Chapter 6 A Quick Lesson on Camera Settings 74 1 Press MSU SW Set on the MSU Configuration menu The MSU SW Setting display appears MSU SW Setting PIX WF PIX WF Syncro All Mode PIX WF Control Test SW Mode min Screen saver setting area 6 4 File Structure The HDC 900 is able to store adjustment data in memory in the form of files There are six types of files for different purposes 1 Operator File Stores the items displayed on the viewfinder and Switch settings for the camera operator This file is stored in the Memory Stick media card yet the video data paint data cannot be stored 2 Preset Operator File Stores the standard state of operator file items This file is stored in the camera yet video data paint data cannot be stored 3 Scene File Stores the temporary video setting data according to the scene T
45. 24 TTL H SHORT 6 DSR No connection 12 R TALLY Y IN OFF 0 Vac TTL L OPEN 7 EXT CMD1 OUT RTS DEDE 18 GND CHASSIS GND 8 EXFCHD 1 IN CTS IN 14 PROD R X PROD SYSTEM 9 NC No connection OUT RECEIVE 0 dBu BALANCED 5 This is set using the S1 switch on the AT 141 board 15 PROD R Y AT AUX OUT x URUNK 16 PROD G GND for PROD 8 2 1 7 1 0 PORT D sub 15 pin Female 17 PROD T X IN PROD SYSTEM TALK 18 PROD T Y IN 0 dBu BALANCED 19 PGM2 X IN 20 dBu O dBu B ecu 5p 20 PGM2 Y IN 2 with 5302 9 O 21 PGM2 G IN 22 AUX4 23 AUX5 External view 24 GTALLY X IN ON 24 Vdc TTL H SHORT No Signal Specifications 25 G TALLY Y IN OFF 0 Vac TTL L OPEN NG Ohms 5V 8 2 1 9 WF MODE 4 pin Female 2 IN2 GND 5 V OPEN 47 kOhms 5 V PULL UP IN3 GND 5 V OPEN 47 kOhms 45 V PULL UP 4 INA GND 5 V OPEN 47 kOhms 5 V PULL UP 5 INS5 GND 5 V OPEN 47 kOhms 5 V External view PULL UP 6 6 GND 5 V OPEN 47 kOhms 5 V No Signal Specifications PULL UP 1 SEQCONTOUT OPEN COLLECTOR 7 N7 GND 5 V OPEN 47 kOhms 5 V G PNP NPN PULL UP 2 SEQ CONT OUT Selectable with COP 1 8 GND 5 V OPEN 47 kOhms 5 V X 78 PULL UP 3 STAIR CASE OUT 9 9 GND x 10 0011 0 5 V 1 kOhms 4 STAIR CASE OUT GND for STAIR CASE 11 0072 0 5 V 1 kOhms 6 12 OUT3 0 5 V 1 kOhm
46. AC IN RET 1 2 3 HDC 900 950 930 Series Product Information Manual D sub 25 pin 1 INCOM 4W 2 systems PD ENG 0 dB e PGM 2 systems 0 dB 20 dB TALLY R G 8 pin multi connector 1 100 to 240 V AC BNC type 3 VBS 1 0 Vp p 75 ohms REFERENCE PROMPTER MIC REMOTE Output connectors MIC HD SDI OUT SD SDI OUT MONI HD SDI HD SDI SMPTE 292M 1 485 Gbps 1 4835 Gbps SD SDI SMPTE 259M 270 Mbps BNC type 2 loop through output HD SMPTE 274M tri level sync 0 6 Vp p 75 ohms SD Black burst NTSC 0 286 Vp p 75 ohms PAL 0 3 Vp p 75 ohms or NTSC 10F BB BNC type 2 loop through output analog signal 1 0 Vp p 75 ohms D sub 15 pin 1 JAE made DAC1 J10 recommended switchable to WF REMOTE by an internal setting XLR 3 pin male 2 0 dBu 20 dBu BNC type 2 SMPTE 292M 0 8 Vp p 75 ohms 1 485 Gbps 1 4835 Gbps BNC type 2 SMPTE 259M 0 8 Vp p 75 ohms 270 Mbps BNC type 1 0 8 Vp p 75 ohms 1 485 Gbps 1 4835 Gbps Chapter 10 Specifications 183 SYNC OUT BNC type 1 Optional accessories HD S001A tri level AC power cord sync 0 6 Vp p 75 ohms USA and Canada 1 551 812 XX SD composite sync 0 3 Other countries 1 782 929 Vp p 75 ohms Power cord plug holder HD SYNC or SD SYNC USA and Canada 2 990 242 01 selectable Other countries 3 613 640 01 PIX OUT BNC type 1 VBS R G B HKCU 951 SD Encoder Unit VBS 1 Vp p
47. B4x6 Warning e f the rack falls due to the weight of the equipment it may cause death or major injury To prevent the rack from falling or moving be sure to fix the rack to the floor e f the rack falls death or serious injury may result When attaching the unit be sure to fix the rack to the floor and be careful not to attach at a height of 1 2 m or higher from the floor Caution Use the specified rack mount adapter If not injury could occur by drop of the unit because strength of the shelf board is not enough Mount the unit with more than two persons A one man job may cause injury Be careful not to catch your finger or hand in the rack mount rail Mount in the rack in a stable position Injury could occur by drop of the unit in unbalance condition of Chapter 2 Total System 40 installation or removal Install in a posture of stability and carelully Required Parts Rack mount adapter RMM 301 1 set Screw B4 x 6 supplied with the RMM 301 4 pcs Sony part No 7 682 560 04 Washer W4 SMALL supplied with the RMM 301 4 pcs Sony part No 7 688 004 03 B5 screw 6 mm or longer 4 pcs RCP 700 Series and MSU 700 Series The RCP 750 751 700 701 and the MSU 700A 750 can be mounted into a 19 inch rack using an optional drawer Each type of equipment requires different parts to mount it into the drawer Drawer RCP 700 Series HDC 900 950 930 Series Product Information M
48. p Q VTR START recording start stop button When a VTR is connected recording begins when this button is pressed and stops when it is pressed again This button functions the same as the VTR button on the lens When a camera control unit is connected the function of this button can be changed to the RET2 INCOM1 MIC INCOM2 MIC ON OFF function on using the OPERATION menu connector EXT I O connector 959 REMOTE connector DC OUT connector DC IN connector HD SERIAL OUT connector VTR connector INCOM1 and 2 intercom 1 and 2 connectors XLR 5 pin Used for input and output of intercom audio signals EARPHONE jack minijack Connect an earphone or headset for output of the VTR playback audio signal Chapter 7 Location and Function of Parts and Controls 84 TRACKER connector 20 pin Used for communication between the camera operator and tracker and for intercom 1 and 2 connection This also supplied the up tally and program audio signals The TRUNK LINE input output signals are also assigned Q GENLOCK IN RET IN PROMPTER OUT external gen lock signal input return video signal input prompter signal output connector BNC type and switch Setthe switch according to the signal at the connector GENLOCK IN For input of an external gen lock signal valid in stand alone use only RET IN For input of the return video signal valid in stand alone use only PROMPTER OUT Use
49. receiver optional HDC 900 950 930 Series Product Information Manual D DC IN DC power supply input connector XLR 4 pin Used for connection to the AC 550 550CE AC Adaptor a battery etc to supply power to the camera HD SERIAL OUT connector BNC type Used for output of HD SDI serial data VTR connector 26 pin Used for connection to a VTR such as the HDW 250 or HDCD 50 HD Signal Distributor Chapter 7 Location and Function of Parts and Controls 85 7 2 4 Back Right Side Memory stick section POWER switch Memory Stick media card section A slot to accommodate a Memory Stick media card and an eject button to remove the stick are provided behind the panel The eject button lights in red while writing or reading data to from a Memory Stick media card Note Do not insert remove the memory stick when the eject button lights POWER switch CCU Power supply will be received from the camera control unit EXT Power supply will be received through the DC IN or VTR connector control and select switch 2 Line select switch 1 9 LEVEL TALK switch I8 INCOM control HDC 900 950 930 Series Product Information Manual LEVEL TALK R ON F RET 1 button RET button and select switch 1 2 contr and switches Q CALL button Q RET 1 return video 1 button The return video 1 signal from the camera control unit is monito
50. 1 Supplied accessories AC power cord x1 Plug holder for the AC power cord x1 Operation manual x1 Maintenance manual x1 For other countries 1 0 Vp p VBS 0 7 Vp p V 75 ohms PIX A INPUT BNC type 1 1 0 Vp p VBS 75 ohms WF A INPUT BNC type 1 1 0 Vp p VBS 75 ohms CHARACTER INPUT BNC type 1 with loop through output 0 7 Vp p V 75 ohms AC IN 3 pin 1 Output connectors PIX A and PIX B OUTPUT BNC type 1 each 1 0 Vp p VBS 75 ohms WF A and WF B OUTUT For USA and Canada 1 0 Vp p VBS 0 7 Vp p V 75 ohms For other countries 1 0 Vp p VBS 0 7 Vp p V 75 ohms Chapter 10 Specifications 185 WF MODE SYNC OUTPUT BNC type 1 0 3 Vp p VBS 75 ohms negative polarity Round 4 pin connector 1 Supplied accessories AC power cord x1 Plug holder for the AC power cord x1 4 pin connector x1 Operation manual x1 Remote connectors Maintenance manual x1 REMOTE 8 pin multi connector 1 PORT D sub 37 pin 1 10 9 MSU 700A Master Setup Unit General Mass Power requirements 100 to 240 V AC 50 60 Hz Approx 4 5 kg 9 Ib 15 oz Current consumption 0 45 A Inputs outputs Peak inrush current 1 Power ON current REMOTE probe method CCU CNU 8 pin multi connector 1 20A 100V 55A 240V AUX 8 pin multi connector 1 2 Hot switching inrush PORT 50 pin 1 current measured in AC IN 3 pin 1 accordance with European standard EN55103 1 12A 230V Operating
51. 1 485 Gbps 1 4835 Gbps SMPTE 292M SERIAL OUTPUT 1 3 BNC 0 8 V p p 75 Ohms 1 485 Gpbs 1 4835 Gbps SMPTE 292M SYNC OUT BNC 0 3 V ternary SYNC 75 Ohms SYNC OUT BNC 0 3 V ternary SYNC 75 Ohms 0 3 V p p SD SYNC 75 Ohms selectable 8 2 1 2 CAMERA connector optical electrical connector VIDEO Y PB PR 1 485 Gbps 1 4835 Gbps serial SMPTE 292M RET VIDEO Y PB PR 1 485 Gbps 1 4835 Gbps serial SMPTE 292M INCOM 2ch MIC 2ch DIGITAL AUDIO AES EBU CAMERA COMMAND PROMPTER Chapter 8 Connectors and Cables 153 8 2 1 3 AUDI0 0UTPUT CH 1 CH 2 XLR 3 pin Male External view No Signal Specifications 1 IMIC OUT G 0 dBu 20 dBu Selecta 2 MIC OUT X ble with S402 S403 AT board 3 MIC OUT Y 0 0 775 Vrms 8 2 1 4 MIC REMOTE D sub 15 pin Female 8 15 goo OE ooooooooc O External view 2 8pin 15pin MIC GAIN CONT L L MIC 1 and 2 ON L H MIC 1 ON H L MIC 2 ON H H INTERNAL set 3 CONT1 CONT2 ASPECT L H SQ 16 9 H H EC 4 3 L L INTERNAL set H L LB 4 3 8 2 1 5 WF REMOTE D sub 15 pin Female 8 15 9 External view Recall system 4 HDC 900 950 930 Series Product Information M
52. 6 POWER 7 POWER 3 8 SPARE CHASSIS GND CHASSIS GND RS232C No Signal Specifications 1 DCD IN DATA CARRIER DETECT 2 RXD IN RECEIVED DATA 3 TXD OUT TRANSMITTED DATA 4 DTR OUT DATA TERMINAL READY 5 SIGNAL GND SIGNAL GND 6 DSRIN DATA SET READY 7 RIS OUT REQUEST TO SEND 8 CTSIN CLEAR TO SEND 9 NC 85422 Signal Specifications 1 DCD IN DATA CARRIER DETECT 2 RXD IN RECEIVED DATA 3 TXD OUT TRANSMITTED DATA 4 TXD OUT TRANSMITTED DATA 5 SIGNAL GND SIGNAL GND 6 RXD IN RECEIVED DATA 7 RTS OUT REQUEST TO SEND 8 CTSIN CLEAR TO SEND HDC 900 950 930 Series Product Information Manual E CCU1 to CCU6 CONNECTOR 6PIN POWER IN 7PIN POWER IN RCP1 to RCP6 AUX1 AUX2 MSU 6PIN POWER OUT RCP POWER 25 V 7PIN POWER OUT GND for Power VCS CONNECTOR 6PIN NOT USED 7PIN NOT USED Chapter 8 Connectors and Cables 160 8 4 2 Gable Wiring CCA 5 Cable for REMOTE connector Black White M Orange White Brown Red White 77 Red v Brown 8 4 3 Connection Connector Use the connectors below or the equivalent at its tip when cables are connected to each connector on the connector panel during installation and servicing Connector name REFERENCE CHARACTER BNC
53. HDC 950 930 HKC T950 External view No Signal 1 0 Specifications 1 RET VIDEO ENABLE O V ENABLE DISABLE 5 V or OPEN 2 VTR START IN ENABLE 0 V STOP DISABLE 5 V or OPEN 3 GND GND for UNREG HDC 900 950 930 Series Product Information Manual No Signal Specifications 4 AUTO SERVO OUT AUTO 5 V MANU 0 V or OPEN 5 IRIS CONT OUT 3 4 V F16 to 6 2 V F2 8 6 UNREG OUT 10 5 V to 17 V 7 RIS POSITION IN 3 4 V F16 to 6 2 V F2 8 8 AUTO MANU OUT AUTO IRIS MANUAL IRIS 5 V 9 EXTENDER IN 2 0 ON OFF EX 0 8 ON 41 8 V OFF 44 8 V 10 ZOOM IN WIDE 2V POSITION TELE 7 V 11 FOCUS POSI IN o 7 V LENS RX min 2 V 12 LENS TX OUT VF 25P FEMALE HDC 900 External view No Signal Specifications 1 Y VIDEO X OUT 1 0 V p p Zo 75 Ohms 2 PRVIDEO GND GND for PR VIDEO 3 PR VIDEO X OUT 0 7 V p p Zo 75 Ohms 4 PB VIDEO GND GND for PB VIDEO 5 PB VIDEO X OUT 0 7 V p p Zo 75 Ohms 6 PEAKING IN JOto5V dc LEVEL 7 12V OUT 10 5 to 20 V 8 412V OUT 10 5 to 20 V 9 C No connection 10 S DATA IN TTL level OUT 11 RTALLY OUT JON 5 V OFF 0V 12 EFFECT OUT JON 5 V OFF 0V 13 NC No connection 14 Y VIDEO GND GND for Y VIDEO
54. LENS c d ENG EPP LENS COLOR VIDEO CAMERA COLOR VIDEO CAMERA ULT FORMAT HDC 900 HDC 950 930 MULTI FORMAT CD COLOR VIEWFINDER LCD COLOR VIEWFINDER HDVF C750W HDVF C700W iP SCRIPT HOLDER STUDIO ZOOM LENS LARGE LENS ADAPTER BKP 7911 CA 905L 7 TYPE VIEWFINDER SADDLE BKP 9057 HDC 900 950 930 Series Product Information Manual MULTI FORMAT MULTI FORMAT ELECTRONIC VIEWFINDER LCD COLOR VIEWFINDER HDVF 700A HDVF C700W Chapter 2 Total System 14 Figure 2 2 Optional Accessories for the HDC 900 HDVF 700A 7 Type Viewfinder HFH 770 Outdoor Hood with standard hood sold separately Front cover supplied HDVF C700W L 6 Type Viewfinder HDC 900 HDC 900 L HD Color Video Camera 020 00 o 000 CSO 0 c BKP 7911 Script Holder with Light Zoom lens HDCU 900 HD Camera Control Unit V Shaped wedge supplied with tripod HDC 900 950 930 Series Product Information Manual Chapter 2 Total System 15 Figure 2 3 Optional Accessories for the HDC 950 930 HDVF C750W HD Electronic Viewfinder HDVF 20A 0 HD Electronic Viewfinder BKW 401 Viewfinder Rotation Bracket Zoom lens HDC 950 930 HD Color Video Camera HKC T950 VCT 14 Tripod Adapter CA 905L Large Lens Adapter CCA 5 Cable max 200 meters u annnunassanun nununna nunnannnn nunnunnnn mmm nun o
55. MIT Se gt 2 SYNC OUT A Picture Monitor y OUT Waveform Monitor HDCU 950 SYNC OUT SYNC SIGNAL SDI RETURN VIDEO SIGNAL SERIAL RET INPU to3 SERIAL OUTPUT 1 2 HD SDI SIGNAL HD SDI SIGNAL lt HD SDI OUT 1 2 HDC 950 CA 905L SD SDI SIGNAL i OUT e 01 5 505 HDSDI C QU OA Ica Q Q G gt SYNC OUT A Picture Monitor MEIO ON els x RE RCPICNU We INCOM T LLY PGM Waveform Monitor HDCU 950 SD ANALOG VIDEO SIGNAL SD REFERENCE SIGNAL Next HDCU 950 O O 00 00 020 60000000005 CNU 700 Terminated at 75 HDC 900 950 930 Series Product Information Manual Chapter 2 Total System 37 2 7 2 4 Analog NTSC PAL System Figure 2 7 2 3 Example of connection using HDCU 950 3 System format Analog NTSC PAL system SD SYNC REFERENCE SIGNAL PROMPTER SIGNAL ANALOG RETURN VIDEO SIGNAL REFERENCE SIGNAL ANALOG COMPONENT VIDEO SIGNAL SYNC OUT PROMPTER IN RET INPUT 1 to 3 REFERENCE IN Component OUT Doo lo HDC 950 CA 905L
56. Set the field frequency to 1 1 001 times Set the field frequency to 1 001 when using NTSC 525 60 signal in the SD system 1 000 Set the field frequency to 1 time Set the field frequency to 1 000 when using PAL 625 50 signal in the SD system REMOTE Set it with RM MSU etc that is connected outside 2 Set the field frequency Setup switch S418 on the AT 149 board Factory setting 60 V 60 V When the FC 88 board HKCU 953 is not used but the NTSC 525 60 signal is used in the SD system When the FC 88 board HKCU 953 is not used but the PAL 625 50 signal is used in the SD system 48 V At present this function is not supported 50V 3 Set the shooting mode of the camera Setup switch 5419 on the AT 149 board Factory setting INTR INTR When shooting with interlacing system PROG When shooting with progressive PsF system When shooting with 540 60P system At present this function is not supported 540P Note If you select a format of 48i 48 field interlace or another format that is not supported by the HDCU 950 the setting causes an error and the indicators D201 to D205 on the AT 149 board will flash 2 Setting the SD signal output When 5420 on the AT 149 board is set to a position other than REMOTE set the SD signal output to NTSC 525 60 or PAL 625 50 Setup switch 5423 1 on the AT 149 board Factory setting OFF ON PAL 625 50 OFF NTSC 525 60 HD
57. To set on this unit The switches and become valid with the LOCAL setting Down converter mode switch To select the operating mode of the down converter SQ Squeeze mode LB Letterbox mode EC Edge Crop mode The switches and Q become valid with the EC setting Q Edge crop mode setting switch To set the Edge crop mode of the down converter CENT To fix the picture frame at the center when performing edge crop VAR The edge crop position can be varied with the edge crop position setting switch Q Edge crop position setting switch To set the edge crop position This switch will return to its original position when you release it Press and hold the switch toward RIGHT to move the position to the right and toward LEFT to move it to the left 2 7 4 12 Internal Switches and Internal Boards EN Board Internal of the optional HKCU Q POWER indicator VBS controls COMPONENT controls SC PHASE switch POWER indicator The LED is lit when the power voltage inside the board is normal VBS controls To adjust VBS signal LEVEL To adjust the video level Chapter 7 Location and Function of Parts and Controls 100 SYNC To adjust the sync level CHROMA To adjust the chroma level COMPONENT controls Each is for adjusting the corresponding component video output R R Y G Y or B B Y Q SC PHASE switch Used to adju
58. Usually software is integrated into switches for internal setting or for communications with other devices The following are some technical terms we frequently use in this field Auto black balance ABB Auto black balance automatically adjusts the black level to prevent coloring other than black which occurs while the lens is closed Sometimes black set is also carried out at the same time Some CCD cameras use APR Automatic Pixel Restoration to perform auto black balance for convenience Auto lris Auto iris is a function that automatically controls the aperture lens opening based on the mean or the peak value of video signals Auto set up Auto set up is a function for camera automatic adjustment which can be divided into Auto White Balance AWB Auto Tracing White ATW Auto Black Balance ABB Level Auto Setup Auto White Shading Auto Black Shading etc Auto tracing white ATW It is a convenient function for low end or consumer type cameras which automatically keeps adjusting the white balance during shooting However most of the cameras used for broadcast applications do not adopt this method because the white balance is not very precise and the ongoing changing of color temperature is not usually a variable to consider because scenes are staged and controlled Auto white balance AWB Auto white balance automatically adjusts color temperature when shooting a white subject HDC 900 950 930 Series Product I
59. connected via an optical fiber cable to the CAMERA connector on the rear panel It flashes to warn about insufficient optical reception status of the optical fiber cable Q MAIN POWER switch and indicator Turns on or off the power to the entire system consisting of the HDCU 900 a video camera an RCP 700 series Remote Control Panel connected via the REMOTE connector etc Setting the switch to the Chapter 7 Location and Function of Parts and Controls 87 position turns the power on and setting it to turns it off The indicator lights when the power supply is on CAMERA POWER switch and indicator Turns on or off the power to the camera when the MAIN POWER switch is on Setting the switch to the position turns the power on and setting it to O turns it off When a remote control panel is connected and the power supply is turned off with the CAM PW button 7 3 2 Rear Panel CAMERA connector on the remote control panel this switch alone cannot turn on the video camera power INTERCOM connector XLR 5 pin Connects to a headset Note To use a headset with a plug other than an XLR 5 pin plug consult a Sony service or sales representative HD signal input output block SD signal input output block 5552 D Expansion slot AC IN CAMERA connector optical fiber connector Used to connect a video camera using an optical fiber cable such as the FC2 PD50 PD
60. insertion section AC IN connector RS 232C 1 through 3 connectors REFERENCE connectors CHARACTER 1 and 2 connectors POWER switch and indicator Press to turn the power ON or OFF The indicator illuminates when power is switched on CCU camera control unit 1 through 6 connectors 8 pin Connect to the RCP CNU REMOTE connector on a CCU 700A 700AP Camera Control Unit using a CCA 5 cable RCP remote control panel 1 through 6 connectors 8 pin Connect to the CCU CNU REMOTE connectors on an RCP 700 Series Remote Control Panel using a CCA 5 cable MSU Master Set up Unit connector 8 pin Connect to the CCU CNU REMOTE connector on an MSU 700 Master Set up Unit using a CCA 5 cable VCS video selector connector 8 pin Connect to the REMOTE connector of a VCS 700 Video Selector using a CCA 5 cable AUX1 and AUX2 auxiliary 1 and 2 connectors 8 pin Connect to the AUX1 or AUX2 connector of another CNU 700 using a CCA 5 cable when controlling multiple cameras with two or more CNU 700 units You can connect up to eight CNU 700 units HDC 900 950 930 Series Product Information Manual CHARACTER 1and 2 connectors BNC type Supply character data as a 525 or 625 line black and white video signal The signal output is automatically selected according to the reference signal input to the REFERENCE connector If no reference signal is input the CNU 700 for the USA and Canada supplies
61. rear panel Cable clamp 2 Operation manual including BKP 9057 1 Maintenance manual part 1 1 Angle adjusting plates 2 Rear panel sticker 1 Optional accessories BVF 77 77CE 7 type monochrome viewfinder HDVF 700A 7 type monochrome viewfinder BVF 7700 7700P 7 type color viewfinder Only when the CCU 900 900P is used HDVF C750W C700W 6 type color LCD viewfinder BVF 55 55CE 5 type monochrome viewfinder HDC 900 950 930 Series Product Information Manual MIC IN XLR 3 Female VIDEO OUT HD Y BNC x 1 LENS 12 Pin VF 20 Pin INCOM XLR 5 Female Cable adaptor I F Camera cable CCZ type 26pin Female MIC OUT XLR 3 Male VF 20 Pin INCOM XLR 5 Male Supplied accessories HDCZ A10 cable 10 m 1 VF relay cable 1 MIC relay cable 1 INCOM relay cable 1 Top cover 1 Operation manual 1 Optional accessories HDCZ A25 25 m Part number 1 823 616 11 HDCZ A50 50 m Part number 1 523 617 11 Chapter 10 Specifications 190 Function comparison chart Paint MSU 700A MSU 750 RCP 750 751 RM B750 Menu Sub Menu Control Item i Direct Menu Direct Menu Direct Menu Direct Button Button Button Button R B Master Menu Black R G B Master v v v ABB v v v lt lt lt White R G B R B AWB v v v Flare R G B Flare Off Gamma Knee Gamma Blk Gamma Knee Point Knee Slope S lt ASA SASS Gamma Off Black Ga
62. rewind button buttons RM Menu mode in which the Press and light this button to start a rewind operation 1 DE QS gt play button AM Press and light this button to start a playback 2 A p operation fast forward button also permits the menus of the camera to be Press and light this button to start a fast forward operated from this unit the functions operation indicated with blue letters for the buttons and recording review button he leftmost control knob are valid Press and light this button to execute a recording m e 11 review operation Notes menu of this unit appears on the LCD when When the VTR START STOP button is lit these you press and light ie Diri Withthe buttons are deactivated To activate the buttons first MONITOR button lit the character display of press the VTR START STOP button to cancel noo turned on when you press and Recording mode Ignt this button A part of the VTR control functions of this unit may be MAINTENANCE VF MENU viewfinder menu disabled depending on the combination of camera With the MONITOR button unlit the and VTR For details ask your Sony dealer 2 1 the ALARM indicator With the MONITOR button lit the unit enters Camera Menu mode when you press and light this button The main menu of the camera appears on the LCD SCENE CANCEL With the MONITOR button unlit the Scene File menu of this unit appears on the LCD when you press and light this but
63. selected items The button lights during adjustment and goes dark when adjustment is completed If you press the button when lit the automatic adjustment is canceled and the button flashes To stop the flashing press the button again WHITE white balance button Press to automatically adjust the white balance The button lights during adjustment and goes dark when adjustment is completed If you press this button when lit or the START BREAK button the automatic adjustment is canceled and the button flashes To stop the flashing press the button again 4 BLACK black balance button Press to automatically adjust the black balance and black set The button lights during adjustment and goes dark when adjustment is completed If you press this button when lit or the START BREAK button the automatic HDC 900 950 930 Series Product Information Manual adjustment is canceled and the button flashes To stop the flashing press the button again Notes f an error occurs during adjustment the pressed button flashes The leftmost button is for future use and has no function at present Q Camera CCU function ON OFF buttons Various functions of the video camera or the CCU can be turned on and off from this unit The following Switching functions are assigned to 18 of the buttons at the factory and the other nine buttons are reserved for future use HOODOO KNEE DETAIL LVLDEP GAMMA CHROMA MATRIX SD MATRIX SD OFF OFF OFF O
64. 1 CCU1 to CCU6 Connectors 6pin POWER OUT RCP POWER 30 V 7pin POWER OUT GND for Power 6pin POWER IN MSU VCS Connectors 7pin POWER NOT USED RCP1 to RCP6 AUX Connectors 8 5 2 Cable Wiring 5 Cable for REMOTE connector Black White Orange White Brown Red White Red Brown 8 5 3 Connection Connector Connections made with the connector panels during installation or service should be made with the connectors complete cable assemblies specified in the following list or equivalent parts Connector name Connection connector cable REFERENCE 1 569 370 12 Connector BNC CHARACTER BNC 8 6 MSU 700A Master Setup Unit 8 6 1 Connector Input Output Signals Q POWER switch AC IN connector Brown RS 232C 9P FEMALE 1 566 354 11 D SUB 9P MALE CCU 1 766 848 11 PLUG 8P MALE RCP or CCA cable assembly option MSU CCA 5 10 10 m VCS CCA 5 3 3 m AUX 8P FEMALE CCU CNU REMOTE connector AUX REMOTE connector A IN POWER switch Turns the power to the unit on and off AC IN AC power input connector Connect to an AC power source using the supplied AC power cord The power cord can be fixed to this unit using the supplied plug holder HDC 900 950 930 Series Product Information M
65. 10 kOhms BNC type 75 Ohms 1 0 V p p ON GND OFF OPEN Input Signals 6 RET 2 ON OFF IN Zi gt 10 kOhms ON GND GENLOCK IN HDC 950 930 OFF OPEN BNC type 75 Ohms 1 0 V p p RET IN HDC 950 930 BNC type 75 Ohms 1 0 V p p Q Not used Use this connector by selecting PROMPTER OUT GENLOCK IN and RET IN signals with the switch on the rear panel of the HDC 950 930 PROMPTER OUT signal becomes effective when the camera is connected to the CCU GENLOCK IN and RET IN signals become effective when the External view DC OUT 4P FEMALE OO j d alone CSEG RONA No Signal yo Specifications 1 GND GND for POWER 2 NC No connection HDC 900 950 930 Series Product Information Manual Chapter 8 Connectors and Cables 144 No Signal Specifications 3 INC No connection 4 UNREG OUT 12 V dc 500 mA REMOTE 8P FEMALE GOA 0 6 External view No Signal y o Specifications 1 SERIAL DATA 2 3 RX HDCU MSU RCP 4 RXC CNU VCS SERIAL DATA 5 TXGND GND for TX 6 POWER OUT 26 V 200 mA max 7 POWER GND GND for POWER 8 VIDEO X 75 Ohms 1 0 V p p CHASSIS CHASSIS GND AC OUT HDC 900 E 1 JN External view No Signal 1 0 Specifications E GND CHASSI
66. 15 S CK OUT TTL level 16 BATT IND OUT JON 5 V OFF 0V 17 CHASSIS GND 18 TALLY OUT JON 5 V OFF 0V 19 GND 12 V GND for 12 V 20 GND 12 V GND for 12 V 21 VF SEL IN BW OV COLOR 5 V Chapter 8 Connectors and Cables 147 No Signal Specifications No Signal Specifications 22 H EXPAND OUT ON GND 5 Pr VIDEO X OUT 0 35 V p p Zo OFF 5 V 75 Ohms 23 NC No connection 6 Pr VIDEO G GND for Pr VIDEO 24 NC No connection 7 Pb VIDEO X OUT 0 35 V p p Zo 25 V EXPAND OUT ON GND 75 Ohms OFF 5 V 8 Pb VIDEO G _ GND for Pb VIDEO 9 SDA VF IN TTL level VF 20P FEMALE HDC 950 930 OUT 10 VD OUT Negative Pulse 3 0 V p p Low impedance 11 CALL ON ON Ov OFF H 3 V 12 VF POWER OFF OUT H 5 V OFF L 0 V External view 13 MAIN POWER OUT 8 V ON OFF OFF GND No Signal yo Specifications 14 SCL VF OUT TTL level 1 S DA TA TTL level 15 TALLY GND GND for TALLY 16 BACK TALLY OUT ON 5 V 2 INC No connection OFF GND 3 NC No connection 17 PANEL DATA IN RX SERIAL DATA 4 SCK OUT TTL level 18 PANEL DATA OUT
67. 200 Function comparison chart Button and Knob Button MSU 700A MSU 750 RCP 750 751 RM B750 l T wu CAM PW v4 v v4 VF PW vs 71 v v4 v4 v4 Signal output select TES Aus TESTBARS TEST BARS TEST BARS CLOSE v4 v v4 4 STANDARD v4 v 4 4 AUTO SETUP SKIN DTL AUTO HUE v v v4 LEVEL v v 4 START BREAK v v v WHITE v v 4 v BLACK v v v4 v Camera CCU function ON OFF KNEE off v DETAIL off v LVL DEP off v GAMMA off v CHROMA off v MATRIX off v KNEE APERTURE v KNEE SAT v v MONO COLOR v COLOR CORRECT v 5600K v v v v AUTO KNEE v v v v SKIN DETAIL v v v v DETAIL GATE v v SATURATION v CONTRAST v BLACK GAMMA v v v CHARACTER v v v SD MATRIX off v SD DETAIL off v LOW KEY SAT v Scene File Control SCENE FILES v v STORE v v PICTURE MONITOR v v WAVEFORM MONITOR 4 v Camera Select PANEL ACTIVE v v PARA v v 4 EXPAND v v MASTER v SLAVE v Filter control FILTER CTRL v ND v CC v ECS Shutter select v Gamma select v Master gain select v IRIS MB ACTIVE 4 v v MASTER BLACK control knob v v v v MASTER BLACK RELATIVE v Iris Control knob v4 v4 v4 v CALL 4 v v v 84 HDC 900 950 930 Series Product Information Manual Appendix 201
68. 33 72kHz 59 94Hz 1080 60i 33 75kHz 60Hz HDC 900 950 930 Series Product Information Manual External dimensions Unit mm inches 265 10 1 2 10 16 HDVF 700A HD Electronic Viewfinder Effective Horizontal Vertical scanning Format scanning scanning lines frequency frequency 1035 59 94i 33 72kHz 59 94Hz 1035 60i 33 75kHz 60Hz Video input 1 0 Vp p 6 dB 75 ohms terminated Video input 1 0 Vp p 6 dB SMPTE DC restoration Frequency response Peaking Synchronization Connectors CAMERA connector Supplied accessories 240M 75 ohms terminated Back porch type Back porch level within 2 of peak The fluctuation in black level against 10 to 90 fluctuation in APL 0 1 to 23 MHz x2 dB 23 to 27 MHz dB 01018 dB 17 MHz Line pull range Horizontal 500 Hz or more Vertical 10 Hz or more Line hold range 500 Hz or more D sub 25 pin Studio monitor hood 1 Number plate 1 Fuse 1 Operation manual 1 Optional accessories VFH 770 Outdoor Hood 362 14 3 8 300 11 7 8 Chapter 10 Specifications 188 General Power supply Power consumption Operating temperature Storage temp Mass erature External dimensions LCD LCD DC10 5 to 17 0V supplied by the camera 10W 0 C to 45 32 F to 113 F 20 C to 60 4 F to 140 F HDVF C750W 2 0kg 4 4 Ib not including
69. 4 connectors LR 202 8 4 n f ff N ff N N 2 N 2 N 2 N 2 1 SERIAL RET INPUT Q SERIAL RET INPUT 1 4 HD SDI return video 1 2 3 and 4 input connectors BNC type Four different HD SDI analog return video input signals 720 60P may be received independently The selection of RET 1 2 3 or 4 is made by the camera s return switch The type of input signal on RET 1 2 3 and 4 may be set individually using switches on the AT board in the HDCU 900 or using the MSU 700A 750 Master Setup Unit 7 3 9 Internal Boards DPR board AUDIO PHASE control Adjusts the delay of the audio signal with respectto the video signal output from this unit 1 step 5 ms 1 frame delay 30 frames s 7 25 frames s 8 MAIN OUTPUT DPR HDC 900 950 930 Series Product Information Manual am 1 001 60 50 PsF CHU LOCK __ 2091999 v T u output connectors for pull down Switching is made using the switches on the internal FC board SERIAL OUTPUT 1 to 3 and MONI monitor connectors BNC type The 1 to 3 connectors output the signal from the camera as three HD SDI signals The MONI connector outputs the signal from the video camera mixed with skin tone gate signals and some aspect marker signal in HD SDI format Note When used in combination with the HKCU 903 mount the HKCU 903 into the second slot from the top and the HKCU 904 into the third sl
70. 5V OFF 0 0 5 V 24 No connection 25 16 9 ON OUT ON GND OFF High impedance HD video Pin TX No Signal y o Specifications 1 Y VIDEO OUT VS 1 0 Vp p Zo 75 Ohms Pg VIDEO GND GND for VIDEO PRVIDEO X OUT V 0 7 Vp p Zo 75 Ohms 4 Pg VIDEO GND GND for Pg VIDEO 5 Pg VIDEO X OUT 0 7 Vp p Zo 75 Ohms HDC 900 950 930 Series Product Information Manual Chapter 8 Connectors and Cables 171 HDC 900 950 930 Series Product Information Manual Glossary Terms and Definitions 9 1 Hardware The following are some technical terms that are frequently used in camera brochures or technical papers Adaptive DTL A simple limiter makes DTL become thick Adaptive DTL is a very effective function to keep the DTL under a certain level It was originally developed for anti aliasing Adaptive highlight control To make the picture look perceptively better the picture is divided into several zones along the bright level in which the compression rates of the smaller zones are increased while those of the larger zones are decreased The Adaptive Highlight Control has been developed for Sony s HDC BVP Series which only applys to the portion whose level is higher than the knee point Aspect ratio conversion Converting 16 9 video signals to 4 3 signals is essential because most of the applications today are 4 3 even though sometimes shot with 16 9 cameras Sony vid
71. 6 CH6ONI 7 SEL 1 SEL 1 1 SEL2 L NC IN SEL 1 H SEL 2 L WF PIX External view 8 PIX WF SEL 2 SEL 1 1 SEL 2 H WF IN SEL1 H SEL2 H PIX n Signal Specifications 9 PORTENBIN L ACTIVE 10 SW RESET IN 1 RESET 1 SEG CONT OUT G OPEN COLLECTOR 11 C 2 SEG CONT OUT X 12 C 3 STAIR CASE OUT X STAIR CASE SIGNAL 13 C 125Vpp G B 942Vdc 14 4 STAIR CASE OUT G 15 NC 16 C 17 C 8 13 1 2 Remote 8P Female 18 INC 19 45V POWER SUPPLY OUT max 500 mA 20 CH1 LED OUT TRANSISTOR 21 cH2 LED OUT OPEN COLLECTOR OUT 22 CH3 LED our ON LOW 23 CH4 LED OUT 24 CH5 LED OUT External view 25 CH6 LED OUT 26 SEQ ON IN L ON H OFF Pin Signal Specifications CH 1 2 and of WF INPUT will No be output in sequence when 1 TX VCS SERIAL DATA he pin status is LOE ON 2 TXC 27 ISEQ3B OFF CH 4 5 and 6 of WF INPUT will 3 PXG N be output in sequence when 4 RX he pin status is LOE ON 5 TXGND GNE for TX 28 C DES 6 POWER NOT USED 20 C 7 POWER NOT USED 30 C 8 SPARE 31 C CHASSIS GND CHASSIS GND 32 mS 33 C 34 C 35 C 36 GND SIGNAL GND 37 GND FRAME GND HDC 900 950 930 Series Product Information Manual Chapter 8 Connectors and Cables 168 8 14 CA 905L Large Lens Adaptor 8 14 1 Connector Input Output Signals FIBER CA 905L LEMO type 8 14 1 1 REMOTE 8P Male External view
72. 7 Flexible Configuration Extremely Flexible Configuration When ex factory The assignments between CCUs and RCPs are set as below HDC 900 CNU 700 CCU 1 Down 2 CCU2 Oupus _ VCS 700 3 CCU3 4 4 5 CCU5 MSU1 HDC 950 CCU6 For flexibility assignments can be easily changed e g CAM 1 controlles from RCP 1 amp 2 CAM 2 controlled from RCP 384 CAM 3 controlles from RCP5 and CAM 5 controlled from RCP 6 HDC 900 CNU 700 i CCU 1 Down Con 2 CCU2 Outputs VCS 700 3 4 CCU 4 5 CCU5 MEUS HDC 950 RCP 740 741 HDC 900 950 930 Series Product Information Manual Chapter 4 Control System 59 4 5 Auto Set up The HDC 900 and HDC 950 930 cameras incorporate a sophisticated Auto Setup system to adjust the video processing circuitry parameters for optimum color matching In addition to auto white balance auto black balance and auto level set up the following parameters can also be adjusted acco
73. 75 ohms HKCU 953 HD Frame Rate Converter Unit WF OUT BNC type 1 VBS R G B CCA 5 3 Connection Cable 3 meter 10 feet VBS 1 Vp p 75 ohms CCA 5 10 Connection Cable 10 meter 33 feet WF MODE 4 pin 1 RMM 301 Rack Mount Adaptor Expansion Board Supplied accessories 4 pin connector 1 Number plates 1 set Operation manual 1 Installation and maintenance manual 1 Dimensions Unit mm inches 30 1 3 16 410 16 1 4 200 7 7 8 5 7 32 9 3 8 HDC 900 950 930 Series Product Information Manual Chapter 10 Specifications 184 General Power requirements Current consumption Operating temperature Dimensions Mass For United States 100 to 120 VAC 50 60 Hz For other countries 220 to 240 VAC 50 60 Hz Max 4 0 A 09 to 45 32 F to 113 424 W x 132 x 400 D mm 16 3 4 x 5 1 4 x 15 3 4 inches 9 5 kg 20 Ib 15 oz Input and output connectors CCU 1 through 6 8 pin multi connector 1 each 10 6 CNU 700 Camera Command Network Unit RCP 1 through 6 8 pin multi connector 1 each MSU 8 pin multi connector 1 VCS 8 pin multi connector 1 AUX 1 and 2 8 pin multi connector 1 each CHARACTER BNC type 2 video 0 7 Vp p sync 0 3 Vp p REFERENCE BNC type 2 0 3 Vp p with loop through output RS232C D sub 9 pin AC IN 3 pin 1 Supplied accessories AC power cord x1 Plug holder for the AC pow
74. 902 HKCU 903 HKCU 904 2 1 1 3 Progressive and Cinema Production System PIX WF or SDI Monitor MSU 700A 750 l l l l l l l l l l l HDCU 900 HKCU 901 HKCU 902 HKCU 903 HKCU 904 1 l l l HDCU 900 HKCU 901 HKCU 902 HKCU 903 HKCU 904 HDCU 900 HKCU 901 HKCU 902 HKCU 903 HKCU 904 RCP 700 701 RCP 750 751 System format Combination of boards Slots on the front Signal input output slot Second slot from the top Third slot from the top 720 59 94P SDI RC FC LC Third slot from the top 720 59 94P SDI Film Like FC LC Third slot from the top 1080 23 98PsF SDI RC FC LC RC LC Top most slot 1080 24PsF SDI RC FC LC RC LC Top most slot 1080 25PsF SDI RC FC LC RC LC IF Top most slot 1080 29 97PsF SDI RC FC LC RC LC IF Top most slot 1080 30PsF SDI RC FC LC RC LC Top most slot 525 29 97PsF SDI RC LC IF Second slot from the top 4 When the IF 789A 789P board HKCU 901 is going to be installed confirm beforehand that the RC 86 board is installed in the second slot from the top Setting switches Switch setting System format Se04 LOCAL board C93 board Board S805 S807 S806 S603 52 53 52 5802 540 11001 720P T 720 59 94P
75. Alternative gain settings may be defined by using the configuration menu of the RM B150 Operation Panel See Settings on the RM Configuration Menu D MENU operation block 00000000 DISPLAY SELECT 559 Menu display 8 columns In normal operation mode the display illuminates to show the shutter speed ECS frequency or S EVS value only when the shutter control block is operated When you select the RM Configuration menu the display shows menu items set values and various information depending on operations RM Configuration switch Selects the RM Configuration menu When this switch is pushed in the Y direction the Basic is selected HDC 900 950 930 Series Product Information Manual When this switch is pushed in the Y direction while holding the CANCEL ENTER switch at ENTER the Detail menu is selected The RM Configuration menu is switched off by pushing this switch in the A direction 3 DISPLAY switch For control of the camera s menu ON Shows the character display function of the camera OFF Shows the character display function of the camera MENU Sets the camera into the camera menu mode CANCEL ENTER switch To register or cancel a menu item or value selection 5 Menu select knob rotary encoder In normal operation the shutter speed ECS frequency or S EVS value can be adju
76. CASE OUT G for STAIR CASE 15 RECALL8 G B LOW ACTIVE 4 Stair Case signal External view No Signal Specifications 1 CCU SERIAL DATA 2 ITX 3 RCP CNU BVP MSU VCS 4 RX SERIAL DATA 5 TX GND GND for TX 6 POWER OUT RCP POWER 30 V 7 POWER OUT for POWER 8 SPARE 8 3 1 8 INTERCOM 5 pin Female 5 1 Og 20 O External view No 1 INCOM T IN Y Signal Specifications 20 dBu 2 INCOM T IN X CARBON MIC 40 dBu ECM MIC 60 dBu DYNAMIC MIC 3 INCOM T IN G GND for INCOM 4 INCOM R OUT X Max 12 dBu No connection 0 dBu 0 775 Vrms 8 3 2 Connection Connectors When connecting cables to each connector of the connector panel during installation or service connect the following connectors or equivalent to the tip Connector HDCU 950 REFERENCE IN PIX OUT WF OUT SYNC OUT PROMPTER IN HKCU 951 Y G OUT Chapter 8 Connectors and Cables Connector cable 1 569 370 12 PLUG BNC 159 B Y B OUT R Y R OUT VBS OUT Connector Connector cable HKCU 953 FRAME REFERENCE IN FRAME REFERENCE OUT REMTOE D sub 15 pin Female INTERCOM TALLY PGM D sub 25 pin Female WF MODE 4 pin Female RCP CNU 8 pin 1 506 582 11 D sub 15 pin male or JAE DA CI J10 equivalent D sub 25 pin male JAE DA 25PF N equivalent
77. CHARACTER System information display function When this button is lit ON the various information on the entire system is displayed on the monitor connected to the CHARACTER connector of the CNU 700 The display contents can be changed through a menu operation Chapter 7 Location and Function of Parts and Controls 107 3 EL display touch panel Displays the menu selected with the MODE buttons and permits the displayed items to be r adjusted 39 2002 g SCENE FILES STORE Scene file control block IC card insertion block SCENE FILES buttons While the STORE button is flashing When you press one of these buttons the current setting data is stored as a file of the corresponding number When the STORE button is dark The stored data can be retrieved by pressing and lighting up the button of the desired number Press the lit button to turn it dark and resume the previous status 2 STORE button To store a scene file first press this button so access CI that the button starts flashing then press the SCENE FILES button of the desired number When file registration is completed the STORE IC card slot button goes dark To cancel the registration press the flashing button again before pressing the SCENE FILES button The STORE button Insert an IC card which conforms to PCMCIA to store reference files and scene files of the video camera or CCU SRAM CARD ONLY
78. G OUTPUT Connector cable 1 564 742 11 PLUG BNC or B B cable assembly 1 5 m optional Connector HDCU 900 REFERENCE IN PIX OUT WF OUT SYNC OUT CHARACTER DIGITAL AUDIO PROMPTER IN HDC 900 950 930 Series Product Information Manual B Y B OUTPUT R Y R OUTPUT VBS OUT 1 2 PIX OUT WF OUT SYNC OUT HKCU 902 RET INPUT 1 4 Y G OUTPUT 1 2 PB B OUTPUT 1 2 Chapter 8 Connectors and Cables 156 Connector Connector cable PR R OUTPUT 1 2 PIX OUT SYNC OUT HKCU 903 SYNC OUT FRAME REFERENCE IN FRAME REFERENCE OUT HKCU 904 SYNC OUT BNC HDCU 900 SERIAL RET INPUT 1 4 SERIAL OUTPUT 1 3 MONI equivalent SERIAL RET INPUT 1 4 SERIAL OUTPUT 1 4 1 569 370 12 PLUG BNC or BELDEN8281 Cable or HKCU 903 SERIAL RET INPUT 1 4 SERIAL OUTPUT 1 3 MONI HKCU 904 SERIAL RET INPUT 1 4 SERIAL OUTPUT 1 3 BNC AUDIO OUTPUT CH 1 CH 2 1 508 083 00 XLP 3 pin female 3 pin Male or CANNON XLR 3 11C 8 3 HDCU 950 HD Camera Control Unit 8 3 1 Connector Input Output Signals 8 3 1 1 BNC connector HDCU 950 1125 digital signal RET 1 to 3 IN BNC Conforms to 50048 1 485 Gbps 1 4835 Gbps SMPTE 292M SERIAL OUT 1 to 2 MONI BNC Conforms to 5004 0 8 V p p 75 Ohms 1 485 Gbps 1 4835 Gbps SMPTE 292M REFERENCE IN BNC 0 3 V ternary SYNC 75 Ohms Or black burst signal 0 286 V p p 75 Ohms SD 525 625 digital signal RET 1 to 3 IN BNC Compon
79. Information Manual Optical Fiber Connector and Cable 5 1 Optical Fiber Overview In order to secure the High Definition signal transmission between the HDCU 900 950 to an HDC 900 or HDC 950 930 with a much longer distance compared with the conventional Triax cable the SMPTE standard optical fiber connector and cable have been adopted The connecting cable uses two single mode optical fiber lines two control lines and two power lines to carry digitized video audio control signals and power to the camera As a result an extremely high quality all digital bi directional video 5 2 Cleaning of the Connector and Cable It is recommended to clean the optical contact portions mentioned below before connecting this unit to the camera control unit CCU connector of this unit Camera connector of the camera control unit Optical Electrical cable It is also necessary to clean the optical contact portions mentioned below before using the HDC 950 930 with the large lens adaptor CA 905L CA cable of a large lens adaptor CCU connector of a large lens adaptor Follow the procedures below for cleaning Tools Required Alignment sleeve remover HC 001 for female connector Sony P N J 6480 010 A Note Insert the shorter nose end when removing installing the alignment sleeve Grasp the handle not the shock absorber Shock absorber portion Handle T ee Insert the shorter nose end Cott
80. Information Manual Chapter 4 Control System 61 Figure 4 11 Remote control of the RCP assignment without an MSU 700A 750 INI to 5 PIXI video in to 17 WFI video in NTSC or PAL OUTI to 5 PIX1 video out t PIX Pon OUT13 to 17 WFI video out wi Router DVS V3232 etc Primary Station PU WF Monitor for ROP uu De e Remote Assign S BUS BNC Panel 5 i PIX Video BNC Camera name display onto CNU Serial Tally Transfer Sony uses a PC as the primary control station of a Decodes S Bus serial tally signal and forward to digital router Each camera can be given name with HDCU this primary PC and these names are then automatically shown on the CNU character display A CNU 700 requires a BKP 7933 option for S Bus functionality Figure 4 12 Current tally and S Bus tally S BUS Tally Current Tally RS 422A S BUS Tally Decoder CCA 5 cable HDCU 4 HDCU HDC 900 950 930 Series Product Information Manual Chapter 4 Control System 62 HDC 900 950 930 Series Product
81. ON 3 The MSU 700A 750 EL display now shows a representation of the Multi Matrix as it would appear on a vectorscope You can select the desired color phase that you want to adjust 4 After selection of the color phase its hue and Photo 3 2 Multi Matrix Vectorscope saturation can be adjusted Figure 3 1 Multi Matrix B Y VECTOR PHAGE Normal VECTOR PHASE ON HDC 900 950 930 Series Product Information Manual Chapter 3 Benefit of Sony ADSP Advanced Digital Signal Processing 43 J 2 Auto Knee When the Auto Knee button on the MSU or RCP panel is pressed it optimizes the knee point and knee slope Figure 3 2 Auto Knee curve image Input signal level white clip 1 es point limit for best reproduction of the high lights The Adaptive Highlight control function can also be used in conjunction with Auto Knee Output signal level auto knee circuit 3 Gamma New 12 bit A D conversion more precisely defines the required gamma characteristic by using a gamma curve created from 48 segments This is in comparison with the 32 segments in the previous camera range 4 Black Gamma Black Gamma allows control of the linear part of the gamma characteristic providing adjustment of the shadow areas of the picture during shooting Also the Black Gamma range can be adjusted depending upon the situation 5 Black Clip Improvements in the Black Clip cir
82. Output Signals HDC 900 Connector Layout HDC 900 950 930 Series Product Information Manual e 277 o eto 1 gt neon 0 o o e o So one Chapter 8 Connectors and Cables 143 HKC T950 Connector Layout Input Output Signals CCU connector Based upon BTA S 004A 005A 006A 1 485 Gbps serial Output Signals EARPHONE OUT HDC 950 930 EARPHONE mini jack External view RET CONTROL 6P FEMALE TEST OUT No Signal 1 0 Specifications BNC type 75 Ohms 1 0 V p p 1 INCOM 1 IN Zi gt 10 kOhms MIC ON OFF ON GND PROMPTER OUT OFF OPEN BINDS IO V pa 2 INCOM 2 IN Zi2 10 kOhms MIC ON OFF ON GND HD SERIAL DIGITAL OUT OFF OPEN Based upon BTA S004A 3 GND BNC type 75 Ohms 0 8 V p p 1 485 Gbps 4 NC No connection VIDEO OUT HKC T950 5 RET 1 ON OFF Zi gt
83. PORT 19 04 INPUT OUTPUT PORT 20 EXT I O 07 INPUT OUTPUT PORT 21 12 INPUT OUTPUT PORT 22 EXT 0 15 INPUT OUTPUT PORT 23 EXT I O 20 INPUT OUTPUT PORT 24 EXT I O 23 INPUT OUTPUT PORT HDC 900 950 930 Series Product Information Manual Darlington transistor drive One port max 5 mA VEXT 1 5 V RETX 1 1 kOhms All ports total max 60 mA Chapter 8 Connectors and Cables 163 8 6 2 Cable Wiring CCA 5 Cable Black 77 White White v Orange Brown Red White Red Brown 8 pin connector Male Wiring side 8 6 3 Connection Connector Connections made with the connector panels during installation or service should be made with the connectors complete cable assemblies specified in the following list or equivalent parts Connection connector cable Plug 8 pin Male Sony part number 1 766 848 11 Connector name REMOTE AUX 8 pin REMOTE CCU CNU 8 pin 8 7 MSU 750 Master Setup Unit 8 7 1 Gonnector Panel Brown 8 pin connector Male Wiring side CCA 5 cable assembly Option 5 3 3 m CCA 5 10 10 m Plug D SUB 50 pin Male Sony part number 1 566 358 11 or JAE DDU 50PF FO or equivalent PORT 50 pin Q POWER switch DAC IN connector
