Ansel 5015 print server
Contents
1. USB TO TIDE 8810c0 E MI emm a View device webpage Disconnect Create Shortcut Properties 2 You will now see the external hard drive become available as if were directly connected to your computer Jes ae y Computer k E Organize m Views OM AutoPlay d Properties System properties jg Uninstall or change a program Map network drive Bauer Links Name Type Total Size Free Space i Hard Disk Drives 3 6 Documents EWINXPP C EVista p Music BP 13 0 GB free of 17 5 GB 4 89GBfreeof196GB More Devices with Removable Storage 1 Folders wr DVD RW Drive D EE Desktop E m IPE naa PR Connecting to an USB HUB 1 If you have more than one USB device that you would like to share over your network you may add an USB HUB 4 port maximum to the Network USB over IP Server 2 Connect the USB cable of the USB HUB to the USB port on the Network USB over IP Server and then connect the USB device s to the USB ports on the USB HUB Make sure the power adapter of the USB HUB is plugged in and powered on Note Network USB over IP server can only support up to 4 USB devices through an USB HUB and certain USB devices require a direct connection to your computer in order to function at full capacity 26 Disconnecting an USB Device 1 To safety disconnect an USB device under the Network window right click the USB device icon and select Disconnect from2. For Windows 2000 XP Users 1 Insert the setup CD into your computer A welcome screen should appear with a menu of options including the option to install the proper Network USB over IP Server software access the User Manual or Exit out of the welcome menu 2 The installation wizard will start the installation process click OK to continue Choose Setup Language 3 When the installation completed click Finish to close the installation wizard USB over IP Server InstallShield Wizard InstallShield Wizard Complete Setup has finished installing USB over IP Server on your computer Cancel 4 On your desktop you will see a new icon double click the icon and it will bring up the Network USB over IP Server setup utility Phe ompurer 2 Launch HSBaverIPs 5 he setup utility will show up and display all the active Network USB over IP Servers on your network In this screen you will see the product listed as USB over IP Server 8810C0 192 168 0 21 The 8810 0 is the last 6 digits of the Network USB over IP Server s MAC address and the 192 168 0 21 is the Network USB over IP Server s IP address gt USB over IP Server File View Help zx USB over IP Server 8810C0 192 168 0 21 Connecting to an USB Device 1 Connect the USB cable on your USB device to the USB port of the Network USB over IP Server and make sure both the USB device and the Network USB over IP Server are powered o
3. Error with USB device Example out of paper JSB device is in use by another user Problem with a USB device occupied by another user Unsupported USB device USE server ison a different network segment USB device can not be connected 17 Setting the Polling Interval 1 The polling interval will allow the setup utility to pull information from your network to find out the status of all connected Network USB over IP Server and USB devices To configure the polling interval in the utility click on File gt Settings gt Polling Interval USB over IP Server mim View Help Polling Interval Quit Languages E w Receive Disconnect Request 2 You may set a number in the Seconds box Click on Submit to allow the new interval setting to take effect Once you have set a number the utility will automatically update any changes made to server in the main dialog box gt Polling Interval mn m Configuration 30 arcan Input 0 ta stop polling Minimum imputis 20 seconds Cancel Setting the Network USB over IP Server by Setup Utility 1 To configure the Network USB over IP Server by setup utility right click on the USB over IP Server and select Setting 18 lt gt USB over IP Server File View Help Elis USB over IP Server 8810C0 Generic Flash Disk 2 AServer Setting window will be displayed You may set the DHCP default IP address and password Moreo
4. PM EVISTA E E EE Create Shortcut 55 PM eneric Flash Control Panel ate 10 Click on the blinking window at the system tray which is prompted by the User Account Control permission window Click Continue to proceed with the installation Tem SSS SS User Account Control eem J Windows needs your permission to continue E U you slLarbec cornu J PnPX Device Association Uscr Account Control hclps step unauthorized changcs to your computer 11 After the driver installation has been completed the USB over IP server icon will change to a new product image If the new product image icon does not change press F5 to refresh the Network window Before installing the driver USB over IP Server 8810C0 8810c0 192 After installing the driver E gt USE over IP Server 8810C0 8810c0 192 You are now ready to use the Network USB over Server Connecting to an USB Device 1 After you have successfully installed the Network USB over IP Server driver connect the USB device to the USB port of Network USB over IP Server and make sure both the USB device and the Network USB over IP Server are powered on 24 2 When the USB device is connected the Network USB over IP Server will detect the connection of the USB device and an icon of the USB device will show up in the Network window
5. setup your printer on the computer Connecting to an USB HUB 1 If you have more than one USB device that you would like to share over your network you may add an USB HUB 4 port maximum to the Network USB over IP Server 2 Connect the USB cable of the USB HUB to the USB port on the Network USB over IP Server and then connect the USB device s to the USB ports on the USB HUB Make sure the power adapter of the USB HUB is plugged in and powered on Note Network USB over IP server can only support up to 4 USB devices through an USB HUB and certain USB devices require a direct connection to your computer in order to function at full capacity 13 3 After the USB device s are connected to the USB HUB the Network USB over IP Server setup utility will automatically display the connected USB device s If you do not see the USB device s that are connected press Search button to refresh the list gt USB over IP Server File View Help Note If your USB device does not show up on the list please try to disconnect and reconnect the USB device to the USB HUB Also please make sure the Network USB over IP Server and your USB HUB are powered on Disconnecting an USB Device 1 To disconnect an USB device simply click on the connected USB device on the list of the Network USB over IP Server setup utility and press the Disconnect button The device Will the
6. to see the Network USB over IP Server icon under Other Devices 22 Note If you are prompted by a User Account Control message notifying you that Windows needs your permission to continue screen please click on Continue to process 8 Select Yes turn on network discovery and file sharing for all public networks i 32 Network discovery and filesharing i R Do you want to turn on network discovery and file sharing for all public networks What is network discovery No make the network that I am connected to a private network Metwork discovery and file sharing will be turned on for private networks such as those in homes and workplaces gt Yes turn on network discovery and file sharing for all public networks Cancel 9 Right click on the USB over IP server icon and select Install to begin using the Network USB over IP Server 23 19 Network My Organize m Views Ra add aprinter W Addai Install tas Network and sharing Center Favorite Links Name Category Documents Computer 7 aues A 44 94 A PM ASUS Ec ie Music More Network Infrastructure 2 Folders bal EE Desktop M BUFFALO Airstation BUFFALO WZR AMPG144NH Other Devices 1 n Public ther L evices 1 Computer USB over IP it 1 Network Server 8810CO f OEM 44E94 A2BE4 View device Webpage jE PM ASUS 188
7. In this example we