84. Product Information Manual Chapter 6 A Quick Lesson on Camera Settings 69 1 Turn on the power to the MSU 700A 750 while holding PARA PANELACTIVE and camera select buttons pressed PARA button MSU 700A rn PANEL ACTIVE LH 2 3 4 5 6 T 8 9 10 EXPAND Camera select button 1 PANEL ACTIVE button PARA button MSU 750 PANEL ACTIVE button 1288 __ Camera select 0 0 0 UJ button 1 The numeric keys appear on the display 2 Press the 0 3 5 9 of the numeric keys to enter 0359 in the field for entering the security code hen press OK The Engineer Protection display now appears Engineer Protection Protection Code Enable Code Delete 3 To delete the security code press Code Delete To temporally disable the security code press Code Enable to change it from inverse video to unhighlighted display Once you press it again to return it to inverse video the security code is enabled 4 As the message Code Delete OK is displayed if you press Code Delete in step 3 press OK to return to the Engineer Protection display 5 Press Exit Note At the factory the unit is set in a mode in which no security code is used 6 3 2 Setting the Security Status You can limit the control fun
85. SDI NOT 60 Intr 720 59 94P SDI Film Like NOT 48 PsF 1001 ii 720P 1080 23 98PsF SDI 48 PsF 1001 ji 1080 24PsF SDI 48 PsF 1000 b 1080 25PsF SDI NOT 50 PsF 1000 2 1080 29 97PsF SDI NOT 60 PsF 1001 5 1080 30PsF SDI NOT 60 PsF 1000 i 525 29 97PsF SDI NOT 60 PsF 1001 525 HDC 900 950 930 Series Product Information Manual Chapter 2 Total System 30 Figure 2 7 1 7 Example of connection using HDCU 900 7 System format 720 59 94P SDI Required boards Slot to be installed Slots the front ihe raai Remarks Top most slot DPR 163 SDI 54A HDCU 900 Second slot from the top RC 86 DIF 102 HDCU 900 Third slot from the top LC 41 SDI 54C HKCU 904 SERIAL RET INPUT ios HD SDI RETURN VIDEO SIGNAL S o 4 REFERENCE IN REFERENCE SIGNAL SYNC OUT 720 59 94P SYNC SIGNAL HDC 900 PROMPTERKN PROMPTER SIGNAL SERIAL OUTPUT 1 to 3 AA Te e x 2 9 e 090 9 c le le o o S e 5 eC Jo HDCU 900 ol SERIAL INPUT 1104 HDC 900 SYNC OUT SERIAL OUTPUT 1 to 3 HD SDI RETURN VIDEO SIGNAL 720 59 94P tri level SYNC SIGNAL HD SDI SIGNAL eo e EAS 9 9 e e e Je e
86. Series camera system Sony has adopted the philosophy that all technical controls are important and that remote access to virtually all controls on a single control panel would bring higher operational efficiency This led to the introduction of the MSU 700A 750 Master Set up Unit To avoid undue complication of the ergonomics of the panel layout that would result from such extensive access a novel Electro Luminescent EL sub panel forms an integral part of the overall MSU 700A 750 control panel Photo 4 1 This menu driven touch screen allows remote pre programmed and logical access to dozens of technical adjustments Perhaps no other system can HDC 900 950 930 Series Product Information Manual High speed communication of digital control commands A considerably augmented Master Set up Unit the MSU 700A 750 The introduction of a powerful technical nerve center concept the camera Command Network Units CNU 700 and CNU 500 Electronically assignable camera remote control panels for use with these camera command network units better illustrate the enhanced degree of centralized control than that relating to access to the many adjustments required for the image enhancement system Depending upon the creative desires of the program director the MSU 700A 750 allows highly flexible finger tip access to all critical adjustments including skin detail control The main features of the MSU 700A 750 are given below 1 Eas
87. Shading dd d V Auto B Shading d ud 4 Lens Adjusting R G B v v V Mod Saw R G B Master v v D Shad Comp on v v off V Mod Saw Off v v Auto lris Pattern v v v v HDC 900 950 930 Series Product Information Manual Appendix 195 MSU 700A MSU 750 RCP 750 751 RM B750 Sub Menu Control Item Menu Direct Menu Direct menu Direct menu Direct Button Button Button Button Level v v v v APL Ratio v v v v Iris Gain v v v v SD Adjusting Gamma HD M Gamma v v v HD BIk Gamma v v v SD M Gamma v v v H Interp A B C D E v v V Interp A B C D E v v Detail Detail 1 SD Level v v v v SD Limiter v v v v SD Crispening v v v v HD Detail Off v v v v v SD Detail off v v v v v Detail 2 SD H V Ratio v v v v SD Frequency v v v v HD Detail Off v v v v v SD Detail off v v v v v Detail 3 SD W Limiter v v v v SD B Limiter v v v v HD Detail Off v v v v v SD Detail off v v v v v pue 7 Coring v v v Level v v v Comb v v v Aspect Aspect Select v v 16 9 Squeeze v v Letter Box v v 4 3 Crop v v Letter size v v Crop Posi v v HDC 900 950 930 Series Product Information Manual Appendix 196 Function comparison chart Gonfiguration
88. TX SERIAL DATA 5 INC No connection 19 VF UNREG 412 V 410 5 V to 6 INC No connection 17 0 V 7 NC No connection 20 GND GND for UNREG 8 G TALLY OUT 5 V OFF GND TRACKER FEMALE 9 INC No connection 10 INC No connection 11 NC No connection 12 Y VIDEO OUT 1 0 V p p Zo 75 Ohms 13 VIDEO GND for VIDEO 14 Pb VIDEO OUT 0 35 V p p Zo 75 Ohms 15 Pr VIDEO OUT x0 35 V p p Zo 75 Ohms 16 NC No connection External view 17 R TALLY OUT ON 5V OFF GND No Signal Specifications 18 NC No connection 1 TRK R X OUT TRACKER 19 UNREG GND for UNREG RECEIVE GND 0 dBu unbalanced 20 UNREG OUT 10 5 V to 17 V 2 for TRACKER R EXT I O 20 HDC 950 930 3 GND GND for UNREG UNREG TALLY TALLY 4 R TALLY OUT 5 V Open Collector OFF 0 V Open Collector 5 TRK PGM G _ GND for PGM 6 UNREG OUT 12 V 10 5 to 17 0 V External view 7 IRKT X TRACKER TALK 0 dBu _20 dBu No Signal 1 0 Specifications High impedance 1 YVIDEO x OUT 10 V p p Zo 75 balanced Ohms 8 TRKT Y IN TRACKER TALK 2 Y VIDEO G GND for Y VIDEO 0 dBu 20 dBu High impedance PROMPTER X OUT 1 0 Vp p Zo 75 balanced Chis 9 TRKT G GND for TRACKER 4 PROMPTER G GND for T PROMPTER HDC 900 950 930 Series Product Information Manual Chapter 8 Connectors and Cables 148
89. The LEDs will light to show the status of the connected camera 60 50 48 One of these LEDs that corresponds to the field frequency setting on the camera lights PsF The LED is lit when the camera is operating in Progressive mode 540P The LED is lit when the camera is operating in 540 60P mode not used at present Operation mode of the camera is set from the camera control unit Q CHARACTER switch To page the character displays being imposed to the monitor output This switch will return to its original position when you release it Press it toward FF to go to the next page or toward REW to return to the previous page When you hold the button pressed the display changes continuously 7 4 11 Internal Switches and Internal Boards RC Board Q POWER indicator SD signal format indicators Down converter remote local switch Down converter mode switch Edge crop mode setting switch Edge crop position setting switch HDC 900 950 930 Series Product Information Manual POWER indicator The LED is lit when the power voltage inside the board is normal SD signal format indicators Either of the indicators lights to show the selected SD signal format 525 525 59 94i NTSC format 625 625 50i PAL format Down converter remote local switch To specify whether the down converter is remotely set or locally set REM remote To set from the MSU 700A 750 Master Setup Unit LOCAL
90. The selection of RET 1 2 3 or 415 made by the camera s return switch The type of input signal on RET 1 2 3 and 4 may be set individually using switches on the AT board in the HDCU 900 or using the MSU 700A 750 Master Setup Unit HDC 900 950 930 Series Product Information Manual SYNC OUT connectors FRAME REFERENCE IN OUT connectors SERIAL OUTPUT 1 to 3 and MONI connectors des 2 2 _ ff N N N N 2 N 2 N 2 FRAME REFERENCE L sERIALOUTPUT SYNC OUT HD SD sync signal output connectors BNC type The left connector outputs a sync signal of the same format as that of the input output block in the above slot The right connector outputs the HD tri level sync signal of the same format as that of the SERIAL OUTPUT 1 to 3 connectors Chapter 7 Location and Function of Parts and Controls 92 FRAME REFERECE IN OUT connectors BNC type The IN connector is used to receive an HD tri level reference sync signal or SD reference sync signal black burst signal for frame sequence lock between camera control units In this case the signal supplied to the IN signal is output from the OUT connector as is When this unit is used as the master unit these connectors can be used as the frame sync pulse 7 3 8 HKCU 904 Line Converter Unit The optional HKCU 904 is to be installed in the HDCU 900 expansion slot or in place of the SD signal input output block SERIAL RET INPUT 1
91. a 525 line video signal the CNU 700 for other countries supplies a 625 line video signal You can select whether to add a sync signal to the output signal with switch S7 SYNC ON OFF on the AT board Refer to the system manual for details on the board switch settings REFERENCE reference signal input loop connectors BNC type Accepts a reference signal VS BS etc The signal output from the CHARACTER connector is synchronized with the input signal RS 232C 1 through 3 connectors D sub 9 pin Used for RS 232C interfaces The function of these connectors depends on whether or not an optional BKP 7930 System Expansion Board is installed in the CNU 700 as shown below Connector No BKP 7930 With BKP 7930 No installed installed 1 Reserved for ISR system 2 Reserved for RS 232C interface 3 Reserved for RS 232C system Chapter 7 Location and Function of Parts and Controls 102 IN AC power input connector Connect to an AC power source using the supplied AC power cord The power cord can be fixed to the CNU 700 using the supplied plug holder Optional board insertion section Used for attaching the connector panel of an optional BKP 7930 7933 When you attach the BKP 7930 to the CNU 700 up to 12 cameras and remote control panels can be controlled BKP 7933 enables the S bus functionality 1 6 CNU 500 Camera Command Network Unit 7 6 1 Front and Rear Panels Front
92. arranged above and below the viewfinder such as a tally lamp battery warning indicator and an indicator to tell that one or more settings are other than standard This makes it simple to check the status of the camera 4 Zebra pattern A stripe pattern displayed on the viewfinder screen which indicates the portions where the video level is above about 70 or 100 Used to check the video level of the subject Optical digital transmission The camera uses electro optical composite cable for 1 5 gigabit digital optical transmission between the camera and a camera control unit High resolution 2 type multi format viewfinder HDC 950 930 only Along with developing the HDC 950 a 2 type multi format viewfinder HDVF 20A is provided Prevention of electrical shock When the power connection is unsafe the power supply from the HDCU Camera Control Unit will be shut off Chapter 2 Total System 17 Wide variety of input and output connectors Optical connector HD SDI output connector DC power supply input connector Prompter signal output connector RCP connector VTR connector e Lens connector 2 3 Camera Control Unit The HDCU 900 Camera Control Unit carries out signal processing and offers an interface for external equipment By incorporating a optical digital transmission and digital control system as well as multiple inputs and outputs the HDCU 900 provides maximum camera performance combined with f
93. buttons to select the corresponding ND filter Chapter 7 Location and Function of Parts and Controls 109 Examples 1 Clear 2 1 4 ND 3 1 8 ND 4 1 16 ND 5 1 64 ND When the FILTER CTRL button is not lit the button corresponding to the filter selected at the video camera lights CC color temperature conversion filter select buttons While the FILTER CTRL button is lit press and light up one of these buttons to select the corresponding CC filter Examples A Cross filter B 3200K clear C 4300K D 6300K E 8000K When the FILTER CTRL button is not lit the button corresponding to the filter selected at the video camera lights ECS Shutter control block left Gamma control block center Master gain control block right EJ Cong pa I ECS SHUT TER GAI IMA GAIN ECS Extended Clear Scan button Press and light up the button to set the video camera to ECS mode Press again and turn off the button to set the video camera to Shutter mode 2 ON button Turns on and off the ECS function when the ECS button is lit or the shutter function when the ECS button is not lit The function is ON when this button is lit 8 ECS frequency Shutter speed select buttons and display window In ECS mode when the ECS button is lit The selected ECS frequency is displayed in the window Press to select the desired scan frequency The frequency increases when the A up button
94. cable for open or short circuits An alarm is given if a fault is found and some appropriate precautionary actions taken case by case An additional safety feature is that a low voltage is initially supplied from the HDCU 900 optical fiber connector when the unit is switched on Only when the system check has verified that an appropriate camera is connected is the normal operating voltage output Locking to External Reference Signals The HDCU 900 950 can be locked to an external reference signal Either a HD tri level sync signal according to SMPTE 240M or an SD black burst signal can be used as the reference signal RCP 750 751 Remote Control Panels Two types of RCP 750 Series Remote Control Panels are also available providing a range of control functions from the basic to very sophisticated for operational adjustments of an HDC 900 950 930 Each type is available with either a joystick or dial type iris control RM B750 Remote Control Unit The RM B750 Remote Control Unit has been designed to establish a highly mobile and fully controllable camera system in the field by integrating control capability equivalent to a Master Set up Unit into a compact unit powered from the device to be controlled HDC 900 950 930 Series Product Information Manual The RM B750 can be connected directly to the any HDC 900 Series camera attached to the half rack HDCU 950 Camera Control Unit or connected to an HDW 250 portable VTR used with the
95. each set of preferences can then be used to initialize individual or groups of cameras Multi Matrix This function enables a particular color in a scene to be selected and its hue and saturation changed Adaptive Highlight Control Auto Knee mode The Sony ADSP system intelligently monitors the brightness of all areas of the picture and automatically adapts the knee point slope for optimum reproduction at that particular scene location within the picture A typical example is shooting an interior scene which includes a sunlit exterior seen through a window Three channel Skin Tone Detail Correction The Skin Tone Detail Correction controls the detail level of those objects in a scene with specific color tones The HDC 900 950 930 allows detail to be set independently for each of three separate color ranges These colors are not limited to skin tones but can be set for any color Detail may be increased or decreased relative to the normal level Knee Saturation Function This function works similar to Sony s TruEye processor which is one of the most innovative features that Sony ADSP allows This function makes it possible to reproduce very natural colors of high contrast scene content When knee correction is individually applied to the RGB channels it can lead to color distortion in highlight areas for example skin tones can tend to look yellow Knee Saturation processing automatically retains accurate color in these highlig
96. flashing then press the SCENE FILES button of the desired number When file registration is completed the STORE button goes dark To cancel the registration press the flashing button again before pressing the SCENE FILES button The STORE button goes dark Monitor output select buttons Press to select the output signal from the WF2 and PIX2 OUTPUT connectors of CCU 8 8 0 2364 Um es WF PIX MONITOR Output signal select buttons After selecting the output connector of the CCU by pressing either the WF or PIX button press to light the button for the signal to be output The signal corresponding to the lit button is output R G B Select the R signal G signal or B signal The signals can be selected either independently or in combination When any of these buttons is pressed the SEQ for WF only and ENC circuits are turned off SEQ sequence Effective only for the WF2 OUTPUT connector When this button is pressed the R G B circuits are turned off and the SEQ signal is output You can monitor the waveforms of the three R G and B signals in sequence on a waveform monitor ENC encode When this button is pressed the R G B and SEQ circuits are turned off and the ENC signal is output Output connector select buttons WF Press to light the button when switching the output signal from the WF2 OUTPUT connector with the output signal select buttons Press the button again
97. for manual iris adjustment O IRIS control When the AUTO button is not lit you can adjust the iris manually by turning the control When the AUTO button is lit the reference value for automatic iris adjustment can be set in a range of 1f with this control Chapter 7 Location and Function of Parts and Controls 122 Iris gauge AUTO button The white line on the gauge provides a click position Press and light the button to automatically adjust the for the IRIS control Turn the gauge to setthelinetothe iris according to the amount of input light When this most frequently used iris position and it can be used button is lit the reference value for automatic iris as the reference for manual iris adjustment The gauge adjustment can be set in a range of 1f with the iris rotates infinitely in either direction When no click control If you press the button when lit it goes dark position is required set the line outside the rotation and manual iris adjustment is enabled range of the IRIS control 7 10 4 Connector Panel Q CCU CNU REMOTE connector AUX REMOTE connector EXT connector CCU CNU REMOTE camera control unit camera command network unit remote connector 8 pin Connect to the RCP CNU connector of a camera control unit or the RCP connector of a camera command network unit AUX REMOTE auxiliary remote connector 8 pin Connect to the RCP 700 701 EXT I O external input output c
98. from lighting Attach a supplied number plate 0 through 9 to display the camera number Safety lock Locks the side panelto prevent accidental opening To open the side panel loosen the side panel lock screws slide the safety lock toward the lens and open the panel The side panel locks automatically when closed HDC 900 950 930 Series Product Information Manual Cable clamp CCU connector DC IN connector AC OUT connector Q Camera number plate Attach a light gray number plate supplied to display the camera number Side panel lock screws These screws secure the side panel Turn clockwise until tight to lock the panel Lens lock and knob These lock the lens To attach or remove a lens turn the knob counterclockwise until the lens lock is horizontal To secure the lens turn the knob clockwise until the lens lock is vertical Note To attach a large lens remove the pin from the bayonet mount of the lens Chapter 7 Location and Function of Parts and Controls 77 Cable clamp Used to secure the fiber optic cable The clamp is designed for the FC2 PD50 and FC2 PD250 Accessory bracket Used to secure optional accessories such as the BKP 7911 7912 Script Holder or Focus Zoom Demand For more information on attaching an accessory see the accessory s operation manual Q AUDIO IN CH 1 and CH 2 connectors XLR 3 pin Used to input microphone or line signals AUDIO IN switch Set this s
99. heads and HDCUs connected to the CNU 700 and CNU 500 can be displayed on a monitor via the CHARACTER connector This includes e Camera settings e System connection information Results of Auto set up e Self diagnostics information 4 Emergency feature In the event of a problem with the CNU 700 and CNU 500 turning their internal OPERATION switch to the EMERGENCY position allows control signals from the remote control panel to be directly connected to the camera head In this way program production cancontinue by bypassing the CNU CNU 700 CNU 500 Up to 6 cameras Up to 6 cameras Number of Cameras Up to 12 cameras with BKP 7930 fitted No connectable Up to 96 cameras with multi CNU No connected Up to 6 RCPs Up to 6 RCPs Number of RCPs connectable Up to 12 RCPs with BKP 7930 fitted No Up to 96 RCPs with multi CNU No connected Multi MSU connectable Yes No Multi VCS connectable Yes No Other controller connectable Yes Available with optional AUX connector Programable with remote No control RS 232C connector for ISR Yes Yes RS 232C connector for One No switcher etc Two when BKP 7930 fitted No REF video in Yes Yes Character out 2 1 Assignment between RCP and CHU CCU Free Fixed HDC 900 950 930 Series Product Information Manual Chapter 4 Control System 51 CNU 700 CNU 500 Power supply to RCP Yes No But RCP can be powered from CCU He
100. hood HDVF C700W 2 2kg 4 9 Ib not including hood See below 6 type color TFT screen Image display area dimensions 132 x 74mm 5 1 4 x 3 in 16 9 aspect ratio Tally lamps display area dimensions 132 x 4mm 5 1 4 x 3 16 in the upper and the lower part 10 17 HDVF C700W C750W HD Electronic Viewfinder Performance Brightness 300cd m2 Resolution 500 or more lines Supported formats Effective Horizontal Vertical scanning Format scanning scanning lines frequency frequency 1080 23 98PsF 26 97kHz 47 95Hz 1080 24PsF 27kHz 48Hz 1080 25PsF 28 13kHz 50Hz 1080 29 97PsF 33 72kHz 59 94Hz 1080 30PsF 33 75kHz 60Hz 1080 50i 28 13kHz 50Hz HDC 900 950 930 Series Product Information Manual External dimensions Unit mm inches HDVF C750W 259 10 1 4 Effective Horizontal Vertical scanning Format scanning scanning lines frequency frequency 1080 59 94i 33 72kHz 59 94Hz 1080 60i 33 75kHz 60Hz 1035 59 94i 33 72kHz 59 94Hz 1035 60i 33 75kHz 60Hz Color temperature 6500K Indicators R TALLY G TALLY BATT Input signals Pb Pr 0 7Vp p asynchronous 75 W terminated Ys 1 0Vp p synchronous 75 W terminated Connectors CAMERA connector HDVF C750W Round type 20 pin HDVF C700W D sub 25 pin Supplied accessories Monitor hood 1 Number plate 1 Operation manual 1 The followings are supplied with the HDVF C750W only V shaped shoe attac
101. input as defined by SMPTE 240M Furthermore the HKCU 903 Frame Converter Boards provide 2 3 pull down to change the picture format between 24P and progressive 30 frames And lastly the HKCU 904 Line Converter Board has the capability to convert 1080 line pictures into 720 line pictures and provides four sets of HD SDI outputs and V F return inputs The HKCU 951 and HKCU 953 used with the portable HDCU 950 CCU provide equivalent functions to the above HKCU 901 and HKCU 903 720 60 HD Production Format 10801601 1080 50 1080 30P 1080 25P 1080 24P 420209 only 2 Head Capture 1080 60i 1080 50i 1080 30P 1080 25P 1080 24P 1080 60i 540 60P HDCU 900 950 Output Format HD SDI Reserved slot 1080 60i 1080 50i 1080 30P 1080 25P 1080 24P 1080 60 540 60P Down converted SDI ve S e 480 60i 576 50i 480 30P 576 25P 480 60i 480 60i 480 60i 22 2 Frame No 1080 60 No No Converter Optional Bee de his No No No No 720 60P 720 60P Optional HKCU 901 951 SD m 2 NTSC PAL NTSC PAL No No No Monitoring quality only Entries printed in blue are recommended choices HDC 930 only supports interlace formats and 1080 60i 1080 50 HDC 900 950 930 Series Product Information Manual Chapter 1 Introduction 11 Standard Definition Origination
102. lights when there is a short circuit between a power supply line and the sheath of the optical fiber cable or when the two power supply lines are shorted When this indicator lights the power supply to the camera is shut off Q POWER switch and indicators The switch turns on or off the power to the entire System consisting of the HDCU 950 a video camera an RCP 700 series Remote Control Panel connected via the REMOTE connector etc The MAIN and CAM camera indicators light when the power is turned on Chapter 7 Location and Function of Parts and Controls 94 If the CAM PW button on the Remote Control Panel or Master Setup Unit is pressed only power to the camera is turned off and the CAM indicator alone goes dark Note Standby power is kept supplied even when the POWER switch is set to off The main power switch is provided on the power unit behind the front cover If you open the front cover and set the main power switch to off power cannot be turned on with the POWER switch on the front panel MIC PGM microphone program audio switch ON To turn on the headset microphone OFF To turn off the headset microphone PGM program To output the program audio to the intercom connector 7 4 2 Rear Panel Intercom volume control To adjust the intercom input level Q Intercom line selector Select the intercom line to which the intercom signal is to be connected PROD producer Producer line PRIV private T
103. off SSISIS S S S SA SA SA A SA A SA SA SA S ASA SA SA SAC SA SASA S S S S S SISISISISISISISISISISISISIS SSISIS S S S SA SA SA JA SA A SA SA SASA A SA SA SA SA SA SASA S S S S S SISISISISISISISISISISISISIS SISISINS SIS Note MSU V1 20 RCP V1 01 RM B750 V1 00 1 Available w VTR function SW selectable when in the ENG Mode in the menu 2 Available w Black knob selected from the menu HDC 900 950 930 Series Product Information Manual Appendix 193 Function comparison chart File MSU 700A MSU 750 RCP 750 751 RM B750 Menu Sub Menu Control Item i i i i Menu Button Menu Button Menu Button Menu Button Reference Ref Store v v v v Ref Transfer CAM CARD v v v MS v MS CARD CA v v v MS v MS CARD CAMs v v CAM CAMs v v Adjusting Paint Menu Items v v Scene File Scene Transfer CAM CARD v v v MS v MS CARD CA v v v MS v MS CARD CAMs v v CAM CAMs v v Delete v v Adjusting Paint Menu Items v v Lens File Lens Store v v Auto White v v v v v v Lens Select Select File v v Change Name v v Adjusting Lens Adjusting Items v v OHB File OHB Store v v v v Auto W Shading v v Auto B Shading v v Auto White v v v v v v Auto Black v v v v v v Adjusting Black Shading v v White Shading v v Black Set v v OHB Matrix v v
104. off the unnecessary high frequency that might cause beat interference caused by the relation between the number of pixels and the pattern of the shooting subject during the sampling Out of green The older version cameras create V DTL from the G channel and add it to each channel to carry out image enhancement This method helps use a less number of delay lines but does not perform well in some cases such as a deep red flower picture Some cameras create V DTL from R G channels Chapter 9 Glossary Terms and Definitions 174 Pedestal Master black It is the black level If the pedestal level is too high the whole picture will become a little bit white Prism block for color separation A prism block that breaks down sunlight into red green and blue the three element colors for a video image is an essential component for a CCD camera Skin tone DTL Skin tone DTL is a function that changes the DTL value by color It was originally designed to make an announcer s face more lustrous by reducing the DTL on his her face It is also a useful function for intentionally emphasizing certain scenes such as the surface of a lawn System conversion In addition to HD output NTSC and PAL outputs are also necessary for HD cameras For that the CCU uses a down converter 9 2 Software Software plays an important role in cameras today It is not too strong to say that a camera without software is just like a body without a brain
105. on the display of the menu operation block for a few seconds In S EVS mode the S EVS value is adjusted with the menu select knob rotary encoder SHUTTER button amber illumination Press and illuminate the button to set the camera to Shutter mode The current shutter speed is shown on the display of the menu operation block for a few seconds In Shutter mode the shutter speed is adjusted with the menu select knob rotary encoder HDC 900 950 930 Series Product Information Manual Chapter 7 Location and Function of Parts and Controls 127 Notes When you change the shutter speed ECS frequency or S EVS value in the corresponding mode the menu block display shows it for a few seconds When this unit is in RM Configuration Menu mode the shutter speed ECS frequency and S EVS value cannot be adjusted Filter control block o gt cc gt o FILTER ND ND filter indicators The indicator corresponding to the currently selected ND filter illuminates ND ND filter select button Press and illuminate the button when it is not lit Filter camera control mode to enable filter selection from this unit When this button is illuminated the ND filter cyclically changes in the sequence of 1 gt 2 gt gt 4 5 gt 1 gt each time it is pressed 3 CC color temperature conversion filter indicators The indicator that corresponds to the currently
106. panel Q POWER switch and indicator CNU number indicator 000000 Rear panel MSU connector CCU 1 through 6 connectors CCU1 CCU2 CCU3 CCU4 CCU5 CCU6 QD RCP 1 through 6 connectors VCS connector AUX connctor POWER switch and indicator Press to turn the power ON or OFF The indicator illuminates when power is switched on CNU number indicator Attach the number plate CCU camera control unit 1 through 6 connectors 8 pin Connect to the RCP CNU REMOTE connector of a CCU 700A 700AP Camera Control Unit using a CCA 5 cable MSU Master Set up Unit connector 8 pin Connect to the CCU CNU REMOTE connector on an MSU 700 Master Set up Unit using a CCA 5 cable CHARACTER connector BNC type Supplies character data as a 525 or 625 line black and white video signal The signal output is automatically selected according to the reference signal input to the REFERENCE connector If no signal is input to the REFERENCE connector the CNU 500 for the USA and Canada supplies a 525 line video signal and the CNU 500 for other countries supplies a 625 line video signal RS 232C connector D sub 9 pin Used for the RS 232C interface This connector is reserved for the ISR system AC IN AC power input connector Connect to an AC power source using the supplied AC power cord The power cord can be fixed to the CNU 500 using the supplied plug
107. power supply control video and audio are sent and received over one optical fiber cable Note Dust on the connection surface of the optical fiber cable may result in transmission errors When not connected always keep the end covered with the supplied cap Q Expansion slot For installation of the optional HKCU 951 SD Encoder Unit When using the HKCU 953 HD Frame Rate Converter Unit move the DIF board and internal RC board to this slot and install the HKCU 953 in the original DIF RC board position INCOM TALLY PGM intercom tally program audio connector D sub 25 pin Used for input and output of intercom tally and program audio signals Connect to the intercom tally program audio connector of the intercom system MONI HD SDI monitor output connector BNC type The signal from the video camera can be mixed with skin tone gate signals and some aspect marker signal and output in HD SDI format Note Mixing is set to ON or OFF using switches on the internal AT board or the MSU 700A 750 Master Setup Unit D RET1 RET2 and RET3 return video input 1 2 and 3 connectors BNC type Return video input signals can be received from three different systems The selection among from RET 1 2 and 3 is made using the camera s return video switch The type of input signal can be any of HD SDI SD component SDI or analog VBS and can be set using the switch on the internal DTX board or using the MSU 700A 750 Ma
108. program audio to be sent to the headset connected to the intercom connector on the front panel PGM1 Program audio 1 MIX Program audio 1 Program audio 2 PGM 2 Program audio 2 PGM1 LEVEL program 1 audio level control To adjust the mixing volume of the PGM1 audio signal atthe headset connected to the intercom connector on the front panel PGM2 LEVEL program 2 audio level control To adjust the mixing volume of the PGM2 audio signal atthe headset connected to the intercom connector on the front panel SIDE TONE control To adjust the volume of your voice to be supplied to the headset connected to the intercom connector on the front panel Q 2WIRE CANCEL controls When using the 2 wire intercom system adjust the controls to minimize the side tone level on the producer line PROD and engineer line ENG Q MIC AMP GAIN microphone amplifier gain controls These controls permit you to adjust the amplifier gain of the camera so that the proper audio levels can be obtained appropriate to the sensitivities of the microphones MIC1 and MIC2 connected to the camera The adjustment is valid when no connection is made to the MIC REMOTE connector on the rear panel of this unit or if the connection is made when the internal setting is selected for the connector pins 8 and 15 are set to a high level The adjustment range is from NORM 60 dB to MIN 20 dB in 10 aB steps This switch changes the gain of a microphone amplif
109. reproduction and accuracy of color reproduction A 600 6 dynamic range in conjunction with the 12 bit A D and the superior DSP processing ensure superb processing of overexposed picture information and the handling of specular highlights Just some of the state of the art features are Optical filter wheels Multiple output capability Optical fibre digital transmission Memory Stick media card operation Triple skin tone detail Adaptive detail control Electronic soft focus Adaptive highlight control Knee saturation Multi matrix control These improvements contribute to an unsurpassed image quality making the HDC 900 Series a true of the line studio OB camera The HDC 950 930 is the portable version of the HDC 900 and has identical video processing circuitry Both models have the same signal performance and can be controlled either at the camera head or by remote control through studio system peripherals such as the HDCU 900 HDCU 950 Camera Control Unit MSU 700A 750 Master Set up Unit and CNU 700 500 Camera Command Network Units Because of this design concept users of the HDC 950 930 have the same features the same operational performance and the same operational feel as the HDC 900 an optimized solution to meet the needs of high end users for a companion studio portable camera The flexible interfacing of the HDC 900 and HDC 950 930 means that they are not only high end HD broadcasting camer
110. settings For instance a 9 3 Camera characteristics Most of the camera characteristics cannot just be determined by numbers Good values do not always equal good picture quality Judging by human eyes is one of the most important processes to evaluate a camera The following are a few technical terms to be familiar with Modulation depth Modulation depth is used to measure a camera s fundamental performance It shows a video level percentage of a 0 5 MHz pulse wave in a subject so that the 0 5 MHz pulse wave video level is 10096 as black to white by shooting a Multi Burst chart while Detail Gamma Matrix and Knee are off The camera s performance is calculated by measuring the 0 5 MHz response in the actual video bandwidth Usually the frequency characteristics of the amplifier should be kept flat because if the level is raised too high aliasing noise will increase and the S N becomes worse In actual shooting picture quality is adjusted by adding Detail signals to enhance the response Power consumption and heating Power consumption is a factor that develops heat which is critical for shoulder operating production cameras although it is a little bit relaxed for studio cameras Using a cooling fan to reduce heating is not a good solution because the camera operator can hear this noise So low power consumption is an essential factor Reliability Reliability is one of the most important factors when we evaluate a came
111. switches on the AT board in the HDCU 900 or using the MSU 700A 750 Master Setup Unit The aspect ratio may also be selected for SD signals Note If a signal asynchronous with the HDCU 900 is supplied the picture quality may be degraded SYNC OUT SD sync signal output connector BNC type Used for output of an SD composite sync signal from the internal sync signal generator Q PIX OUT picture monitor output connector BNC type Used for output of the picture monitor video signal selected using the RCP 700 series Remote Control Panel MONITOR SELECT button or the MSU 700A 750 Master Setup Unit PICTURE MONITOR button When both the RCP and MSU are in use this connector can be assigned to the output connector for MSU control Signal selection can be made using Switches on the AT board WF OUT waveform monitor output connector BNC type Used for output of the waveform monitor video signal selected using the RCP 700 series Remote Control Panel MONITOR SELECT button or the MSU 700A 750 Master Setup Unit WF MONITOR button When both the RCP and MSU are in use this connector can be assigned to the output connector for MSU control Signal selection can be made using Switches on the AT board B Y B and R Y R OUTPUT component video signal output connectors BNC type Used for output of either Y B Y R Y component video or G B R component video signals The type of signal HDC 900 950 930 Se
112. that it exactly matches the various scanning frequencies that are in use The clear scan shutter speed range is 60 1 to 4300 Hz 1080 60i mode The ECS function is especially effective under the frequency of 60 Hz or 50 Hz The ECS function is available with the HDC 900 and HDC 950 Super EVS Super EVS Enhanced Vertical definition System raises vertical picture resolution while minimizing line flicker It is ideal for shooting of a stationary subject or still images the method used for the Claymation process for instance The Super EVS functions when operated at Interlace mode Standard 2 3 inch type Lens Mount Either an HD lens or a standard definition 2 3 inch type format lens can be mounted This allows standard lenses that are in everyday use with Sony cameras and camcorders to be used with the HDC 900 and HDC 950 930 HDC 900 950 930 Series Product Information Manual Memory Stickm Media Card Sony Memory Stick media card technology provides a new function on both the HDC 900 and HDC 950 930 Camera operators can store their personal preferences for a number of camera set up parameters and V F indicators in a personal Memory Stick media card Whenever one of these memory devices is inserted into its slot on a HDC 900 950 930 camera the operators particular settings are instantly recalled All the data stored in one or more Memory Stickmedia cards also can be registered and stored in a standard PC so that
113. the card However when the card is ejected the data cannot be main tained Replace the battery before using using the Function menu Filter display window The currently selected ND and CC filters are displayed Filter selection is made using the orange Function menu ND filter Examples 1 Clear Data are being read written If you eject 2 1 4 ND Litin red the disc in this condition the data is not 3 1 8 ND guaranteed All the data may be lost 4 1 16 ND For battery replacement refer to the instructions for the IC 5 1 64 ND Gard CC filter Examples Cross filter IC card slot B 3200K clear Insert an IC card which conforms to 4300K to store reference files and scene files of the E i video camera or CCU SRAM CARD ONLY When the card is correctly set the ACCESS indicator lights in green Note The data in the memory card is maintained by the battery built into the card If the battery is exhausted the data in the card will be lost You can check the battery condition by the ACCESS indicator If the battery becomes weak replace the battery with a new one as soon as possible 8 Eject button Press to eject the inserted IC card Note Do not eject a card when the ACCESS indicator is lit in red it means that the data is being read from or written to the card This may erase data stored in the card HDC 900 950 930 Series Product Information Ma
114. to an emergency broadcasting condition 3 Setup Store all the data for standard camera status on a Reference file so the camera system can be operated under a standard condition previously set just by pressing the Standard button 6 2 Gase 2 for general operations 1 One touch power on Turn on the power for the whole camera system using the main switch of the power supply for system stability 2 Camera head connection 1 When the CCU has already been connected to he camera head do the heat run for 10 to 30 minutes 2 When the camera head connection needs to be changed turn off the HEAD POWER through he CCU or RCP 3 Check the cable indicator on the CCU If the ight of the indicator goes off then you can turn on the camera power 4 Turn the camera power off using the POWER SW on the camera head side when changing he accessories such as a lens or viewfinder 3 Camera adjustment 1 Press the STANDARD button to clear the data rom the last shooting or execute Auto Setup 2 Perform auto white balance using a gray scale or standard white chart When shooting the scale or chart use the same lighting equipment that will be used for program shooting Be sure to direct light on the scale or chart uniformly under standard illumination that will be used in the studio because it will affect the shading adjustment 4 Keep all the cameras at the same level by adjusting the IRIS and MASTER PED Usually this ste
115. two picture monitor outputs and two waveform monitor outputs The selection of monitoring signals can be controlled by the camera selection buttons on the MSU 700A 750 Master Set up Unit or by external control equipment through the D sub 37 pin I O port on the VCS 700 For SDI monitoring the optional BKP 7933 S Bus Interface Board provides connection to a Sony digital routing system Remote Control Panels RCP 700 Series There are four ranges of remote control panels for remote control of the HDC 900 Series via the HDCU 900 950 Camera Control Unit For the iris and master black adjustments each range has two types joystick control and dial control The RCP 750 751 is the newly developed top of the range for sophisticated operational use and can be used as a substitute for the MSU 700A 750 Master Set up Unit The panel is connected to the HDCU Series Camera Control Unit or the CNU Series Camera Command Network Unit which is connected to the HDCU Series by a special cable of up to 200 m 656 ft in length The RCP 700 701 features the basic control items required for daily operation of camera acquisition systems type HD monochrome electronic viewfinder are newly designed which fulfill the requirement for different applications All of these models are very compact in size light in weight and economical in power consumption The low mounting positions of the HDVF 700A and HDVF C700W provide convenient viewfinder displa
116. type Used for output of an HD tri level sync signal from the internal sync signal generator SYNC OUT connector PIX OUT PIX OUT connector OUTPUT 1 2 connectors YIG Pe B PR R 21 xo sel OUTPUT 1 OUTPUT 2 PIX OUT HD picture monitor output connector BNC type Used for output of the picture monitor video signal selected using the RCP 700 series Remote Control Panel MONITOR SELECT button or the MSU 700A 750 Master Setup Unit PICTURE MONITOR button Either the Remote Control Panel or Master Setup Unit may control the output depending on which button was pressed most recently OUTPUT 1 2 HD analog component video 1 and 2 output connectors BNC type HD analog component video signals are output in either Y PB PR or G B R format The selection of Y PB PR or G B R format may be made independently for OUTPUT 1 and OUTPUT 2 using switches on the AT board Factory setting G B R 7 3 7 HKCU 903 Frame Rate Converter Unit The optional HKCU 903 is to be installed in the HDCU 900 expansion slot or in place of the SD signal input output block SERIAL RET INPUT 1 4 connectors 1 A 2 A 3 A 4 A 7 ff N f 4 N N J 2 L SERIAL RET INPUT Q SERIAL RET INPUT 1 4 HD SDI return video 1 2 3 and 4 input connectors BNC type Four different HD SDI return video input signals may be received independently
117. units either mount directly into the rack or with optional slide rails such as the Sony RMM 30 Rack Mount Rail These slide rails allow the unit to be easily pulled out from the rack and are recommended if you intended to pull out the unit frequently Warning for Safety Purpose It takes two or more people to mount a unit into a rack Mounting the unit into a rack by yourself can cause back or other injuries Mounting the unit directly to the rack Fix the unit to the rack using the rack mount bracket of 3 Loosen the screw of the bracket of the outer the unit Daily maintenance is easy with the unit member mounted with this method Universal type rack 4 Attach the front and rear brackets of the outer member to the rack Screws b c and d are supplied with the RMM 30 Plate nut Wide type rack Mounting the unit using the RMM 30 Rack Mount Rail When the RMM 30 Rack Mount Rail is used the unit can be mounted into a rack with a depth of 660 to 830 mm 26 to 32 3 4 inches Proceed as follows 1 Pull out inner member while pushing against the stopper Screw d When a 1U unit is mounted 1 Attach the front bracket to the inside of the front of the rack at the screw holes at 15 9 mm 22 32 inch intervals using screw b and plate nut c 2 Attach the rear bracketto the outside of the rear of the rack at the screw holes at 31 75 mm 1 5 16 inches intervals using screws
118. using a cable of length different from that of a standard length contact your local Sony Sales Office Service Center 3 Only for HKC T950 Chapter 8 Connectors and Cables 152 8 2 HDCU 900 HD Camera Control Unit 8 2 1 Connector Input Output Signals 8 2 1 1 BNC connector HDCU 900 1125 digital signal SERIAL RET INPUT 1 4 BNC 1 485 Gbps 1 4835 Gbps SMPTE 292M SERIAL OUTPUT 1 3 MONI BNC 0 8 V p p 75 Ohms 1 485 Gbps 1 4835 Gbps SMPTE 292M REFERENCE IN BNC x 0 3 V tri level SYNC 75 Ohms Or Black burst 0 286 V p p 75 Ohms for UC 0 3 V p p 75 Ohms for CE SD 525 625 digital signal SERIAL RET INPUT 1 4 BNC Component serial signal 270 Mbps SMPTE 259M SERIAL OUTPUT 1 4 BNC Component serial signal 0 8 V p p 75 Ohms 270 Mbps SMPTE 259M Analog signal PIX OUT BNC 1 0 V p p 75 Ohms WF OUT BNC 1 0 V p p 75 Ohms SYNC OUT BNC 0 3 V ternary SYNC 75 Ohms 0 3 V p p SD SYNC 75 Ohms selectable CHARACTER BNC 525 625 black and white Picture 0 5 V Sync 0 3 V 75 Ohms Others DIGITAL AUDIO BNC AES EBU format PROMPTER IN BNC 1 0 V p p 75 Ohms HKCU 901 525 625 analog signal RET INPUT 1 4 BNC 1 0 V p p 75 Ohms Y G OUTPUT BNC Y 1 0 V p p picture 0 714 V sync 0 286 V 75 Ohms G 0 7 V 75 Ohms B Y B OUTPUT BNC B Y 0 7 V p p 75 Ohms for UC during 75 color bar input 0 525 V p p 75 Ohms for CE during 75 color bar input B 0 7 V 75 Ohms R
119. 0 SYNC OUT HD SERIAL RET INPUT 1 to 3 SERIAL OUTPUT 1 2 h 9 HD SDI SIGNAL HDC 950 CA 905L SP e IEFERENCE PROMPTEI lo CAMERA O L O c SD ANALOG Monitor ds 50 ON ex 7 2 gt SYNC OUT a at Gor A EON Waveform Monitor Qs Goes OSES De TINCOM TALLY PGM MIC REMOTE D O LJ O HD SDI Monitor HDCU 950 SD ANALOG VIDEO SIGNAL SD REFERENCE SIGNAL 00 080 005 Q CNU 700 Terminated at 75 HDC 900 950 930 Series Product Information Manual Chapter 2 Total System 36 2 7 2 3 HD SD Film Like System Figure 2 7 2 2 Example of connection using HDCU 950 2 System format HD SD film like system SYNC OUT SYNC SIGNAL PROMPTER SIGNAL LROMPTER IN SERIAL RET INPUT 1 to 3 SDI RETURN VIDEO SIGNAL REFERENCE REFERENCE SIGNAL SERIAL o HD SDI SIGNAL HDC 950 CA 905L HD SDI SIGNAL lt HD SDI OUT 1 2 SUB REFERENCE SIGNAL PAME REF SD SDI SIGNAL PROMPTE
120. 0 102 x 354 x 126 5 mm Supplied accessory 4 1 8 x 14 x 5 inches Operation Manual 1 RCP 751 102 x 354 x 86 5 mm 4 1 8 x 14 x 31 2 Optional accessories Remote cable CCA 5 3 3 m Mass HDC 900 950 930 Series Product Information Manual inches Remote cable CCA 5 10 10 m RCP 750 1 5 kg 3 Ib 5 oz RCP 751 1 3 kg 2 Ib 14 OZ Remote cable CCA 5 30 30 m Maintenance Manual Memory Stick Chapter 10 Specifications 186 10 12 RCP 700 701 Remote Control Panel Connectors Dimensions REMOTE CCU CNU 8 Pin PREVIEW 8 Pin I O port 29 pin Power requirements 30 VDC RCP 700 1 0 kg 2 Ib 3 oz RCP 701 0 9 kg 2 Ib Mass RCP 700 68 W x 221 H x 127 D mm 2 3 4 x 8 3 4 x 5 inches RCP 701 68 W x 221 H x 83 D mm 2 3 4 x 8 3 4 x 3 3 8 inches 10 13 RM B150 front panel Hand held Remote Control Unit General Mass Power Requirements DC 10 5 30 V max supplied from camera camcorder CCU Operating Temperature 20 C to 45 C Storage Temperature 20 C to 55 C Dimensions W x H x D 86 mm x 65 mm x 179 mm 3 1 2 x 25 8 x 7 1 8 inches Inputs Control interface Monitor in Approx 0 7 kg 1 Ib 9 oz 8 pin x 1 Sony Camera Command Network Protocol BNC type x 1 VBS No HD signal capable 10 14 RM B750 front panel Hand held Remote Control Unit General Mass Power Requirements DC 10 5 30 V max supplied from camera camcorder CCU Operating Te
121. 0 Series Remote Control Panels are directly connected to their respective camera control units The switch is set to NORMAL at the factory MODE switch 0 Factory setting 1 When the switch is set to this position the UP DOWN switch is activated and the switch changes the character page displayed on a monitor connected to the CHARACTER connector 2 through F Not used UP DOWN switch Changes the page displayed on the monitor screen This switch functions only when the MODE switch is set to 1 The contents of each page are shown in the following table Page Contents Nothing appears when power is turned on 1 Shows a warning if a problem is detected by the self diagnosis of the camera 2 status of Cameras 1 through 6 3 Not used 4 Not used Shows the results of auto set up of Camera 1 5 through 6 6 Cannot be used DIAGNOSIS OF ALL CAMERAS displays 7 which shows the results of the self diagnosis of all the cameras 8 Not used DIAGNOSIS OF ONE CAMERA display which 9 shows the results of the self diagnosis of the selected camera DATA OF ALL CAMERAS display which shows the setting status of each camera DATA OF ONE CAMERA display which shows the setting status of the selected camera 10 11 SET CANCEL switch Selects the displayed item or camera CAM when display page 9 10 or 11 appears on the monitor screen SYN
122. 0 5 to 17 volts with low power consumption 33 watts The HDVF C750W C700W has the following features Compact and lightweight The viewfinder uses an LCD panel making it more compact in size and lighter in weight as compared with a CRT viewfinder that has a display of the same size Multiscan In addition to the 60i format formats such as 24PsF and 50i are supported for control signals from the camera High resolution The high resolution LCD panel of the viewfinder provides 500 or more lines of horizontal resolution 2 6 Optional Accessories For HDC 900 HDVF 700A HD Electronic Viewfinder 7 type monochrome HDVF C700W HD Electronic Viewfinder 6 type color VFH 770 Outdoor Hood BKP 7911 Script Holder with script light CAC 6 Return Video Selector EX 738 A 8327 351 A Extension Board For HDC 950 930 BKP L551 Battery Adaptor BKW 401 Viewfinder Rotation Bracket C 74 Microphone CA 905L Large Lens Adaptor CAC 6 Return Video Selector CAC 12 Microphone holder HDC 900 950 930 Series Product Information Manual Stable picture The LCD panel provides a stable image without distortion regardless of screen brightness Step variable peaking Step variable peaking circuits provide a sharp image making it easy to focus the camera Tally lamps The viewfinder has red and green tally lamps which light in response to tally signals Superior usability The height of the HDVF C750W can be set to one of three posit
123. 0 741 RCP 750 751 Combination of boards Board name Slot 1 Slot 2 Slot 3 Slot 4 Slot 5 Slot 6 Front side 149 AVP 4 DTX 1 DRX 1 RC 91 Rear side CN 2219 CN 2220 SDI 70 HIF 5 DIF 124 HDCU 950 w HKCU 951 Front side 149 AVP 4 DTX 1 DRX 1 RC 91 EN 145 HDCU 950 installed Rear side CN 2219 CN 2220 SDI 70 HIF 5 DIF 124 VDA 61 HDCU 950 w HKCU 953 Front side 149 AVP 4 DTX 1 DRX 1 FC 88 RC 91 installed Rear side CN 2219 CN 2220 SDI 70 HIF 5 SDI 73 DIF 124 HDC 900 950 930 Series Product Information Manual Chapter 2 Total System 35 HD REFERENCE SIGNAL PROMPTER SIGNAL HD SDI RETURN VIDEO SIGNAL REFERENCE SIGNAL HD SDI SIGNAL J O SD ANALOG Monitor Waveform Monitor Q C HD SDI Monitor HD REFERENCE SIGNAL HD SDI RETURN VIDEO SIGNAL 2 7 2 2 Standard HD SD System Figure 2 7 2 1 Example of connection using HDCU 950 1 System format HD SD system SYNC OUT HD PROMPTER IN SERIAL RET INPUT 1 to 3 REFERENCE IN SERIAL OUTPUT 1 2 B p HDC 950 CA 905L Ge PROMPTE CAMERA 9r D HDCU 95
124. 000000 00000 o Figure 2 4 HDC 950 Stand alone System HDC 950 930 HDVF 20A HDC 900 950 930 Series Product Information Manual CAC 6 Return Video Selector HDCZ 10 25 Connection Cable Dcn HD VTR HDW 250 etc BP L60A L90A Battery Pack BKP L551 Battery Adapter DCU 900 HD Camera Control Unit m Optical Fiber Cable HDCU 950 HD Camera Control Unit CCA 5 Cable Eooo RM B150 r gt 22 Remote Contorl Unit RM B750 CNU 700 Camera Command Network Unit CCA 5 Cable max 200 meters o B qp C O CCA 5 Cable max 200 meters RCP 700 series Remote Control Panel SONY HDCU 950 RM B750 Remote Control Unit Chapter 2 Total System 16 2 2 Gamera Head The HDC 900 Series is an outstanding new generation HD camera with a true multi purpose system in which many new technologies have been incorporated such as Sony s ADSP Advanced Digital Signal Processing a newly developed 2 2 million pixel CCD and 12 bit A D conversion 12 bit A D conversion improves gradation analysis by a factor of four compared to 10 bit conversion significantly improving control over picture tonal
125. 1 560 155 00 PLUG 4 pin male supplied HDCU 950 1 569 370 12 PLUG BNC or RET IN 1 3 BELDEN8281 Cable or SERIAL OUTPUT 1 2 MONI equivalent SD SDI OUT 1 3 HKCU 953 HD SDI OUT 1 2 MIC1 MIC2 3 pin Male 1 508 083 00 XLR 3 pin MIC REMOTE WF female or CANNON XLR 3 11C equivalent 8 4 1 Connector Input Output Signals Main connector input and output signals are as follows 8 4 1 1 BNC connector 75 Ohms Input Signal REFERENCE Output Signal CHARACTER 300 mV p p loop through 700 mV p p 300 mV p p SYNC 8 4 1 2 RS232C 1 2 3 1 9P Female 550000 g9999g 1 External view Female Female 1 766 848 11 PLUG 8 pin male or CCA cable assembly optional CCA 5 30 30 m CCA 5 10 10 m CCA 5 3 3 m INTERCOM 5 pin 1 508 370 11 XLR 5 pin male or CANNON XLR 5 12C equivalent 8 4 CNU 700 Camera Command Network Unit No Signal Specifications 9 NC 1 The RS 232C 3 port can be used only when the BKP 7930 is installed 2 The 5 232 2 and RS 232C 3 ports be used for RS 422 interfaceing by changing the switch setting of S802 to S806 on the IF 777 board 8 4 1 3 REMOTE 8P Female RCP CCU MSU VCS AUX 1 2 3 4 OOA External view No Signal Specifications 1 TX CNU SERIAL DATA 2 3 RX 4 MSU RCP CCU VCS AUX 4 SERIAL DATA 5 TXGND GND for TX
126. 1 951 HKCU 902 HKCU 903 953 HKCU 904 RCP 700 701 RCP 750 751 HDCU 900 950 HKCU 901 951 HKCU 902 HKCU 903 953 HKCU 904 System format Combination of boards Slots on the front Signal input output slot Second slot from the top Third slot from the top 525 59 941 SDI RC LC IF Second slot from the top Re RC Third slot from the top NTSC RC IF Third slot from the top 625 50l SDI RC LC IF Second slot from the top PAL RC IF Third slot from the top Setting switches Switch setting System format DPR 163 board S804 LOCAL 7141 FC 83 board board 5805 5807 5806 5603 52 53 S802 525 59 94 SDI NOT 60 Intr 71901 525 pu him NOT 48 PsF 1001 525 NTSC NOT 60 Intr 71901 525 625 501 SDI NOT 50 intr 11000 625 NOT 50 Intr 11000 625 HDC 900 950 930 Series Product Information Manual Chapter 2 Total System 26 Figure 2 7 1 4 Example of connection using HDCU 900 4 System format 525 59 941 SDI Required boards Slot to be installed Slots the front ihe raai Remarks Top most slot DPR 163 SDI 54A HDCU 900 Second slot from the top RC 86 DIF 102 HDCU 900 Third slot from the top Blank Blank SERIAL RET INPUT 1 to 4 REFERENCE IN SYNC OUT PROMPTER IN SERIAL OUTPUT 1 to 4
127. 2 1 2 3 1 160 8 4 1 3 REMOTE 8P 160 8 4 2 Cable 161 8 4 3 Connection 161 8 5 CNU 500 Camera Command Network Unit 161 8 5 1 Connector Input Output Signals 161 8 5 1 1 BNC connector 75 Ohms 161 8 5 1 2 RS232C 161 8 5 1 3 REMOTE 8P 161 8 5 2 Cable Wiring mu 162 8 5 3 Connection Connector 162 8 6 MSU 700A Master Setup Unit 162 8 6 1 Connector Input Output Signals 162 8 6 1 1 REMOTE 8 pin 163 8 6 1 2 I O PORT 50 pin Female 163 8 6 2 Cable Wiring ceux de oe Od Ya Led a Mere a e 164 8 6 3 Connection 164 8 7 MSU 750 Master Setup 164 8 7 1 Connector 164 8 8 RCP 750 751 Remote Control Panel 165 8 8 1 Connector Input Output Signals
128. 250 All video camera signals including power supply control video and audio are sent and received over one optical fiber cable Note Dust on the connection surface of the optical fiber cable may result in transmission errors When not connected always cover the end with the supplied cap AC IN AC power supply input connector Use the supplied power cord to connect to an AC power supply The power cord may be secured to the HDCU 900 body using the supplied plug holder HDC 900 950 930 Series Product Information Manual connector Remote control connectors CHARACTER OUTPUT connector DIGITAL AUDIO connector MIC OUTPUT connectors INTERCOM TALLY PGM connector Q Remote control connectors RCP CNU REMOTE connector 2 WF REMOTE connector TRUNK LINE connector REMOT 1 TRUNK LINE WF Cao oko VO PORT eye I O PORT connector MIC REMOTE connector RCP CNU REMOTE connector 8 pin Used to connect to an MSU 700A 750 Master Setup Unit CNU 500 700 Camera Command Network Unit or RCP 700 series Remote Control Panel via a CCA 5 Connection Cable Control signals are sent and received via this connector When using an RCP 700 series unit power is also supplied WF MODE REMOTE waveform monitor remote connector D sub 15 pin Used to attach to the appropriate connector on a waveform monitor when operating the waveform monitor display using an MSU 700A Chapter 7 Location a
129. 30 Series Product Information Manual camera setting data made during rehearsal can be stored in a scene file and then be recalled during an actual take different DTL settings Usually it is measured when IRIS is closed gamma is off DTL is off Chroma is off and the pedestal level is set at 5 There is a close relationship between S N sensitivity and dynamic range When we raise the sensitivity the S N and dynamic range will decrease So it is difficult to decide to emphasize which item while the other two items will be affected Although the measured value of the S N is important it seems that the S N judged by human eyes after gamma and DTL are set is more important Weight and balance Very naturally less weight is better for shoulder operated equipment However balance is also a very important factor If the camera weight is too low then the overall balance of the camera will be off when a large lens is attached Chapter 9 Glossary Terms and Definitions 176 10 1 HDC 900 HD Color Video Camera General Operating temperature 20 to 45 C 4 F to Storage temperature Mass Approx Dimensions Unit mm inches Imager Imager Method Effective resolution 113 F 209 to 50 C 4 F to 122 F 21 kg 46 lb 5 oz main unit only See below 2 3 type frame interline transfer CCD 3 CCD RGB 1920 horizontal x 1080 vertical Optical system specifications Spectral
130. 50048 0 8 V p p 75 Ohms 1 485 Gbps 1 4835 Gbps Chapter 8 Connectors and Cables 157 SMPTE 292M Analog signal FRAME REFERENCE IN BNC 0 3 V ternary SYNC 75 Ohms No Signal Specifications VF F IIUa 7 GAIN IN CONTO Refer to the below column 8 MIC1GAIN CONT 2 Refer to the below Or black burst signal 0 286 V p p 75 Ohms ON OFF IN column FRAME REFERENCE OUT BNC THROUGH OUT 0 3 V p p FRAME SYNC pulse 75 9 END OND for F99 V Ohms 10 TALLY OUT R G TALLY OUT ON GND Max 30 mA 8 3 1 2 CAMERA connector optical electrical u composite connector 1 INC No connection VIDEO Y PB PR 12 ASPECT REMOTE L REMOTE Conforms to 50048 ON OFF 1485Gbps 13 ASPECT CONTI Refer to the below 1 4835 Gbps serial column SMPTE 292M s RET VIDEO Y PB PR 4 CTLCONT2 Refer to the below Conforms to 50048 column 1 485 Gbps 15 MIC2 GAIN CONT 2 Refer to the below 1 4835 Gbps serial ON OFF IN column SMPTE 292M INCOM 2ch 1 CHU MIC 1 2 AMP GAIN MIC 2ch DIGITAL AUDIO AES EBU CONTO CONT1 CONT2 CHU MIC GAIN CAMERA COMMAND H H H 6008 PROMPTER L H H 50 dB 8 3 1 3 MIC1 MCI2 XLR 3 pin Male E H 4048 L L H 30 dB H H L 20 dB The setup for the HDCU 700A mode is shown in paren
131. 51 Remote Control Panel 186 10 12 RCP 700 701 Remote Control Panel 187 10 13 RM B150 front panel Hand held Remote Control 187 10 14 RM B750 front panel Hand held Remote Control 187 10 15 HDVF 20A HD Electronic 187 10 16 HDVF 700A HD Electronic Viewfinder _ 188 10 17 HDVF C700W C750W HD Electronic 189 10 18 HKC T950 HD CCD Block 190 10 19 CA 905L Large Lens 190 Appendix eem 191 Function comparison chart 192 Function comparison 194 HDC 900 950 930 Series Product Information Manual Table of Contents 6 Function comparison chart Maintenance 195 Function comparison chart 197 Function comparison chart Function 199 Function comparison chart Multi 200 Function comparison chart Button and 201 HDC 900 950 930 Series Product Information Manual Tab
132. 73 6 3 4 2 To set the built in 73 6 3 4 3 adjust the buzzer 73 6 3 4 4 To turn on off the buzzers independently 74 6 3 4 5 To turn off all the buzzers 74 6 3 4 6 To adjust the brightness of the LEDs 74 6 3 4 7 To adjust the brightness of the EL display 74 6 3 4 8 To adjust the brightness of the LED displays MSU 750 only 74 6 3 4 9 To set the screen 74 6 4 File SUCH EOGOOSAORUOEAORXOR EORR RT RRR RRR PUR 75 Chapter 7 Location and Function of Parts and Controls 76 7 1 HDC 900 HD Color Video Camera TI 7 1 1 Right Side and Left Side 8 77 7 152 Rear Panel Ge Ee GO Ge ep RE ES ws ERU XC qu s 79 1 2 HDC 950 930 HD Color Video Camera 82 22 1 RIgBESIGG s eiie xe tuer PP pew reas Pa Yam Pg 82 72222 Front Lent Side e Le E ETE Wu ka pa E REPE EE 83 7 2 3 Back Left 84 722 4 Back Right SIGE assa bedded adie kde od ques RR wawas 86 7 3 HDCU 900 HD Camera Control Unit 87 2321 s oz cc kawana ER
133. 7kHz 47 95Hz Lens assembly farsighted Part No A 8262 537 A 1080 24PsF 27kHz 48Hz 2 2 low magnification Part 1080 25PsF 28 13kHz 50Hz Lens assembly standard magnification with special 1080 29 97PsF 33 72kHz 59 94Hz compensation for aberrations Part No A 8267 1080 33 75kHz 60Hz 737 1080 50i 28 13kHz 50Hz HDC 900 950 930 Series Product Information Manual Chapter 10 Specifications 187 General Power supply Power consumption Operating temperature Mass External dimensions CRT CRT CRT Dimensions Picture size 10 5to 17 0V DC supplied by the camera 33 W 0 C to 40 C 32 F to 104 F 5 0 kg 11 Ib not including hood See below 7 type monochrome 90 deflection 160 x 131 mm 6 3 8 x 5 1 4 in 120 x 90 mm 4 3 4 x 3 5 8 in 4 3 aspect ratio Deflection and high voltage Brightness Resolution Geometric distortion EHT voltage regulation EHT voltage 500 cd m2 800 lines at center 600 lines at edges 2 096 or less within 2 096 12 5 kV standard Input voltages and signal characteristics Supported formats Effective Horizontal Vertical scanning Format scanning scanning lines frequency frequency 1080 23 98PsF 26 97kHz 47 95Hz 1080 24PsF 27kHz 48Hz 1080 25PsF 28 13kHz 50Hz 1080 29 97PsF 33 72kHz 59 94Hz 1080 30PsF 33 75kHz 60Hz 1080 50i 28 13kHz 50Hz 1080 59 94i
134. 950 System Configuration portable model is designed for full integration into an HDC 900 studio system as well as being used as a standalone acquisition camera In addition to the new peripherals such as HDCU 900 950 RCP 750 751 and RM B750 a variety of key peripherals like the CNU 700 and CNU 500 Camera Command Network Units help users to easily expand upgrade their systems REMOTE CONTROL PANEL RCP 751 RCP 750 CCA 5 CABLE CCA 5 CABLE REMOTE MASTER SETUP UNIT MASTER SETUP UNIT CONTROL PANEL MSU 700A MSU 750 s J e ooh cao CCA 5 CABLE Bs CCA 5 CABLE RCP 700 RCP 701 CAMERA COMMAND NETWORK UNIT CNU 700 500 5 CABLE 5 CABLE N CCA 5 CABLE CAMERA CONTROL UNIT CAMERA CONTROL UNIT CAMERA CONTROL UNIT HDCU 900 HDCU 900 HDCU 950 HKCU 901 s HKCU 902 ir oo HKCU 951 HKCU 903 HKCU 953 HKCU 904 8 PIX PIX WF F PX WF FIBER CABLE FIBER CABLE MULTI FORMAT 2 ELECTRONIC VIEWFINDER HDVF 20A MULTI FORMAT HDVF 700A LCD COLOR VIEWFINDER UE HDVF C750W ESI EAT S 8 STUDI0 200
135. A dO des 87 3 2 Rear Panels me eee e bec rece e ac Roe ed kote ana aa 88 7 3 3 HD Signal Input Output 89 7 3 4 SD Signal Input Output 90 7 3 5 HKCU 901 SD Analog Interface 91 7 3 6 HKCU 902 HD Analog Interface 92 7 3 7 HKCU 903 Frame Rate Converter 92 7 3 8 HKCU 904 Line Converter 93 7 3 9 Internal Boards DPR board 93 7 3 10 Internal Boards AT board 94 7 4 HDCU 950 HD Camera 94 T5451 FRONT RANG s ua aea ut et os eiat UR Ri ate s 94 494 2 Rear Panel tp rar TUE edu a acea REND p SS CG s 95 7 4 3 Output Block DIF 96 7 4 4 HKCU 951 SD Encoder 97 7 4 5 HKCU 953 HD Frame Rate Converter 97 7 4 6 Internal Switches and Internal Boards Internal switches 98 7 4 7 Internal Switches and Internal Boards AT Board 98 7 4 8 Internal Switches and Internal Boards AVP Board 99 7 4 9 Internal Switches and Internal Boards DTX Board
136. AL M CNU character Auto white shading The shading compensation is achieved with horizontal and vertical sawtooth and parabolic waveform as well as with a digitally synthesized waveform for almost 1000 individual correction zones created by DSP Skin detail auto hue automatic hue detection for specified color range with full skin detail function on the MSU 700A 750 and can be set by pressing the lit IRIS MB ACTIVE button Parallel Mode The MSU 700A 750 and RCP 700 Series panels have a PARA button to select Parallel Mode When the PARA button of the unit is pressed and lit Parallel Mode is activated and all the control functions other than the iris master black controls become operative from both units The Parallel Mode can be canceled by pressing the PARA button of the MSU 700A 750 or RCP 700 Series control panel of the operational advantages of the S Bus system is that the routing of input signals to the primary inputs of a DVS 7000 8000 Series Video Switcher can be changed at any time without having to re connect cables Even the source name display tally signal and tally display are interlocked and changed automatically Sony camera command system with S Bus Controlling the router from an MSU panel The digital router s cross point can switched from the MSU 700A 750 by pressing its camera select button SDI video monitoring is enabled MSU 700A
137. C 900 950 930 Series Product Information Manual 3 Setting the frame conversion when the HKCU 953 is installed When the shooting mode of the camera is set to 24PsF set the HD SDI output signal format from the HKCU 953 Setup switch S2 on the FC 88 board Factory setting OFF ON When the shooting mode of the camera is set to 24PsF the frame frequency conversion is implemented OFF The frame frequency is not converted The same signal as the main HD SDI signal is output Note The setting of the frame conversion frequency must follow the set format of the SD signal output When 5423 1 on the AT 149 board is set to OFF the frame frequency is converted to 60i 30 Hz When 5423 1 on the AT 149 board is set to ON PAL the frame frequency is converted to 50i 25 Hz Chapter 2 Total System 34 2 1 2 1 Standard System PIX WF HDCU 950 VCS 700 Do o CI 1 9 o Q HDCU 950 HDC 950 CA 905L HKCU 953 DEZ O 9 HDCU 950 HDC 950 CA 905L P HKCU 953 C 950 HDCU 950 HKCU 951 HKCU 953 HDCU 950 HKCU 951 HKCU 953 RCP 700 701 MSU 700A 750 RCP 720 721 RCP 730 731 RCP 74
138. C ON OFF switch Selects whether the sync signal is to be added to the video signal output from the CHARACTER connector At the factory the switch is set to ON added HDC 900 950 930 Series Product Information Manual Chapter 7 Location and Function of Parts and Controls 104 7 7 VCS 700 Video Selector 7 7 1 Front and Rear Panels POWER switch and indicator Front panel PIX A INPUT connector PIX A OUTPUT connector PIX B OUTPUT connector SYNC OUT connector CHARACTER INPUT connectors PIX 1 through PIX 6 INPUT connectors Rear Panel Q WF 1 through WF 6 INPUT connectors WF A INPUT connector AC IN connector QD I O PORT connector WF A OUTPUT connector REMOTE connector WF B OUTPUT connector WF MODE connector Q POWER switch and indicator Q PIX B OUTPUT picture monitor B output This switch turns the power ON and OFF The indicator connector BNC type illuminates when power is switched on Supplies the same video signal for a picture monitor as the PIX A OUTPUT connector The signal loss of a PIX1 through PIX6 INPUT picture monitor 1 connecting cable up to about 100 meters 330 feet through 6 inputs connectors BNC type long can be compensated for with the switch on the Accept video signals for a picture monitor Connect internal board When you connect a picture monitor each of these connectors to the PIX2 OUTPUT using long connecting cabl
139. CAM Control When the RCP assignment is canged PIX WFM video is also changed automatically Controlling the router from an RCP Pressing the preview switch on an RCP 700 Series control panel switches the appropriate digital router cross point SDI video monitoring is enabled NTSC or PAL MANI pM with 7933 MSU 700A Figure 4 10 Router control from an RCP HDCU 900 with A D board 4 nau o muna 910 0 0 uenmo oo oo b Camm os O 9 an PEA hk Hh HDCU 900 E with A D board me Router DVS V3232 etc Primary Station HDCU 900 with A D board S BUS BNC ccA 5 P eese bea Suede Video BNC Controlling the RCP assignment from other S Bus assignment of RCPs in a system that does not include equipment an MSU 700A 750 All S Bus equipment detects the connection configurations between camera heads HDCUs and RCPs by communicating with each other This means that other S Bus equipment can change the HDC 900 950 930 Series Product
140. CMOS LEVEL 3 3 HI ACTIVE PORT 2 Assignable 5 SPARE I O CMOS LEVEL 3 3 HI ACTIVE PORT 3 Assignable 6 SPARE I O CMOS LEVEL 3 3 HI ACTIVE PORT 4 Assignable 7 SPARE I O CMOS LEVEL 3 3 HI ACTIVE PORT 5 Assignable 8 OUT 5V DC 9 GND HDC 900 950 930 Series Product Information Manual 8 8 2 Connection Connector Connections made with the connector panels during installation or service should be made with the connectors complete cable assemblies specified in the following list or equivalent parts Connector function AUX REMOTE CCU CNU REMOTE 8P FEMALE EXT 9P Female Connection connector 1 706 848 11 PLUG MALE Cable assembly Option CCA 5 3 3 m CCA 5 10 10 m CCA 5 30 30 m 1 560 651 00 D SUB 9P MALE 1 561 749 00 JUNCTION SHELL 9P Chapter 8 Connectors and Cables 165 8 9 HDVF 20A HD Electronic Viewfinder 8 9 1 Connector Input Output Signals Pin No Signal 1 0 Specifications VF 20P Mal 9 PEAKING OUT VFto CAM 1 CTL kOhms OVto5V PEAKING OFF 5 PEAKING 10 INC 11 INC External view 12 Y VIDEO IN 1 0 V p p Ro 75 N kOhms
141. Connectoin connector cable 1 569 370 12 Connector BNC 8 5 1 Connector Input Output Signals Main connector input and output signals are shown below 8 5 1 1 BNC connector 75 Ohms Input Signal REFERENCE Output Signal CHARACTER 300 mVp p loop through 700 mVp p 300 mVp p SYNC 8 5 1 2 RS232C 9P Female 5 1 9090006 External view No Signal Specifications 1 I DCD IN DATA CARRIER DETECT 2 RXD IN RECEIVED DATA 3 TXD OUT TRANSMITTED DATA 4 DTR OUT DATA TERMINAL READY 5 SIGNAL GND SIGNAL GND 6 DSRIN DATA SET READY 7 RTS OUT REQUEST TO SEND 8 CTS OUT CLEAR TO SEND HDC 900 950 930 Series Product Information Manual v Brown RS232C 9P FEMALE 1 566 354 11 CCU RCP MSU VCS AUX 1 2 3 4 8P FEMALE 8 5 CNU 500 Camera Command Network Unit D SUB 9P MALE 1 766 848 11 PLUG 8P MALE or CCA cable assembly option CCA 5 10 10 m CCA 5 3 3 m CCA 5 30 30 m No 9 Signal NC Specifications 8 5 1 3 REMOTE 8P Female RCP CCU MSU VCS AUX OVD CIO External view No Signal Specifications 1 CNU SERIAL DATA 2 ITX 3 RX MSU RCP CCU VCS AUX 4 RXC SERIAL DATA 5 TX GND GND for TX 6 POWER 7 POWER 8 SPARE CHASSIS GND CHASSIS GND Chapter 8 Connectors and Cables 161
142. D N Dii OI O IO O Example MSU 700A 1 Press to light the CONFIG button The Configuration Menu appears on the display 2 Press MSU The MSU Configuration menu appears MSU Configuration MSU MSUSW Adjusting Set Date Time 6 3 4 2 To set the built in clock The MSU 700A 750 has a built in clock to record the date and time when reference and scene files are saved to IC memory cards To set the clock proceed as follows 1 Press Date Time on the MSU Configuration menu The current setting is displayed on the Data Ti Set menu Date Time Set Exit 1998 7 1 WED 11 47 00 me 2 To set the date 1 Press Date to set it to inverse video Date Time Set Exit 1999 7 1 WED 11 47 27 E EH Year Month 1998 7 HDC 900 950 930 Series Product Information Manual 6 3 4 1 To display the MSU Configuration menu 2 Set the Year Month and Day with the left three control knobs 3 Press Set The set date becomes valid To restore the previous setting press Cancel instead of Set Date Time Set Exit 3 To set the time 1 Press Time Date Time Set 1998 7 1 WED 11 47 51 Hour Minute Second 11 47 51 2 Set the Hour Minute and Second with the lef
143. DC 900 950 930 Series Product Information Manual Appendix 197 MSU 700A MSU 750 RCP 750 751 RM B750 Secondary Menu Menu Sub Menu Control Item Menu Direct Menu Direct Menu Direct menu Direct Button Button Button Button Rotary RCP Encoder BLACK Black v FLARE Setting Flare v DETAIL Detail v SD Detail v LCD LCD Brightness Bright v v Contrast Contrast v v Memory Memory Stick Stick Format v E pm Cable 10M 30M 50M v Comp SW Setting Panel Active 1 2 Full Part Lock v Full Lock v Test Saw 3 Step 10Step v 2 2 VTR 5 5 VTR CALL v Function SW VTR Ctrl v VF Menu Control Enable v P Absolute Relative 1 1 VR Setting White Relative 1 2 Relative 1 4 Absolute Relative 1 1 BLACK Relative 1 2 Relative 1 4 v Absolute Relative 1 1 MasterBlack Relative 1 2 Relative 1 4 Absolute gt Min gt Max Iris Relative 1 1 Relative 1 2 v Relative 1 4 WF PIX R G B RGB SEQ ENC v Note Italic Accessible only when in the ENG Mode HDC 900 950 930 Series Product Information Manual Appendix 198 Function comparison chart Function MSU 700A MSU 750 RCP 750 751 RM B750 Menu Control Item i i Direct Direct Direct Direct Menu Button Menu Button Menu Button Menu Button Operation Ctrl v v v v v ND 1 2 3 4 5 CC A B C D E Shutter on off ECS on
144. E IN ln REFERENCE SIGNAL c LL HDC 900 dli PROMPTER SIGNAL 0005 5 95 VA 244 650 HO 250944 RK 202250 90505050404 XX 2555 lt 5 e 25 e lt Re 90 HD Analog Video HD Analog Video SYNC OUT HD RET INPUT 1 to 4 HDCU 900 Picture Monitor Picture Monitor HD Analog Video HD Analog Video SYNC OUT HD RET INPUT 1 to 4 HD ANALOG VIDEO SIGNAL HD ANALOG VIDEO SIGNAL HD REFERENCE SIGNAL HD ANALOG VIDEO SIGNAL pe HDCU 900 HD ANALOG VIDEO SIGNAL HD ANALOG VIDEO SIGNAL HD REFERENCE SIGNAL HD ANALOG VIDEO SIGNAL HDC 900 950 930 Series Product Information Manual REMOTE Terminated at 750 SD ANALOG VIDEO SIGNAL SD REFERENCE SIGNAL Chapter 2 Total System 25 2 7 1 2 SD System pis HDC 950 Combination of boards E mm PIX WF HKCU 901 VCS 700 HDCU 900 l l l HKCU 901 HKCU 902 l l l l l HKCU 903 HKCU 904 HDCU 900 20000 0 MSU 700A 750 HKCU 901 HKCU 902 HKCU 903 HKCU 904 HDCU 900 950 HKCU 90
145. EG GND GND for UNREG 3 INC No connection 20 UNREG IN 10 5 Vto 17 V 4 5 IN TTL level 5 COLOR BW OUT B W GND COLOR OPEN 6 INC No connection 7 INC No connection 8 G TALLY IN ON 5V OFF GND 9 PEAKING OUT VF to CAM Zi 1 kOhms CTL ON 5 V OFF GND 10 INC No connection 11 INC No connection HDC 900 950 930 Series Product Information Manual Chapter 8 Connectors and Cables 167 8 13 VCS 700 Video Selector 8 13 1 Connector Input Output Signals 8 13 1 3 1 0 Port D SUB 37P Female Main connector input and output signals are shown below 19 1 PIX 1 to PIX 6 INPUT 1 0 Vp p VBS 75 Ohms O WF 110 WF 6 INPUT 1 0Vp p VBS 0 714 Vp p V 75 Ohms 37 20 CHARACTOR INPUT 0 7 Vp p V 75 Ohms 7 PIX A INPUT 1 0 Vp p VBS 75 Ohms WF A INPUT 1 0 Vp p VBS 75 Ohms External view PIX A PIX B OUTPUT 1 0 Vp p VBS 75 Ohms WF A WF B OUTPUT 1 0 Vp p VBS 0 714 Vp p V pin 75 Ohms No Signal Specifications SYNC OUTPUT 0 3 Vp p 75 Ohms negative 1 CH10ONI L ON 8 13 1 1 WF Mode 4P Female 2 cH2ONIN H OFF 3 ICH3ONI 4 CH4ON IN 5 CH50NI
146. ET return video CONTROL connector 6 pin This connector allows an external controller to switch return video 1 2 and 3 as well as turn the intercom microphone on and off D DC OUT connector 4 pin Used to supply power 12 V 5 W maximum to a script light of the BKP 7911 7912 Script Holder CCU camera control unit connector electro optical multi connector Connect to the CAMERA connector of the HDCU 900 Camera Control Unit using an electro optical composite cable Power and video audio and control signals are passed between the camera and the control unit using just one cable HDC 900 950 930 Series Product Information Manual D DC IN connector 4 pin Connect to a DC power source 10 5 to 17 V when using the HDC 900 as a stand alone unit D AC OUT connector Used to supply AC power 200 VA maximum VTR connector 26 pin When using the camera in stand alone use a VTR can be connected using an HDCZ cable to this connector In this case however the VTR cannot be started or stopped from the camera HD SERIAL OUT connector A serial digital interface with a transfer speed of 1 5 Gbps this connector may be used to output a video signal to a monitor or VTR Chapter 7 Location and Function of Parts and Controls 78 7 1 2 Rear Panel Video signal select buttons POWER indicator ND filter selector CC filter selector H POSI control WIDTH control D V POSI control HEIGHT
147. EXT indicator Qe SENS control knob COARSE control knob 9 age IRIS control Iris gauge Q nis AUTO button MASTER BLACK display Displays the current master black setting in the range from 99 to 99 MASTER BLACK control Manually adjust the master black level The setting is displayed in the MASTER BLACK display IRIS MB ACTIVE iris master black active button Press and light up this button to enable the iris master black control block of the panel When the PANEL ACTIVE button is pressed this button also lights If you press this button so that it goes dark the panel will be locked preventing accidental misoperation IRIS RELATIVE iris relative button When the IRIS MB ACTIVE button is lit the iris adjustment mode can be selected with this button Press and light up the button for Relative mode or press so that it goes dark for Absolute mode When the IRIS MB ACTIVE button is not lit Relative mode is automatically selected and this button is not operative HDC 900 950 930 Series Product Information Manual Q f number display Displays the f number of the current iris setting When the iris is closed CL is displayed Q EXT lens extender indicator Lights when the lens extender is used SENS sensitivity control knob Used for manual iris adjustment in Absolute mode This control is not operative when Relative mode is selected Q COARSE control knob Used
148. FF OFF OFF DETAIL KNEE KNEE LOW KEY MONO COLOR APERTURE SAT SAT COLOR CORRECT 5600K AUTO SKIN DETAIL SATURATION CONTRAST BLACK CHARACTER KNEE DETAIL GATE GAMMA Upper row OFF when the button is lit KNEE OFF Knee compensation function DETAIL OFF Detail compensation function LVL DEP OFF Level dependent function which controls the details in the dark part of a picture GAMMA OFF Gamma function CHROMA OFF Chroma function MATRIX OFF Linear matrix function to enhance color fidelity Middle row ON when the button is lit KNEE APERTURE Knee aperture function KNEE SAT Knee saturation function MONO COLOR Mono color function which mixes the chroma signals of a single hue to the luminance signal The chroma level is modulated according to the luminance signal COLOR CORRECT Color correction function for a certain hue range Lower row ON when the button is lit 5600K 5600K electronic color temperature conversion function AUTO KNEE Auto knee function When this button is lit ON the knee point is automatically adjusted according to the light content of the picture SKIN DETAIL Skin tone detail function DETAIL GATE Skin tone detail gate function When this button is lit ON the adjustment range of the skin tone detail is displayed in white on the monitor Screen SATURATION Saturation function CONTRAST Contrast function BLACK GAMMA Black gamma function
149. IDEO X OUT 95 mV p p Zo 75 Ohms 100 96 8 G GND for B VIDEO No Signal 1 0 Specifications A UNREG OUT 13 V to 17 V UNREG GND GND for UNREG 1 OHBH IN 0 3 V p p Positive pulse 2 OHB H G GND for OHB H 3 G VIDEO G GND for G VIDEO 4 G VIDEO X N 300 mV p p Zo 75 Ohms 100 5 RVIDEO X N 300 mV p p Zo 75 Ohms 100 6 RVIDEO G GND for R VIDEO 7 BVIDEO X N 95 mV p p Zo 75 Ohms 100 96 8 BVIDEO G GND for B VIDEO 9 MIC X N 60 dBu 50 dBu 40 dBu 10 MIC Y N 30 dBu 20 dBu selectable HDC 900 950 930 Series Product Information Manual INCOM MIC GND GND for INCOM MIC CHU F IRIS CONT Chapter 8 Connectors and Cables 150 No Signal Specifications No Signal 1 0 Specifications 12 IRIS CONT OUT 3 4 V F16 to 18 VF VIDEO X OUT 180 mV p p Zi 6 2 V F2 8 75 Ohms 13 CHUF OUT 0 3 V p p Positive 19 VF VIDEO G GND for VF pulse VIDEO CHU H 14 INCOM RECEIVE OUT dBu 20 PGM OUT 0 15 INCOM MIC X 20 dBu CAR 21 RX COMMAND X OUT 1340 mV p p BON MIC 22 RX COMMAND Y OUT 340 mV p p 16 INCOM MIC Y 60 dBu 23 COMMAND X IN 340 mV p p DYNAMIC 24 TX COMMAND Y IN 340 mV p p 17 CHU H OUT 150 mV p p Pos
150. IDEO Y IN VS 10V pp Zi 75 Ohms 13 VIDEO GND GND for Y VIDEO 14 VF VIDEO Pg IN 0 7 V p p Zi 75 Ohms 15 VF VIDEO IN 0 7 V p p Zi 75 Ohms External view 16 NC No connection 17 RTALLY JON 5 V SD video OFF GND i 18 INC No connection 5 Signal O Specifications 19 UNREGGND GND for UNREG 20 NC No connection 1 VTR SAVE 2 NC No connection 3 16 9 MODE IN H NORMAL 4 3 L WIDE 16 9 REC ALARM 5 COMP VBS SW IN OUT 6 NC No connection 7 INC No connection G TALLY IN Indicator lights L Indicator goes out 9 PEAKING OFF IN 10 Y 09 1 V p p VF Zi 1 5 kOhms HDC 900 950 930 Series Product Information Manual 8 14 1 5 VF 25P Female BKP 9057 O 6999 600990000 Go ex e3e2 e9 9 1990909 External view Chapter 8 Connectors and Cables 170 SD video Pin No Signal Specifications Pin Signal y o Specifications No 9 p 6 PEAKING IN Oto5 Vdc 1 VFRVIDEO 091 OUT 714 mV p p NTSC EEG eU 4 1 700 mV PAL i Zo 75 Ohms 5 7 12 OUT 12 V at 4 A POSI 8 12V OUT 12 V at 4 A 2 INC No connection 9 INC No conne
151. IF gt Top most slot 1080 59 941 SDI Film Like FC RC LC Second slot from the top RC IF Second slot from the top 1080 59 94 Analog 7 RC FC LC _ Third slot from the top 1080 501 SDI RC FC LC RC LC IF 1 Top most slot 1 When installing the IF 789A 789P board HKCU 901 confirm that the RC 86 board is installed in the second slot from the top Setting switches 2 The second slot from the top on the rear side must have the ADA 59 board HKCU 902 installed 3 The third slot from the top on the rear side must have the ADA 59 board HKCU 902 installed Switch setting System format DPR 163 board S804 LOCAL 2 83 board 5805 5807 5806 5603 52 52 1080 59 941 SDI NOT 60 intr 71001 x 1080 59 941 SDI Film Like 48 PsF 11001 80 i 1080 59 941 Analog NOT 60 Intr 1001 1080 501 SDI 50 Intr 71000 x NA HDC 900 950 930 Series Product Information Manual Chapter 2 Total System 22 Required boards Figure 2 7 1 1 Example of connection using HDCU 900 1 System format 1080 59 941 SDI Slot to be installed Slots the front ihe raai Remarks Top most slot DPR 163 SDI 54A HDCU 900 Second slot from the top RC 86 DIF 102 HDCU 900 Third slot from the top Blank Blank SERIAL RET INPUT 1 to 4 HD SDI RETURN VIDEO SIGNAL REFERENCE IN REFERENCE SIGNAL SYNC OUT HD HD REFERENCE SIGNAL
152. Interface Unit HKCU 902 HD Analog Interface Unit HKCU 903 Frame Rate Converter Unit or HKCU 904 Line Converter Unit REFERENCE IN connectors PROMPTER IN connectors SERIAL OUTPUT 1 3 connectors SERIAL OUTPUT MONI connector PROMPTER IN Q PROMPTER IN connectors BNC type Used for prompter signal input If loop through output is not used terminate the unused connector with 75 ohms If the signal used is a 1 0 Vp p 75 ohm signal it may be output from the video camera PROMPTER OUT connector with a frequency bandwidth of 8 MHz regardless of signal format SERIAL OUTPUT 1 3 HD SDI 1 2 and 3 output connectors BNC type The signal from the video camera may be output as three HD SDI signals Q SERIAL OUTPUT MONI HD SDI monitor output connector BNC type The signal from the video camera may be mixed with skin tone gate signals and some aspect marker signal and output in HD SDI format Chapter 7 Location and Function of Parts and Controls 89 7 3 4 SD Signal Input Output Block These connectors can be replaced with the optional HKCU 902 903 904 SERIAL RET INPUT 1 4 connectors SYNC OUT connector LL____ SERIAL RET INPUT _ SYNC OUT PIX OUT Q SERIAL RET INPUT 1 4 SD SDI return video 1 2 3 and 4 input connectors BNC type Four different SD SDI return video input signals may be received independently when the system is operating w
153. Jo 960 e G 2 HDCU 900 Next HDCU 900 Wes SD REFERENCE SIGNAL SD ANALOG VIDEO SIGNAL VCS VCS 700 i i I PIX 1 DE 1 2000000 REMOTE PIX A SUE J WFA CNU 700 Terminated at 75 Q HDC 900 950 930 Series Product Information Manual Chapter 2 Total System 31 2 7 1 4 HD SD Simul Gast System io HDC 900 pool HDCU 900 HKCU 901 HKCU 904 T 7 lo HDC 900 HDCU 900 HKCU 901 HKCU 904 HDCU 900 HKCU 901 HKCU 904 PIX WF HKCU 901 PIX WF HDCU 900 VCS 700 2 0101010 s00 E HDCU 900 HD SDI Monitor HKCU 901 HKCU 904 RCP 700 701 MSU 700A 750 RCP 750 751 Combination of boards Combination of boards System format Slots on the front Signal input output slot HD SD Second slot Third slot from the top from the top 1080 59 941 SDI 525 59 941 SDI RC LC IF Top most slot or second slot from the top 1080 59 941 SDI NTSC RC IF Top most slot or third slot from the top 1080 50 SDI 625 501 SDI RC LC IF Top most slot or second slot from the top 1080 50 SDI PAL RC IF Top most slot or third slot from the top Second slot from the top o
154. MERA connector on the CCU Q Number plate holder Fit the supplied number plates Q Accessory bracket Attach an optional accessory such as a BKP 791 1 7912 Script Holder HDC 900 950 930 Series Product Information Manual Lens mouth 2 Lens lock RM Z Lens lock holding knob Lens connector Cable Clamp Q Lens mode switch Q CCU connector CA camera adaptor cable fiber connector LEMO type Connect to the CCU connector on the camera adaptor D REMOTE cable 8 pin Connect to the REMOTE connector on the camera adaptor Lens connector 12 pin Connect to the LENS connector of the camera Chapter 7 Location and Function of Parts and Controls 140 7 17 2 Camera mounting Section Inner Base and the Optional BKP 9057 Viewfinder Saddle Camera mount slide lever Number plate holder VF viewfinder connector Connect to the camera connector on a viewfinder Viewfinder mount Attach the viewfinder Viewfinder release button Push this button to disengage the viewfinder Pan lock lever Turn counterclockwise to tighten the viewfinder Turn clockwise to loosen the viewfinder VF connecting cable supplied with the BKP 9057 20 pin Connects to the VF connector 20 pin on the camera Saddle lock knob Locks the saddle so it does not topple down Turn counterclockwise to tighten the saddle or clockwise to loosen it Number plate holder F
155. MMA Black gamma function CHARACTER Self diagnostic display function When this button is lit ON the contents of the self diagnosis of the CCU HDCU series are displayed on the monitor connected to the CHARACTER OUTPUT connector of the CCU HDCU series The contents are also mixed to the video signal to be output from the PIX1 OUTPUT connector Each time you press this button the status changes as follows OFF ON page 1 ON page 2 ON page n OFF The contents of the self diagnosis may be displayed when required even if this button is not lit The right two buttons are for future use and do not function at present HDC 900 950 930 Series Product Information Manual WHITE white balance manual adjustment knobs Used to manually adjust the white balance From the left the knobs are for R G and B signal adjustment Q BLACK FLARE black balance flare balance manual adjustment knobs and indicator Used to manually adjust the black balance when the indicator is not lit or the flare balance when the indicator is lit From the left the knobs are for R G and B signal adjustment Selection between black balance and flare balance is made using the Maintenance menu Camera number tally indication window The number of the camera being controlled from this panel is displayed in orange When a red tally signal is sent to the camera the number is displayed in black and the background of the number lights
156. No connection 19 INC No connection 20 NC No connection CAM BODY HKC T950 26P MALE OOOO OzOzOc0 Ov External view No Signal 1 0 Specifications 9 MIC X OUT 60 dBu 50 dBu 40 dBu 10 MIC Y OUT 30 dBu 20 dBu selectable 11 INCOM MIC GND GND for INCOM MIC CHU F IRIS CONT 12 IRIS CONT IN 3 4 V F16 to 6 2 V F2 8 13 CHUF IN 0 3 V p p Positive pulse 14 INCOM RECEIVE IN 0 dBu 15 INCOM MIC X OUT 20 dBu CAR BON MIC 16 INCOM MIC Y OUT 60 dBu DYNAMIC MIC 17 CHUH IN 150 mV p p Posi tive pulse 18 VF VIDEO X IN 180 mV p p Zi 75 Ohms 19 VF VIDEO G GND for VF VIDEO CHU H 20 PGM IN 0 dBu 21 RX COMMAND X IN 340 mV p p 22 RX COMMAND Y IN 340 mV p p 23 TX COMMAND X OUT 340 mV p p 24 TX COMMAND Y OUT 340 mV p p OPT HEAD HKC T950 26P FEMALE OROS ORONO OZOEO O Ow O 20200 ORO NON O gt O External view No Signal Specifications A UNREG IN 13 V to 17 V B UNREG GND GND for UNREG 1 OHB H OUT 0 3 V p p Positive pulse 2 OHB H G GND for OHB H 3 G VIDEO G GND for G VIDEO 4 VIDEO X OUT 300 mV p p Zo 75 Ohms 100 5 R VIDEO X OUT 300 mV p p Zo 75 Ohms 100 96 6 RVIDEO G GND for R VIDEO 7 BV
157. ON A frame marking 90 of the picture area the safety zone will be displayed on the viewfinder screen Using the Marker Settings page in the HDC 900 950 930 Series Product Information Manual Operation menu the size of the displayed frame may also be set to 80 92 5 or 95 of the picture area OFF The safety zone will not be displayed DISPLAY switch The functions of the DISPLAY switch are as follows ON Text and messages describing the camera settings and operating status may be displayed on the viewfinder screen OFF Status messages will not appear on the viewfinder screen MENU Menus for camera settings will be displayed on the viewfinder screen D MENU SELECT switch The functions of the MENU SELECT switch are as follows ENTER Confirm the menu or page selected using the MENU SELECT control or confirm setting values CANCEL Cancel menu setting values or return to page select mode or the top menu MENU SELECT control Used to select menu items or change setting values in the menus displayed on the viewfinder screen Assignable switch You can assign a function such as lens extender ON OFF using the OPERATION menu VF DETAIL viewfinder detail adjustment switch ON Emphasizes the contours of the image on the viewfinder screen When the switch is set to this position you can adjust the amount of detail using the VF DETAIL control OFF Disables contour emphasis D VF DETAIL viewfinder
158. OR STORE button Press this button to store the size and position of the box cursor in memory Note If the CURSOR ON button is not lit box cursor information will not be stored CURSOR ON button When this button is pressed the button will light up and the box cursor will be displayed on the viewfinder screen When the button is pressed again the light will go off and the box cursor will disappear HEIGHT control Adjust the height of the box cursor displayed on the viewfinder screen within the effective resolution area V POSI vertical position control Adjust the vertical position of the box cursor displayed on the viewfinder screen within the effective resolution area WIDTH control Adjust the width of the box cursor displayed on the viewfinder screen within the effective resolution area HDC 900 950 930 Series Product Information Manual H POSI horizontal position control Adjust the horizontal position of the box cursor displayed on the viewfinder screen within the effective resolution area VF viewfinder connector D sub 25 pin Connect to the viewfinder CAMERA connector INTERCOM 1 and 2 connectors XLR 5 pin Connects to an XLR 5 pin headset The INTERCOM 1 connector may be used for communications even when the power to the camera is turned off by the HDCU 900 Camera Control Unit Installing the BKP 7913 RTS Intercom System Kit option allows the INTERCOM 2 connector to work with an RTS in
159. OWER switch Q attention indicator Red tally lamps BRIGHT control Friction adjustment lock lever CONTRAST control PEAKING control BATT indicator Green tally lamps QD Lift lock release knob 1 External tally lamp External tally dimmer control TALLY ON OFF switch Blanking marker ON OFF switch Tally dimmer switch Lift lock release knob 2 CAMERA connector D Clamper D Mounting wedge BRIGHT brightness control Adjusts the picture brightness Q Friction adjustment lock lever Adjusts the amount of friction in the tilting mechanism Also locks the viewfinder into a desired angle The angle is locked when the lever is pushed toward the camera lens When the lever is pulled toward the back of the camera the tilting mechanism can be adjusted CONTRAST control Adjusts the picture contrast Chapter 7 Location and Function of Parts and Controls 138 PEAKING control Sharpens the edges in the picture Turning the control clockwise increases the sharpness The peaking can be adjusted from off to 16 dB Q BATT battery indicator This indicator blinks when the voltage output of the camera battery drops When the battery reaches a point that it may no longer be used the indicator will light up To prevent camera shut down due to the battery running down change the battery as soon as possible after this indicator begins blinking The threshold battery vo
160. PROMPTER IN PROMPTER SIGNAL SERIAL OUTPUT 1 to 3 HD SDI SIGNAL 619 o9 5 800 059000000 5 00 5 500 S x o 9 9 Os 5 00 lt x x lt HDC 900 eo e e e e 9 0 HDCU 900 e e e OE A e Jo o o e0 3 99 SERIAL RET INPUT 1 to 4 HD SDI RETURN VIDEO SIGNAL i D SYNC OUT HD HD REFERENCE SIGNAL HDC 900 SERIAL OUTPUT 1193 HD SDI SIGNAL eo e e e eC Je HDCU 900 SD REFERENCE SIGNAL Md SD ANALOG VIDEO SIGNAL HD SDI Monitor HD SDI Monitor x e Je oe LJ Q L3 O 5 pum CNU 700 Terminated at 75 Q PIX 1 PIX 2 VCS 700 90000 00000 2 REMOTE PIXA WEA HDC 900 950 930 Series Product Information Manual Chapter 2 Total System 23 Figure 2 7 1 2 Example of connection using HDCU 900 2 System format 1080 59 941 SDI Film Like Required boards Slot to be Installed Slots the iront e ihe taai Remarks Top most slot DPR 163 SDI 54A HDCU 900 Second slot from the top FC 83 SDI 54B HKCU 903 Third slot from the top RC 86 DIF 102 HDCU 900 SERIAL RET INPUT 1 to 4 HD SDI RETURN VIDEO SIGNAL REFERENCEIN HD REFERENCE SIGNAL
161. RE 22 2 7 1 2 SD 26 2 7 1 3 Progressive and Cinema Production System 30 2 7 1 4 HD SD Simul Cast System 32 2 7 2 Setting the System Format using 950 34 2 7 2 1 Standard 2 35 2 7 2 2 Standard HD SD 36 2 7 2 3 HD SD Film Like System 37 2 7 2 4 Analog NTSC PAL System 38 2 8 Rack Mounting of System Equipment 39 Chapter 3 Benefit of Sony ADSP Advanced Digital Signal Processing 42 3 1 Full DSP Camera 0 43 3 2 Precise Handling of Highlight Position 44 3 3 Outstanding reliability and easy maintenance 48 3 4 Low power consumption 48 Chapter 4 Control System 49 4 1 Sony Camera Command Network System 50 4 2 Master Set up Unit NSU 700A 750 50 4 3 Camera Command Network Units CNU 700 and CNU 500 51 4 4 New Remote Control Panels 750 751 57 3 5 AU SO
162. RT 4 MSU RCP CCU VCS AUX 40 EXT 24 NPUT OUTPUT PORT 5 TXGND GND for TX 41 0 27 NPUT OUTPUT PORT 6 POWER Not used 42 EXT 0 32 NPUT OUTPUT PORT 7 C Not used 43 EXT I O 35 NPUT OUTPUT PORT 8 SPARE m 44 40 OUTPUT PORT CHASSIS GND CHASSIS GND 45 EXT l O 43 OUTPUT PORT 46 EXT 0 46 NPUT PORT 8 6 1 2 1 0 PORT 50 pin Female 47 5 V OUT Utility power 5 V 48 GND 5 V GND for utility power 5 V 68688668585858858 49 GND 12 V GND for utility power 12 V Q 5885885858088805598 50 SPARE No connection 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 OO OOOOOOO0 O0 O O O O O 1 INPUT ON 5 V OFF OV OUTPUT TTL LEVEL External view us Signal Specifications 1 EXT 00 INPUT OUTPUT PORT 2 EXT I O 03 INPUT OUTPUT PORT 3 06 INPUT OUTPUT PORT 4 EXTI O 11 INPUT OUTPUT PORT 1 5 EXTI O 14 INPUT OUTPUT PORT 6 EXT I O 17 INPUT OUTPUT PORT 7 EXT I O 22 INPUT OUTPUT PORT 8 25 INPUT OUTPUT PORT 9 EXT I O 30 INPUT OUTPUT PORT 10 EXTI O 36 INPUT OUTPUT PORT 11 EXTI O 03 INPUT OUTPUT PORT 12 EXTI O 41 OUTPUT PORT 13 44 INPUT PORT 14 47 INPUT PORT 15 12 V OUT Utility power 12 V 16 12 V OUT Utility power 12 V 17 5 connection 18 01 INPUT OUTPUT
163. S GND N OUT AC 100 V 200 V or L UTL H OUT below DC IN 4P MALE AUDIO IN CH1 CH2 FEMALE External view O O 2 3 Or External view No Signal 1 0 Specifications 1 GND GND for DC 2 NC No connection 3 NC No connection 4 DC IN 10 5to 17 V dc No Signal y o Specifications 3 AUDIO Y IN AUDIO G 60 dBu 50 dBu 40 2 AUDIO X IN dBu 30 dBu 20 selectable High imped ance Balanced 0 dBu 0 775 Vrms INTERCOM CH1 CH2 5P FEMALE 5 O 3 1 JD External view VTR 26 MALE HDC 900 External view No Signal INCOM MIC Y Specifications IN 20 dBu CAR 2 INCOMMIC X IN BON 60 dBu DYNAMIC MIC GND INCOM PGM 4 INCOMRECEIVE OUT 0 dBu 5 PGM OUT 0 dBu HDC 900 950 930 Series Product Information Manual No Signal y o Specifications A NC No connection B VTR CMD GND GND for VIR CMD 1 IGENLOCK Sync 0 6 V p p OV dc Zi 75 Ohms 2 GENLOCK GND GND for GENLOCK 3 G Y GND GND for G Y 4 DC IN 1 Vp p 0 V dc Zo 75 Ohms 5 IR PR OUT 1 Vp p 0 35 V p p OV Zo 75 Ohms 6 R PR GND GND for R PR 7 B Pg OUT 1 Vp p x0 35 V p p OVdc Zo 75 Ohms 8 B Pg GND GND for B P
164. SAT SAT COLOR CORRECT 5600K AUTO SKIN DETAIL SATURATION CONTRAST BLACK KNEE DETAIL GATE CHARACTER 7 8 3 Connector Panel Q POWER switch AC IN connector jn ER CF IN POWER switch Turns on and off the power of this unit AC IN AC power input connector Connect to an AC power source using an optional AC power cord The power cord can be fixed to this unit using an optional plug retainer CCU CNU REMOTE camera control unit camera command network unit remote connector 8 pin Connect to the RCP CNU connector of CCU or the MSU connector of CNU HDC 900 950 930 Series Product Information Manual Right two buttons in the upper row OFF when the button is lit SD MATRIX OFF To turn on off the linear matrix in down converting SD DETAIL OFF To turn on off the SD contour compensation function in down converting Fourth button from the left in the middle row ON when the button is lit LOW KEY SAT To turn on off the low key saturation function linear matrix for dark areas Menu operation block 1 MODE mode select buttons The uppermost MODE button in the menu operation block functions as the FUNCTION button both in HD and SD camera systems Use the unit with the supplied label attached as shown below FUNCTION buttons Selects Function menu to control various camera and CCU functions g m 3 gt m o o
165. SONY High Definition Video System Digital graze Sony Multiformat Camera System HDC 900 950 930 Series Product Information Manual Table of Gontents Chapter 1 Introduction 8 DORN coer ie ER sts Eee E pars 9 1 2 Advanced Digital Signal Processing 0 9 1 3 Sony Design riterid ee eee R 9 1 4 Features of the HDC 900 050 930 9 1 5 Features of the System 11 Chapter 2 Total System 13 2 1 System Configuration u J l du uuu ued Ree eee eS RR RO ERR Se E 14 zw Den HEIL x1 a qd ad M 17 2 3 Camera Control 18 zu GOBHOL SUSIBHE uso ass s s d CR SC RORIS ADR ORTU EH ee 19 2 5 VIGWHNOES ccc eek hse EKER RK r istr REE RRR 19 2 6 Optional Apcessories 20 2 1 SUSIE SOW RE ERE ERE EAE 21 2 7 1 Setting the System Format using HDCU 900 21 2 7 151 HDYSYSIOM ee a alana s T
166. T and LOCK modes FULL mode All controls from this unit are enabled panel active status Both this button and the IRIS MB ACTIVE indicator in the iris master black control block light PART mode Controls only from the iris master black control block are enabled iris master black active status This button goes dark but the IRIS MB ACTIVE indicator stays lit LOCK mode All controls from this unit are disabled lock status Both this button and the IRIS MB HDC 900 950 930 Series Product Information Manual White balance black balance control block lris master black control block ACTIVE indicator in the iris master black control block go dark Using the RM Configuration menu under the Maintenance menu the function of this button can be changed to switch only between FULL and LOCK modes The RM Configuration menu operation is possible in any mode STANDARD button When you press this button the video camera is initialized to its standard state and the button lights for Several seconds If you press the button while lit the video camera retrieves the state before the button was lit Q Spare button For future use Q Test signal output select buttons Press and light up one of these buttons to activate the test signal generator of the video camera and send the respective signals TEST To send a signal to test the video circuits You can select the kind of the test signal to be output using the RM Config
167. Y R OUTPUT BNC R Y 0 7 V p p 75 Ohms for UC during 75 color bar input 0 525 V p p 75 Ohms for CE during 75 color bar input R 0 7 V 75 Ohms VBS OUT 1 2 BNC 1 0 V p p 75 Ohms PIX OUT BNC 1 0 V p p 75 Ohms HDC 900 950 930 Series Product Information Manual WF OUT BNC 0 714 V p p 75 Ohms ENC 1 0 V p p SYNC OUT BNC 0 3 V p p SD SYNC 75 Ohms HKCU 902 1125 analog signal RET INPUT 1 4 BNC 1 0 V p p picture 0 7 V sync 0 3 V 75 Ohms Y G OUTPUT 1 2 BNC 1 0 V p p picture 0 7 V sync 0 3 V 75 Ohms PB B OUTPUT 1 2 BNC B 1 0 V p p picture 0 7 V sync 0 3 V 75 Ohms Picture 0 35 V Sync 0 3 V 75 Ohms PR R OUTPUT 1 2 BNC R 1 0V p p picture 0 7 V sync 0 3 V 75 Ohms PR Picture 0 35 V Sync 0 3 V 75 Ohms PIX OUT BNC 1 0 V p p picture 0 7 V sync 0 3 V 75 Ohms BNC 0 3 V ternary SYNC 75 Ohms HKCU 903 1125 digital signal SERIAL RET INPUT 1 4 BNC 1 485 Gbps 1 4835 Gbps SMPTE 292M SERIAL OUTPUT 1 3 MONI BNC 0 8 V p p 75 Ohms 1 485 Gbps 1 4835 Gbps SMPTE 292M Analog signal SYNC OUT BNC 0 3 V ternary SYNC 75 Ohms SYNC OUT BNC 0 3 V ternary SYNC 75 Ohms FRAME REFERENCE IN BNC 0 3 V ternary SYNC 75 Ohms Black burst 0 286 V p p 75 Ohms for UC 0 3 V p p 75 Ohms for CE FRAME REFERENCE OUT BNC THROUGH OUT 0 3 V p p FRAME SYNC pulse 75 Ohms HKCU 904 720 60P signal SERIAL RET INPUT 1 4 BNC
168. a select block and the ACCESS indicator The master brightness can be adjusted with the rightmost control knob When the adjustment is completed Press Home to return to the MSU adjustment menu and press Exit to release the menu operation 6 3 4 7 To adjust the brightness of the EL display You can adjust the brightness of the display of the menu control block To adjust the brightness proceed as follows HDC 900 950 930 Series Product Information Manual 1 Press MSU Adjusting on the MSU Configuration menu to display the MSU Adjustment menu 2 Press EL Bright to set it to inverse video The ower half of the display becomes the EL Display adjustment display LED Disp Bright EE Bright Bright EL Display Brightness mea 50 3 Adjust the brightness with the leftmost control knob When the adjustment is completed Press Home to return to the MSU adjustment menu and press Exit to leave this menu 6 3 4 8 To adjust the brightness of the LED displays MSU 750 only You can adjust the brightness of the LED displays camera number indicators on the control panel To adjust the brightness proceed as follows 1 Press MSU Adjusting on the MSU Configuration menu to display the MSU Adjustment menu 2 Press LED Disp Bright to set it to inverse video The lower half of the display becomes the LED Display Brightness adjustment display Dis LEM Bright EL Brion Bright
169. ale 1 Clear Scan selection 60 1 to 4300 Hz AUDIO IN 1 2 XLR 3 pin female 1 Modulation depth 45 or more horizontally EARPHONE OUT Minijack 1 8 ohms 800 TV lines at center DC IN XLR 4 pin 1 10 5 to 17 V 27 5 MHz with typical lens DC Smear level typical 425 dB DC OUT 4 pin 1 10 5 to 17 V DC Frequency response Within 0 5 dB 10 to 25 5W maximum MHz HD SERIAL OUT BNC type 1 Within 1 0 dB 25 to 30 INCOM1 and 2 XLR 5 pin female 1 MHz TEST OUT BNC type 1 Horizontal resolution 1000 TV lines at center of GENLOCK IN RET IN PROMPT OUT screen BNC type 1 1 Vp p 45 10 5 27 5 MHz 75 ohms Geometric distortion Negligible not including RET CONT 6 pin 1 lens distortion REMOTE 8 pin 1 TRACKER 20 pin 1 Optical system specifications EXT 20 pin 1 Spectral system F1 4 prism Built in filters Color temperature Supplied accessories conversion filters Operation manual 1 A cross filter Installation amp maintenance manual 1 B 3200K clear C 4300K Optional accessories D 6300K BKP L551 Battery Adaptor E 8000K BKW 401 Viewfinder Rotation Bracket ND filters C 74 Microphone 1 clear CA 905L Large Lens Adaptor 2 1 4 ND CAC 6 Return Video Selector 3 1 8 ND CAC 12 Microphone holder 4 116 ND HDVF 20A HD Electronic Viewfinder 5 1 64 ND HDVF C750W HD Electronic Viewfinder Servo filter control Yes MSA 4A 8A 16A Memory Stick Lens mount Sony bayonet mount VCT 14 Tripod adaptor Laser Diode Properties Maintenance ma
170. amera equipment The cost effective 2 3 inch type 2 2 million pixel IT CCD used in the HDC 930 provides equivalent performance as the FIT version CCD excluding the vertical smear level which is provided at 125 dB typical numbers 12 bit A D conversion and ADSP Advanced Digital Signal Processing The combination of 12 bit A D conversion and the new 2 2 million sensor CCD provides excellent color rendition and overall picture quality The powerful ADSP circuitry enables camera set up parameters to be adjusted over a wide range Menus are used to select the required parameters such as gain gamma flare pedestal and detail and with adjustments made from a central Master Set up Unit Chapter 1 Introduction 9 MSU parameter settings can be transferred to other cameras in a system for perfect picture matching Ergonomic Body Design For over two decades Sony has been designing and manufacturing broadcast video cameras and camcorders In creating these designs great importance has always been given to achieving control layouts based on the practical operational requirements of the user The control layout of the HDC 900 therefore naturally follows that of other HDC and BVP Series cameras For example the V F adjustment and controls for the intercom system V F return selection lens filter selection etc are alllocated in similar positions to previous models so that operators with experience of Sony cameras can operate
171. anual No Signal Specifications 1 45 5 V OUT Max 250 mA No Signal Specifications 2 TALLY GND GND for TALLY 1 INC No connection 3 GTALLY OUT ON GND Max 30 mA 2 NC No connection IN 3 NC No connection 4 RTALLY OUT ON GND Max 30 mA 4 NC No connection 5 CHU MIC CONT2 Refer the below col Mis 6 3 B LOW ACTIVE 6 AMP CONTI T Refer to the below col 2 RECALLT R EE 8 RECALLA SEQ LOW 7 GAININCONTO 7 Refer to the below col 9 GND umn 10 NC No connection 8 MIC1 GAIN CONT Refer to the below col 11 NC No connection ON OFF IN umn 12 5 ENC LOW 9 GND GND for 45 5 V 13 6 R B LOW ACTIVE 10 TALLY OUT R G TALLY OUT 14 RECALL7 R G LOW ACTIVE nr GAD Max 15 RECALL8 G B LOW ACTIVE 11 INC No connection 4735HD 1730HD 12 ASPECT REMOTE L REMOTE ON OFF No Signal Specifications 13 ASPECT CONT1 Refer to the below col 1 lLNEFIELD LINE 5 V dc FIELD 0 V dc 14 CTL CONT2 5 Refer to the below col 2 FOUR OUT FOUR 0 V do umn 15 2 GAIN CONT 2 Refer to the below col 3 C 4 ON OFF IN umn 4 1 REMOTE 5 V dc 1 CHU MIC 1 2 AMP GAIN ENB 0 V dc 5 RECALL1OUT RECALL 5 V dc CONTO CONT1 CONT2 CHU MIC AMP GAIN 6 STORE OUT STORE 0 V dc H H H 60dB 7 RECALLOOUT _ 5 dc H H 50dB 8 THREE OUT THREE 0 V dc H L H 409 9 GND GND for si
172. anual REMOTE PORT connector CCU CNU REMOTE camera control unit camera command network unit remote connector 8 pin Connect to the RCP CNU connector of the CCU 700A 700AP or the MSU connector of the CNU 700 AUX REMOTE auxiliary remote connector 8 pin Chapter 8 Connectors and Cables 162 V O PORT connector 50 pin Reserved for future use N Signal Specifications Main connector input and output signals are shown below 25 EXT 26 INPUT OUTPUT POR 26 0 31 INPUT OUTPUT PORT 8 6 1 1 REMOTE 8 pin Female 27 EXT 0 34 INPUT OUTPUT PORT AUX 28 EXT 37 INPUT OUTPUT PORT CCU CNU 29 42 OUTPUT PORT 30 EXT I O 45 INPUT PORT GOA 31 45V OUT Utility power 5 V 32 GND 5 V GND for utility power 5 V 33 GND 5 V GND for utility power 12 V m 1 Esqermal saw 34 EXT I O 02 NPUT OUTPUT PORT 35 05 NPUT OUTPUT PORT No Signal Specifications 36 EXT 10 NPUT OUTPUT PORT 1 MSU Serial data 37 EXTI O 13 NPUT OUTPUT PORT 2 TXO MSU Serial data 38 EXT 0 16 NPUT OUTPUT PORT RX CCU CNU AUX Serial data 39 EXT 21 NPUT OUTPUT PO
173. anual Chapter 2 Total System 41 HDC 900 950 930 Series Product Information Manual Benefit of Sony ADSP Advanced Digital Signal Processing 3 1 Full DSP Camera Processing The HDC 900 Series uses 12 bit A D conversion Photo 3 1 Multi Matrix ON and OFF based on the latest LSI technology This advanced technology has allowed Sony to take a major step forward from the 10 bit conversion of its previous generation of cameras a move that was not possible with earlier A D converters and DSP LSIs 1 Multi Matrix Multi Matrix is a function that electronically adjusts the basic RGB color taking characteristics of the camera to achieve optimum colorimetry It makes it easy to match the color of cameras under multi camera operations or to reproduce the characteristics of another type of camera It can also be used to manipulate color for a particular special effect A conventional linear matrix function provides only six adjustable parameters with considerable interaction between their effects on a specific color Multi Matrix divides the spectrum into 16 segments each of 22 5 degrees for each of which there is an independent hue and saturation parameter Multi Matrix allows the selection of each of these segments with separate adjustment of hue and saturation parameters Operation flow is as follows 1 Select Multi Matrix on the paint menu of the MSU 700A 750 Master Set up Unit 2 Turn the Matrix and the Multi switches to
174. as but they can also be easily integrated into conventional studio OB vehicle systems that use earlier BVP 900 700 500 Series cameras The HDC 900 950 family has the following features High picture quality and high performance The new 2 3 type 1080 FIT CCD with 2 200 000 pixels a unique CCD output signal processing circuit and a 12 bit A D converter provide high picture quality and excellent performance for the HDC 900 and HDC 950 A high cost performance IT type HDC 930 is also available Newly designed integrated unit HDC 950 930 only Low power consumption and high efficiency of heat radiation were addressed by integrating the camera and camera adapter into a single unit improving the reliability In addition five filter discs each for CC and ND are provided as standard to match the operability of the studio use HDC 900 Multiple formats The HDC 900 and HDC 950 operate with various formats covering 24PsF 50i 25PsF 30PsF as well as 60i systems while the HDC 930 operates with 50i and 60i systems HDC 900 950 930 Series Product Information Manual Memory Stick operation The camera is equipped with a Memory Stick drive which enables setup data storage and software upgrading using Memory Stick media cards 1 Memory Stick is a trademark of Sony Corporation Selection of gamma table Multiple gamma tables are provided enabling you to use multiple formats and perform flexible image creation Wid
175. ay be received independently The selection of RET 1 2 3 or 4 is made by the camera s return switch The type of input signal on RET 1 2 3 and 4 may be set individually using switches on the internal AT board or using the MSU 700A 750 Master Setup Unit REFERENCE IN connectors BNC type Used to input an HD tri level reference sync signal or SD reference sync signal black burst signal If loop through output is not used terminate the unused connector with 75 ohms Note To use the VBS signal of the HKCU 901 when SC phase lock is required use an SD reference sync signal black burst signal HDC 900 950 930 Series Product Information Manual Note Use of a case wider than 42 mm can cause interference at connectors 2 4 5 It is recommended to use JAE made DA C1 J10 CHARACTER OUTPUT connector BNC type Used to output the results of the HDCU 900 diagnostic self test in SD black and white analog video format Q DIGITAL AUDIO connector BNC type Used to output a digital audio signal input to the camera Q MIC OUTPUT microphone output connectors XLR 3 pin Used for output of the microphone input to the video camera INTERCOM TALLY PGM program audio connector D sub 25 pin Used for input and output of intercom tally and program audio signals Connect to the intercom tally program audio connector of the intercom system Q Expansion slot For installation of the optional HKCU 901 SD Analog
176. bserve the signal from the camera Chapter 7 Location and Function of Parts and Controls 134 7 14 1 Appearance Viewfinder cable Microphone holder 1 14 HDVF 20A HD Electronic Viewfinder Plug Stopper Tally indicator rear Diopter adjustment ring Tally indicator front PEAKING control CONTRAST control BRIGHT control ZEBRA TALLY Plug Connect to the VF connector on the camera Stopper Prevents the viewfinder from coming off the camera when it is slid from side to side Tally indicator rear Lights up when the camera receives a tally control signal This indicator can be covered when not in use Diopter adjustment ring Allows for optimal focus adjustment HDC 900 950 930 Series Product Information Manual TALLY switch ZEBRA switch DISPLAY ASPECT switch Tally indicator front Lights up when the camera receives a tally control signal Setthe TALLY switch to OFF when not in use The brightness can also be adjusted with the TALLY switch Q PEAKING control Turning this control clockwise adjusts the picture sharpness and makes focusing easier This control has no effect on the output signals of the camera Q CONTRAST control Adjusts the contrast of the screen This control has no effect on the output signals of the camera Chapter 7 Location and Function of Parts and Controls 135 BRIGHT control Adjusts the brightness
177. but also it cannot be changed manually When you wish to change the iris turn Auto lris off If Auto Iris is kept ON the skin tone auto iris will start functioning when the subject for reference is resumed Chapter 7 Location and Function of Parts and Controls 116 For the skin tone auto iris refer to the system manual Iris control When the AUTO button is not lit you can adjust the iris manually by turning the control The adjustment value is displayed in f numbers on the display When the AUTO button is lit the reference value for automatic iris adjustment can be set in a range of 2f with this control D MASTER BLACK control block Turn the control to adjust the master black level The adjustment value is displayed in the display window Camera number tally indication window The number of the camera being controlled from this unit is displayed in orange When a red tally signal is sent to the camera the number is displayed in black and the background of the number lights in red When a green tally signal is sent to the camera the number is displayed in black and the background of the number lights in green When both the red and green tally signals are simultaneously sent the left half of the background lights in red and the right half lights in green HDC 900 950 930 Series Product Information Manual Chapter 7 Location and Function of Parts and Controls 117 7 10 1 Operation Panel RCP 750 Control selec
178. cameras all the processing parameters are completely and precisely defined at the design stage and almost all the potentiometers are replaced by semiconductor memories Consequently Sony ADSP cameras show extremely stable performance regardless of environmental conditions such as temperature humidity shock and vibration This high stability together with the advantages of the self 3 4 Low power consumption To achieve its design aim of complete digital processing including digital implementation of the nonlinear processing stages Sony has developed VLSIs which contain over 1 600 000 actual gates This complexity demonstrates the advances that Sony has made in the application of its semiconductor technology Despite this complexity Sony ADSP cameras approach the same low power consumption as previous analog digital portable cameras This has been made possible by using the Sony EDA Electronic Design Automation system to optimize the complex camera circuitry in a short time scale and to incorporate the latest LSI technologies 2 5 V drive and 0 35 umdesign rule to give a total power consumption of just 25 W for the HDC 950 portable HD camera in stand alone use without options 3 3 Outstanding reliability and easy maintenance contained menu system enables easy and accurate set up of camera systems for regular realignment Finally a great benefit of Sony ADSP cameras is their advanced self diagnostic system HDC 900 Series
179. cameras detect problems in their digital processing and provide a viewfinder warning indication Detailed information such as identifying the faulty board is also shown on the Master Set up Unit screen and the Camera Command Network Unit character display to provide easy and rapid fault location Chapter 3 Benefit of Sony ADSP Advanced Digital Signal Processing 48 4 1 Sony Camera Command Network System 4 2 Master Several decades of TV operations have led to the development of many alternative operational and engineering philosophies relating to the deployment of video and technical control and to the monitoring and routine maintenance of multi camera studio and OB truck installations Sony has re examined the entire studio camera architecture with the goal of structuring a far higher degree of system flexibility This new architecture is based on Set up Unit MSU 700A 750 The Master Set up Unit MSU is the centralized technical control position for multi camera systems The MSU 700A 750 has been designed to provide comprehensive and wide ranging technical supervision and alignment of a complex camera system from a single centralized panel If itis desirable in a large program origination complex to extend this supervision to more than one control location for example separate operational and engineering maintenance control centers then a number of MSU 700A 750 units can access the entire camera system To exerci
180. can be adjusted with the rightmost control knob 6 3 4 4 To turn on off the buzzers independently Press the corresponding button When it is in inverse video the buzzer is on Call Buzzer For the buzzer sound when a call signal is received Touch Click For the buzzer sound when a button displayed on the menu display is operated Switch Click For the buzzer sound when a button on the panel is operated 6 3 4 5 To turn off all the buzzers Press Off When the adjustment is completed Press Home to return to the MSU adjustment menu and press Exit to release the menu operation 6 3 4 6 To adjust the brightness of the LEDs You can adjust the brightness of the LEDs of the panel buttons and camera number tally indication window To adjust the brightness proceed as follows 1 Press MSU Adjusting on the MSU Configuration menu to display the MSU adjustment menu 2 Press LED Bright to set it to inverse video The lower half of the display becomes the LED Brightness adjustment display EL 1 bell Bright EL Bright v LED Brightness Switch Tally Other LED Master 72 78 93 78 3 Adjust the brightness with the three corresponding control knobs Switch Brightness of the built in LEDs of the control buttons Tally Brightness of the built in LEDs of the camera number tally indication window Other LED Brightness of the other LED indicator such as those of the camer
181. ceed with operations as desired Cate Subcategory Setting Contents Operation gory For menu operations use the menu operation block of Sets the cable the unit to start the menu operation Cbl 10m length for the To select the Basic menu Comp Len 50m cable compen Push the RM Configuration switch in the Y direction 100m sation circuit The menu display shows Comp the first category Sets the bright of the Basic menu 1010 ness of the To select the Detail menu _ LED 99 50 LEDs on the Push the RM Configuration switch in the Y direction Bright control panel while holding the CANCEL ENTER switch toward ng ENTER The menu display shows Mode the first 10 to Sets the bright category of the Detail menu Disp 99 50 1688 of the Note menu display The RM Diag category of the Detail menu is used to 10 to Sets the sound display various information to check operations and Lvl 99 50 volume of the reset the menu For items for which the operation buzzer procedure differs the procedure is discussed in the Eger Turns buzzer corresponding Contents column Out On Off output on and To make settings on the menu off 1 Turn the menu select knob until the required category appears on the display Example Mode Set VR Setup 2 Push the CANCEL ENTER switch toward ENTER to register your selection made in step 1 The first subcategory of the selected category appea
182. component video signal output connectors BNC type Used for output of either Y B Y R Y component video signals or G B R component video signals The type of signal is selected using switches on the EN board Factory setting G B R 7 4 5 HKCU 953 HD Frame Rate Converter Unit The optional HKCU 953 is to be installed in the slot for the DIF board SD output block internal RC board after moving them to the expansion slot Connector panel SDI board Q HD SDI OUT 1 and HD SDI OUT 2 connectors FRAME REF IN and OUT connectors Q HD SD OUT 1 and HD SDI OUT 2 HD SDI output 1 and 2 connectors BNC type These connectors output the signals from the camera as HD SDI signals When the camera is operating in 24PsF mode frame conversion can be applied to input signals to provide 60i 50i signals from these connectors FRAME REF IN and OUT frame reference input and output connectors BNC type The IN connector is used to receive an HD tri level reference sync signal or SD reference sync signal black burst signal for frame sequence lock between camera control units The signal supplied to the IN connector is output from the OUT connector as is When this unit is used as the master unit the OUT connector can be used as the frame sync pulse output connector for pull down Chapter 7 Location and Function of Parts and Controls 97 7 4 6 Internal Switches and Internal Boards Internal switches The followi
183. conds Turn on the camera power When the VTR START button is pressed recording will begin immediately ON SAVE ON STBY GAIN switch1 Used to select the gain of the video amplifier based on lighting conditions The gain values for the L M and H settings may be set using the menus When shipped Chapter 7 Location and Function of Parts and Controls 82 from the factory the values set are L 0 dB M 6 and H 12 dB When the MESSAGE setting on the VF DISPLAY page of the OPERATION menu is set to ON the newly selected gain value will be displayed in the setting change adjustment progress message display area of the viewfinder screen for three seconds when the gain setting is changed using this switch Example GAIN 12 dB D OUTPUT output signal selection AUTO KNEE Switch1 Used to select the signal color bar signal or camera s video signal to be used as output to a VTR the viewfinder or a video monitor When the camera s video signal is being used as output the auto knee function may be used The relationship between the switch setting and the output signal and auto knee function is shown in the table below AUTO OUTPUT KNEE Function BARS OFF Output is a color bar signal Output is the camera s video CAM OFF signal The auto knee circuit is disabled Output is the camea s video CAM ON signl The auto knee circuit is enable WHITE BAL whit
184. control CURSOR ON button CURSOR STORE button RET 2 button RET 1 button RETURN SELECT knob 2 FILTER LOCAL button Q UP TALLY switch RETURN SELECT knob 1 Memory stick section Back tally lamp VF SCAN switch SCREEN SIZE MARKER switch CENTER MARKER switch ood 080 o o o Paa INTERCOM PROD ENG switch INTERCOM volume control 1 2 switch PGM volume control MIC ON OFF switch Video signal select buttons Select the video output signal R G or B to the viewfinder The R G and B buttons may be pressed individually or in combination The signal corresponding to each pressed button will be output When two buttons are pressed the output of will consist of those two signals mixed together The video output to the monitor connected to the TEST OUT connector will always be the Y signal regardless of these buttons When a color viewfinder is used e When allthree buttons are pressed the output to the viewfinder and monitor will be the Y signal e When no button is pressed the output to the viewfinder will be the color signals and to the monitor will be the Y signal HDC 900 950 930 Series Product Information Manual D CURSOR 1 2 and 3 buttons CALL button VF DETAIL control VF DETAIL switch QD Assignable switch MENU SELECT control MENU SELECT
185. ct Button Menu v Direct Button Direct Menu Button v Gamma Table Standard User Standard on off User on off lt lt lt amp KIN S lt S Gamma Off Knee Point R G B Master SISISISIS S Auto Knee on off Knee Off lt lt Knee Slope R G B Master lt lt Auto Knee on off Knee Off Knee Saturation Knee Point Knee Slope Level S lt lt S SISISIS Auto Knee on off Knee Off lt Knee Sat on off White Clip R G B Master White Clip Off Matrix R G G B B R SINSISISIS Matrix on off em ser Matrix on off 79 reset Matrix on off atrix Off R B G R B G S lt lt S S lt lt S ulti Matrix on off ser Matrix on off 79 reset Matrix on off atrix Off Multi Phase Hue Saturation All Clear ulti Matrix on off SISISINS SIS C ser Matrix on off 79 reset Matrix on off atrix Off lt lt Low Key Sat Level Low L Mid H Mid High Range Low Key Sat on off Mono Color Saturaion Hue ono on off Auto lris Pattern lt lt Auto Iris on off ECS S EVS Shutter ECS S EVS Shutter on off ECS on off S EVS on
186. ction 3 NC No connection 4 12V LENS OUT 12 V 2 A max 5 LENS DC GND GND for 12 V LENS 6 GND GND 7 2 POT FOL No connection LOW 8 LENS EXT1 IN 2 LENS SERIAL SERIAL RXD DATA 9 LENS 2 2 10 LENS IN 2 11 LENS AUX OUT ON GND OFF High impedance 12 IRIS POSI IN Zi 210 kOhms 2to7V 8 4 0 1 V F16 6 2 0 1 V F2 8 13 7 POSI 2 210 kOhms 2to7V 2 V WIDE 7 V TELE 14 RET 1 ON Zi 210 kOhms ON L OFF High impedance 15 RET2 IN Zi 210 kOhms ON L OFF High impedance 16 FOCUS POSI IN Zi 210 kOhms 2to7V 2 V MIN 7 V 17 MRIS CONT OUT 2t07 V 3 4 0 1 V F16 6 2 0 1 V F2 8 Zo lt 1 kOhms 18 IRIS AUTO OUT AUTO L MANU SERIAL MANU H TXD Zo lt 1 kOhms LENS SERIAL DATA 19 NC No connection 20 NC No connection 21 LENSR TALLY OUT ON L ON OFF H Zo 21 5 22 EXP POSITION IN Zi gt 10 kOhms 1 to4 V 1 V 7 5 4 V e 7 5 23 RET3 ON IN Zi 210 kOhms ON L OFF High impedance 24 LENS ADRSA IN 84 25 LENS ADRS B 1 26 LENS ADRSC IN 84 Chapter 8 Connectors and Cables 169 ia Sig
187. ction 3 IVF G X OUT B W Y RET 10 S DATA IN TTL level COLOR G OUT 2D S ES 11 R TALLY OUT ON 5 V VP P OFF 0 V 4 NC No connection 12 NC EFFECT No connection 5 VFB VIDEO X OUT V2 714 mV p p NTSC ON 5 V 700 mV p p PAL OFF 0 V Zo 75 0 5 POSI 13 NC No connection RETON OUT ON GND Y 14 YVIDEOGND GND for Y VIDEO f _ OUT 12V do 15 5 OUT TTL level SOUT ae de 16 NC BATT IND No connection 9 UP TALLY ON OUT ON 12 V ON 5 V OFF OV OFF 0 V 10 NC VF RET No connection 17 CHASSIS GND VIDEO 09 V 1 0 V p p 18 G TALLY OUT ON 5 V Zo 75 Ohms 5 OFF 0 V 11 R TALLY ON OUT ON 50 V 0 5 V 19 GND 12 V GND for 12 V Z esu x a 20 GND 12V GND for 12 V COL BW B W High impedance 2T NG VF SEL aw 13 NC No connection COLOR 45 V 14 VFRVIDEO OUT GND for R VIDEO 52 NO Connection G H EXPAND EXPAND 4 3 GND 15 PEAKING OFF OUT OFF GND NORMAL 5 V ON High impedance 23 NC No connection 16 VF G VIDEO OUT GND for VF G VIDEO 24 C No connection 8 25 C No connection 17 CHASSIS GND CHASSIS GND V EXPAND EXPAND 4 3 GND 18 VFB VIDEO OUT GND for VF B VIDEO NORMAL 5 V G 19 DC GND GND for 12 V VF 20 VFDCGND GND for 12 V VF 21 TALLY GND GND for TALLY 22 NC VF RET No connection GND VIDEO OUT for VF RET VIDEO G 23 G TALLY ON OUT ON 5 0V 0
188. ctions of the MSU 700A 750 when required The status setting is enabled in the Engineer Mode HDC 900 950 930 Series Product Information Manual Operation Proceed as follows Menu operation block Example MSU 700A Configuration Menu S m 0 Configuration Menu 1 Camera cnu 2 D JIAO m 1 Press to light the CONFIG button 2 Press MSU The MSU Configuration Menu appears MSU Configuration 24 MSU MSUSW Adjusting Set m 3 Press Security The Security Menu display appears Security Menu Exit Engineer Mode 4 Press Engineer Mode to set it to inverse video The numeric keys and field for entering the Code No are displayed Engineer Mode Code No 7 89 456 Chapter 6 A Quick Lesson on Camera Settings 70 5 Enter the security code using the numeric keys then press OK Note Each digit you input will be displayed as an asterisk The Security Menu items now appear Security Menu Exit Engineer Mode Code Status Change Engineer Mode 6 Press Status The display changes to the Security Status setting display Security Status Engineer Mode Ref Lens OHB Enable Enable Enable View Paint 7 Setting the status for cont
189. cuitry have improved the signal noise ratio for more natural reproduction 6 Auto Black White The HDC 900 Series provides superb accuracy in black and white balance 3 2 Precise Handling of Highlight Position 1 Optimized bit assignment Highlights are compressed by a pre knee circuit before A D conversion providing the most efficient utilization of the 12 bit A D conversion process 2 Knee saturation Knee Saturation eliminates both the washed out effect and hue changes in overexposed areas of a picture providing more natural color reproduction HDC 900 950 930 Series Product Information Manual Photo 3 3 Knee saturation ON and OFF On Chapter 3 Benefit of Sony ADSP Advanced Digital Signal Processing 44 3 Low key saturation Photo 3 5 Adaptive highlight control ON and OFF With conventional cameras low light areas can be subjectto a reduction in saturation This can result in color in these areas being washed out The Low Key Saturation function on the HDC 900 Series eliminates this problem by optimizing the amplification of color saturation at low light levels providing more natural color reproduction Photo 3 4 Low key saturation ON and OFF Normal On Olympic Stadium of Barcelona 5 Triple Skin Tone Detail Correction Skin Tone Detail Correction controls the detail level of those objects which have specific color tones The HDC 900 Series allows detail to be set independent
190. d When a unit other than 1U height is mounted 1 Attach the front bracket to the outside of the front of the rack at the screw holes at 31 75 mm intervals using screws d HDC 900 950 930 Series Product Information Manual Chapter 2 Total System 39 2 Attach the rear bracketto the outside ofthe rear of the rack at the screw holes at 31 75 mm intervals using screws d 5 Fasten the screws loosened in step 3 6 Pull the rails out 7 Insert the inner member to the outer member while pushing against the stopper and then fully push the unit into the rack Warning for Safety Purpose It takes two or more people to mount a unit into a rack Mounting the unit into a rack by yourself can cause back or other injuries 8 Push the unit into the rack and secure the front panel to the rack with screws RK M5 x 16 to 20 and washers 5 De HDCU 950 The two HDCU 950 can be mounted in parallel in a 19 inch EIA standard rack by using the rack mount adapter RMM 301 optional Three unit height HDC 900 950 930 Series Product Information Manual Installation 1 Secure the RMM 301 in the 19 inch EIA standard rack with the four B5 screws 6 mm or longer 57 2 mm p B5 screw 6 mm or longer oooboobooo RMM 301 B5 screw 6 mm or longer 2 Secure the unit with the supplied four screws B4 x 6 and the four washers
191. d for output of a prompter signal valid only when a camera control unit is connected AUDIO IN audio input 1 2 connectors BNC type and switches Connect audio signals An input select switch and microphone power switch are provided for each channel Input select switches 2 Microphone power switches d LINE MIC O OFF 48V LINE MIC O OFF 48V C AUDIO CH 1 O CH 1 O Input select switch Set to the appropriate position according to the connected equipment LINE When a line level signal source is connected MIC When a microphone is connected Microphone power switch When a microphone is connected set whether or not to supply power to the microphone 48V To supply a power of 48 V OFF Not to supply a power Note To supply a power of 12 V modification of the camera is required For details refer to the Installation amp Maintenance Manual Note that the modification must be performed by service personnel only RET CONT return control connector 6 pin Used for connection to a CAC 6 Return Video Selector EXT I O external input and output connector 20 pin Used to supply signals such as Y Pb Pr signals to external equipment REMOTE connector 8 pin Used for connection to an RM B150 Remote Control Unit RCP 700 series Remote Control Panel or MSU 700A 750 Master Setup Unit DC OUT DC power supply output connector 4 pin Used to supply power to devices such as a wireless
192. d operation from 1080 24P to analog composite NTSC PAL The HDC 900 Series must provide higher picture quality than any conventional digital cameras Operationally it must be compatible with current Sony color video cameras Digital system architecture should be consistent with current 12 bit digital cameras and the previous models as well so that all types can be mixed together without picture matching difficulties 1 4 Features of the HDC 900 950 930 Exclusive HAD sensor technology A new design of CCD has been developed for the HDC 900 HDC 950 and HDC 930 Based on Sony HAD sensor technology and using the on chip lens structure of the latest Power HAD sensors this CCD is based on the 1920 x 1080 CIF Common Image Format and is switchable between progressive mode and interlace mode readout except HDC 930 which is only available at 1080 60i and 1080 50i without progressive mode With its light collecting capability dramatically improved this 2 3 inch type 2 2 million pixel FIT CCD used in the HDC 900 950 offers an industry leading sensitivity of 10 at 2 000 lux It has a limiting horizontal resolution of 1000 TVL ph a signal to noise ratio of 54 dB unweighted over 30 MHz and the outstandingly low vertical smear level of 135 dB HDC 900 950 930 Series Product Information Manual key component such as pickup device camera head camera control unit and so forth One of the major design criteria was to easily inte
193. detail control Adjust the amount of detail of the picture on the viewfinder screen when the VF DETAIL switch is set to ON This has no effect on the output signal of the camera Note The viewfinder detail control function has no effect on a return video signal CALL button Press to call the operator of the HDCU 900 Camera Control Unit the MSU 700A 750 Master Setup Unit or the RCP 700 series Remote Control Panel When pressed the camera s red tally lamp will light up if previously off and turn off if previously on The CALL button on the MSU 700A 750 Master Setup Unit or RCP 700 series Remote Control Panel will light up and their buzzer will sound When the CALL button on the RCP 700 series Remote Control Panel or the MSU 700A 750 is pressed this button will light up D CURSOR cursor memory 1 2 and 3 buttons Used to store the size and position of the box cursor displayed on the viewfinder screen Three different box cursor settings may be stored in memory using buttons 1 2 and 3 Pressing one of these buttons will cause a cursor of the stored size to be displayed in the stored position Note When one of the CURSOR buttons is lit up the HPOSI V POSI WIDTH and HEIGHT buttons will be disabled Chapter 7 Location and Function of Parts and Controls 80 Back tally lamp This lamp lights red when the red tally signal is supplied When the CALL button on the MSU 700A 750 Master Setup Unit or the RCP 700 seri
194. djustment is enabled IRIS MB ACTIVE iris master black active indicator green illumination Illuminated when the control mode is set as FULL or PART mode with the ACTIVE button When this indicator is illuminated iris master black controls from this unit are enabled IRIS control When the AUTO button is not illuminated you can adjust the iris manually by turning this control When the AUTO button is illuminated you can fine adjust the reference value for the automatic iris adjustment in a range of 2 f stops with this control The adjustment mode of this control is specified at the factory as Absolute mode which can also be changed to Relative mode using the RM Configuration menu See Settings on the RM Configuration Menu Iris gauge Turn the gauge to set the white line to the most frequently used iris position and it can be used as the reference for the manual iris adjustment VTR control block Controls VTR operations VTR 5 5 44 pb REW FFWD 5 gt Lg STOP PLAY REVIEW Chapter 7 Location and Function of Parts and Controls 129 lt lt REW rewind button amber illumination Press this button to start a rewind operation The button is illuminated F FWD fast forward button amber illumination Press this button to start a fast orward operation The button is illumi
195. ds the number of its setting items In order to improve the operability and make it easy setting and correction information are storedin the files in the camera while the reference and scene files are stored on a memory card Lens file Lenses of the cameras for broadcasting use are often changed to meet different shooting environments Since each lens has its own characteristic individual settings and adjustments have to be done every time the lens is changed In order to improve the operability a lens file is developed to store the setting data that can be recalled so to skip over the process of setting and adjustment to save time Level auto set up Level auto set up is a function that automatically keeps adjusting the camera to a standard setting e g automatically adjusting gamma knee etc Pattern auto iris Pattern auto iris is used to emphasize auto iris on certain portions of the screen e g granting priority to the center portion cutting the upper portion or emphasizing the center Reference file A reference file is a place to store setting data for normal status that varies depending on the user s individual settings The data is also the target value for level auto set up including not only the analog control data but also the digital file data for switch settings Chapter 9 Glossary Terms and Definitions 175 Scene file A scene file is a place to temporally store the data that differs from the normal
196. e connect it to this connector on the CCU 700A 700AP Camera Control connector When using two or more VCS 700 units Unit The signal loss of a connecting cable up to about connected in series connect a picture monitor to the 30 meters 99 feet long can be compensated for with PIX B OUTPUT loop connector on the VCS 700 whose the switch on the internal board For details refer tothe PIX A OUTPUT connector is not used for series system manual connection For details on cable compensation refer to the system manual CHARACTER INPUT connectors BNC type Accept character signals The input signal is mixed SYNC OUT sync signal output connector BNC with the signal output from the PIX OUTPUT connector type Connect to the CHARACTER connector on the CNU Supplies the sync signal for a picture monitor 700 Camera Command Network Unit When using two VCS 700 units connect either of these connectors to WF1 through WF6 INPUT waveform monitor 1 the CHARACTER INPUT connector on a second VCS through 6 input connectors BNC type 700 When a bridge connection is not made sureto Accept video signals for a waveform monitor Connect terminate with 75 ohms these connectors as required to the WF2 OUTPUT connector on CCU 700A 700AP Camera Control Units PIX AINPUT picture monitor A input connector signal loss of a connecting cable up to about 30 BNC type meters 99 feet long can be compensated for with the Connect to t
197. e a perception of a sharper picture or higher resolution Since the characteristic cannot be Chapter 9 Glossary Terms and Definitions 173 compared in numbers it does not appear in the specifications of the brochure However it is very important for evaluating picture quality intuitively Usually it is only called DTL detail IT FIT In an IT type CCD beside the pixels there are columns of cells dedicated for vertical transfer The electronic signals are transferred from the pixels to the columns of cells during vertical blanking Finally the signals reach a row of cells driven by a horizontal block for horizontal transfer from where the signals are output as video signals Although there is a cover to protect the cells from light leakage sometimes the leakage still happens under a strong light which causes smear To avoid this phenomenon in an FIT type CCD there is additional storage added to the CCD which enables the vertical transfer to perform much more quickly so to minimize the chance of light leakage even under a strong light However this additional storage increases the cost Recently there has been great advances in IT CCD technology and the gap between IT and FIT has been dramatically reduced Knee aperture Contrasts always become worse when compressing in the direction of the bright level during knee correction Knee aperture is used to improve this point to emphasize the contour to which the kne
198. e balance memory selection Switch1 Used to select the white balance adjustment method or the memory used to store the adjusted value PRST preset White balance is adjusted to a preset value corresponding to a color temperature of 3200K 7 2 2 Front Left Side Q TEST OUT connector For future use MIC 1 IN connector RET 1 button MIC IN switch HDC 900 950 930 Series Product Information Manual A or B Selects memory A or B When the AUTO W B BAL switch is set to WHT the white balance will be automatically adjusted according to the setting of the FILTER control The adjusted value will be stored in the selected memory Each memory can store up to four adjusted values for a total of 8 When the MESSAGE setting on the VF DISPLAY page of the OPERATION menu is set to ON the new setting will be displayed in the setting change adjustment progress message display area of the viewfinder screen for three seconds when the setting is changed using this switch Example WHITE Ach or WHITE PRESET DISPLAY switch You can turn on or off the displays safety zone marker center marker text displays and menu screens on the viewfinder screen ON Text describing the camera s operation status will be displayed on the viewfinder screen OFF All viewfinder screen displays will be turned off MENU Setup menus will be displayed on the viewfinder screen CANCEL STATUS switch When a menu is displayed o
199. e correction applies Knee correction The dynamic range of a natural scene is very large but that of a video standard is limited When we use the iris to adjust for the subject photographically the bright portion of the picture will become almost completely white However when we focus on the bright portion the subject for photography will become very dark Knee correction is a function to solve this problem by compressing the level of the bright area to meet that in the video standard so as to make the dynamic range seem larger Knee point and knee slope Knee point is the starting point of the knee correction process and the knee slope is its compression rate Usually knee slope is the peak value under an environment of 200 incident light Knee saturation Because knee correction performs independently in R G B channels in a conventional knee circuit the R G B percentage of the portion to which the knee correction applys will change and thus the color phase and saturation change This is called white clip or wash out Knee saturation is used to balance the coloring to avoid this phenomenon Level depend Just like Crisp reduces noise level depend is a circuit that decreases the DTL value in dark areas Limiter A limiter is a circuit used to constrain the DTL peak value that may ruin the picture quality when the luminance difference is too big that it will generate too large of a DTL Linear matrix The linear ma
200. e the unused connector with 75 ohms The type of reference signal is selected using the switch on the internal AT board or using the MSU 700A 750 Master Setup Unit Note To use the VBS signal of the HKCU 951 SD Encoder Unit SC phase lock is required use an SD reference sync signal black burst signal Chapter 7 Location and Function of Parts and Controls 95 SYNC OUT sync signal output connector BNC type Used for output of an SD composite sync signal or HD tri level sync from the internal sync signal generator Factory setting SD composite sync PROMPTER connectors BNC type Input a teleprompter signal to either of the two connectors The input signal is output from the other connector as is loop through output If loop through output is not used terminate the unused connector with 75 ohms If the signal used is a 1 0 Vp p 75 ohm analog signal it may be output from the video camera s PROMPTER OUT connector with a frequency bandwidth of 8 MHz regardless of signal format RETA return video input 4 connector When required either of the PROMPTER connectors can be assigned for the fourth return video input exclusively for analog VBS signals MIC1 and MIC2 microphone output 1 and 2 connectors XLR 3 pin Used to output microphone signals from the video camera Q CAMERA connector optical fiber connector Used to connect a video camera using an optical fiber cable All video camera signals including
201. e variety of detail control functions Skin tone detail function Allows control emphasis or suppression of the detail level for just a certain hue or chroma area in the image by creating a detail gate signal from hue color components centered on skin tones Detail boost frequency control The boost frequency can be adjusted from 20 MHz to 30 MHz This allows the detail thickness to be set appropriately for the subject thus enabling more subtle image expression ratio control The ratio between horizontal and vertical detail can be adjusted White black limiter The white side and black side detail can be limited independently Easy menu based setting Selections and settings for shutter speed ECS Super EVS mode viewfinder display items video gain safety zone marker 2 or center marker 3 screen size marker etc may be made quickly and easily using setup menus displayed on the viewfinder screen or an external monitor 2 Safety zone marker A box shaped marker displayed the viewfinder screen which indicates 80 90 92 5 or 95 of the total screen area 3 Center marker A cross shaped marker that indicates the center of the viewfinder screen Wide variety of viewfinder display options Along with items such as operation messages a zebra pattern 4 a safety zone marker and a center marker camera settings may also be displayed on the viewfinder screen using text and symbols Further there are other indicators
202. echnical supervision and alignment of a complex camera system from a single centralized panel If it is desirable to extend this supervision to more than one control location for example separate operational and engineering maintenance control centers then a number of MSU panels can form part of a large camera system The MSU 700A and the MSU 750 are designed to work in conjunction with the Command Network Units CNU 700 and CNU 500 However in a single camera system these MSUs can operate alone They provide rapid finger tip access to all controls relating to the smooth functioning of an operational System including Technical alignment controls for the entire camera chain Picture and waveform monitor switching e System configuration Control data filing Precise picture adjustment Some of the important control functions that can be made from these MSUs are described below HKC T950 HD CCD Block Adaptor The new HKC T950 HD CCD Block Adaptor which is a unique accessory of HDC 950 and HDC 930 portable cameras allows the CCD block to be extended from the camera body by up to 10 m up to 50 m with an optional cable Therefore more creative camera shooting such as in space limited or awkward environments is possible thus expanding HD camera applications The viewfinder can be detached from the CCD block depending on the environment of the application The HKCT950 can also be mounted on a High Definition O
203. ed in memory A Press the button again to release Memory A mode 8 B memory B button amber illumination Press and illuminate the button to obtain the white balance setting stored in memory B of the camera Memory B mode When this button is illuminated adjustments made to the white balance are stored in memory B Press the button again to release Memory B mode AWB auto white balance button red illumination Press to start automatic adjustment of the selected items The button is illuminated during adjustment and this is turned off when adjustment is complete If you press the button while it is illuminated the automatic adjustment is canceled and the button flashes To stop it flashing press the button again PRE preset button amber illumination Press and illuminate the button to fix the white balance to 3200K Preset mode Press the button again to release Preset mode Note In Preset mode manual adjustment with the WHITE controls and automatic adjustment with the AWB button are both disabled When the adjustment mode of the WHITE controls is Chapter 7 Location and Function of Parts and Controls 128 specified as Absolute mode the Memory A B and AWB buttons are disabled Black balance control block ABB R BLACK black balance controls These 4 specified at the factory to adjust the R B black balance Us
204. efficient to perform the linearity corrections between each axis Normally each axis needs six matrix coefficients that means 96 matrix coefficients are needed However the number of coefficients can be reduced to two for each axis in most of Sony s cameras using some dedicated software color phase and saturation On chip lens To obtain a better quality picture the more pixels the better for a CCD However increasing the number of pixels means decreasing the pixel size When the pixel size becomes smaller less incident light can be gathered which degrades the sensitivity The on chip lens is a micro lens put on each pixel to help increase light gathering so to improve the sensitivity Optical filter There are two types of optical filters Neutral Density ND filter and Color Temperature Conversion CC ilter The former is like a pair of sunglasses for the camera to avoid the iris to be stopped down too much under a very strong light while the latter works like a pair of colored glasses to compensate for the color emperature beyond the white balance compensation range Both of them are integrated on a built in filter disk can be manually or electronically controlled and can be remotely controlled using the remote controller or the electronic filter Optical low pass filter Shooting with a CCD camera means sampling a picture via the use of the pixels on a CCD An optical low pass filter is made of optical crystal to cut
205. elected items on the touch panel DETAIL knob Used to adjust the detail level You may select HD detail or SD detail using the Maintenance menu MEMORY STICK media card slot and access lamp Insert a Memory Stick media card to store setting data such as reference files and scene files of the video camera or CCU HDCU The access lamp shows the status of the Memory Stick media card Off No Memory Stick media card is inserted Lit in green There is a Memory Stick media card in the slot In this condition you can safely eject the Memory Stick media card Lit in red Data are being read written If you eject the Memory Stick media card in this condition the data are not guaranteed All the data may be lost Chapter 7 Location and Function of Parts and Controls 120 7 10 2 lris master black control block RCP 750 5 ACTIVE button AUTO button f number display Q EXT indicator MASTER BLACK AUTO MASTER BLACK RELATIVE button RELATIVE RELAT IRIS MB ACTIVE Q MASTER BLACK display 3 e SENS control knob SENS O Master black control ring QD IRIS control lever IRIS RELATIVE button Q MASTER BLACK display Displays the current master black setting in the range from 99 to 99 MASTER BLACK RELATIVE button When the IRIS MB ACTIVE button is lit the master black adjustment mode can be selected with this button Press and light up the bu
206. emote Control Unit PANEL ACTIVE button STANDARD button MEMORY STICK lamp Memory Stick slot Rubber cap Spare button Test signal output select buttons CLOSE button Q VTR START STOP button VTR playback control buttons PANEL STANDARD ACTIVE c 5 amp SG TEST BARS CLOSE VIR START STOP i lt lt C O O OO gt nez cs a e m z m CANCEL C AUTO 5 IRIS ACTIVE MASTER BLACK m 25 6 52 2 m3 gt m MENU SELECT O O O ONTROL UNIT RM B750 REMO Menu operation block ALARM indicator Q Memory Stick slot Insert a Memory Stick to store setting data such as reference files and scene files of the video camera or camera control unit MEMORY STICK Memory Stick access lamp The lamp shows the status of the Memory Stick Off No Memory Stick is inserted Lit in green There is a Memory Stick in the slot In this condition you can safely eject the Memory Stick Lit in red Data are being read written If you eject the Memory Stick in this condition the data are not guaranteed All the data may be lost PANEL ACTIVE button Press to select the control mode for the connected camera system Each time you press the button with the factory setting the control mode cyclically Switches among FULL PAR
207. en not lit or go dark when lit When the CALL button on the video camera is pressed the CALL button on this unit lights and a buzzer sounds IRIS MB ACTIVE iris master black active button Press and light up this button to enable the iris and master black adjustment functions of the unit When the PANEL ACTIVE button is pressed this button automatically lights To disable only the iris master black control block of the panel press this button so that it goes dark HDC 900 950 930 Series Product Information Manual Iris control block EXT F AUTO IRIS EXT lens extender indicator Lights when the lens extender is used Iris display window The iris value is displayed in f numbers When the iris is closed CL is displayed in the window AUTO button Press and light the button to automatically adjust the iris according to the amount of input light Auto Iris When this button is lit the reference value for automatic iris adjustment can be set in a range of 2f with the iris control If you press the button when lit it goes dark and manual iris adjustment is enabled Note If the subject being used as the reference for automatic adjustment is lost while operating a camera having the skin tone auto iris function the skin tone auto iris stops functioning and the iris value at that time is maintained The AUTO button then flashes In this condition not only is the iris not automatically adjusted
208. ent serial signal 270 Mbps SMPTE 259M SD SDI OUT 1 to 2 BNC Component serial signal 0 8 V p p 75 Ohms 270 Mbps SMPTE 259M Analog signal PIX OUT BNC 1 0 V p p 75 Ohms WF OUT BNC 1 0 V p p 75 Ohms SYNC OUT BNC HDC 900 950 930 Series Product Information Manual Equivalent WF REMOTE MIC REMOTE 1 506 582 11 D sub 15 pin male PORT D sub 15 pin Female or JAE DA CI J10 equivalent INTERCOM TALLY PGM D sub 25 pin male D sub 25 pin Female JAE DA 25PF N equivalent WF MODE 1 560 155 00 PLUG 4 pin male 4 pin Female supplied RCP CNU 1 766 848 11 PLUG 8 pin male or CCA cable assembly optional CCA 5 10 10 m CCA 5 3 3 m 8 pin Female INTERCOM 5 pin Female 1 508 370 11 XLR 5 pin male or CANNON XLR 5 12C equivalent TRUNK LINE 1 560 651 00 D sub 9 pin male or JAE DE 9PF N equivalent 1 561 749 00 JUNCTION SHELL D sub 9 pin Female 0 3 V ternary SYNC 75 Ohms Or 0 3 V p p SD SYNC 75 Ohms selectable Other PROMPTER IN BNC 1 0 V p p 75 Ohms HKCU 951 525 625 analog signal Y G OUT BNC Y 1 0 V p p video 0 714 V sync 0 286 V 75 Ohms G 0 7 V 75 Ohms B Y B OUT BNC B Y 0 756 V p p 75 Ohms when 75 color bar is input B 0 7 V 75 Ohms R Y R OUT BNC R Y 0 756 V p p 75 Ohms when 75 color bar is input R 0 7 V 75 Ohms VBS OUT BNC 1 0 V p p 75 Ohms HKCU 953 1125 digital signal HD SDI OUT 1 to 2 BNC Conforms to
209. eo esa HN e e e 8 0 9079 9 6 Of 016 6 909 Os e le e e e Je e 9 O e e HDCU 900 CHARACTER OUTPUT ANALOG VIDEO SIGNAL D SERIAL RET INPUT 1 to 4 SD COMPONENT SDI RETURN VIDEO SIGNAL HDC 900 SING OUT SD REFERENCE SIGNAL SERIAL OUTPUT 1 to 4 SD COMPONENT SDI SIGNAL eo mI mp e e F 919 6 909 9 9 09 e eB 9 0 0 000000 e Ere e e Je e 2 eC e el 992 Jee Je HDCU 900 SD REFERENCE SIGNAL SD ANALOG VIDEO SIGNAL Next HDCU 900 Picture Monitor Picture Monitor Waveform Monitor Waveform Monitor I I CNU 700 ogg Terminated at 75 HDC 900 950 930 Series Product Information Manual Chapter 2 Total System 28 Figure 2 7 1 6 Example of connection using HDCU 900 6 System format NTSC Required boards Slot to be installed Slots the front ihe raai Remarks Top most slot DPR 163 SDI 54A HDCU 900 Second slot from the top RC 86 DIF 102 HDCU 900 Third slot from the top IF 789A VDA 57 HKCU 901 ol RET INPUT 1 to 4 REFERENCE IN PIX OUT For RCP PROMPTER IN WF OUT For RCP ANALOG RETURN VIDEO SIGNAL REFERENCE SIGNAL PICTURE MONITOR OUTPUT FOR RCP PROMPTER SIGNAL WF MODE For RCP WAVEFORM MONITOR OUTPUT FOR RCP
210. eo cameras for broadcasting and professional use provide the aspect ratio conversion function in combination with a digital filter Some manufacturers perform this function by changing the reading process of the CCD Auto knee DCC It is a device that automatically adjusts the knee point and knee slope to raise the dynamic range depending on the pattern of the subject for photography Black Gamma Black Gamma is a function to change the Gamma curve of dark portions of the picture It also can change the coloring Black shading correction Black shading correction is used to compensate for the irregular black shading which occurs because of the dark current of picture elements and the characteristics of power circuits Boost frequency Horizontal image enhancement is usually performed by raising the space frequency between 3 to 4 MHz The peak of the frequency raised can be adjusted in order to meet the users different tastes CCD CCD is the acronym for Charge Coupled Device It is a kind of semiconductor that converts an optical image into electronic signals the heart of a camera After accomplishing the conversion each pixel a kind of photoelectric transformer on the CCD first holds the signal and then transfers it to the next cell These cells work like a bucket brigade According to the transfer method there are two types of CCDs IT CCD and FIT CCD Color bars Almost all of the video cameras used for broadcasting
211. er cord x1 Operation manual x1 Maintenance manual x1 10 7 CNU 500 Camera Command Network Unit General Power requirements Current consumption Operating temperature Dimensions Mass For United States 100 to 120 VAC 50 60 Hz For other countries 220 to 240 VAC 50 60 Hz Max 4 0 A 5 C to 45 C 41 F to 113 F 424 W x 45 H x 400 D mm 16 3 4 x 1 3 4 x 15 3 4 inches 7 kg 15 Ib 7 oz Input and output connectors CCU 1 through 6 8 pin multi connector 1 each 10 8 VCS 700 Video selector General Power requirements Current consumption Operating temperature Dimensions Mass Input Connectors PIX 1 to PIX 6 INPUT WF 1to WF 6 INPUT HDC 900 950 930 Series Product Information Manual n United States 10010 120 VAC 50 60 Hz n other countries 220 to 240VAC 50 60 Hz For USA and Canada Max 0 28A For other countries Max 0 28 A 0 C to 45 32 F to 113 424 W x 44 x 400 D mm 16 3 4 x 1 3 4 x 15 3 4 inches 5 2 kg 11 Ib 7 oz BNC type 6 1 0 Vp p VBS 75 ohms BNC type 6 For USA and Canada 1 0 Vp p VBS 0 714 Vp p V 75 ohms RCP 1 through 6 8 pin multi connector 1 each MSU 8 pin multi connector 1 VCS 8 pin multi connector 1 AUX 1 and 2 8 pin multi connector 1 each CHARACTER BNC type 2 video 0 7 Vp p sync 0 3 Vp p REFERENCE BNC type 2 0 3 Vp p with loop through output RS232C D sub 9 pin AC IN 3 pin
212. erence value for automatic iris adjustment can be set in a range of x2f with this control When the iris is closed CL is displayed in the window Chapter 7 Location and Function of Parts and Controls 110 AUTO button Press and light the button to automatically adjust the iris according to the amount of input light Auto Iris If you press the button when lit it goes dark and manual iris adjustment is enabled Note If the subject being used as the reference for automatic adjustment is lost while operating a camera having the skin tone auto iris function the skin tone auto iris stops functioning and the iris value at that time is maintained The AUTO button then flashes In this condition not only is the iris not automatically adjusted but also it cannot be changed manually When you wish to change the iris turn Auto lris off If Auto Iris is kept ON the skin tone auto iris will start functioning when the subject for reference is resumed 7 8 2 Operation Panel in use with HD Equipment Camera CCU function ON OFF buttons When this unit is used in an HD camera system HDC 700 750 700A 750A 900 950 930 HDW 700 F900 HDCU 700 900 950 another three camera CCU function ON OFF buttons become effective Use the unit with the labels for an HD system supplied attached to the appropriate positions KNEE DETAIL LVLDEP GAMMA CHROMA Bm OFF OF OF OFF OFF LOW KEY IONO COLO APERTURE
213. erial Digital Interface signal inputs and outputs and four sets of SD component SDI signal inputs and outputs Adding of various optional function boards allows the following signal input and output HKCU 901 SD Analog Interface board This provides the capability of PAL NTSC and SD analog component signal input and output HKCU 902 HD Analog Interface board This provides HD analog signal input and output HKCU 903 Frame Rate Converter board This provides 60i 50i format output in a 24P Cinema Production system HKCU 904 Line Converter board This provides 720 60P input and output Multiple video outputs HDCU 950 only The HDCU 950 has three HD SDI Serial Digital Interface signal outputs 2 regular outputs and 1 monitor output and two SD component SDI signal outputs Adding the optional units allows the following signal outputs HDC 900 950 930 Series Product Information Manual Viewfinder connector Intercom connector e Analog audio input connectors e Tracker connector Test output connector Return control connector AC OUT connector e Large lens connector HKCU 951 SD Encoder board This provides the capability of NTSC or PAL SD analog component signal output HKCU 953 HD Frame Rate Converter board This provides 60i 50i format HD and SD signal outputs in a 24P Cinema Production system Three return video inputs HDCU 950 only The HDCU 950 has three return video input connectors which rece
214. es Remote Control Panel is pressed the lamp lights if previously off or goes off if previously on The brightness of the lamp may be adjusted using a control provided in the camera Attach a supplied number plate 0 through 9 to display the camera number Lights green when the green tally signal is supplied Memory Stick media card section Insert a Memory Stick media card into the slot The lamp lights while writing or reading data to from a Memory Stick media card RETURN SELECT knob 1 This knob selects from the four return signals from the CCU By pressing in the RET 1 button you can view the selected return video signal in the viewfinder RETURN SELECT knob 2 This knob selects from the four return signals from the CCU By pressing in the RET 2 button you can view the selected return video signal in the viewfinder RET 1 button By pressing in this button you can view the return video signal selected by the RETURN SELECT knob 1 in the viewfinder Pressing this button again will switch the viewfinder screen display and MONITOR output back to the camera s video signal RET 2 button By pressing in this button you can view the return video signal selected by the RETURN SELECT knob 2 in the viewfinder Pressing this button again will switch the viewfinder screen display and MONITOR output back to the camera s video signal Note If both the RET 1 and RET 2 buttons are pressed RET 1 will be displayed CURS
215. ess the button when Parallel mode is cance 2 MASTER and SLAVE b When adjusting the wh VE button is not lit If you it it goes dark and led uttons ite balance of multiple cameras in Master Slave mode designate the master camera or the s ave cameras Press and light up the MASTER button to specify the connected camera for he master Press and light up the SLAVE but connected camera for on to specify the he slave The slave cameras follow the master camera settings If you press a button when lit it goes dark STANDARD button When you press this button the video camera is initialized to its standard state and the button lights for several seconds If you press the button while it lights the video camera reverts to the state before the button was lit Q Camera CCU function ON OFF buttons Various functions of the video camera or the CCU HDCU series can be turned on and off from this panel CHAR ACTER 5600K AUTO SKIN DTL BLACK KNEE DETAIL GATE GAMMA 5600K 5600 electronic color temperature conversion function AUTO KNEE Auto knee function When this button is lit ON the knee point is automatically adjusted according to the light content of the picture SKIN DETAIL Skin tone detail function DTL GATE Skin tone detail gate function When this button is lit ON the adjustment range of the skin tone detail is displayed in white on the PIX picture monitor screen BLACK GA
216. ewfinders feature very low power consumption and as they are very compact their panning and tilting angles are greater than those of CRT based viewfinders The HDVF C700W is for use with the HDC 900 camera and the HDVF C750W for use with the HDC 950 930 portable camera The liquid crystal display fitted to this unit is manufactured with high precision technology giving a functioning pixel ratio of at least 99 99 Thus a very small proportion of pixels at most 0 01 may be stuck constantly on or constantly off In addition over a long period of use because of the physical characteristics of the liquid crystal display such stuck pixel may appear spontaneously These problems have been kept to an absolute minimum but are an unavoidable characteristic of liquid crystal technology HDVF 700A and HDVF 20A CRT based Viewfinders The monochrome CRT based viewfinders HDVF 700A 7 type and HDVF 20A 2 type can also be used with the HDC 900 950 930 Chapter 1 Introduction 12 2 1 System Configuration As a major design criteria the HDC 900 Series inherited all the benefits from Sony digital camera systems such as the BVP 900 700 500 Series to ensure the HDC 900 950 930 Family to be smoothly integrated into these renowned field proven camera control systems This new camera system features two camera heads the HDC 900 full size model and its full companion portable camera the HDC 950 930 The Figure 2 1 HDC 900
217. exclusive features MASTER BLACK control Turn to manually adjust the master black IRIS control When the AUTO button is not illuminated you can adjust the iris manually by turning the control When he AUTO button is illuminated the reference value for automatic iris adjustment can be set in a range of 1f stop with this control See the table Iris adjustment unctions D Iris gauge The white line on the gauge provides a click position or the IRIS control Turn the gauge to set the line to the most frequently used iris position and it can be used asthe reference for manual iris adjustment The gauge rotates infinitely in either direction When no click position is required set the line outside the rotation range of the IRIS control Chapter 7 Location and Function of Parts and Controls 125 PREVIEW button Connects the preview signal to the PREVIEW connector Connector Panel PREVIEW REMOTE 2 REMOTE connector PREVIEW connector PREVIEW connector 6 pin Supplies preview in The RCP 701 receives the power from an external source such as a video switcher to illuminate the PREVIEW button through this connector REMOTE connector 8 pin Connect to the RCP CNU connector of a CCU 700A 700AP the RCP connector of a CNU 700 or the AUX connector of another RCP Series Remote Control Panel HDC 900 950 930 Series Product Information Manual Chapter 7 Location and Function of Par
218. g 9 CH1 MIC X OUT 20 dBu Low 10 CH1 MIC Y OUT impedance Bal anced 11 CH1 CH2 MIC GND for CH1 CH2 GND MIC Chapter 8 Connectors and Cables 145 No Signal Specifications No Signal Specifications 12 INC No connection 18 RET VIDEO IN 1 0V p p OV ac 13 NC No connection Zi 75 Ohms 14 INCOM LINE IN 0 5 V p p 19 RET VIDEO GND GND for RET OUT VIDEO 15 2 MIC OUT 20 dBu Low 20 AUDIO IN 2 750 Ohms 16 CH2 MIC Y our impedance Bal anced 21 RX COMMAND X IN RS 422 17 No connection 22 RX COMMAND Y IN 18 RET VIDEO 1 0 V p p 0 V Zi 23 TX COMMAND X OUT RS 422 75 Ohms 24 TX COMMAND Y OUT 19 RET VIDEO GND GND for RET VIDEO 0 dBu 0 775 Vrms 20 AUDIO 6 dBu 750 Ohms 1kHz D LENS 36P FEMALE HDC 900 21 RX COMMAND X IN RS 422 22 RX COMMAND X I 18 1 23 TX COMMAND X OUT RS 422 24 TX COMMAND Y OUT 36 19 0 0 775 Vrms External view VTR 26 MALE HDC 950 930 No Signal y o Specifications O s 1 INC No con
219. gnal L L H 30dB 10 REMOTE SYNC REMOTE SYNC 5 V dc H H L 2odB 11 BOTH OUT BOTH 0 V dc 12 CH 1 ON OUT CH 1 ON 0 V dc 13 CH 2 ON OUT CH 2 ON 0 V dc Chapter 8 Connectors and Cables 154 No Signal Specifications 14 CH 3 ON OUT CH 3 ON 0V dc 15 A B OUT A 5V dc B 0Vdc 4 This is set using the S103 4 and 5 switches on the AT 141 board 4 ON Recall system 5 OFF 1125 SDI ON 525 625 SDI 4 OFF 1735HD 1730HD 8 2 1 6 TRUNK LINE D sub 9 pin Female 8 2 1 8 INTERCOM TALLY PGM D sub 25 pin Female 25 13 0000009 External view No Signal Specifications 5 1 1 TENG R X OUT ENG SYSTEM RECEIVE 2 ENG R Y OUT 0 dBu BALANCED 99 OOO 6 3 ENG G GND for ENG External view 4 ENG T O0IN ENG SYSTEM TALK 5 ENG T Y IN 0 dBu BALANCED No Signal Specifications 6 PGM1 x IN 20 dBu 1 INC DCD IN B No connection 7 PGM1 Y IN Selectable with S301 AT 2 EXT CMDO IN IN gt 8 PGMi G IN _ 09879 3 TXD OUT IGND GND for AUX 4 DTR OUT 12 V 15 kOhms 10 5 GND 11 RTALLY X IN
220. grate the most popular Sony digital camera control Systems in order to enable the field proven Sony camera control system and its familiar menu control Systems to be used with the HDC 900 950 930 resulting in quick and reliable installation and a wide choice of camera systems implementations from a single stand alone camera to a sophisticated Multi camera installation 1 2 Advanced Digital Signal Processing ADSP Moreover variations between cameras which are very difficult to avoid in analog models can be reduced to a minimum with digital processing by simply equalizing parameter values Flexible signal processing and parameter settings A significant advantage of digital processing is that it can provide very flexible operation Many camera parameters can be controlled and each parameter setting can be varied over a wide range of values To take full advantage of 12 bit digitization as many camera processes as possible should be digital particularly gamma detail and so on Operational controls and connectors are located in similar positions to those on current Sony HDC and BVP Series cameras so operators accustomed to these models immediately find the HDC 900 Series familiar and easy to use Existing Sony MSUs CNUs and RCPs can be used with the HDC 900 Series Current menu control systems and auto set up functions are also compatible Capital cost must not be significantly greater than Sony standard definition c
221. have a color bar generator Although the color bar has been originally developed for the adjustment of an analog encoder it has become a standard function for professional video camera Since video cameras are quite often used as a color bar generator it is still a HDC 900 950 930 Series Product Information Manual standard function for a video camera even though the encoder has been digitalized Crisp DTL enhances picture sharpness but at the same time also emphasizes the noise which makes the picture noisy Crisp is a circuit that removes small amplitude DTL to improve S N DTL comb filter The DTL comb filter is used to weaken the oblique DTL that interferes with the sub carrier to generate cross color However resolution seems to look bad if the oblique DTL becomes too weak Some component dedicated cameras such as HD cameras do not adopt DTL comb filter Electronic soft focus The DTL circuit can make the picture sharper but it can also shade off the picture by reverting the polarity When used this way electronic soft focus is a function to generate a gentle film like picture It is more effective to make an announcer s skin color much more lustrous when used in combination with the Skin Tone DTL Encoder Inside the camera video signals are processed in R G B component signals The encoder is a device used to convert the component signals into composite signals such as NTSC and PAL Flare correction In an optica
222. he PIX A OUTPUT connector on a second switch on the internal board For details refer to the VCS 700 when using two or more VCS 700 selectors System manual Q PIX A OUTPUT picture monitor A output WF A INPUT waveform monitor A input connector BNC type connector BNC type Supplies a video signal for a picture monitor Selectthe Connect to the WF A OUTPUT connector on a second output signal with the camera select buttons on an VCS 700 when using two of these units MSU 700 or by command from the I O PORT connector on the VCS 700 Video Selector When using WF A OUTPUT waveform monitor A output two or more VCS 700 units connect this connector to connector BNC type the PIX A INPUT connector on each subsequent VCS Supplies the video signal for a waveform monitor 700 and a picture monitor to the PIX A OUTPUT Selectthe output signal with the camera select buttons connector on the final VCS 700 in the series on an MSU 700 or by command from the I O PORT connection connector on a VCS 700 When using two or more VCS 700 units connect this connector to the WF A INPUT connector on each subsequent VCS 700 and a HDC 900 950 930 Series Product Information Manual Chapter 7 Location and Function of Parts and Controls 105 waveform monitor to the WF A OUTPUT loop connector on the VCS 700 which is the last unit in the series connection WF B OUTPUT waveform monitor B output connector BNC type Supplies the same video signal fo
223. he button to automatically adjust the iris according to the amount of input light If you press the button when lit it goes dark and manual iris adjustment is enabled EXT lens extender indicator Lights when the lens extender is used on the connected camera IRIS control When the AUTO IRIS button is not lit you can adjust the iris manually by turning the control When the AUTO IRIS button is lit you can fine adjust the reference value for automatic iris adjustment in a range of 2f with this control The adjustment mode of this control is specified atthe factory as Absolute mode which can also be changed to Relative mode using the RM Configuration menu under the Maintenance menu IRIS MB ACTIVE iris master black active indicator Lights when the control mode is set as FULL or PART mode with the PANEL ACTIVE button When this indicator is lit iris master black controls from this unit are enabled MASTER BLACK control Manually adjusts the master black level The adjustment mode of this control is specified at the factory as Relative mode which can be changed to Absolute mode using the RM Configuration menu under the Maintenance menu White balance black balance control block AWB button ABB button 5 AWB ABB WH WHITE controls BLACK BLACK controls do D AWB auto white balance button Press to automatically adjust the white balance The button lights during adjustme
224. he button when lit it goes dark and the operation panel of this unit is locked PARA parallel mode button Press and light up this button to activate Parallel mode which enables concurrent operation with another control panel If you press the button when lit it goes dark and Parallel mode is canceled 8 MULTI indicators Show the Master Slave status of the corresponding cameras 1 through 12 when the EXPAND button is not lit or 13 through 24 when the EXPAND button is lit The indicator for the camera which is specified as the master for Master Slave mode lights in green The indicators for the slave cameras light in orange They light in red during the auto setup of the corresponding cameras If an error occurs during the auto setup and the operation is interrupted they will flash in red TALLY indicators Show the tally status of the corresponding cameras 1 through 12 when the EXPAND button is not lit or 13 through 24 when the EXPAND button is lit The corresponding indicator lights in red when a red tally is sent to camera and it lights in green when a green tally is sent When both red and green tally are sent it lights in orange When a call signal is sent to the camera the indicator rapidly flashes in red 5 Active indicators Show the control status of the corresponding cameras 1 through 12 when the EXPAND button is not lit or 13 through 24 when the EXPAND button is lit The indicators for the cameras u
225. he calibrations on the waveform monitor and picture monitor 3 Color bar adjustment Precisely adjust the color bar level and black balance of each camera to the same level 4 Gray scale adjustment Make the R G B levels be consistent with each other from black level to white level by shooting a gray scale 5 In case the black balance is out of line Check the black balance at the time of lens close whether it is in line or not If not execute Auto Black or adjust the R G B BLK to the same level between each signal 6 Open the IRIS and adjust the white level to 100 Execute Auto White or adjust RGB WHT to make the R G B levels be consistent with each other 7 Perform Gamma level adjustment when the gray scale cross point level is out of line 8 Perform Flare adjustment when the gray scale s darkest level has a level difference in the low frequency area Even if the level difference is around 1 to 2 stop iris in the Flare adjustment perform a fine adjustment to minimize the difference Be sure to repeat the adjustments because the adjusted items affect each other subtlety when using a gray scale for fundamental adjustment Shading adjustment Sometimes the R G B levels are not consistent with each other even after a gray scale adjustment This occurs when the shading adjustment is not sufficient or when a lens is changed 1 Preparation beforehand A total white pattern or an integrating spherical pattern
226. he producer line and engineer line are disconnected and communication is possible only between the HDCU 950 and the connected camera ENG engineer Engineer line Intercom connector XLR 5 pin Connect a headset Note To use a headset with a plug other than an XLR 5 pin plug consult a Sony service or sales representative Q HD SDI OUT 1 and HD SDI OUT 2 connectors SD output block DIF board INCOM TALLY PGM 0200090000000 000008000000 Expansion slot RETI RCP CNU MIC REMOTE 00000000 L REFERENCE connectors SYNC OUT connector PROMPTER connectors RET4 MIC1 and MIC2 connectors CAMERA connector WF MODE AC IN connector WF MODE connector RCP CNU connector MIC REMOTE connector WF REMOTE RET2 and RET3 connectors MONI connector INCOM TALLY PGM connector HD SDI OUT 1 and HD SDI OUT 2 HD serial digital interface output 1 and 2 connectors BNC type The signal from the video camera may be output as HD SDI signals REFERENCE connectors BNC type Input an HD tri level reference sync signal or SD reference sync signal black burst signal to either of the two connectors The input signal is output from the HDC 900 950 930 Series Product Information Manual other connector as is loop through output If loop through output is not used terminat
227. his file is stored in the camera and Memory Stick media card Table 6 1 Structure of Paint Related Files Note The Test SW Mode Setting area is displayed with the MSU 750 only 2 Press ON to set it to inverse video to activate the screen saver 3 When the screen saver is turned on set the wait time in units of minutes until it activates by pressing A or V When the adjustment is completed Press Exit to leave this menu 4 Reference File Stores the custom paint data adjusted by the video engineer This file is stored in the camera and Memory Stick media card 5 Lens File Used for compensation of the deviation which generates by switching the lens extender from OFF to ON and for compensation of the difference in the characteristics between lenses This file is stored in the camera 6 OHB File Used for adjustment of the CCD block maintenance This file is stored in the camera Refer to File Items When STANDARD is executed Lens File When lens extender setting is OFF Flare R G B and V Modulation Shading R G B Master can be stored When lens extender setting is ON White R B Flare R G B and V Modulation Shading R G B Master can be stored Reference File Refer to File Items OHB File R G B for each White Shading H SAW H PARA V SAW VPARA can be stored R G B for each Black Shading H SAW H PARA V SAW and V PARA can be stored And OHB matrix and the ND offset can be stored Facto
228. hment 1 Hexagonal key 1 Hexagonal socket head screws 4 Connecting cable 1 Optional accessories VHF 770 Outdoor Hood 216 8 5 8 215 8 1 2 HDVF C700W 260 10 1 4 190 7 1 2 258 10 1 4 Chapter 10 Specifications 189 10 18 HKC T950 HD CCD Block Adaptor General Current consumption 13 0 to 17 0 V DC Operating temperature 20 C to 45 C Operating humidity 10 to 90 no condensation Cable adapter Approx 0 5 kg 1 Ib 2 OZ CCD block adapter Approx 0 85 kg 116 14 Oz adapter only Approx 1 65 kg 31610 OZ with the CCD block Dimensions W x H x D Approx 108 mm x 230 3 mm x 237 mm 4 3 8 x 9 1 8 x 9 3 8 inches Mass CCD block adaptor I F Camera cable CCZ type 26 pin Male 10 19 CA 905L Large Lens Adaptor General Mass Dimension w h d 12 kg 24 Ib 4 oz 368 x 327 xx 534 mm 14 5 8 x 13 x 21 1 8 inches Operating temperature range 20 C to 45 C 4 F to 113 F 20 C to 55 C 4 F to 131 F 90 W Large lens and 7 type color viewfinder with the BKP 9057 Storage temperature Power Consumption Input Output connectors CCU connector LEMO type fiber connector Lens connector front 36 LENS connector top 12 CA connector LEMO type fiber connector REMOTE connector 8 pin Supplied accessories Number plate 2 side panel Number plate 1
229. holder HDC 900 950 930 Series Product Information Manual CHARACTER connector RS 232C connector AC IN connector REFERENCE connectors REFERENCE reference signal input connector BNC type Accept a reference signal VS BS etc The signal output from the CHARACTER connector is synchronized with the input signal AUX auxiliary connector 8 pin Not used VCS video selector connector 8 pin Connect to the REMOTE connector of a VCS 700 Video Selector using a CCA 5 cable RCP remote control panel 1through 6 connectors 8 pin Connect to the CNU CCU REMOTE connector on RCP 700 Series Remote Control Panels using a CCA 5 cable Chapter 7 Location and Function of Parts and Controls 103 7 6 2 Internal Board OPERATION MODE aumen SYNC om NORMAL EMERGENCY re UP DOWN CANCEL PHUSE Q 5 V indicator MODE switch SYNC ON OFF i switch OPERATION switch P DOWN switch oe CHARACTER SET CANCEL switch PHASE control 5 V indicator CHARACTER PHASE control Lights when 5 V power to the board Adjusts the horizontal phase of the signal output from the CHARACTER connector referring to the reference OPERATION switch signal Adjust the phase by monitoring the signal on NORMAL Set to this position for normal operation the monitor screen EMERGENCY Set to this position when the CNU 500 or MSU 700 cannot function normally The RCP 70
230. ht areas to maintain the saturation in those picture areas compressed by the Knee function Low key Saturation The Knee Saturation function is also effective for low key pictures maintaining saturation to give color reproduction characteristics Selectable Gamma and Initial Gain Several Pre set Gamma curves and Initial Gain settings are provided to emulate standardized video gamma transfer characteristics These gamma tables are always accessible and interchangeable via the camera set up menu Variable Black Gamma Range The Variable Black Gamma Range function helps to precisely control shadow areas It can help to bring out details from the dark areas of the picture without affecting mid tones and keeping the absolute black level unchanged 12 bit A D and the low noise CCD have extended the prowess of this important subjective picture control Black Stretch Limits the Black Gamma function to picture luminance Chapter 1 Introduction 10 Level Dependent Detail This function provides natural detail enhancement on extreme highlights by automatically limiting the 1 5 Features of the System Components MSU 700A and MSU 750 Master Set up Units These MSUS provide a centralized technical control position in a multi camera system The MSU 700A is designed for use mounted with its control panel horizontal while the MSU 750 is designed for mounting vertically They have been designed to allow comprehensive wide ranging t
231. i tive pulse 8 1 2 Wiring Diagrams for Cables CCA 5 Cable e Black White Orange White Brown Red White Red Brown 8 pin connector Male Wiring side HDC 900 950 930 Series Product Information Manual Brown 8 pin connector Male Wiring side Chapter 8 Connectors and Cables 151 HDCZ Cable Yellow 26P CONNECTOR FEMALE MALE WIRING SIDE Black Blue Red Brown Gray Red 8 1 3 Connection Connectors Cables Connections made with the connector panels during Black White Red Red White Blue Red White Orange White Red Yellow White Indication VTR CAM BODY Connection connector cable 1 564 184 00 Plug 26P Female or Cable assembly HDCZ A10 supplied with HKC T950 10 m 1 823 615 11 HDCZ A25 option 25 m 1 823 616 11 HDCZ A50 option 50 m 1 823 617 11 OPT HEAD 26P FEMALE 1 564 183 31 Plug 26P Male or Cable assembly 3 HDCZ A10 supplied with HKC T950 10 m 1 823 615 11 HDCZ A25 option 25 m 1 823 616 11 HDCZ A50 option 50 m 1 823 617 11 DC IN 4P MALE 1 508 362 00 XLR 4P Female or ITT Cannon XLR 4 11C equivalent or Cable assembly 1 551 577 00 Supplied with AC 550 550CE REMOTE 8P FEMALE 1 766 848 11 Plug 8P Ma
232. ier in the camera HDC 900 950 930 Series Product Information Manual 7 4 9 Internal Switches and Internal Boards DTX Board Q POWER indicator OPTICAL CONDITION indicators CHU LOCK indicator RETURN SET switch Q POWER indicator The LED is lit when the power voltage inside the board is normal OPTICAL CONDITION indicators The corresponding LEDs light to show the condition of optical signal reception at this unit CCU and the camera CHU Green Good Yellow Low optical level Red Extremely low optical level or disconnection If communication with the connected camera is not established all the three CHU green yellow and red indicators go dark CHU LOCK indicator The LED is lit when communication with the connected camera is being properly made RETURN SET switch Select the type of the return video signal to be connected to the RET1 RET2 and RET3 connectors of this unit HD HD SDI signal local setting REM remote Signal selected on the MSU 700A 750 Master Setup Unit SD SD signal local setting Switching between SD SDI and VBS is made with an internal switch Chapter 7 Location and Function of Parts and Controls 99 7 4 10 Internal Switches and Internal Boards DRX Board Q POWER indicator Camera status indicators CHARACTER switch POWER indicator The LED is lit when the power voltage inside the board is normal Camera status indicators
233. ight 3U 1U 19 inch standard rack Yes Yes mauntable Figure 4 1 CNU 700 500 Basic System Configurations Up to six cameras with one CNU 700 or CNU 500 mcm Command Video Character Monitor HDC 900 Waveform Vector HDCU 900 Monitor Scope B W monitor for character display CNU 700 500 NTSC or Jj PAL MSU 700A 1 1 1 1 1 a 1 1 1 1 1 1 3 1 1 1 1 J 1 1 1 1 1 1 lo RCP 700 Series HDC 900 950 930 Series Product Information Manual Chapter 4 Control System 52 Figure 4 2 CNU 700 Expanded System Configurations Up to 12 cameras with one CNU 700 with one BKP 7930 installed
234. in red When a green tally signal is sent to the camera the number is displayed in black and the background of the number lights in green When both the red and green tally signals are simultaneously sent the left half of the background lights in red and the right half lights in green ALARM indicator Lights when trouble occurs in the camera system and the self diagnostic function activates at the video camera or the CCU HDCU series CALL button Press to send a call signal to the video camera on which the CALL button lights The tally lamps on the camera and the red tally lamp on the CCU HDCU Series light when not lit or go dark when lit When the CALL button on the video camera is pressed the CALL button on this panel lights and a buzzer sounds PANEL ACTIVE button Press and light up the button to permit this panel to control the camera system Panel active status The IRIS MB ACTIVE button also lights If you press this button so that it goes dark the panel will be locked preventing accidental misoperation D Power and output signal select block oo CAMPW TEST BARS CLOSE D CAM PW camera power button Press and light up this button to turn the power supply to the video camera ON The button promptly flashes until the camera becomes ready for transmission When you press this button again it starts flashing and the power supply is turned off 2 Signal output select buttons Press and light
235. ing the RM Configuration menu you can change the function of these controls to adjust the R B flare balance The adjustment mode of these controls is specified at the factory as Relative mode which can also be changed to Absolute mode using the menu See Settings on the RM Configuration Menu 2 ABB auto black balance button red illumination Press to automatically adjust the black balance and black set The button is illuminated during adjustment and this is turned off when the adjustment is completed If you press this button when it is illuminated the automatic adjustment is canceled and the button flashes To stop the flashing press the button again Note When the adjustment mode of the BLACK controls is specified as Absolute mode automatic black balance adjustment with the ABB button is disabled Q ACTIVE button green illumination Press to select the control mode for the connected camera system Each time you press the button with the factory setting the control mode cyclically Switches between FULL PART and LOCK modes FULL mode All controls from this unit are enabled panel active status Both this button and the IRIS MB ACTIVE indicator in the iris master black control block are illuminated PART mode Controls only from the iris master black control block are enabled iris master black active status This button is not illuminated but the IRIS MB ACTIVE indicator stays lit LOCK mode cont
236. ing the supplied connecting cable HDVF C700W The CAMERA connector is on the bottom of the viewfinder Connect to the camera s viewfinder connector Clamper HDVF C750W only Clamps the supplied connecting cable Mounting wedge To attach the viewfinder to a camera the mounting wedge is inserted into the V shaped groove on the top of the camera 1 These controls have no effect on the camera s video output signals HDC 900 950 930 Series Product Information Manual Chapter 7 Location and Function of Parts and Controls 139 7 17 CA 905L Large Lens Adaptor 7 17 1 Lens Attachment Section Front and Connectors BKP 9057 Viewfinder Saddle not supplied KA 9 Lens connector REMOTE cable CA cable Q Accessory bracket Number plate holder Q Lens lock Secures the lens by the tongue like protrusion at the lens bottom Lens lock holding knob Secures the lens lock Turn clockwise to tighten and counterclockwise to loosen Lens connector 36 pin Connect to the connector on the lens Cable clamp Secures the camera cable The diameter of the cable with a diameter of 8 to 15 mm should be used with the cable clamp Q Lens mode switch Selects one of the two lens communication modes During normal operation set to NORMAL During use of a serial communication lens set to SERIAL Q CCU camera control unit fiber connector LEMO type Connects through an optional fiber cable to the CA
237. ions It can be tilted up to 90 upwards or 90 downwards and can be panned up to 90 to the left or 90 to the right The HDVF C700W can be tilted up to 90 upwards or 50 downwards Drip proof construction The drip proof design is able to withstand light rain making the viewfinder well suited to outdoor use Studio monitor hood outdoor hood The viewfinder can be fitted with a strong easy to use hood supplied or an outdoor hood with excellent shading ability option Energy saving design The viewfinder will accept a wide range of power supply voltage from 10 5 to 17 volts with low power consumption 10 watts The HDVF 20A has the following features Multiscan In addition to the 60i format formats such as 24PsF and 50i are supported for control signals from the camera High performance CRT Quick start type The image appears as soon as the camera is turned on Enhanced resolution Reduced flare Marker indication When the camera setting allows the center marker or safety zone marker indication the viewfinder can set the marker indication on or off Removable eyepiece Detaching the eyepiece gives you a clear view of the center of the screen even with your eye away from the viewfinder You can clean dust from the screen or the mirror by detaching the eyepiece Other features Fitting an optional fog proof filter Part No 1 547 341 12 over the viewfinder lens prevents breath or vapor conden
238. is pressed and decreases when the Y down button is pressed It continuously changes when either button is kept pressed In Shutter mode when the ECS button is not lit The denominator of the selected step shutter speed is displayed in the window Press to select the desired shutter speed The speed increases when the A up button is pressed and decreases when the Y down button is pressed It continuously changes when either button is kept pressed 9 GAMMA select buttons and display window Select the step gamma The selected value is displayed in the window The gamma value decreases when the A up button is pressed and increases when the Y down button is pressed It continuously changes when either button is kept pressed HDC 900 950 930 Series Product Information Manual Note The higher the gamma effect the lower the value amp MASTER GAIN selects buttons and display window Select the appropriate video gain according to the illumination of the subject to be shot The selected value dB is displayed in the window The gain value increases when the A up button is pressed and decreases when the Y down button is pressed It continuously changes when either button is kept pressed IRIS MB ACTIVE iris master black active button Press and light up this button to enable the iris and master black adjustment functions of the unit When the PANEL ACTIVE button is pressed this button automatically lights To disable
239. is the component video signal s selected by the R G B switch R G B red green blue switch When the Y RGB switch is set to RGB select the component video signal s to be provided as output to the VF and TEST OUT connectors ASSINABLE switch You can assign a function using the OPERATION menu Q FILTER internal filter selection control Used to select an internal filter appropriate for the light source illuminating the subject HDC 900 950 930 Series Product Information Manual 1 2 HDC 950 930 HD Color Video Camera CAMERA VTR switch D GAIN switch OUTPUT AUTO KNEE switch WHITE BAL switch DISPLAY switch CANCEL STATUS switch MENU SEL knob ENTER button ND filter Color temperature conversion filter 1 Clear A Cross filter 2 1 4ND B 3200K 3 1 8ND C 4200K 4 1 6ND D 6300K 5 1 64ND E 8400K AUTO W B BAL white and black balance automatic adjustment switch1 Used to automatically adjust white and black balance WHT Automatically adjust white balance BLK Automatically adjust black balance Q CAMERA VTR switch1 Used to select control signals sent to a VTR connected to the camera The operation of the VTR at the start of recording for each setting is shown in the table below CAMERA OFF VTR SAVE Function Turn off the camera power Camera power is on When the VTR START button is pressed recording will begin after a few se
240. it the supplied number plates Camera mount slide lever Pull this lever to slide the camera mount forward and backward Camera mount release lever To remove the camera from the unit push this lever while pushing the safety lever on the left rightward D Camera mount Fit the camera Slide to the front and rear HDC 900 950 930 Series Product Information Manual Q VF viewfinder connector Viewfinder mount Viewfinder release button Pan lock lever VF connecting cable Saddle lock knob 7 17 3 Rear control panel CA 905L during use with the HDC 950 930 only with rear panel sticker attached Power O Assignable switch SCREEN SIZE MARKER switch VF SCAN switch VF SCAN viewfinder scan switch Selects the aspect ratio of the viewfinder screen 16 9 16 9 aspect ratio 4 3 4 3 aspect ratio SCREEN SIZE MARKER switch Selects the screen size marker on the viewfinder screen ON E Display area is bounded by two dark margins Display area is bounded by two white lines OFF No marker is displayed Assignable switch A function specified by menu setting on the HDC 950 930 can be assigned to this switch Chapter 7 Location and Function of Parts and Controls 141 Gonnectors and Cables 8 1 HDC 900 950 930 and HKC T950 HD Color Video Camera and HD CCD Black Adaptor 8 1 1 Connector Input
241. item is on selection control enabled when the characters are shown in black and off selection control disabled when the characters are shown in white Each time Set is pressed on the MSU Assignment menu with the cursor on the item turns it on or off Caution Be sure to enable the camera selection for at least one camera If selection control is disabled for all the connected cameras the MSU 700A 750 becomes inoperative and the MSU Assignment HDC 900 950 930 Series Product Information Manual mode cannot be selected anymore If this occurs change the MSU assignment as described in To restore operations of the MSU 700A 750 on the next page To resume the initial assignment Press Default on the MSU Assignment menu 7 When your settings are completed press Set on the MSU Assignment menu with the cursor on Ret in the upper right of the CNU character display To cancel the settings press Cancel The character display of the CNU 700 returns to its previous status MSU Assignment display In SUPERVISER MSU mode perform the settings for the cameras of other groups in the same manner When the MSU assignment is completed Press Exit on the MSU Assignment menu 6 3 3 1 To restore operations of the MSU 700A 750 If the MSU 700A 750 has become inoperative by disabling the selection control for all the connected cameras change the MSU assignment using the internal switches of the CNU 700 as follows
242. ith the field frequency of 59 94 50 Hz The selection of RET 1 2 3 or 4 is made by the camera s return switch The type of input signal on RET 1 2 3 and 4 may be set individually using switches on the internal AT board or using the MSU 700A 750 Master Setup Unit The aspect ratio may also be selected for SD signals SYNC OUT HD SD sync signal output connector BNC type Used for output of an HD tri level sync or SD composite sync signal from the internal sync signal generator Factory setting HD tri level sync Q PIX OUT picture monitor output connector BNC type Used for output of the picture monitor video signal selected using the RCP 700 series Remote Control Panel MONITOR SELECT button or the MSU 700A 750 Master Setup Unit PICTURE MONITOR button When both the RCP and MSU are in use this connector functions as the output connector for RCP control WF OUT waveform monitor output connector BNC type Used for output of the waveform monitor video signal selected using the RCP 700 series Remote Control Panel MONITOR SELECT button or the MSU 700A 750 Master Setup Unit WF MONITOR button When both the RCP and MSU are in use this connector functions as the output connector for RCP control Note The SC phase of the VBS signal output from connectors 3 and 4 is not locked to the black burst signal supplied to the REFERENCE IN connector Use the monitor in Internal sync mode HDC 900 950 930 Series Product I
243. ithin 0 5 dB 10 to 25 MHz Within x 1 0 dB 25 to 30 MHz 1000 TV lines at center of screen 45 10 5 27 5 MHz Negligible not including lens distortion Chapter 10 Specifications 179 Optical system specifications DC OUT 4 pin 1 10 5 to 17 V DC Spectral system F1 4 prism 5W maximum Built in filters Color temperature HD SERIAL OUT BNC type 1 conversion filters and 2 XLR 5 pin female 1 A cross filter TEST OUT BNC type 1 B 3200K clear GENLOCK IN RET IN PROMPT OUT C 4300K BNC type 1 1 Vp p D 6300K 75 ohms E 8000K RET CONT 6 pin 1 ND filters REMOTE 8 pin 1 1 clear TRACKER 20 pin 1 2 1 4 ND EXT 20 pin 1 3 1 8 ND 4 1 16 ND Supplied accessories 5 1 64 ND Operation manual 1 Servo filter control Yes Installation amp maintenance manual 1 Lens mount Sony bayonet mount Laser Diode Properties Optional accessories Material InGaAsP BKP L551 Battery Adaptor Wave length 1310 40 nm BKW 401 Viewfinder Rotation Bracket Emission duration Continuous C 74 Microphone Laser output power 141 37 19 mW CA 905L Large Lens Adaptor CAC 6 Return Video Selector Input output connectors CAC 12 Microphone holder VTR CCZ 26 pin 1 HDVF 20A HD Electronic Viewfinder CCU Electro multi connector 1 HDVF C750W HD Electronic Viewfinder LENS 12 pin 1 MSA 4A 8A 16A Memory Stick VF 20 pin 1 VCT 14 Tripod adaptor MIC IN XLR 3 pin female 1 Maintenance manual CD ROM version 4 E m Mi
244. ive either HD SDI SD component SDI or analog VBS signals mixed input of different signals is not allowed may be setto 4 3 edge crop 16 9 squeeze or letterbox External reference signals The HDCU 900 950 family can be locked to an external reference signal Either an HD tri level sync signal or an SD sync black burst signal may be used as the reference signal Internal down converter When the system is operating at a 59 94 50 Hz field frequency HD signals can be converted to SD component SDI signals using the down converter The output signal aspect ratio may be set to 4 3 edge crop 16 9 squeeze or letter box The down converter has independent image enhancement gamma control and matrix ON OFF features and can be controlled externally Internal up converter The HDCU 900 950 family has an up converter to allow monitoring of SD signal return video using an HD viewfinder The aspect ratio of the return video signal may be set to 4 3 edge crop 16 9 squeeze or letter box Optical digital transmission The HDCU 900 950 can be connected to a camera with the use of an optical fiber cable two single mode optical fiber lines two power lines two control lines for the transmission of digitized video audio and control signals By connecting optical fiber cables signals can be transmitted up to a maximum of 3000 meters 1 86 miles when using the HDCU 900 and up to 1200 meters 0 7 mile using the HDCU 950 The maximum le
245. l MONITOR SELECT button or the MSU 700A 750 Master Setup Unit PICTURE MONITOR button When both the RCP and MSU are in use this connector functions as the output connector for RCP control WF OUT waveform monitor output connector BNC type Used for output of the video signal for waveform monitoring selected using the RCP 700 series Remote Control Panel s MONITOR SELECT button or the MSU 700A 750 Master Setup Unit s WF MONITOR button When both the RCP and MSU are in use this connector functions as the output connector for RCP control Note The SC phase of the VBS signal output from connectors 2 and 3 is not locked to the black burst signal supplied to the REFERENCE connector Use the vector monitor in Internal Sync mode 7 4 4 HKCU 951 SD Encoder Unit The optional HKCU 951 is to be installed in the HDCU 950 expansion slot Connector panel VDA board Q VBS OUT connector Y G B Y B and R Y R connectors Note All the connectors function when the system is operated at a 59 94 50 Hz field frequency but do not operate when the system field frequency is 60 Hz Q VBS OUT composite video signal output connector BNC type Used for output of the video camera signal in analog composite video format An internal setting enables the SD SDI OUT1 and OUT2 connectors on the DIF board also to be used as analog VBS outputs HDC 900 950 930 Series Product Information Manual Y G and R Y R
246. l system the image might sometimes seem floating or some colors might appear in dark portions of the picture because of diffused reflection Flare correction electronically compensates for this phenomenon Gamma correction A CRT does not beam at the screen linearly as per the signal level Normally a TV set should compensate for the error because it is part of a CRT s characteristics However in consideration of the total cost the industry has reached an agreement with TV stations that the acquisition side should take the responsibility to correct the error This is the gamma correction As the standard in this agreement is not very strict the Gamma correction value is not always completely the same between different manufacturers and different TV stations In the camera field Gamma correction is also a way of creating user s taste and setting the picture quality Gen lock Synchronization should be done when using multiple cameras Gen lock is a function developed for this purpose to synchronize the cameras to an external VBS input Then horizontal phase vertical phase and sub carrier phase will be synchronized Horizontal image enhancement H DTL Horizontal image enhancement is performed by raising the frequency characteristic of the video signals which is carried out by using the Low Pass Filter and Delay Line for analog cameras while using the digital filter for digital cameras Image Enhancement It is a function to giv
247. l the camera system Panel active status The IRIS MB ACTIVE button also illuminates HDC 900 950 930 Series Product Information Manual REMOTE CONTROL PANEL WHITE white balance button Press to automatically adjust the white balance The button is illuminated during adjustment and remains illuminated until the adjustments are completed If you press this button while it is illuminated or press the START BREAK button the automatic adjustment is canceled and the button flashes To stop it flashing press the button again Chapter 7 Location and Function of Parts and Controls 124 Note If an error occurs during adjustment the selected button flashes BLACK black balance button Press to automatically adjust the black balance and black set The button is illuminated during adjustment and remains illuminated until the adjustments are completed If you press this button while it is illuminated or press the START BREAK button the automatic adjustment is canceled and the button flashes To stop it flashing press the button again Note If an error occurs during adjustment the pressed button flashes CALL button Press to send a call signal to the camera on which the CALL button is illuminated The tally lamps on the camera and the red tally lamp on the CCU 700 A700AP are illuminated if they were not lit or are turned off if they were already illuminated When the CALL button on the camera is pressed the CALL butt
248. le of Contents 7 1 1 Overview The HDC 900 950 930 family is designed to provide a wide range of choices of HDTV and SDTV configurations to fulfill the increasing demands for multiple global digital origination formats from almost all applications including broadcasters filmmakers production companies etc The HDC 900 Series consists of HDC 900 full size studio model color video camera and the 950 930 its flawless companion portable version Both of them were developed for both studio and outside application systems based on several newly developed technologies applied to each Easy to setup and highly reliable Digital processing performs parameters in a digital memory and keeps them intact for long periods of time resulting in a dramatic reduction of the need for operator adjustment With the use of digital processing further advantages are achieved such as to easy implementation of this circuitry in ICs and LSIs while increasing reliability Precise adjustment The values of the camera set up parameters can be defined with great precision by digital processing 1 3 Sony Design Criteria There are several important design criteria Sony has taken very seriously in the HDC 900 Series to ensure that it not only provides the features required for these new services but also has compatibility with existing broadcast environments and further enhances DSP Digital Signal Processing technology True multi standar
249. le or CCA 5 cable assembly option 2 CCA 5 10 10 m CCA 5 3 3 m or REMOTE cable 1 783 372 11 supplied with RM B150 10 m 12 installation or service should be made with the connectors complete cable assemblies specified in the following list or equivalent parts Indication Connection connector cable MONITOR 1 569 370 12 Plug BNC PROMPTER SERIAL OUT VIDEO OUT BNC AUDIO IN 1 508 084 00 XLR 3P Male or MIC IN ITT Cannon XLR 3 12C equivalent FEMALE Cable assembly supplied with HKC T950 0 8 m 1 823 599 11 3 MIC IN 1 508 083 00 XLR 3P Female or 3P MALE ITT Cannon XLR 3 11C equivalent Cable assembly supplied with HKC T950 0 8 m 1 823 599 11 3 RET CONTROL 1 560 078 00 Plug 6P Male or 6P FEMALE HIROSE HR10 7PA 6P equivalent DC OUT 1 566 425 11 Plug 4P Male or FEMALE HIROSE HR10A 7P 4P equivalent INTERCOM 1 508 370 11 XLR 5P Male or INCOM ITT Cannon XLR 5 12C equivalent FEMALE Cable assembly supplied with HKC T950 0 8 m 1 823 600 11 3 INCOM 1 508 363 00 XLR 5P Female or 5P MALE ITT Cannon XLR 5 11C equivalent Cable assembly supplied with HKC T950 0 8 m 1 823 600 11 TRACKER 20P FEMALE HIROSE HR25 9P 20P equivalent VF 20P FEMALE Cable assembly supplied with HKC T950 0 7 m 1 792 603 21 HDC 900 950 930 Series Product Information Manual 1 Use of the REMOTE cable enables the operator to monitor video signals 2 If
250. lexible operation It has been designed to achieve the highest reliability afford easy maintenance and allow flexible system configuration The HDCU 900 features a down converter to convert HD signals to SD 2 and a return video up converter to convert SD signals to HD making it usable with standard definition color video cameras as well as high definition color video cameras It can be combined with an optional MSU 700A 750 Master Setup Unit or an optional RCP 750 751 700 701 Remote Control Panel to form a camera control system that meets your system needs Furthermore a system capable of controlling multiple video cameras can also be configured by adding a CNU 700 500 Camera Command Network Unit 1 High Definition HD signal A name for 1125 line high definition TV signals 2 Standard Definition SD signal A name for NTSC PAL 525 625 component or 525 625 composite signals The HDCU 950 Camera Control Unit is also available for use with the HDC 950 and HDC 930 cameras Its compact body and multiple video outputs make this unit ideal for field use A stand alone system can be easily configured by attaching the control panel of the RM B750 Remote Control Unit to the HDCU 950 which allows you to directly operate the connected camera from the HDCU 950 The HDCU 900 and HDCU 950 camera control units have the following major features Multiple video inputs and outputs HDCU 900 only The HDCU 900 has four sets of HD SDI S
251. ltage value to make this indicator begin blinking is set by the camera For details refer to the manual for the camera Q Green tally lamps Light up when the camera receives a green tally signal QD Lift lock release knob 1 HDVF C750W only Adjust the viewfinder height using lift lock release knob 2 together with this knob External tally lamp Lights up red in response to a red tally signal Can be used to display the camera number by attaching one of the supplied number plates 0 through 9 External tally dimmer control Adjusts the brightness of the external tally lamp Use a screwdriver to turn the control counterclockwise to increase the brightness or clockwise to dim the lamp TALLY ON OFF switch Controls the external tally lamp When set to ON the external tally lamp will operate When set to OFF the lamp will not operate will not light in response to a tally signal Blanking marker ON OFF switch Turns the display of the blanking marker on and off Tally dimmer switch Adjusts the brightness of the red tally lamps the green tally lamps the attention indicator and the BATT battery indicator on the front panel Lift lock release knob 2 HDVF C750W only Adjust the viewfinder height using lift lock release knob 1 together with this knob CAMERA connector HDVF C750W Round type 20 pin HDVF C700W D sub 25 pin HDVF C750W Connect to the camera s viewfinder connector us
252. ly for each of three separate color ranges Colors are not limited to skin tones but can be setfor any color Detail may be increased or decreased relative to the normal level Phase Sets the color phase for which Skin Tone Detail Correction is activated Width Sets the color width for which Skin Tone Colorimetry in dark areas are improved On 4 Adaptive highlight control Auto Knee mode Detail Correction is activated Conventional cameras only have a single knee point Saturation Sets the saturation for which Skin Tone slope characteristic In contrast the Sony ADSP Detail Correction is activated System has multiple knee point slope characteristics The camera monitors the brightness of all areas of the Figure 3 4 Skin Tone Detail Correction picture and adapts the knee point slope for optimum reproduction A typical example is shooting an interior scene which includes a sunlit exterior seen through a window This new function applies only to video levels in excess of the knee point the middle and low luminance parts remaining unchanged Figure 3 3 Knee curve image B Y Intput signal level white clip Saturation Output signal level o o o o o S x x HDC 900 950 930 Series Product Information Manual Chapter 3 Benefit of Sony ADSP Advanced Digital Signal Processing 45 knee point 2 knee point 3 knee point n Photo 3 6 Triple Skin Tone Detail Co
253. ly by moving the lever When the AUTO button is lit the reference value for automatic iris adjustment can set in a range of 1f with this lever See the following table Iris adjustment functions Chapter 7 Location and Function of Parts and Controls 121 IRIS RELATIVE iris relative button When the IRIS MB ACTIVE button is lit the iris adjustment mode can be selected with this button Press and light up the button for Relative mode or press so that it goes dark for Absolute mode When the IRIS MB ACTIVE button is not lit Relative mode is automatically selected and this button is not operative Iris adjustment functions Relative mode Absolute mode RELATIVE button RELATIVE button lit not lit Adjusts the iris with Adjusts the iris IRIS lever 5 RCP 750 relative values within the variable within 1 4 of the range set by the IRIS control RCP 751 total range from SENS and OPEN to CLOSED COARSE Adjusts the total COARSE range from OPEN Sets the lower limit control to CLOSED in rela for CLOSED tive values Sets the upper limit for OPEN accord SENS Does not function ing to CLOSED control value set by the COARSE control 7 10 3 lris master black control block RCP 751 IRIS RELATIVE button MASTER BLACK L D MASTER BLACK control MASTER BLACK OO IRIS MB ACTIVE button IRIS MB AUTO _ ACTIVE f number display
254. mma on off Knee Off lt lt SISISIS Auto Knee on off V mod Saw R G B Master V Mod Saw Off Detail Detail 1 Level Limiter Crispening S lt lt S SISISIN SIS Level Dep Level Dep Off S SISIS S S SIS S SISISISISISISISISISISISI S SSISIS S S SIS S 5 5 5 ASA SA SASA ASAS S Detail Off lt SD DTL Off v Detail 2 Ratio Frequency ix Ratio Detail Comb SISISISIS SISISISIS Detail Off SD DTL Off v Detail 3 W Limiter B Limiter Knee Aperture Knee Aperture on off SISISISIS SISISISIS Detail on off 1 2 3 Skin Detail common Level lt lt Phase Width lt lt Saturation S lt lt S S lt lt S Auto Hue DTL Gate v v Gate on off Skin Dtl cach channel on off SkinDetail all channels on off Gamma R G B Master Gamma 0 40 0 45 0 50 Gamma Off Black Gamma RGB R G B Master Low L Mid H Mid High Range Black Gamma on off Y Y SISISIS S SS S ASS lt lt lt Low L Mid H Mid High Range HDC 900 950 930 Series Product Information Manual Appendix 192 Sub Menu Control Item Black Gam Y on off MSU 700A MSU 750 RCP 750 751 RM B750 Direct Menu Button lt Menu lt Dire
255. mperature 5 C to 40 Storage Temperature 20 C to 55 C Dimensions W x H x D 197 mm x 62 mm x 124 mm 7 7 8 x 2 1 2 x 5 inches Inputs Control interface Monitor in 10 15 HDVF 20A HD Electronic Viewfinder Approx 0 7 kg 1 Ib 9 oz 8 pin x 1 Sony Camera Command Network Protocol BNC type x 1 VBS No HD signal capable General x Power requirements 10 5 to 17 V DC Horizontal Vertical Power consumption AW scanning Format scanning scanning Operating temperature 20 C to 45 4 F to frequency frequency 113 F 1080 59 94i 33 72kHz 59 94Hz Storage temperature 20 C to 50 4 F to 1080 60i 33 75kHz 60Hz 122 F External dimensions 239 x 76 x 210 mm 9 1 2 1035 39 94 33 72kHz 59 94 2 x 3 x 8 3 8 inches w h d 1035 60i 33 75kHz 60Hz Mass 600 g 1 Ib 5 oz Video input 1 0 Vp p 6 dB 75 ohms terminated Performance Indicators REC TALLY BATT VTR CRT 2 type monochrome SAVE 500 TV lines at center Conforming to BTA S001 and SMPTE274M Horizontal resolution Signal system Accessories Microphone spacer diameter 19 mm 1 standards Microphone spacer diameter 21 mm 1 Supported formats Operation manual 1 Effective Horizontal Vertical Optional accessories ane orma 2 BKW 401 Viewfinder Rotation ines requency frequency Fog proof filter Part No 1 547 341 12 1080 23 98PsF 26 9
256. n These features ensure easy and error free use of this remote control panel Controlling the automatic setup function The RCP 750 751 has built in microcomputers that reliably perform automatic setup for the majority of the control items The various items can be automatically adjusted independently or in combination Controlling the scene file function Camera adjustment and control data such as paint data for a particular scene can be stored in the video camera in the form of a scene file The stored data can easily be retrieved at any time to automatically adjust the camera to the shooting conditions for that particular scene This panel enables up to five scene files to be created and handled Controlling the ECS shutter function of the camera The ECS Extended Clear Scan and electronic shutter functions of the camera can be turned on off from this panel The ECS frequency and shutter speed are also selectable Signal transmission via a digital line Between this remote control panel and the camera control unit signals are digitally transmitted via a single connection cable CCA 5 ensuring a reliable signal Operating power is also supplied via the cable Memory Stick media card slot Various data including scene files and reference files can be stored on a Memory Stick media card and reproduced at any time Touch panel with 31 2 inch LCD for various operations The control panel has a touch panel that permits various i
257. n the viewfinder screen pressing this button will cancel any changed setting and return the display to the previous menu When menus are not displayed on the viewfinder screen pressing this button will display the PIND item MENU SEL menu select knob ENTER button rotary encoder Used to select settings from menus displayed on the viewfinder screen by rotating the knob and to confirm settings by pushing the button VF connector Q SHUTTER switch INCOM EAR LEVEL control VTR START button Chapter 7 Location and Function of Parts and Controls 83 TEST OUT test output connector BNC type Connect to a monitor as necessary The output will be the signal selected with the Y RGB and R G B switches MIC 1 IN microphone 1 input connector XLR 3 pin female Connect a microphone This connector and the AUDIO IN CH 1 connector on the back are alternately activated with the MIC IN switch RET 1 return video 1 button The return video 1 signal from the camera control unit is monitored on the viewfinder screen while this button is pressed It is the same function as with the RET 1 buttons on the grip and right side MIC IN microphone input switch Select either the microphone connected to the MIC 1 IN connector or that connected to the AUDIO IN CH 1 connector on the back 48V FRONT To use the microphone connected to the MIC1 IN connector and supply a power of 48 V to the microphone
258. nal Specifications PA Signal yo Specifications 27 LENS ADRS D IN 1 11 INC No connection 28 EXTENDER 1 OUT ON GND 12 VF VIDEO X IN 1 0 V p p VF Zi 1 5 ON OFF High impedance kOhms 29 2 OUT GND 13 AUDIO CTL ON OFF High impedance 14 B Y X IN 700 mV p p VF Zi 30 FDEM FAR No connection 1 5 kOhms 75 96 color 31 INCOM 1 21210 kOhms bars ENG PRD ENG GND 15 R Y X IN 700 mV p p VF Zi PRD High impedance 1 5 kOhms 75 color 32 INCOM2 IN Zi gt 10 kOhms bars ENG PRD ENG GND 16 INC No connection PRD High impedance 17 IND IN H Indicator lights 33 IC 1 Zi gt 10 kOhms L Indicator goes out ON ON GND _ 18 NC No connection INCOMMIC2 IN gt ms ON ON GND 20 NC No connection OFF High impedance HD video 35 FCONT SIG No connection 36 F DEM NEAR No connection us Signal Uo Specifications 1 Zi210kOhns o 1 High impedance d 151 1 S DATA o TTL level LENS ADRS A Low order bit LENS ADRS D High order bit 2 No connection 2 Zi210 3 C N ti 1 High impedance connection 0 0 0 5 V 4 SCK TTL level 5 N ti EXT1 2 MODE 6 C No connection 1 1 1 EXTENDER OFF 7 No connection 1 0 1 __ 1 5 ON 8 G TALLY IN 5 0 1 1 EXT B x2 ON OFF GND 0 0 1 EXT C x2 5 ON 9 C No connection 10 C No connection 11 C No connection 8 14 1 4 VF 20P Male BKP 9057 12 VF V
259. nated 9 START STOP button red illumination Press this button to start a recording operation The button is illuminated Pressing this button when it is illuminated stops the VTR recording B STOP button Press to stop a rewind fast orward or playback operation E PLAY button amber illumination Press this button to start a playback operation The button is illuminated 6 REVIEW recording review button amber illumination Press this button to execute a recording review operation The button is illuminated Notes When the START STOP button is illuminated the other buttons in the VTR control block are deactivated To activate the other buttons first press the START STOP button to cancel the Recording mode Some of the VTR control functions of this unit may be disabled depending on the combination of camera and VTR For details ask your official Sony representative OUTPUT selector Selects the output signal from the connected camera CAM Picture output BARS Color bar signal TEST Test signals for a video circuit check the signal is selected using the RM Configuration Menu See Settings on the RM Configuration Menu GAIN master gain selector Selects the video gain from three values LOW MID HIGH according to the illumination of the subject to be shot Normally these three gain settings are those chosen in the camera set up
260. nd Cable 64 Great care should be taken so as not to lose or damage the alignment sleeve Alignment sleeve Sony P N 9 980 074 01 Alignment sleeve m 3 Clean the tip of the white optical contacts with a cotton swab moistened with alcohol Optical contacts white 4 Insert the remover with the alignment sleeve attached to its tip and push it until it clicks 5 Rotate the remover counterclockwise to install the alignment sleeve and extract the remover HDC 900 950 930 Series Product Information Manual Chapter 5 Optical Fiber Connector and Cable 65 HDC 900 950 930 Series Product Information Manual A Quick Lesson on Camera Settings The following are two quick setting guides for the HDC 900 Series Case 1 and Case 2 The former is mainly for applications where minimal camera operational 1 One touch power on Use the main switch of the power supply to turn on off the whole system rather than using the power on off switches on the individual devices for operating convenience 2 Stable time Normally a camera system can be used to start shooting within a few seconds after power is turned on Ifthe camera is connected in a large system environment it may require a little more time especially for System Locking after the power is turned on System components that need continual system stability such as a sync generator should be in round the clock operation in case it is needed to respond
261. nd Function of Parts and Controls 88 750 Master Setup Unit or RCP 700 series Remote Control Panel Either a recall type monitor or the 1730HD 1735HD Waveform Monitor may be connected When using a recall type monitor preset a display mode on the waveform monitor and then recall the mode externally Switches on the AT board are used to select either recalltype or 1730HD 1735HD type operation 8 TRUNK LINE connector D sub 9 pin RS 232C Used to connect the HDCU 900 to the TRACKER connector on an HDC 900 HD Color Video Camera via an RS 232C interface Used mainly for communication with equipment on the camera side The RXD TXD RTS and CTS signals can be transferred at up to 19 2 kbps using this connector 4 MIC REMOTE microphone remote connector D sub 15 pin Using this connector the video camera s microphone input level may be set by external equipment such as an audio mixer in five steps 760 50 40 30 and 20 dB When taping set the volume to a level appropriate for the audio conditions 5 PORT connector D sub 15 pin Used for remote control using an external control device 7 3 3 HD Signal Input Output Block SERIAL RET INPUT 1 4 connectors M Bu MEN x Nf Nf Nf N N 2 N 2 A 2 N 2 ____ SERIAL RET INPUT 1 REFERENCE IN Q SERIAL RET INPUT 1 4 HD SDI return video 1 2 3 and 4 input connectors BNC type Four different HD SDI return video input signals m
262. nder control of this unit light in green and the indicators for the cameras under control of another control panel light in orange An indicator whose corresponding camera or HDC 900 950 930 Series Product Information Manual camera control unit is not connected does not light An indicator lights in red when an error is detected and the self diagnostic functions are activated in the corresponding camera or camera control unit Camera select buttons Select the cameras to be controlled from this unit Press and light up the button corresponding to each desired camera Cameras 1 through 12 are selected when the EXPAND button is not lit and cameras 13 through 24 are selected when the EXPAND button is lit EXPAND button Press to select the group to be selected with the camera select buttons Cameras 1 through 12 can be selected when this button is not lit and cameras 13 through 24 can be selected when this button is lit Note An appropriate camera command network unit CNU 700 etc is required to control multiple cameras using the camera select function D Filter control block T Ld f 1 BEES LES ERR LES FILTER CTRL lt N AMAA CC FILTER CTRL filter control button Press and light up the button to enable filter selection with the CC and ND filter select buttons of this unit ND ND filter select buttons While the FILTER CTRL button is lit press and light up one of these
263. nection 9 49 8 2 5 IN connection 72 698 3 NC No connection 20 69898 4 12 LENS OUT 12 V at 2 A 2 5 LENS DC GND for 12 V LENS GND External view 6 GND SIG GND 7 INC No connection No Signal Specifications 8 LENS EXTA IN l2 A VTR UNREG IN 10 5 to 17 V dc LENS EXT 2 IN 2 GND GND for UNREG 10 LENS EXT 3 IN 1 GENLOCK 5 0 6 V p p OV 11 NC LENS AUX OUT JON GND dc Zi 75 Ohms OFF High impedance 2 GENLOCK GND GND for GEN 12 IRIS POSI IN Zi gt 10 kOhms LOCK 2to 7 V 3 G Y GND GND for GY 8 4 0 1 V F16 4 G Y OUT 1 Vp p 0 V dc Zo 6 2 0 1 V F2 8 75 Ohms 13 ZOOM POSI Zi 10 kOhms 5 R Pg OUT 1 Vp p 20 35 V p p 0 V dc Zo 75 2 V WIDE 7 V TELE Ohms 14 RET 1 ON Zi gt 10 kOhms 6 R Pg GND GND for eu ae ne 7 B Pg OUT 1 Vp p s0 35 V p Nudus p 0 V dc Zo 75 5 RET2ON Zi gt 10 kOhms onmes CE Ere imped 16 FOCUS POSI IN 2 510 5 9 CH1MIC X OUT 20 dBu Low aa 10 CH1 MIC Y OUT 2 Bal 2 V MIN 7 V ance 11 CH1 CH2 MIC GND for CH1 CH2 GND MIC SIG 3 4 0 1 V F16 6 2 0 1 V F2 8 12 UNREG SENSE Zo lt 1 kOhms N 18 IRIS AUTO GND 13 UNREG SENSE MANU MANU High imped IN ance 14 INCOM LINE IN 0 5 V p p Zo lt 1 kOhms OUT 19 NC No connection 15 CH2 MIC X OUT 20 dBu Lo
264. nformation Manual PIX OUT connector WF OUT connector WF MODE connector SERIAL OUTPUT 1 4 connectors 9 WFOUT WF MODE _______ SERIAL OUTPUT WF MODE waveform monitor mode connector 4 pin Connect to the appropriate connector on a waveform monitor when monitoring a signal in sequential mode A sequence signal will be output when the SEQ button on the RCP 700 series Remote Control Panel is pressed allowing simultaneous monitoring of the R G and B signals in sequential mode When both the RCP and MSU are in use this connector functions as the output connector for RCP control Q SERIAL OUTPUT 1 4 SD SDI 1 2 3 and 4 output connectors BNC type When the system is operating with the field frequency of 59 94 50 Hz the signal from the video camera may be down converted and output as four SD component SDI signals Chapter 7 Location and Function of Parts and Controls 90 The optional HKCU 901 is installed in the HDCU 900 expansion slot Q RET INPUT 1 4 connectors SYNC OUT connector L RET input n SYNC OUT PIX OUT Q RET INPUT 1 4 return video 1 2 3 and 4 input connectors BNC type Four different SD analog return video input signals may be received independently The selection of RET 1 2 3 or4 is made by the camera s return switch The type of input signal on RET 1 2 3 and 4 may be set individually using
265. nformation Manual Vertical image enhancement V DTL Vertical image enhancement is performed by enhancing the difference between vertical picture elements using a 2H delay line White balance White balance is used to compensate for the color temperature of the subject for photography Contrarily a sunset scene can be taken even in the daytime by using the white balance adjustment White clip Black clip The range between black level and the maximum white level is fixed in video signal standards The white clip and black clip are the circuits used to prevent video signals from exceeding this range White shading correction Because irregular shading happens during light to current inversion in a CCD sensitivity becomes uneven on the screen It is not so conspicuous for a one chip camera but for a three chip camera sometimes the color may not be completely the same depending on the portion of the screen White shading correction is used to avoid this phenomenon that is also called modulation shading Auto white shading Auto black shading Both of them automatically adjust the shading Auto black shading is simply carried out when the lens is closed However in the strict sense of the word a complete white subject for photography is needed for auto white shading in which there are two modes one keeps each of the R G B waves flat and the other matches them to the G channel File system Increasing camera functions also expan
266. ng and CNU control assignment can be displayed on a monitor ince the CNU is the nerve center of a system it has a bypass facility to maintain communication between the HDCUs and RCPs in the event of a CNU malfunction or power loss Therefore even when the power unit or AT board of the CNU 700 or CNU 500 has failed camera heads and HDCUs can be directly controlled from the RCPs to let program production n Table 4 1 A comparison between the CNU 700 and CNU 500 4 3 Camera Command Network Units CNU 700 and CNU 500 continue As mentioned in Section 2 Total System the cost versus performance balance between the two types of Camera Command Network Units allows users to build up systems that meet their application needs The CNU 500 is suitable for applications with up to six cameras while the CNU 700 can be expanded to handle up to 12 cameras with use of the BKP 7930 optional expansion board 1 High speed data transmission rates CNU to MSU RCP HDCU More than 500 Kbps Camera Head to HDCU 35 Kbps 2 System configuration Basic system Up to six cameras with one CNU 700 or CNU 500 Expanded system Up to 12 cameras with one CNU 700 with one BKP 7930 optional board installed Maximum system Up to 96 cameras with eight CNU 700 units each with a BKP 7930 optional board installed via I O port on the rear panel four MSU 700A 750 Master Set up Units required 3 Character display Information concerning the camera
267. ng switches are located inside the unit behind the front panel Internal main power switch CARBON S4 EcM DYNAMIC GND 5 OPEN Headset microphone setting switch 2 S5 Headset microphone setting switch 1 S4 Q Internal main power switch When an abnormality has occurred and power cannot be cut off with the POWER switch on the front panel you may turn off the unit using the internal main power Switch Headset microphone setting switch 1 54 Set the switch according to the microphone of the headset connected to the intercom connector on the front panel of this unit CARBON Carbon microphone power supply 20 dB gain ECM Electret condenser microphone power supply 40 dB gain DYNAMIC Dynamic microphone no power supply 60 dB gain Headset microphone setting switch 2 S5 When you set setting switch 1 84 to ECM or DYNAMIC also set this switch accordingly GND Unbalanced type OPEN Balanced type HDC 900 950 930 Series Product Information Manual 7 4 7 Internal Switches and Internal Boards AT Board Q POWER indicator 1 001 indicator Q 90H indicator REFERENCE indicators and switch H PHASE switches COARSE On DELAY Nt POWER indicator The LED is lit when the power voltage inside the board is normal 1 001 frame frequency indicator The LED is lit when the frame frequency of the s
268. ng the Security Code You can set change or delete the security code for entering into the Engineer Mode as follows 6 3 1 1 To set a new security code Menu operation block Example MSU 700A Configuration Menu Configuration Menu S m Camera CCU CONFIG OIOIOIO Note At the factory the unit is set in a mode in which no security code is used To use a security code it is necessary to enable the use of a security code See To enable to cancel the security code 1 Press and light the CONFIG button The configuration menu appears on the display 2 Press MSU HDC 900 950 930 Series Product Information Manual 6 Color matching between the cameras Even after making the above camera adjustments Steps 5 1 to 5 9 there still might be a very small difference between the cameras This difference is so slight that it can usually be ignored However if it is desired to make a closer match then please proceed as follows Choose a camera as a standard reference and adjust the levels of black gamma and flare detail of the other cameras to match those of the camera chosen as the reference standard Notes Be sure to situate each camera as close as possible to each other because the reflected light changes depending on the angle of reflection even when shooting
269. ngth of the cable supplying power to the camera varies with the camera system configuration and with the type of optical fiber cable Safety oriented power supply The HDCU 900 950 is designed for safety When the power is turned on a low voltage is supplied at first Only after it has been verified that an appropriate camera is attached the normal 240 V power supply is activated The power is not supplied unless a camera is connected via an optoelectric cable Also the HDCU 900 950 is equipped with an alarm indicator to warn of open or short circuits in the cable Chapter 2 Total System 18 Wide range of audio functions The HDCU 900 950 family has connectors for two channel microphone outputs a digital audio output and a program audio input The family can use an intercom system with two independent channels and supports four wire and RTS intercom systems Further a Clear Com system can also be supported Note For information on support for RTS systems contact a Sony service or sales representative Remote control The levels and phases of the HDCU 900 950 output signals can be controlled remotely by an MSU 700A 750 Master Setup Unit Microphone volume control The camera s microphone volume can be controlled via the MIC REMOTE connector 2 4 Control System In addition to the MSU 700A 750 Master Set up Unit and several types of RCP 700 Series Remote Control Panels the CNU 700 and CNU 500 Camera Command Ne
270. nt and goes HDC 900 950 930 Series Product Information Manual dark when adjustment is completed If you press this button when lit the automatic adjustment is canceled and the button flashes To stop the flashing press the button again ABB auto black balance button Press to automatically adjust the black balance and black set The button lights during adjustment and goes dark when adjustment is completed If you press this button when lit the automatic adjustment is canceled and the button flashes To stop the flashing press the button again Note When the adjustment mode of the BLACK controls is specified as Absolute mode automatic black balance adjustment with ABB button is disabled WHITE white balance controls Adjust the R B white balance The adjustment mode of these controls is specified at the factory as Relative mode which can be changed to Absolute mode using the RM Configuration menu under the Maintenance menu BLACK black balance controls Adjust the R B black balance The adjustment mode of these controls is specified at the factory as Relative mode which can be changed to Absolute mode using the RM Configuration menu under the Maintenance menu 7 13 2 Connector Panel Q CAMERA connector MONITOR connector Cover fixing screw Q CAMERA connector 8 pin Connect to the camera using the supplied remote control cable MONITOR connector BNC Connect to a color monitor to o
271. nual CD ROM version Material InGaAsP Design and specifications are subject to change without Wave length 1310 40 nm PRA p 1 i Dimensions Unit mm inches A I E oe II 0090980 00 Y Y 133 5 1 4 348 13 3 4 gt HDC 900 950 930 Series Product Information Manual Chapter 10 Specifications 181 General Power supply Current consumption Peak inrush current Operating temperature Storage temperature Mass Approx Dimensions Unit mm inches Input Output connectors CAMERA 10 4 HDCU 900 HD Camera Control Unit 100 110 120 220 240 V AC 50 60 Hz 5 4 A at 100 V AC entire System active 1 Power ON current probe method 80 A 240 V 80 A 100 V 2 Hot switching inrush current measured in accordance with European standard EN55103 1 10 A 230 V 5 C to 40 C 41 F to 104 F 209 to 60 C 4 to 140 F 20 kg 44 Ib 1 oz See below Optical fiber connector 1 1 485 Gbps 1 4835 Gbps SDI 2 240 V AC power supply INCOM TALLY PGM D sub 25 pin 1 INCOM 4W 2 systems PD ENG 0 dB PGM 2 systems 0 20 dB TALLY R G RCP CNU REMOTE TRUNK LINE PORT Input connectors AC IN HD SERIAL RET INPUT D SERIAL RET INPUT REFERENCE INPUT PROMPTER IN MIC REMOTE Outp
272. nual Chapter 7 Location and Function of Parts and Controls 115 Menu operation block olololo MODE mode select buttons Select the menu mode If you press and light one of these buttons the menu for the selected mode appears on the EL display When the lit button is pressed again it goes dark and the menu on the display also disappears MULTI Selects Multi Control menu to set the requirements for Master Slave mode to set up multiple cameras in synchronization CARD Selects IC memory card menu to initialize IC cards CONFIG Selects Configuration menu to configure this unit and the entire camera System MAINTENANCE Maintenance mode to set various camera maintenance items and the H and SC phases of CCU etc FILE Selects File operation menu to retrieve and transfer reference files lens files and scene files in the video camera or on IC cards PAINT Selects Paint control menu to adjust various paint items such as white black and flare FUNCTION Selects Function menu to control various camera and CCU functions EL display touch panel Displays the menu selected with the MODE buttons and permits the displayed items to be adjusted 3 Control knobs rotary encoders Adjust the selected items on the touch panel CALL button Press to send a call signal to the video camera on which the CALL button lights The tally lamps on the camera and the red tally lamp on the CCU light wh
273. o activate the Engineer Mode HDC 900 950 930 Series Product Information Manual Operation Proceed as follows Configuration Menu Configuration Menu g Camera CCU ME msu 1115 E ae 2 OI O IO O Example MSU 700A 1 Press to light CONFIG button on the menu control block to call the Configuration menu on the display 2 Press CNU The CNU Configuration menu appears CNU Configuration menu CNU Configuration Engineer Mode RCP MSU Assign Assign Note The item MSU Assign is displayed only when the Engineer Mode is active 3 Press MSU Assign The MSU Assignment menu now appears Simultaneously the character display of the CNU 700 changes to the MSU Assignment mode Using the four arrow buttons on the MSU Assignment menu MSU 700A 750 move the cursor on the character display of the CNU 700 to the point where you wish to change the assignment MSU Assignment menu MSU Assignment a Default Chapter 6 A Quick Lesson on Camera Settings 71 Character display of the CNU 700 in MSU Assignment mode MSU assignment SUPERVISER MSU mode LOCAL MSU mode CAMERA SELECT NEXT 7 12 ACTIVE assignment
274. o setup and the operation is interrupted they will flash in red HDC 900 950 930 Series Product Information Manual TALLY indicators Show the tally status of the corresponding cameras 1 through 12 when the EXPAND button is not lit or 13 through 24 when the EXPAND button is lit The corresponding indicator lights in red when a red tally is sent to a camera and it lights in green when a green tally is sent When both red and green tally are sent it lights in orange When a call signal is sent to the camera the indicator rapidly flashes in red 6 Active indicators Show the control status of the corresponding cameras 1 through 12 when the EXPAND button is not lit or 13 through 24 when the EXPAND button is lit The indicators for the cameras under control of this unit light in green and the indicators for the cameras under control of another control panel light in orange An indicator whose corresponding camera or camera control unit is not connected does not light An indicator lights in red when an error is detected and the self diagnostic functions are activated in the corresponding camera or camera control unit Camera select buttons and camera number indicators Select the cameras to be controlled from this unit Press and light up the button corresponding to each desired camera When the EXPAND button is not lit numbers 1 through 12 are displayed and cameras 1 through 12 are selected When the EXPAND bu
275. of the screen This control has no effect on the output signals of the camera TALLY switch Controls the tally indicator located on the front of the viewfinder HIGH The tally indicator brightness is set to high OFF The tally indicator is disabled LOW The tally indicator brightness is set to low ZEBRA zebra pattern switch Controls the zebra pattern display on the viewfinder screen as follows ON A zebra pattern appears and stays 7 15 1 Appearance PEAKING control OFF The zebra pattern disappears MOMENT A zebra pattern appears and stays for about 5 seconds DISPLAY ASPECT switch Turns the marker indication on and off and switches between 4 3 and 16 9 aspect ratios for viewfinder screen display DISPLAY When the marker indication is enabled with the camera the marker indication on the viewfinder screen turns on and off every time you push the switch up to this position ASPECT Each push of the switch down to this position toggles the mask display on and off 7 15 HDVF 700A HD Electronic Viewfinder Green tally lamps BRIGHT control PEAKING switch RR m Mv Friction adjustment knob T Nu 5 b n Lock lever CONTRAST control TALLY ON OFF switch BATT indicator Lift lock release knob Q POWER switch indicator QD External tally lamp Red tally lamps
276. off Shutter ECS Gamma Master Gain SW 1 2 5600K on off Auto Knee on off Skin Detail on off Detail Gate on off Black Gamma on off Knee Aperture on off Knee Sat on off Mono on off S Skin Knee on off Low Key Sat on off 2 2 Knee off Gamma Off Detail Off Matrix Off White Clip Off Level Dep Off Chroma Off SD Detail Off SD Matrix Off White Select White Preset Memory A Memory B lt SISISISIS S SISISISISISISIS S S S S S S SISISISISISIS S SISISISISISISIS S S S S S SI amp SI amp SISIS ISISISISISIS S S lt lt lt SKIN SA S lt lt lt S SI SISISISISISIS S S S S S S S S SISISISISI SISISISISISISIS Note 1 Available w VTR function SW selectable when in the ENG Mode in the menu HDC 900 950 930 Series Product Information Manual Appendix 199 Function comparison chart Multi Gard MSU 700A MSU 750 RCP 750 751 RM B750 id menu guo Menu puras Menu euren Menu Multi Control Menu Master Slave Master v v Slave v v All Slave v v All Off v v Character Character on v v v v Default v v System v v Auto v v Diag One Cam v v Data One Cam v v IC Memory Card Menu Card Initialize v v HDC 900 950 930 Series Product Information Manual Appendix
277. on on this panel illuminates and a buzzer sounds Q WHITE white balance manual adjustment knobs Used to manually adjust the white balance Adjust the R and B signals respectively Q BLACK black balance manual adjustment knobs Used to manually adjust the black balance Adjust the R and B signals respectively EXT lens extender indicator Lights when the lens extender is in use IRIS MB ACTIVE iris master black active button Press and illuminate this button to enable the iris master black control block of the panel When the PANEL ACTIVE button is pressed this button also illuminates SENS sensitivity control knob Used for manual iris adjustment See the table Iris adjustment functions COARSE control knob Used for manual iris adjustment See the table Iris adjustment functions ALARM indicator Lights when a problem occurs in the camera system and the self diagnostic function is activated at the camera or the CCU 700A 700AP AUTO button Press and illuminate the button and the iris automatically adjusts to the amount of input light If you press the button when it is illuminated the illumination is turned off and manual iris adjustment is enabled Camera indication window incorporated with MASTER SLAVE indications The number of the camera being controlled from this panel is displayed in orange When a red tally signal is sent to the camera its numbe
278. on swabs commercially available Note Use the cotton swab with a diameter of around 4 mm The cotton swab with a diameter more than 5 mm does not reach far enough in to the inner part of the cable to clean the tip of the optical contact HDC 900 950 930 Series Product Information Manual and audio signal can be transmitted up to a distance of 3 km 1 86 miles with the HDCU 900 and 1 2 km 0 75 miles with the HDCU 950 To maintain this high performance an appropriate cleaning is recommended to carry out periodically When supplying power to the camera via the optical fiber cable the maximum cable length varies with the camera system configuration and lens type the size of the optical fiber cable and the number of cable connectors Cleaning Male connector Clean the tip of the white optical contacts with a cotton swab moistened with alcohol Optical contacts white Female connector The optical contacts for the female connector are in an unexposed area When cleaning it is necessary to expose the contacts by first removing the alignment sleeve Proceed as follows 1 Insert the alignment sleeve remover into the alignment sleeve in a straight line and turn it clockwise oun 2 When the turning stops forcedly pull out the remover in the straight line Note The alignment sleeve can be removed reinstalled with the sleeve itself attached to the tip of the remover Chapter 5 Optical Fiber Connector a
279. only the iris master black control block of the panel press this button so that it goes dark D MASTER BLACK control block Turn the control to adjust the master black level The adjustment value is displayed in the display window D CALL button Press to send a call signal to the video camera on which the CALL button lights The tally lamps on the camera and the red tally lamp on the CCU light when not lit or go dark when lit When the CALL button on the video camera is pressed the CALL button on this unit lights and a buzzer sounds Camera number tally indication window The number of the camera being controlled from this unit is displayed in orange When a red tally signal is sent to the camera the number is displayed in black and the background of the number lights in red When a green tally signal is sent to the camera the number is displayed in black and the background of the number lights in green When both the red and green tally signals are simultaneously sent the left half of the background lights in red and the right half lights in green Iris control block IRIS EXT ra r hH AUTO EXT lens extender indicator Lights when the lens extender is used IRIS control and display window When the AUTO button is not lit you can adjust the iris manually by turning the control The adjustment value is displayed in f numbers on the display When the AUTO button is lit the ref
280. onnector 9 pin With expansion functions added this connector permits you to control an external device Caution When installing this panel provide a gap of 7 cm 3 inches or more behind the connector panel to prevent damage to cables HDC 900 950 930 Series Product Information Manual Chapter 7 Location and Function of Parts and Controls 123 7 11 1 Operation Panel 1 11 RCP 700 701 Remote Control Panel Q PANEL ACTIVE button WHITE button i WHITE 8 CALL button 1 BLACK button WHITE knobs Q BLACK knobs RCP 700 So PANEL IACTIVE MASTER QD AUTO button P J AUTO Camera number tally indication window QD Master black control ring IRIS control lever preview switch Q EXT indicator IRIS MB ACTIVE button SENS control knob COARSE control knob QD ALARM indicator WHITE button RCP 701 x BLACK button CALL button WHITE knobs BLACK knobs Camera indication window MASTER BLACK control IRIS control Iris gauge EXT indicator IRIS MB ACTIVE button SENS control knob COARSE control knob QD ALARM indicator PREVIEW button Parts common to the RCP 700 701 Items through are common to the RCP 700 and RCP 701 Q PANEL ACTIVE button Press and illuminate the button to permit this panel to contro
281. op on the front side the DIF 102 board or the HKCU 902 is installed in the second slot from the top on the front side When installing the optional boards be sure to start installation from the second slot from the top on both the front side and rear side Never install an optional board in the third slot from the top leaving the slots blank without installing the board Be sure to install the HKCU 901 903 904 into the same slot on the front and rear sides Do not install two or more of the same circuit boards at the same time HDC 900 950 930 Series Product Information Manual Chapter 2 Total System 21 2 7 1 1 HD System HDCU 900 HKCU 901 HKCU 902 HKCU 903 HKCU 904 HDC 950 Combination of boards CNU 700 HD SDI Monitor HDCU 900 HKCU 901 HKCU 902 HKCU 903 HKCU 904 HDCU 900 950 HKCU 901 951 HKCU 902 HKCU 903 953 HKCU 904 HDCU 900 950 HKCU 901 951 HKCU 902 HKCU 903 953 HKCU 904 eI RCP 700 701 RCP 750 751 System format Combination of boards Slots on the front Second slot from the top Third slot from the top Signal input output slot 1080 59 941 SDI RC FC LC RC LC
282. ot SYNC OUT connectors SERIAL OUTPUT 1 to 3 connectors B 7 N N 4 2 L SERIAL OUTPUT SYNC OUT HD SD sync signal output connectors BNC type The left connector outputs a sync signal of the same format as that of the input output block in the above slot The right connector outputs the HD tri level sync signal of the same format as that of the SERIAL OUTPUT 1 to 3 connectors Q SERIAL OUTPUT 1 to 3 connectors BNC type The 1 to 3 connectors output the signal from the camera as three HD SDI signals 720 60P AUDIO PHASE control AUDIO PHASE OPTICAL CONDITION 540P 1035 CCU CHU l Chapter 7 Location and Function of Parts and Controls 93 7 3 10 Internal Boards AT board AT POWER Q INCOM SELECT intercom select switch Selects the intercom line to which the intercom signal to be connected via the intercom connector of this unit PROD producer line PRIVATE private line ENG engineer line MIX program mix control Controls the volume of program audio to be mixed to the intercom signal at the headset SIDE TONE control Controls the volume of your voice to be supplied to the receiver of the headset 7 4 HDCU 950 HD Camera Control Unit 7 4 1 Front Panel Q Tally lamp CABLE ALARM indicators POWER switch and indicators MIC PGM switch Q Intercom volume control Q Intercom line selecto
283. ower supply to the viewfinder ON When you press the button again it goes dark and the power supply is turned off Signal output select buttons Press and light up one of these buttons to activate the test signal generator of the video camera and send the respective signals TEST 1 To send a gamma signal to test the video circuits TEST 2 To send a staircase signal BARS To send a color bar signal Note The BARS button takes priority to the other two buttons If the BARS button is lit press the button to turn it dark before pressing the TEST 1 or TEST 2 button CLOSE iris close button Press and light the button to close the iris Press again to release the close mode Q STANDARD button When you press this button the video camera is initialized to its standard state and the button lights for several seconds If you press the button while it lights the video camera returns to the state before the button was lit For details refer to the System Manual AUTO SETUP block For automatic adjustments of cameras AUTO SETI SKINDTL LEVEL START AUTO HUE BREAK WHITE BLACK M Auto adjustment item select buttons Press and light up these buttons to select the items to be automatically adjusted SKIN DTL AUTO HUE Skin tone detail automatic hue LEVEL Gamma balance knee point master black level etc START BREAK button Press to start automatic adjustment of the
284. p can be skipped over if the initial setting is accurate 5 Precise camera adjustment 1 Previous check Check the gray scale for any stains spots cracks or imperfections It is recommended to change the scale every 3 to 6 months Be sure to keep the scale at normal HDC 900 950 930 Series Product Information Manual experience is required or for unmanned robotic control operations The latter is for general operations 6 1 Case 1 for situations requiring minimal camera operator experience 4 Scene files Recall desired scene files that will be used It is very efficient to use the scene files for patternized weather forecasts or special corner inserts in news programs 5 End Just turn off the main switch of the power supply Notes Prepare reference files beforehand if necessary otherwise the factory set files will be stored Make a scene file for every corner and file them Use the main switch of the power supply to turn on off the camera system Setting Color Mode or Test Mode is not recommended because it will lengthen the set up process time Also lens close is not necessary for CCD cameras Usually this kind of operation works well So a system check or adjustment once every 3 to 6 months should suffice room temperature in a dark area because it is painted with a specific pigment that may be altered depending on its storage environment 2 Monitor adjustment Perform the adjustment by using t
285. pplied WF MODE waveform monitor mode output connector 4 pin Connect to the appropriate connector on a waveform monitor when monitoring a signal in Sequential mode A sequence signal will be output when the SEQ button on the MSU 700A 750 Master Setup Unit or RCP 700 Series Remote Control Panel is pressed allowing simultaneous monitoring of the R G and B signals in Sequential mode When both the RCP and MSU are in use this connector functions as the output connector for RCP control AC IN AC power supply input connector Use the specified power cord to connect to an AC power supply The power cord can be secured to the HDCU 950 body using an optional plug holder 7 4 3 Output Block DIF Board Q SD SDI OUT 1 and SD SDI OUT 2 connectors PIX OUT connector WF OUT connector Chapter 7 Location and Function of Parts and Controls 96 SD output block DIF board 1 SD SDI OUT 1 and SD SDI OUT 2 SD SDI output 1 and 2 connectors BNC type When the system is operating with the field frequency of 59 94 50 Hz the signals from the video camera may be down converted to SD component SDI signals and output from these connectors The OUT 2 connector can be assigned for a digital monitor output that includes character and marker information PIX OUT picture monitor output connector BNC type Used for output of the picture monitor video signal selected using the RCP 700 series Remote Control Pane
286. r Intercom connector REFERENCE H PHASE REF GEN 11 001 LOCK REMOTE LOCAL HD BB Sooce O FINE Tally lamp The lamp lights in red when a red tally signal is received When the CALL button on the camera MSU 700A 750 Master Setup Unit RCP 700 series Remote Control Panel etc is pressed this lamp will go dark if previously lit and light up if previously off It lights in green when a green tally signal is received A supplied number plate can be mounted here CABLE ALARM indicators OPEN red The LED lights when there is no camera connected via an optical fiber cable to the CAMERA connector on the rear panel It flashes to warn about HDC 900 950 930 Series Product Information Manual INCOM SELECT switch PGM MIX control SIDE TONE control TALK LEVEL control MIC LEVEL fugu gaa NoD NG PROD SIDE PRIVATE MIX TONE MIC LEVEL CH1 CH 2 controls TALK LEVEL control Controls the volume of your voice to be sent to the producer line engineer line and headset of the camera MIC LEVEL CH1 CH2 CH1 CH2 microphone level controls Control the input level according to the sensitivity of the microphone connected to the MIC connector of the camera so that an appropriate sound volume is obtained HD CAMERA CONTROL UNIT insufficient optical reception status of the optical fiber cable SHORT red The LED
287. r a waveform monitor as the WF A OUTPUT connector The signal loss of a connecting cable up to 100 meters 330 feet long can be compensated for with the switch on the internal board When you connect a waveform monitor using a long connecting cable connect it to this connector When using two or more VCS 700 units connected in series connect a waveform monitor to the PIX B OUTPUT connector on the VCS 700 whose WF A OUTPUT loop connector is not used for series connection For details on cable compensation refer to the system manual WF MODE waveform monitor mode connector 4 pin Connect to a corresponding connector on a waveform monitor to view the signals in sequential mode This 1 8 MSU 700A Master Setup Unit 7 8 1 Operation Panel CLOSE button Signal output select buttons VF PW button CAM PW button ALL button connector supplies a staircase signal and sequential ON OFF control signal REMOTE connector 8 Connect a CNU 700 Camera Command Network Unit using a CCA 5 cable PORT remote control connector D sub 37 pin Accepts and supplies external control signals You can select the signals output to a picture monitor and a waveform monitor with an external video selector connected to this connector The selected input connector number is supplied from this connector AC IN AC power input connector Connect to an AC power source using the supplied AC power co
288. r all the connected cameras of the same group CAM PW camera power button Press and light up this button to turn the power supply to the video camera ON The button promptly flashes until the camera becomes ready for transmission When you press this button again it starts flashing and the power supply to the camera is turned off VF PW viewfinder power button Press and light up this button to turn the power supply to the viewfinder ON When you press the button again it goes dark and the power supply is turned off HDC 900 950 930 Series Product Information Manual Camera number tally indication window MASTER BLACK control block Signal output select buttons Press and light up one of these buttons to activate the test signal generator of the video camera and send the respective signals TEST To send a signal to test the video circuits BARS To send a color bar signal Note The BARS button takes priority to the TEST button If the BARS button is lit press the button to turn it dark before pressing the TEST button Q CLOSE iris close button Press and light the button to close the iris Press again to release the close mode Chapter 7 Location and Function of Parts and Controls 112 STANDARD button When you press this button the video camera is initialized to its standard state and the button lights for several seconds If you press the button while it lights the video camera returns to
289. r is displayed in black against a red background When a green tally signal is sent to the camera the number is displayed in black against a green background When the red and green tally signals are sent simultaneously the left half of the HDC 900 950 930 Series Product Information Manual background is illuminated red and the right half illuminated green In Master Slave mode to adjust the white balance of multiple cameras the upper left MASTER corner is illuminated orange when the camera being controlled from this panel is designated as the master unit and the upper right SLAVE corner is illuminated orange when designated as a slave unit RCP 700 exclusive features Master black control ring Turn to manually adjust the master black IRIS control lever preview switch When the AUTO button is not illuminated you can adjust the iris manually by moving this lever When the AUTO button is illuminated the reference value for automatic iris adjustment can be set in a range of 1f stop with this lever Push it axially to connect the key signal for preview at the PREVIEW connector See the table Iris adjustment functions Iris adjustment functions IRIS lever RCP 700 Adjust the iris within the variable con IRIS control trols RCP 701 COARSE Sets the lower limit for CLOSED control Sets the upper limit for OPEN SENS control according to the CLOSED value set by the COARSE control RCP 701
290. r plates 0 through 9 External tally dimmer control Used to adjust the brightness of the external tally lamp Use a screwdriver to turn the control clockwise to increase the brightness or counterclockwise to dim the lamp CAMERA connector D sub 25 pin Used to connect to the camera s viewfinder connector Mounting wedge To attach the viewfinder to a camera the mounting wedge is inserted into the V shaped groove on the top of the camera 1 These controls have no effect on the camera s video output signals 2 The brightness of these lamps can be adjusted using controls inside the viewfinder body Chapter 7 Location and Function of Parts and Controls 137 7 16 1 Appearance The figure illustrates the HDVF C750W The parts of the HDVF C750W and the HDVF C700W have basically the same functions POWER switch Turns the power supply from the camera to the viewfinder on and off attention indicator This indicator lights when the camera detects certain conditions The particular conditions which cause the indicator to light up are set up by the camera For information on how to set up and verify the conditions under which the indicator will light refer to the manual for the camera being used Red tally lamps Light up when the camera receives a red tally signal HDC 900 950 930 Series Product Information Manual 7 16 HDVF C700W C750W HD Electronic Viewfinder P
291. r third slot 720 59 941 SDI 525 59 941 SDI RC LC from the top Setting switches Switch setting System format DPR 163 board AT 141 LC 41 RC 86 S804 LOCAL board board board HD SD S805 S807 S806 5603 52 5802 1080 59 941 SDI 525 59 941 SDI 60 Intr 1001 i 525 1080 59 941 SDI NTSC NOT 60 Intr 1001 525 1080 50 SDI 625 501 SDI NOT 50 Intr 1000 625 1080 50 SDI PAL NOT 50 Intr 1000 625 540P 720 59 941 SDI 525 59 941 SDI 1001 720P 525 i i NOT 60 Intr NA HDC 900 950 930 Series Product Information Manual Chapter 2 Total System 32 Figure 2 7 1 8 Example of connection using HDCU 900 8 System format HD 1080 59 941 SDI SD NTSC Required boards Board name Board name Slot to be installed Slots on the front Slots on the rear Remarks Top most slot DPR 163 SDI 54A HDCU 900 Second slot from the top RC 86 DIF 102 HDCU 900 Third slot from the top IF 789A VDA 57 HKCU 901 RETINPUT 1104 ANALOG RETURN VIDEO SIGNAL SERIAL RET INPUT 1 to 4 HD SDI RETURN VIDEO SIGNAL SD SYNC OUT SD SYNC REFERENCE SIGNAL IN REFERENCE SIGNAL PIX QUT For RCP PICTURE MONITOR OUTPUT FOR RCP CROMPTERUN PROMPTER SIGNAL WF OUT For RCP WE MODE For RCP SERIAL OUTPUT 1 to 3 WAVEFORM MONITOR OUTPUT FOR RCP WAVEFORM MONITOR MODE FOR RCP HD SDI SIGNAL 229 5 59 e 5550 555505
292. ra Unlike other broadcasting equipment cameras are often used outside under severe circumstances such as live broadcasting of skiing events below the freezing point or live broadcasting of baseball in mid summer where reliability always has first priority and a camera malfunction is not acceptable Resolution When we are talking about camera resolution it usually means horizontal resolution It is calculated on how many black and white lines that you can see horizontally in a subject to that of the black and white lines counted independently For instance a black line and a white line are counted as two lines When it is converted to vertical resolution because the definition is how many lines can be seen vertically it should be revised with the aspect ratio Therefore even though the horizontal pixel number is the same resolution of 4 3 is better than that of 16 9 Since the video signals of most of the cameras are processed digitally the resolution limit is fixed this is why the modulation depth has become to be regarded as more important S N signal to noise ratio Sensitivity and dynamic range When we are talking about camera S N it usually means the S N of black The black level is amplified by gamma and its gain greatly affects the S N which vary between different manufacturers and even different models from the same manufacturer Of course users also have different tastes S N is also changed by HDC 900 950 9
293. rd The power cord can be fixed to the VCS 700 using the supplied plug holder Q STANDARD button AUTO SETUP block Q Camera CCU function ON OFF buttons Scene file control block Menu operation block ODOUDDO IC card insertion block PICTURE MONITOR buttons WAVEFORM MONITOR buttons Camera select block Filter control block ALL button Press the button so it starts flashing to activate the 13 buttons located at the right from CAM PW to AUTO SETUP for all the connected cameras of the same group HDC 900 950 930 Series Product Information Manual Iris control block Camera number tally indication window CALL button MASTER BLACK control block IRIS MB ACTIVE button ECS Shutter control block left Gamma control block center Master gain control block right CAM PW camera power button Press and light up this button to turn the power supply to the video camera ON The button promptly flashes until the camera becomes ready for transmission Chapter 7 Location and Function of Parts and Controls 106 When you press this button again it starts flashing and the power supply to the camera is turned off Q VF PW viewtinder power button Press and light up this button to turn the p
294. rding to a reference file 4 6 Control Priority and Parallel Mode Control Priority When a camera system is configured using the CNU 700 or CNU 500 each camera can be connected in parallel to both an RCP 700 Series Remote Control Panel and the MSU 700A 750 Master Setup Unit and is controlled from whichever unit has control priority Priority for iris master black adjustments only can be obtained when the IRIS MB ACTIVE button on the panel on which the PANEL ACTIVE button is not lit When the MSU 700A 750 is in the panel active status only the iris and master black controls are inoperative 4 7 S BUS Control The S Bus Concept A further advantage of the Sony camera control system is the S Bus control technique which is based on original Sony concept Studio installations and OB units use digital routers as the nerve center for a complete audio video system With Sony system integration all the equipment is connected to the Sony digital router via a LAN called the S Bus With the S Bus system control and tally signals are interlocked so that they along with video and audio signals can be simultaneously switched from a central terminal Each input output source can be given a name which can then be displayed on the source name display panel of a DVS 7000 8000 Series Video Switcher or on the BKS R3280 R3281 Status Character Display One example Figure 4 8 Router control from MSU CNU with BKP 7933 NTSC or P
295. red on the viewfinder screen while this button is pressed RET return video button and select switch When other return video systems are used in addition to return video 1 you can monitor the signal return video 2 3 or 4 selected using the selector on the viewfinder screen while pressing the button Note The RET 1 button has priority over the RET button if both buttons are pressed INCOM and 2 controls and switches There are a PGM control incorporated with a select switch a line select switch a LEVEL TALK switch and INCOM control each for intercom lines 1 and 2 INCOM 1 INCOM 2 same components as those of INCOM 1 P M PGM P M 4 1 2 2 PROD PROD INCOM INCOM ENG ENG LEVEL TALK R ON Ka OL OFF Chapter 7 Location Function of Parts and Controls 86 D PGM program control and switch Adjust the program audio reception level Select program 1 or 2 with the switch 2 Line select switch Select the intercom line PROD Producer line ENG Engineer line 3 LEVEL TALK switch R ON The intercom headset microphone is turned on The intercom audio reception level is adjusted with the INCOM control R OFF The intercom headset microphone is turned off The intercom audio reception level is adjusted with the INCOM control 1 3 HDCU 900 HD Camera Control Unit 7 3 1 Front Panel Q Red tally lamp Green tally lamp MIC switch INTERCOM control
296. reen tally signal BRIGHT brightness control Used to adjust the picture brightness Lock lever This lever is used to lock the viewfinder into a desired angle The angle is locked when the lever is pushed toward the camera lens When the lever is pulled toward the back of the camera the angle can be adjusted The tilt mechanism will resist movement with the amount of friction set by the friction adjustment knob CONTRAST control Used to adjust the picture contrast TALLY ON OFF switch Controls the external tally lamp QD When set to ON the external tally lamp will operate When set to OFF the lamp will not operate will not light in response to a tally signal D BATT battery indicator This indicator blinks when the voltage output of the camera battery drops When the battery reaches a point that it may no longer be used the indicator will light up To prevent camera shutdown due to the battery running down change the battery as soon as possible after this indicator begins blinking The threshold battery voltage value to make this indicator begin blinking is set by the camera For details refer to the manual for the camera Red tally lamps 2 Light up when the camera receives a red tally signal HDC 900 950 930 Series Product Information Manual D External tally lamp Lights up red in response to a red tally signal Can be used to display the camera number by attaching one of the supplied numbe
297. ries Product Information Manual WF OUT 7 3 5 HKCU 901 SD Analog Interface Unit Note All input and output connectors function when the System is operated at a 59 94 50 Hz field frequency but do not operate when the system field frequency is 60 Hz Q PIX OUT connector WF OUT connector Y G B Y B and R Y R OUTPUT connectors Q VBS OUT 1 and 2 connectors B Y B R Y R L OUTPUT ju VBS is selected using switches on the AT board Factory setting G B R Q VBS OUT 1 and 2 composite video output 1 and 2 connectors BNC type The two connectors are for output of the video camera signal in analog composite video format Chapter 7 Location and Function of Parts and Controls 91 7 3 6 HKCU 902 HD Analog Interface Unit The optional HKCU 902 is designed to be installed in the HDCU 900 expansion slot or in place of the SD signal input output block Q RET INPUT 1 4 connectors 7 L Ret input SYNC OUT Q RET INPUT 1 4 return video 1 2 3 and 4 input connectors BNC type Four different HD analog return video input signals may be received independently The selection of RET 1 2 3 4 is made by the camera s return switch The type of input signal on RET 1 2 3 and 4 may be set individually using switches on the AT board in the HDCU 900 or using the MSU 700A 750 Master Setup Unit SYNC OUT HD sync signal output connector BNC
298. rigination amplitude of edge signals when they occur in high contrast signals front or bottom of Helicopter e g using Wescam products or a mini crane HDCU 900 950 Camera Control Units Two camera control units are available for use with the HDC 900 950 the full size HDCU 900 and half rack HDCU 950 The HDCU 900 has been designed to support both the HDC 900 Studio Camera and HDC 950 Portable Camera in fixed environments for maximum expandability flexibility and full controllability The compact HDCU 950 CCU is intended for mobile use but provides controllability almost equivalent to the HDCU 900 As standard the HDCU 900 has four sets of HD SDI SMPTE 292M signal outputs and V F return inputs plus four sets of digitally down converted SDI SMPTE 259M outputs and four digitally up converted V F return inputs The HDCU 950 has three sets of input output interfaces for HD SDI SMPTE 292M signal outputs and V F return inputs and digitally down converted SDI SMPTE 259M outputs and up converted V F return inputs A variety of optional interface expansion boards are available for both units The HKCU 901 HKCU 902 HKCU 903 and HKCU 904 are for use with the HDCU 900 and the HKCU 951 and HKCU 953 are for the HDCU 950 As for the HDCU 900 the HKCU 901 SD Encoder Boards provide analog NTSC and PAL VBS signal outputs and V F return inputs and analog component output The HKCU 902 HD Analog Interface Board enables HD Analog output and
299. rmat electronic monochrome viewfinder with extremely high horizontal resolution the HDVF C700W 6 type multi format LCD color viewfinder is also available for the HDC 900 This multi format LCD color viewfinder is especially convenient for cases where color needs to be identified by the camera operator For the HDC 950 the HDVF C750W a 6 type multi format LCD color viewfinder and the HDVF 20A a 2 HDC 900 950 930 Series Product Information Manual Character signal output The results of the HDCU 900 950 self diagnosis can be obtained with a text display by an SD character signal output Rack mountable The HDCU 900 can be installed in a full 19 inch rack of 3U height while the HDCU 950 can be installed in a half 19 inch rack of 3U height in combination with the RMM 301 Plug in unit configuration Internal printed circuit boards used in the HDCU 900 950 are designed for easy plug in and removal for easy inspection and maintenance Furthermore the power supply housed in the HDCU 900 is also a plug in type unit the CNU 700 and CNU 500 give them a fast response time whatever the system configuration Video Selector VCS 700 The VCS 700 Video Selector is used to switch composite video monitoring signals from an HDC 900 Series multi camera system to a picture monitor and waveform monitor The VCS 700 accepts the video monitoring signal from up to six HDCU 900 or HDCU 950 Camera Control Units and switches these signals to
300. rol button Pressing this button enables selection of a color temperature conversion filter or ND filter using the CC filter selector and ND filter selector Pressing the button again gives control of the filters to the MSU 700A 750 Master Setup Unit or RCP 700 series Remote Control Panel UP TALLY switch Set whether or not the camera s Up Tally lamp and the lens tally lamp will light when the camera receives a red tally signal ON The tally lamps will light OFF The tally lamps will not light Q VF viewfinder SCAN switch Used to control the viewfinder screen display 16 9 To set the viewfinder display to 16 9 aspect ratio 4 3 To set the viewfinder display to 4 3 aspect ratio Q SCREEN SIZE MARKER switch Used to control the display of the screen size marker as follows ON E B Areas outside the specified ratio area will be darkened ON The screen size marker white lines will be displayed OFF The screen size marker will not be displayed Q CENTER MARKER switch Used to control the display of the center marker as follows ON A marker indicating the center of the picture area will be displayed on the viewfinder screen The position of the center marker may be adjusted for the lens being used The adjusted position may be stored in a lens file OFF The center marker will not be displayed SAFETY ZONE switch Used to control the display of the safety zone marker as follows
301. rol from the MSU 700A 750 Ref Enable Set it to inverse video to enable the setting in the reference file Factory setting ON Lens Enable Set it to inverse video to enable the setting in the lens file Factory setting ON OHB Enable Set it to inverse video to enable the setting in the OHB file Factory setting ON Full Lock Set it to inverse video to fully disable the MSU 700A 750 Factory setting OFF View Mode Set it to inverse video to disable all operations from the MSU 700A 750 other than data reference Factory setting OFF Only the display and indicators will be active Any setting and adjustment will be disabled Paint Only Set it to inverse video to enable the paint control only Factory setting OFF 8 When the status settings are completed press Exit The Security menu display in step 5 is restored 9 Press Engineer Mode to exit the Engineer Mode The statuses specified in step 7 become valid Note All operations are enabled in the Engineer Mode regardless of the above status settings 6 3 3 MSU Assignment You can assign specific units among the cameras in the same system to be selected or controlled from the MSU 700A 750 The MSU assignment is to be made for example to assign cameras to each MSU 700A 750 when multiple MSU 700A 750 units are used in the same system This assignment operation is enabled in the Engineer Mode Turn on the CONFIG MSU SECURITY ENGINEER Mode t
302. rols from this unit are disabled lock status Neither this button nor the IRIS MB ACTIVE indicator in the iris master black control are illuminated Using the RM Configuration menu the function of this button can be changed to switch only between FULL and LOCK modes The RM Configuration menu operation is possible in any mode See Settings on the RM Configuration Menu Q STANDARD button green illumination When this button is pressed it remains illuminated for Several seconds while the camera is initialized to its standard state If the button is pressed while illuminated the camera reverts to the state before the button was illuminated HDC 900 950 930 Series Product Information Manual Iris master black control block IRIS MB ACTIVE D AUTO EXT C Q MASTER BLACK IRIS MASTER BLACK control Manually adjusts the master black level The adjustment mode ol this control is specified at the factory as Absolute mode which can be changed to Relative mode using the RM Configuration menu See Settings on the RM Configuration Menu EXT lens extender indicator amber illumination Lights when the lens extender is in use AUTO button amber illumination Press and illuminate the button to automatically adjust the iris according to the amount of input ight If you press the button when it is illuminated this is turned off and manual iris a
303. rrection ON and OFF CH 1 On 6 Adaptive Detail Control The Adaptive Detail Control provides natural detail altering the amplitude of the edge signal for those enhancement on extreme highlights by automatically forms of high contrast signals Photo 3 7 Adaptive Detail Control ON and OFF Normal The black edges removed HDC 900 950 930 Series Product Information Manual Chapter 3 Benefit of Sony ADSP Advanced Digital Signal Processing 46 7 Electronic Soft Focus This function is similar to an optical soft filter By subtracting the edge enhancement signal from the original video signal slight defocused pictures are created electronically This is an important new creative feature that can be used to either complement or replace the Skin Tone Detail Correction function when more of a film look is sought for close ups etc Figure 3 5 Electronic Soft Focus signal image 93 Original Enhancer Soft Focus Photo 3 8 Electronic Soft Focus ON and OFF Normal Electronic Soft Focus On Softer than with Detail Off Detail Off HDC 900 950 930 Series Product Information Manual Chapter 3 Benefit of Sony ADSP Advanced Digital Signal Processing 47 HDC 900 950 930 Series Product Information Manual One of the most important concerns for broadcasters is the reliability of equipment This is considerably improved with Sony digital processing In Sony ADSP
304. rs Example Knee If there is no subcategory belonging to the selected category the first setting or display item of that category appears on the display proceed to step 3 Turn the menu select knob until the desired subcategory appears on the display Example Knee Iris 4 Push the CANCEL ENTER switch toward ENTER to register your selection made in step 3 Pushing toward CANCEL reverses the operation The first setting item of the selected subcategory and its current setting appear Example Ctrl Abs 5 Turn the menu select knob until the desired setting or display item appears on the display Example Ctrl Abs Min Cls For a setting item make your setting 6 Push the CANCEL ENTER switch toward ENTER to register your setting made in step 5 7 Turn the menu select knob until the desired category appears on the display Example Min Cls Min 22 8 Push the CANCEL ENTER switch toward ENTER to register your setting made in step 7 Pushing toward CANCEL cancels the setting in step 7 To continue setting items repeat steps 5 to 8 To end the menu operation Push the RM Configuration switch in the A direction Notes f an operation has not been made in Menu mode after one minute the menu automatically exits HDC 900 950 930 Series Product Information Manual Chapter 7 Location and Function of Parts and Controls 131 7 13 1 Operation Panel 1 13 RM B750 Hand held R
305. ry set value 0 gt The additional data of each file is sent to each circuit on the unit HDC 900 950 930 Series Product Information Manual Output to hardware Chapter 6 A Quick Lesson on Camera Settings 75 HDC 900 950 930 Series Product Information Manual Location and Function of Parts and Controls 7 1 HDC 900 HD Color Video Camera T 1 1 Right Side and Left Side Panels Q Up tally lamp Safety lock Camera number plate Side panel lock screw Right side Q Lens lock and knob Cable 2 AUDIO IN CH 1 and CH 2 connectors AUDIO IN switch Microphone power switch For feture use PROMPTER connector TEST OUT connector Left side Q Accessory bracket D DC OUT connector RET CONTROL connector TRACKER connector REMOTE connector Up tally lamp Safety lock Camera number plate Side panel lock screw Lens lock and knob Accessory bracket HD SERIAL OUT connector connector Uptally lamp Lights when the camera receives a red tally signal When the CALL button on the MSU 700A 750 Master Setup Unit or the RCP 700 series Remote Control Panel is pressed the lamp lights if previously off or goes off if previously on The brightness of the lamp may be adjusted using the menu Setting the UP TALLY switch on the rear panel to OFF will keep the lamp
306. s 6 Stair Case Signa 13 OUTA 0 5 V 1 kOhms 14 OUT5 0 5 V 1 kOhms 15 OUT6 0 5 V 1 kOhms HDC 900 950 930 Series Product Information Manual Chapter 8 Connectors and Cables 155 12 1 4 4 2 L 0 2 Signal 7 POWER OUT Specifications GND for POWER 8 SPARE 8 2 1 11 INTERCOM 5 pin Female 8 2 1 10 RCP CNU 8 pin Female 2 9 3 5 D 5 A External view Signal Specifications 1 INCOM IN Y 20 dBu External view CARBON MIC No Signal Specifications 2 INCOM T IN 60 dBu DYNAMIC MIC 1 CCU SERIAL DATA gt XO 3 INCOM T IN G GND for INCOM 3 RCP CNU BVP MSU VCS di LM GND for POWER X Max 12 dBu 4 RX SERIAL DATA 5 INC No connection 5 TXGND GND for TX 0 dBu 0 775 Vrms 6 IPOWER OUT RCP POWER 30 V 8 2 2 Cable Wiring Diagram CCA 5 cable for RCP CNU connector Black 7 White Orange White Brown Red White Red Brown e e Brown 8 2 3 Connection Connectors When connecting cables to each connector of the HKCU 901 connector panel during installation or service connect RET INPUT 1 4 the following connectors or equivalent to the tip Y
307. sation on the lens CRS 3P Cradle Suspension HKC T950 CCD Block Extension Adaptor HDVF 20A HD Electronic Viewfinder HDVF C750W HD Electronic Viewfinder MSA 8A 16A 32A 64A Memory Stick Media Card VCT 14 Tripod adaptor EX 738 A 8327 351 A Extension Board For HDCU 900 AC power cord USA and Canada 1 551 812 XX Other countries 1 782 929 XX Power cord plug holder USA and Canada 2 990 242 01 Other countries 3 613 640 01 Chapter 2 Total System 20 HKCU 901 SD Analog Interface Unit HKCU 902 HD Analog Interface Unit HKCU 903 Frame Rate Converter Unit HKCU 904 Line Converter Unit CCA 5 3 Connection Cable 3 meter 10 feet CCA 5 10 Connection Cable 10 meter 33 feet EX 450 A 8314 633 A Expansion Board For HDCU 950 AC power cord USA and Canada 1 551 812 XX Other countries 1 782 929 XX Power cord plug holder USA and Canada 2 990 242 01 Other countries 3 613 640 01 SD Encoder Unit HD Frame Rate Converter Unit Connection Cable 3 meter 10 feet HKCU 951 HKCU 953 CCA 5 3 2 7 System Setup 2 7 1 Setting the System Format using HDCU 900 The HDCU 900 can support input and output of multiple formats It can also support various types of user s format by installing the optional circuit boards HDCU 900 and list of optional boards CCA 5 10 Connection Cable 10 meter 33 feet RMM 301 Rack Mount Adaptor EX 854 A 8344 228 A EX 893 A 8344 696 A Extension Board Extension Board
308. se components The combination of an LCD touch panel screen and direct push buttons enables full parameter adjustment of the camera to be controlled When necessary basic tape transport functions of a portable VTR can be controlled For further operational convenience the RM B750 has a Memory Stickg media card slot so that various setup parameters can be stored and transferred between camcorders VTR REC START STOP can also be assigned by the assignable switch CNU 500 and CNU 700 Camera Command Network Units The CNU 700 and CNU 500 Camera Command Network Units form the technical nerve center of a star shaped camera control network providing communication between all the units in the system A RISC based microprocessor system provides high speed transfer of command signals to the HDCU 900 950 CCU for rapid response The CNU 500 is for use in systems with up to six cameras and the CNU 700 is for use in larger systems One CNU 700 can also control six cameras but can be expanded to control up to 12 cameras when fitted with an optional expansion board Several CNU 700 units can be connected to the camera control network in a large system HDVF C700W and HDVF C750W Multi format LCD HD Color Viewfinders The viewfinders developed for the HDC 900 and HDC 950 930 cameras are of a new innovative design that is based on a 6 type TFT color LCD panel providing a resolution of 960 pixels horizontally x 540 pixels vertically These vi
309. se maximum flexibility in controlling a multi camera system the MSU 700A 750 is designed to work in conjunction with the CNU 700 and CNU 500 Command Network Units However if a simplified system is desired the MSU 700A 750 can also operate as a stand alone unit It provides rapid finger tip access to all controls relating to the smooth functioning of an operational system including Technical alignment controls for the entire camera chain Picture and waveform monitor switching e System configuration Control data filing Extended Technical Access to Camera Video Processing A traditional high end studio OB camera chain entails a multiplicity of technical adjustments In combination they optimize of the technical alignment of the RGB video processing channels and allow a broad degree of control over certain critical video subsystems such as image enhancement color reproduction dynamic range etc Typically these technical controls are segregated into those requiring regular operational access and are provided as remote adjustments on video operational panels or technical control panels and others perhaps requiring less frequent access which are relegated to screwdriver adjustments on various circuit boards within the camera head and HDCU This separation often entailed a degree of protracted and frustrating re alignment when subtle creative readjustments are desired for a particular picture composition In the HDC 900
310. selected CC filter is illuminated CC color temperature conversion filter select button Press and illuminate the button when it is not lit Filter camera control mode to enable filter selection from this unit When this button is illuminated the CC filter cyclically changes in the sequence of A B C D gt E gt A gt each time it is pressed Notes Once you press any of the filter select buttons both buttons illuminate The illumination is switched off when filter selection is made on the camera The choice of filters that can be selected depends on the camera being used For available filters refer to the Operation Manual of the camera For a camera with four filters you can change the function of this button to skip 5 or E and switch from 4 to1 or from D to A using the RM Configuration menu However when the connected camera has an automatic filter detection facility setting with the RM Configuration menu is not required Paint control block gt AUTO KNEE KNEE MGAMMA DETAIL AUTO KNEE button amber illumination This button is specified at the factory to turn the auto knee function on and off Press and illuminate the button to turn the auto knee function on However you can use the RM Configuration menu to change the function that is turned on off with this button HDC 900 950 930 Series Product Information Manual 2 KNEE control The con
311. st the SC phase with respect to the reference signal BB This switch will return to its original position when you release it Press and hold the switch toward ADV to advance the phase or toward DELAY for delay 7 4 13 Internal Switches and Internal Boards FC Board Internal board of the optional HKCU 953 POWER indicator CONVERT indicator FRAME indicators POWER indicator The LED is lit when the power voltage inside the board is normal CONVERT indicator The LED is lit when the camera is operating in 24PsF mode and the HKCU 953 is supplying 60i 50i signals after frame conversion It goes dark when the HKCU 953 is supplying the input 24PsF signals as is or when the camera is operating in 60i 50i 30PsF or 25PsF mode FRAME indicators REF IN The LED is lit when a subsidiary reference signal for frame lock is being supplied UNLOCK The LED lights if correct lock to the subsidiary reference signal being supplied cannot be achieved HDC 900 950 930 Series Product Information Manual Chapter 7 Location and Function of Parts and Controls 101 7 5 1 Front and Rear Panels Q POWER switch and indicator 1 5 CNU 700 Camera Command Network Unit NETWORK UNIT Front panel MSU connector RCP 1 through 6 connectors VCS connector CCU 1 through 6 connectors Q AUX1 and AUX2 connectors Rear panel QD Optional board
312. sted with this knob In the camera s menu mode the knob is used for camera menu operations On the RM Configuration menu turn the knob to select menu categories subcategories set items set values and other information on the menu display For operations on the RM Configuration menu see Settings on the RM Configuration Menu For operations on the camera s menu refer to the Operation Manual of the camera or the System Manual 7 12 2 Connector Panel CAMERA connector MONITOR connector 9 LCAMERA MONITOR B a VE CAMERA connector 8 Connect to the camera using the supplied remote cable MONITOR connector BNC Connect to a color monitor to observe the signal from the camera Chapter 7 Location and Function of Parts and Controls 130 Settings on the RM Configuration Menu Values set on the RM Configuration menu are stored The RM B150 is provided with an RM Configuration in memory when you exit the menu operation Be sure Menu mode This enables you to select and adjust the to exit the operation before turning the power off function of the buttons and controls on the panel and to check various information At the beginning of an Basic Menu An underlined item under Setting RM Configuration menu operation select Basic menu indicates the factory setting or Detail menu and pro
313. ster Setup Unit Signals of different types cannot be connected simultaneously Note If a signal asynchronous with the HDCU 950 is supplied it may affect the picture quality of return video HDC 900 950 930 Series Product Information Manual MIC REMOTE microphone remote connector D sub 15 pin Using this connector the video camera s microphone amplifier gain can be set using external equipment such as an audio mixer in five steps 60 50 40 30 and 20 dB When taping set the volume to a level appropriate for the audio conditions Note The microphone amplifier gain can also be set using Switches on the internal AVP board WF REMOTE waveform monitor remote connector With the internal switch setting the MIC REMOTE connector can be assigned for the WF REMOTE connector In this case the connector can be connected to the appropriate connector on a waveform monitor when operating the waveform monitor using an MSU 700A 750 Master Setup Unit or RCP 700 series Remote Control Panel A recall type monitor can be connected For the recall type monitor preset a display mode on the waveform monitor and then recall the mode externally D RCP CNU connector 8 pin Used to connect to an MSU 700A 750 Master Setup Unit CNU 500 700 Camera Command Network Unit or RCP 700 series Remote Control Panel via a CCA 5 Connection Cable Control signals are sent and received via this connector When using an RCP 700 series unit power is also su
314. stment is canceled and the button flashes To stop the flashing press the button again BLACK black balance button Press to automatically adjust the black balance and black set The button lights during adjustment and goes dark when adjustment is completed If you press this button when lit or the START BREAK button the automatic adjustment is canceled and the button flashes To stop the flashing press the button again Note If an error occurs during adjustment the pressed button flashes Menu operation block D MODE mode select buttons Select the menu mode If you press and light one of these buttons the menu for the selected mode appears on the LCD PAINT 1 2 3 Each selects the Paint menu to adjust various paint items such as white black and flare SCENE Selects the File operation menu to register and retrieve scene files MAINTENANCE Selects the Maintenance menu to set the H and SC phases of CCU HDCU and operational conditions of this control panel FUNCTION Selects the Function menu to control various camera and CCU HDCU functions When none of the buttons are lit the status display is obtained LCD touch panel Normally displays the statuses When you press a MODE button the corresponding menu is displayed to permit you to adjust the displayed items HDC 900 950 930 Series Product Information Manual 3 Control knobs rotary encoders Adjust the s
315. switch DISPLAY switch SAFETY ZONE switch VF connector Memo clip INTERCOM 1 and 2 connectors INTERCOM 2 MIC ON OFF switch PGM volume control PGM 1 2 switch INTERCOM volume control INTERCOM PROD ENG switch POWER indicator This indicator lights up or goes off as follows to indicate the power supply status Green Power is being supplied to the HDC 900 Red The CAM PW button of the MSU 700A 750 Master Setup Unit or RCP 700 series Remote Control Panel is set to OFF Yellow Power is being supplied to the HDC 900 but the VF PW button of the MSU 700A 750 Master Setup Unit or RCP 700 series Remote Control Panel is set to OFF and power is not being supplied to the viewfinder Off Power is not being supplied to the HDC 900 Chapter 7 Location and Function of Parts and Controls 79 ND filter selector When the FILTER LOCAL button is lit up this selector may be used to select an ND filter Selector position Selected filter 1 Clear 2 1 AND 3 1 8ND 4 1 16ND 5 1 64ND CC color temperature conversion filter selector When the FILTER LOCAL button is lit up this selector may be used to select a color temperature conversion filter appropriate to the light source illuminating the subject Selector position Selected filter A Cross filter B 3200K clear C 4300K D 6300K E 8000K FILTER LOCAL filter local cont
316. system Built in filters Servo filter control Lens mount Electrical characteristics Sensitivity Minimum illumination f1 4 prism Color temperature conversion filters A cross filter B 3200K clear C 4300K D 6300K E 8000K ND filters clear 1 4 ND 1 8 ND 1 16 ND 1 64 ND Yes Sony hanger mount F10 0 at 2000 Ix with 89 9 reflectivity 10 lux F 1 4 12 dB gain up Image signal to noise ratio Horizontal resolution 54 dB or more typical 1000 TV lines Dynamic range 1080 60i mode Registration 600 Within 0 02 all zones without lens Shutter speed selection 1080 60i Gain selection Clear Scan selection Extended Clear Scan Modulation depth Smear level typical Frequency response Horizontal resolution Geometric distortion Input connectors DC IN RET CONTROL AUDIO IN CH 1 CH 2 HDC 900 950 930 Series Product Information Manual 1 100 1 125 1 250 1 500 1 1000 1 2000 s 3 0 3 6 12 dB 60 1 to 4300 Hz 30 3 to 58 3 Hz 45 or more horizontally 800 TV lines at center 27 5 MHz with typical lens 135 dB Within 0 5 dB 10 to 25 MHz Within x 1 0 dB 25 to 30 MHz 1000 TV lines at center of screen 45 10 5 27 5 MHz Negligible not including lens distortion 4 pin 1 6 pin 1 XLR 3 pin male 1 each For MIC 60 dBs may be selected to 20 dBs by viewfinder menu or HDCU 900 operations balanced For LINE
317. t three controls 3 Press Set in synchronization with a time signal The set time becomes valid To resume the previous setting press Cancel in place of Set When the clock setting is completed Press Exit to leave this menu 6 3 4 3 To adjust the buzzer sound A buzzer sounds on the MSU 700A 750 when it receives a call signal or when a panel control is operated When required you may turn on off the buzzer or adjust the sound volume To adjust the buzzer proceed as follows 1 Press MSU Adjusting on the MSU Configuration menu The MSU adjustment menu appears lA Disp Bright EL Bright Bright V Note LED Disp Bright is displayed with the MSU 750 only 2 Press Buzzer to set it to inverse video The lower half of the display becomes the Buzzer Volume Level adjustment display EL Bright En EI Fa EL Bright EI Buzzer Volume Level Call Touch Switch Buzzer Click Click Call Touch Switch All Off BE 3 Master 30 85 68 66 Chapter 6 A Quick Lesson on Camera Settings 73 3 Adjust the levels with the three control knobs Call Sound volume of the buzzer when a call signal is received Touch Sound volume of the buzzer when a button displayed on the menu display is operated Switch Sound volume of the buzzer when a button on the panel is operated The master volume
318. t block STANDARD button Camera CCU function ON OFF buttons WHITE knobs BLACK FLARE knobs and indicator Camera number tally indication window ALARM indicator Q CALL button PANEL ACTIVE button RCP 751 Camera indication window ALARM indicator Q CALL button PANEL ACTIVE button HDC 900 950 930 Series Product Information Manual 1 10 RCP 750 751 Remote Control Panel RA MASTER SLAVE cAMPW TEST BARS CLOSE AI LEVEL 5 WHITE BLACK 0 ART FREAK AUTO SKIN DTL BLACK KNEE DETAIL GATE 00000000 riri MASTER BLACK REMOTE CONTROL PANEL RELATIVE SENS COARSE REMOTE CONTROL PANEL Chapter 7 Location and Function of Parts and Controls QD Power and output signal select AUTO SETUP block Menu operation block DETAIL knob MEMORY STICK slot and access lamp lris master black control block lris master black control block 118 Control select block PARA MASTER SLAVE PARA parallel mode button This button lights when Parallel mode is active in which concurrent operation with another control panel is possible When this button is lit all the buttons and controls on this panel except for the iris master black control block are active even if the PANEL ACT pr
319. t button is output R G B Select the R signal G signal or B signal The signals can be selected either independently or in combination When any of these buttons is pressed the ENC circuit is turned off ENC encode When this button is pressed the R G B circuits are turned off and the ENC signal is output WAVEFORM MONITOR buttons Press to select the output signal from the WF2 OUTPUT connector of CCU The signal corresponding to the lit button is output R G B Select the R signal G signal or B signal The signals can be selected either independently or in combination When any of these buttons is pressed the SEQ and ENC circuits are turned off SEQ sequence When this button is pressed the R G B circuits are turned off and the SEQ signal is output You can monitor the waveforms of the three R G and B signals in sequence on a waveform monitor ENC encode When this button is pressed the R G B and SEQ circuits are turned off and the ENC signal is output Camera select block PARA lo TALLY PANEL C HeHSH HSHSHz Hs Hs H L J T PANEL ACTIVE button Press and light up this button to permit the cameras selected with the camera select buttons to be controlled from this unit The IRIS MB ACTIVE button also lights up If you press t
320. tem Flashes in MAINTENANCE Maintenance mode to set orange various camera maintenance items and the H and SC phases of CCU etc FILE Selects File operation menu to retrieve before using and transfer reference files lens files and Data are being read written If you eject scene files in the video camera or on IC Litin red the disc in this condition the data is not cards guaranteed All the data may be lost PAINT Selects Paint control menu to adjust various paint items such as white black and For battery replacement refer to the instructions for the IC flare card Control knobs rotary encoders Adjust the selected items on the touch panel Indication Meaning or Measures No card is inserted There is a card in the slot The battery condition is good The battery of the card in the slot begins Lit in losing its charge Although the data are orange still maintained replace the battery at the earliest opportunity The battery of the card in the slot is almost exhausted While the card stays in the MSU 700A the MSU 700A sup plies the power to the card However when the card is ejected the data can not be maintained Replace the battery HDC 900 950 930 Series Product Information Manual Chapter 7 Location and Function of Parts and Controls 108 PICTURE MONITOR buttons Press to select the output signal from the PIX2 OUTPUT connector of CCU The signal corresponding to the li
321. temperature 0 C to 45 C 32 F to 11392 Maximum cable length 200 m 656 feet Dimensions w h d 482 x 222 x 67 mm 19 x 83 4 x 23 4 inches including projecting parts and controls Supplied accessories Operation Manual 1 Maintenance Manual Part 1 1 Button labels for HD system 1 set Optional accessories AC power cord 10 10 MSU 750 Master Setup Unit General Mass Power requirements 100 to 240 V AC 50 60 Hz Approx 3 5 kg 7 Ib 11 oz Current consumption 04 Inputs outputs Peak inrush current 1 Power ON current REMOTE probe method CCU CNU 8 pin multi connector 1 30A 100V 60A 240V AUX 8 pin multi connector 1 2 Hot switching inrush AC IN 3 pin 1 current measured in accordance with European Supplied accessories standard EN55103 1 Operation Manual 1 14A 230V Maintenance Manual Part 1 1 Operating temperature O C to 45 C 32 F to 113 F Maximum cable length 200 m 656 feet Dimensions w h d 204 x 354 x 67 mm 81 8 x 14 x 23 4 inches including projecting parts and controls Optional accessories AC power cord 10 11 RCP 750 751 Remote Control Panel General Inputs outputs Power requirements 10 5 to 35 V DC REMOTE CCU CNU 8 pin multi Power consumption 4 W max connector 1 Maximum cable length 200 m 656 feet with CCU AUX 8 pin multi connector HDCU connected 1 Operating temperature 5 C to 40 C 41 F to 104 F EXT 9 pin D sub connector 1 Dimensions w h d RCP 75
322. tems to be selected and adjusted on the LCD in menu format Parallel operation with another control panel Video cameras can be concurrently controlled from this panel and another controller such as the MSU 700A 750A 750 Master Setup Unit HDC 900 950 930 Series Product Information Manual 4 4 New Remote Control Panels RCP 750 751 Four units mountable on a 19 inch rack Up to four units of this control panel can be mounted in a line on a 19 inch EIA standard rack Chapter 4 Control System 57 Figure 4 6 0peration Panel of the RCP 750 751 RCP 750 Control select block r O OOO and output signal select block OSTANDARD button Camera CCU function 9999 m 52 ECO AUTO SETUP block 5 WHITE BLACK ON OFF buttons Menu operation block OWHITE knobs knob BLACK FLARE knobs and indicator STICK slot and QCamera number tally indication access lamp window lris master black control block indicator OCALL button PANEL button REMOTE CONTROL PANEL RCP 751 Camera indication window RELATE SENS nol Conse lris master black control block indicator OCALL button PANEL button Z REMOTE CONTROL PANEL HDC 900 950 930 Series Product Information Manual Chapter 4 Control System 58 Figure 4
323. tercom system and be connected to up to two channel devices These connectors may also be used for monitoring a VTR playback audio signal when the HDC 900 is used as a stand alone unit INTERCOM PROD ENG intercom producer engineer line select switch Used to switch intercom channel 1 or 2 between producer and engineer lines PROD Use the producer line ENG Use the engineer line INTERCOM volume control Adjust the intercom output level 1 2 program audio select switch Used to switch between program audio 1 and 2 program volume control Adjust the program audio output level MIC microphone ON OFF switch Turn the headset microphone on or off Chapter 7 Location and Function of Parts and Controls 81 7 2 1 Front Right Side INCOM button RET 1 button C e Sy ELS p AY dB CES Y RGB switch R G B switch ASSINABLE switch FILTER control AUTO W B BAL switch INCOM intercom 1 button The intercom 1 microphone is turned ON while this button is pressed RET 1 return video 1 button The return video 1 signal from the camera control unit is monitored on the viewfinder screen while this button is pressed It is the same function as with the RET 1 buttons on the sides Y RGB switch Select the video signal output for the VF and TEST OUT connectors Y Output is the Y signal this is the power on default RGB Output
324. the same chart There are always some variances between different model lenses Fine adjustment is needed even between the same model lenses because the correction value cannot be the same 6 3 Initial Settings for the Control System The MSU Configuration Menu appears MSU Configuration Ext MSU MSUSW Adjustin Set Date Time 3 Press Security The Security Menu display appears Security Menu Exit Engineer Mode 4 Press Engineer Mode to set it to inverse video The Security Menu items now appear Security Menu Exit Engineer Mode Code Engineer Mode Chapter 6 A Quick Lesson on Camera Settings 68 5 Press Code Change The numeric keys and field for entering a New Code No are displayed 8 Code Change X Code 7 89 Status 4 5 6 6 Enter desired code 110 8 digits using the numeric keys then press OK Note Each digit you input will be displayed in an asterisk The message Retype New Code No is then displayed Exit 7 Enter the same code you entered in step 5 once again then press OK The security menu is restored 8 Press Exit The specific security code is now registered When you next press Engineer Mode on the security menu the numeric keys appear and the code input is required The MSU 700A 750 will enter the Engineer Mode if
325. the state before the button was lit AUTO SETUP block For automatic adjustments of cameras ieri AUTO LEVEL START HUE BREAK WHITE BLACK Auto adjustment item select buttons Press and light up these buttons to select the items to be automatically adjusted AUTO HUE Skin tone detail automatic hue LEVEL Gamma balance knee point master black level etc 2 START BREAK button Press to start automatic adjustment of the selected items The button lights during adjustment and goes dark when adjustment is completed If you press the button when lit the automatic adjustment is canceled and the button flashes To stop the flashing press the button again WHITE white balance button Press to automatically adjust the white balance The button lights during adjustment and goes dark when adjustment is completed If you press this button when lit or the START BREAK button the automatic adjustment is canceled and the button flashes To stop the flashing press the button again 4 BLACK black balance button Press to automatically adjust the black balance and black set The button lights during adjustment and goes dark when adjustment is completed If you press this button when lit or the START BREAK button the automatic adjustment is canceled and the button flashes To stop the flashing press the button again Note If an error occurs during adjustment the pressed button flashes Q Camera CCU func
326. thesis In the case of theHDCU 700A mode S423 2 AT 149 ON 2 Esterhalylew 8pin 15pin MIC GAIN CONT L L MIC 1 and 2 ON No Signal Specifications L H MIC 1 ON MIC OUT G 0 dBu 20 dBu H L MIC 2 ON 2 MIC OUT X Selectable with S502 H H INTERNAL set 3 MIC OUT Y S503 AVP 4 0 dBu 0 775 Vrms CONT1 CONT2 ASPECT 8 3 1 4 MIC REMOTE D sub 15 pin Female L H SQ 16 9 WF REMOTE D sub 15 pin Female H H EC 4 3 L L INTERNAL set H L LB 4 3 O 9 In the case of the WF REMOTE mode S423 3 AT 149 ON Recall system External view No Signal Specifications In the case of MIC REMOTE mode S423 3 AT 149 OFF 1 NC No connection 2 NC No connection No Signal Specifications 3 INC No connection 5 5 V OUT Max 250 mA 4 NC No connection 2 TALLY GND GND for TALLY 5 RECALL2 G LOW ACTIVE 3 IGTALLY OUT ON GND Max 30 mA 6 RECALL3 LOW 7 RECALL1 R LOW ACTIVE 4 RTALLY OUT ON GND Max 30 mA 8 RECALLA SEQ LOW IN CHU MIC CONT2 Ref he bel 10 INC connection column 6 AMP CONTI T Refer to the below 0 connection limi 12 5 LOW 13 RECALL6 R B LOW HDC 900 950 930 Series Product Information Manual Chapter 8 Connectors and Cables 158 8 3 1 5 INTERCOM TALLY PGM D sub 25 pin Female
327. this new model intuitively The HDC 950 930 portable model features a body that is so compact and lightweight that it opens up new and exciting possibilities in location camera work Newly developed ADSP LSIs drastically reduces its power consumption which helps contribute to the stable operation of the entire system This design with a low optical axis and superb weight distribution means that the camera can be carried comfortably on the shoulder without causing fatigue Tripod operation is just as easy and the HDC 950 930 has all its controls and connectors located in similar positions to those on Sony BVP cameras Even with a viewfinder microphone and a standard ENG lens the total weight of the HDC 950 930 is only around 7 kg about 16 pounds Optical Filter Wheels Independent ND and CC optical filters are provided on both the HDC 900 and HDC 950 930 The filter drives provided for both 900 and 950 930 are exactly the same so that common operation is enabled between the hard camera and the portable type when the filter settings are adjusted remotely on a RCP MSU or RM B750 B150 Remote Control Unit Electronic Shutter The electronically operated shutter provides speeds of 1 100 1 250 1 500 1 1 000 and 1 2 000 of a second 1080 60i mode Clear Scan and ECS Extended Clear Scan Sony s Clear Scan and ECS functions eliminate banding effects when shooting monitor displays by allowing the shutter speed to be adjusted so
328. ti ae 1 Design and specifications are subject to change without DC IN XLR 4 pin 1 10 5 to 17 V DC Dimensions Unit mm inches gt A E Z d 2 UPL E S S 00 Y Y 133 5 1 4 348 13 3 4 10 3 HDC 930 HD Color Video Camera General Imager 2 3 type interline transfer Power consumption 25W in stand alone use CCD without options Method 3 CCD RGB Operating temperature 20 C to 45 C 4 F to Effective resolution 1920 horizontal x 1080 113 F vertical Storage temperature 20 C to 50 4 F to 4 122 F Electrical characteristics Mass Approx 5 1 kg 112 Ib 7 oz Sensitivity F10 0 at 2000 Ix with Dimensions See below 89 9 reflectivity Unit mm inches Minimum illumination 10 lux F 1 4 12 dB gain up Imager Image signal to noise ratio 54 dB or more typical HDC 900 950 930 Series Product Information Manual Chapter 10 Specifications 180 Horizontal resolution 1000 TV lines Emission duration Continuous Dynamic range 1080 60i mode Laser output power 141 37 49 mW 600 96 Registration Within 0 02 96 all zones Input output connectors without lens VTR CCZ 26 pin 1 Shutter speed selection 1080 60i CCU Electro multi connector 1 1 100 1 125 1 250 1 500 LENS 12 pin 1 1 1000 1 2000 s VF 20 pin 1 Gain selection 3 0 3 6 12 dB MIC IN XLR 3 pin fem
329. tion ON OFF buttons Various functions of the video camera or the CCU can be turned on and off from this unit ON when the button is lit The following switching functions are assigned to four of the buttons at the factory and the other three buttons are reserved for future use LJ LI T 5600K AUTO SKIN KNEE DETAIL CHARACTER 5600K 5600 electronic color temperature conversion function AUTO KNEE Auto knee function When this button is lit ON the knee point is automatically adjusted according to the light content of the picture SKIN DETAIL Skin tone detail function CHARACTER System information display function The various information on the entire system is displayed on the monitor connected to the CHARACTER connector of the CNU 700 The HDC 900 950 930 Series Product Information Manual display contents can be changed through a menu operation Scene file control block SCENE FILES button 2 STORE button 1 2 J 5 SCENE FILES STORE SCENE FILES buttons While the STORE button is flashing When you press one of these buttons the current setting data is stored as a file of the corresponding number When the STORE button is dark The stored data can be retrieved by pressing and lighting up the button of the desired number Press the lit button to turn it dark and resume the previous status 2 STORE button To store a scene file first press this button so that the button starts
330. to make it go dark PIX Press and light the button when switching the output signal from the PIX2 OUTPUT connector with the output signal select buttons Press the button again to make it go dark Chapter 7 Location and Function of Parts and Controls 113 When one of these buttons is lit pressing the output signal select buttons has effect only on the connector that corresponds to the lit button The output signal from the other connector does not change By lighting both the buttons you can simultaneously select the output signal Note If you light both the WF and PIX buttons when different signals are selected for the WF2 OUTPUT and PIX2 OUTPUT connectors the signals selected for either of the connectors flash Press the button for the signal to be output to select it again For example when you light both the WF and PIX buttons with R B selected for PIX2 OUTPUT and B G selected for WF2 OUTPUT the R and G buttons will start flashing while the B button will remain lit To output R and G press the R and G buttons Each pressed button stops flashing and lights output select buttons corresponding to the Camera select block uit PANEL PARA EXPAND ACTIVE C C C 2 C C 2 C 2 C 2 C 2 C 2 gt C 2 C 2 07 08 09 10 Cs c LUULITI Cc O TALLY ca 11 12 7300000 c MULTI C 2 C 2 2 C 2 C TALLY
331. ton With the MONITOR button lit you can cancel the setting of the camera menu item selected on the LCD by pressing this button PAINT ENTER With the MONITOR button unlit the Paint menu of this unit appears on the LCD when you press and light this button With the MONITOR button lit you can register the setting of the camera menu item selected on the LCD by pressing this button When none of the buttons are lit the status display is obtained LCD touch panel Normally displays the statuses When you press and light the MONITOR button it displays the video signal from the connected camera SDTV signal only HDTV signal will not be displayed In RM Menu or Camera Menu mode the selected menu is displayed to permit you to operate the menu Flashes or lights in red when trouble occurs in the camera system and the self diagnostic function activates at the video camera or the camera control unit HDC 900 950 930 Series Product Information Manual Chapter 7 Location and Function of Parts and Controls 133 Control knobs rotary encoders In RM Menu mode adjust the selected items on the touch panel In Camera Menu mode select and adjust the menu items using the leftmost knob Iris master black control block IRIS MB ACTIVE indicator AUTO IRIS S MASTER BLACK button AUTO IRIS MB control IRIS ACTIVE MASTER BLACK EXT lens extender EXT IRIS control D AUTO IRIS button Press and light t
332. trix is actually a circuit used to make the color reproduction look better although some textbooks mention that it is used to correct the difference between camera chromaticity and that of HDC 900 950 930 Series Product Information Manual he signal standard It seems that the linear matrix should be more important to emphasize the visual appeal of the picture apparently rather than just be heoretically determined by some coefficients Mix DTL NAM DTL Recently most of the cameras create V DTL from all hree channels of R G B Depending on how to apply hese three values of V DTL to the add operation there are two types of mix the Mix DTL a simple sum of the values and the NAM DTL a non additive mix of the values Both of them have pros and cons The Mix DTL is not always better than out of green while the NAM DTL helps make a picture sharper but sometimes it makes the S N become worse or adds the DTL opposite to the luminance The NAM DTL does not apply to H DTL because it will increase aliasing Multi matrix Multi matrix is used to easily implement color reproduction that complies with color matching and visual appeal between different cameras by adjusting the matrix coefficient to match the color phase For instance it is possible to change the color phase and saturation of red color only In most of Sony s cameras it works with 16 axes for color phase on a color plane like a vector each of which has its own matrix co
333. trol is specified at the factory to adjust the master knee point However you can use the RM Configuration menu to change the function that is adjusted with this control M GAMMA master gamma control The control is specified at the factory to adjust the master gamma However you can use the RM Configuration menu to change the function that is adjusted with this control DETAIL control The control is specified at the factory to adjust the detail level However you can use the RM Configuration menu to change the function that is adjusted with this control Note The adjustment mode of the above three controls is specified at the factory as Relative mode which can be changed to Absolute mode using the RM Configuration menu The center click position of each control is the reference position in Relative mode The adjustment range in Relative mode is also selected using the menu White balance control block tr R WHITE B WHITE white balance controls Adjusts the R B white balance The adjustment mode of these controls is specified at the factory as Relative mode which can be changed to Absolute mode using the RM Configuration menu See Settings on the RM Configuration Menu A memory A button amber illumination Press and illuminate the button to obtain the white balance setting stored in memory A of the camera Memory A mode When this button is illuminated adjustments made to the white balance are stor
334. ts and Controls 126 1 12 RM B150 Hand held Remote Control Unit 1 12 1 Operation Panel Q Shutter control block VTR control block OUTPUT selector Filter control block CAMo LOWo BARS MID Bango GAIN selector OUTPUT GAIN Paint control block O O O AUTO KNEE O KNEE DETAIL M GAMMA White balance control block Black balance control block ABB R Q ACTIVE button 1 IRIS MB ACTIVE STANDARD button Iris master black control block Q MASTER BLACK IRIS REMOTE CONTROL UNIT RM B150 M J 00000000 MENU DISPLAY SELECT 90 MENU operation block MENU CANCELENTER y Shutter control block ECS Extended Clear Scan button amber illumination Press and illuminate the button to set the camera to ECS mode The current ECS frequency is shown on the display of the menu J 2 operation block for a few seconds In ECS SHUTTER ECS S EVS mode the ECS frequency is adjusted with the menu select knob rotary encoder S EVS Super EVS button amber illumination Press and illuminate the button to set the camera to S EVS mode The current S EVS value is shown
335. tton for Relative mode or press and turn it dark for Absolute mode When the IRIS MB ACTIVE button is not lit Relative mode is automatically selected and this button is not operative 5 ACTIVE iris master black active button Press and light up this button to enable the iris master black control block of the panel When the PANEL ACTIVE button is pressed this button also lights If you press this button so that it goes dark the panel will be locked preventing accidental misoperation AUTO button Press and light the button to automatically adjust the iris according to the amount of input light When this button is lit the reference value for automatic iris adjustment can be set in a range of 1f with the iris control If you press the button when lit it goes dark and manual iris adjustment is enabled Q f number display Displays the f number of the current iris setting When the iris is closed CL is displayed Q EXT lens extender indicator Lights when the lens extender is used HDC 900 950 930 Series Product Information Manual SENS sensitivity control knob Used for manual iris adjustment in Absolute mode This control is not operative when Relative mode is selected Q COARSE control knob Used for manual iris adjustment Master black control ring Turn to manually adjust the master black level IRIS control lever When the AUTO button is not lit you can adjust the iris manual
336. tton is lit numbers 13 through 24 are displayed and cameras 13 through 24 are selected Chapter 7 Location and Function of Parts and Controls 114 Display window block IC card insertion block ACCESS s N 7 1I 011071 ung 45 3 415 ECS SHUTTER Cis E ND IC MEMORY CARD J GAIN FILTER ECS frequency Shutter speed display window The currently selected ECS frequency or step shutter speed is displayed in the window Switching between the ECS mode and shutter mode is made using the Function menu When CD ACCESS indicator Shows the status of the IC memory card both ECS and Shutter are off OFF is Indication Meaning or Measures displayed GAMMA display window Off No card is inserted The currently selected step gamma value is Lit in There is a card in the slot The battery displayed in the window The setting is made green condition is good using the Function menu The higher the gamma effect the lower the value 9 MASTER GAIN display window The selected gain value dB of the camera is displayed in the window The setting is made The battery of the card in the slot begins Lit in losing its charge Although the data are orange still maintained replace the battery at the earliest opportunity The battery of the card in the slot is almost exhausted While the card stays Flashes in in the MSU 750 the MSU 750 supplies the power to
337. twork Units form the command nerve center for a new concept in a camera control system A wide selection of control peripherals allows each user to configure the most suitable system to meet a specific operational need The following are the key peripherals Master Set up Unit MSU 700A and MSU 750 The MSU 700A 750 Master Set up Unit can control up to 6 cameras up to 12 cameras by using an expansion board BKP 7930 in combination with the CNU 700 Camera Command Network Unit The adoption of an EL Touch Panel in the MSU 700A 750 helps to simplify the operation of its sophisticated control system Data Such as scene files can be stored in a world standard PCMCIA memory card Camera Command Network Units CNU 700 and CNU 500 The Camera Command Network Units are designed to be the nerve center of the Sony camera control system for the newly developed HDC 900 950 930 family and the conventional BVP 900 700 500 SD Series of cameras They work as Command Selector Command Distributor and Command Arbitrator These two types of camera command network units give a cost performance choice The CNU 500 is suitable for applications with up to six cameras while the standard six camera capability of the CNU 700 can be expanded to 12 cameras with use of the BKP 7930 optional expansion board The carefully designed software and the high speed CPU of both 2 5 Viewfinders As well as the HDVF 700A a high performance 7 type multi fo
338. up one of these buttons to activate the test signal generator of the video camera and send the respective signals TEST To send a signal to test the video circuits BARS To send a color bar signal Note The BARS button takes priority to the TEST button If the BARS button is lit press the button to turn it dark before pressing the TEST button Chapter 7 Location and Function of Parts and Controls 119 CLOSE button Press and light the button to close the iris To release the close mode press the button again so that it goes dark completed If you press the button when lit the automatic adjustment is canceled and the button flashes To stop the flashing press the button again WHITE white balance button Press to automatically adjust the white balance The button lights during adjustment and goes dark when adjustment is completed If you press this button when lit or the START BREAK button AUTO SETUP block m UP SKINDTL LEVEL START 5 AUTO HUE BREAK WHITE BLACK Auto adjustment item select buttons Press and light up these buttons to select the items to be automatically adjusted SKIN DTL AUTO HUE Skin tone detail automatic hue LEVEL Gamma balance knee point master black level etc START BREAK button Press to start automatic adjustment of the selected items The button lights during adjustment and goes dark when adjustment is NT1 PAINT2 PAINT3 SCENE MAINTE NANCE the automatic adju
339. uration menu under the Maintenance menu BARS To send a color bar signal Chapter 7 Location and Function of Parts and Controls 132 Note Menu operation block The BARS button takes priority to the TEST button If the BARS button is lit press the button to turn it dark RM menu select camera menu set buttons before pressing the TEST button LCD touch panel Q CLOSE button Press and light button to close the iris release the close mode press the button again so that it goes MONITOR dark Q VTR START STOP button Press light up this button to start recording operation When you press the button when lit it goes IAINTENANCE dark and recording stops Using the RM Configuration VE MENU menu under the Maintenance menu you can assign O the CALL button function to this button In this case press to send a call signal to the video camera on which the CALL button lights The tally lamps on the PANT C Jg camera and the red tally lamp on the camera control ENTER unit light when not lit or go dark when lit When the CALL button on the video camera is pressed the button on this unit lights and a buzzer sounds ey e n og p buttons Control knobs ontrols ayback operations stop bolo 4 RM menu select camera menu set buttons Press to stop a rewind fast forward or playback 2 2 bye
340. ut connectors MIC OUT DIGITAL AUDIO OUT CHARACTER OUT HDC 900 950 930 Series Product Information Manual 8 pin multi connector 1 D sub 9 pin female 1 RS 232C for CHU transmission or system expansion D sub 15 pin female 1 JAE made DA C1 J10 recommended 100 110 to 120 220 to 240 V AC switchable BNC type 4 SMPTE 292M Bit rate 1 485 Gbps 1 4835 Gbps BNC type 4 SMPTE 259M Bit rate 270 Mbps BNC type 2 loop through output HD SMPTE 274M tri level Sync 0 6 Vp p 75 ohms SD Black burst or 10F BB 0 286 Vp p 75 ohms NTSC 0 3 Vp p 75 ohms PAL BNC type 2 loop through output analog signal 1 0 Vp p 75 ohms D sub 15 pin 1 JAE made DAC1 J10 recommended 3 pin male 2 dBs 20 dBs BNC type 1 AES EBU format BNC type 1 525 625 black and white WF REMOTE D sub 15 pin female 1 JAEmade DA C1 J10 recommended HD SERIAL OUTPUT BNC type 3 MPTE 292M 0 8 Vp p 75 hms t rate 1 485 Gbps 4835 Gbps HD SERIAL MONI 0 NC type 1 SMPTE 92M 8 Vp p 75 ohms t rate 1 485 Gbps 1 4835 Gbps BNC type 4 SMPTE 259M 0 8 Vp p 75 ohms it rate 270 Mbps NC type 1 D 80014 tri level Sync 0 6 Vp p 75 ohms D composite sync 0 3 p p 75 ohms D SYNC or SD SYNC electable NC type 1 VBS R G B VBS 1 Vp p 75 ohms NC type 1 VBS R G B VBS 1 Vp p 75 ohms 4 pin 1 on
341. w 20 INC No connection 16 CH2 MIC Y OUT 2 Bal 21 LENS R TALLY OUT ON GND ance OFF High impedance 17 No connection Zo lt 1 kOhms HDC 900 950 930 Series Product Information Manual Chapter 8 Connectors and Cables 146 No Signal Specifications 22 EXP POSI IN Zi gt 10 kOhms TION 110 4 1V 7 5 4V 7 5 23 RET 3 ON IN Zi gt 10 kOhms ON GND OFF High impedance 24 LENSADRSO IN 1 25 LENS ADRS 1 IN 1 26 LENSADRS2 IN 1 27 LENSADRSS3 IN 1 28 EXTENDER 1 OUT ON GND ON OFF High impedance 29 2 OUT ON GND ON OFF High impedance 30 F DEM FAR IN No connection 31 INCOM 1 Zi gt 10 kOhms ENG PRD ENG GND PRD High impedance 32 INCOM2 2 gt 10 kOhms ENG PROD ENG GND PRD High impedance 33 INCOM MIC 1 IN Zi2 10 kOhms ON ON GND OFF High impedance 34 INCOM MIC 2 IN Zi2 10 kOhms ON ON GND OFF High impedance 35 FCONTSIG OUT No connection 36 F DEM NEAR IN No connection 1 Zi gt 10 kOhms 1 High impedance 0 0 0 5 V 0 LENS ADRS 0 low order bit LENS ADRS 3 high order bit 2 Zi 10 kOhms 1 High impedance 0 0 0 5V EX1 EX2 1 1 1 EXTENDER OFF 0 0 1 EXT 1 x 1 5 ON 0 1 1 EXT 2 x 2 ON 0 0 1 EXT 3 x 2 5 ON LENS 12P FEMALE
342. witch according to the device connected to the AUDIO IN CH 1 and CH 2 connectors MIC When connecting microphones LINE When connecting line signal sources Microphone power switches For the microphones connected to the AUDIO IN CH 1 and CH 2 connectors respectively 48 V When the connected microphone requires an external power source A power of 48 V is supplied to the microphone OFF When the connected microphone requires no external power Note To supply a power of 12 V modification of the camera is required For details refer to the Installation amp Maintenance Manual Note that the modification must be performed by service personnel PROMPTER connector BNC type Used to output the signal input from the HDCU 900 Camera Control Unit s PROMPTER INPUT connector TEST OUT test signal output connector BNC type Used to output the signal selected by the video signal select buttons on the rear panel If the RET 1 or RET 2 button is pushed in the output will be a return video signal REMOTE connector 8 pin Used to connect the camera to an optional MSU 700A 750 Master Setup Unit or RCP 700 series Remote Control Panel a CCA cable The connected unit may then control the HDC 900 TRACKER connector 20 pin Used for communication between the camera operator and the tracker and also for intercom channels 1 and 2 It also supplies the up tally signal and the program audio signal D R
343. y operation Frequently used functions are directly accessed from the panel The following modes can be easily accessed by using the new EL touch panel display for maintenance and daily operation Paint mode Various paint items such as White Black and Flare are adjustable File mode Storing retrieving and transferring reference files lens files and scene files between camera heads on a PC memory card Maintenance mode System phase control HDCU video level alignment selection of character display from a CNU 700 and CNU 500 etc Configuration mode Entire control system configuration RCP assignment etc Card mode PC memory card initialize store to PC memory card recall from PC memory card etc Multi mode Setting of multi camera operation such as All Control Priority Parallel Mode etc 2 Multi MSU operation In a conventional system a single MSU controls a single studio or multiple studios However in this new control system multiple MSUs can be used to remotely control supervise a single studio from different operational engineering and control rooms 3 Standard switch Users standard setting data is easily recalled by pressing the standard switch Photo 4 1 MSU 700A Master Set up Unit Chapter 4 Control System 50 The CNU 700 and CNU 500 Camera Command Network Units are designed as the technical nerve center of a Star Shape Network System where all commands such
344. you enter the code properly and press OK 6 3 1 2 To change the security code When the registered security code must be changed proceed as follows 1 Display the security menu items by following steps 1 through 3 of the above procedure for setting a new code 2 Press Engineer Mode The numeric keys and field for entering the Code No are displayed Engineer Mode Code No 7 89 Note Each digit you input will be displayed as an asterisk Security menu items now appear Security Menu Engineer Mode Code Engineer Mode 4 Press Code Change The numeric keys and field for entering the Old Code No are displayed Code Change Old Code No 7 89 40516 5 Enter the old code then press OK The field for entering a New Code No now appears Code Change 4 5 6 6 Specify New Code by following steps 6 through 8 of the previous procedure 6 3 1 3 To enable to cancel the security code To use a security code while in the Engineer Mode it is necessary to set the unit in a mode to use the security code If the operator forgets the security code or if an adjustment while in the Engineer Mode 3 Enter the old security code using the numeric keys becomes necessary in emergency when the then press OK authorized operator is absent the security code can be canceled by the following procedure HDC 900 950 930 Series
345. ys aligned as close as possible to the lens axis Chapter 2 Total System 19 The HDVF 700A has the following features Multiscan In addition to the 60i format formats such as 24PsF and 50i are supported for control signals from the camera 16 9 display capability When operated from an external device such as a camera control unit the screen can be switched between 16 9 and 4 3 display modes High resolution The viewfinder uses a high resolution cathode ray tube providing 800 or more lines of horizontal resolution Stable picture A high voltage regulation circuit provides a stable image with a minimum ol distortion regardless of screen brightness Continuously variable peaking A continuously variable peaking circuit provides a sharp image making it easy to focus the camera Tally lamps The viewfinder has red and green tally lamps which light in response to tally signals Superior usability The viewfinder height may be set to one of three positions and it may be tilted up to 60 upwards or 50 downwards Drip proof construction The drip proof design is able to withstand light rain making the viewfinder well suited to outdoor use Studio monitor hood outdoor hood The viewfinder may be fitted with a strong easy to use studio hood supplied or an outdoor broadcasting OB hood with excellent shading ability option Energy saving design The viewfinder will accept a wide range of power supply voltage from 1
346. ystem is set to 1 1 001 90H phase difference indicator The LED is lit when the phase difference between the HD output and SD output is set to 90H HD REFERENCE indicators and switch The switch is to select the type of sync signal to be connected to either of the REFERENCE connectors on the rear panel HD HD tri level reference sync signal local setting REM remote Signal selected on the MSU 700A 750 Master Setup Unit BB SD reference sync signal black burst signal local setting When a signal is supplied to the REFERENCE connector the REF IN indicator lights If the type of the input sync signal does not match the setting on this unit the UNLOCK indicator will light H PHASE switches Used to adjust the H phase First set the phase by steps with the STEP switch then adjust it with the COARSE switch The COARSE switch will return to its original position when you release it Press and hold it toward ADV to advance the phase or toward DELAY for phase delay Chapter 7 Location and Function of Parts and Controls 98 7 4 8 Internal Switches and Internal Boards AVP Board Q POWER indicator PGM1 MIX PGN2 selector PGM1 LEVEL control PGM2 LEVEL control SIDE TONE control 2WIRE CANCEL controls MIC AMP GAIN controls Q POWER indicator The LED is lit when the power voltage inside the board is normal PGM1 MIX PGM2 program audio selector To select the

Sony HDC-900 User's Manual

Contents

Download Pdf Manuals

Related Search

Related Contents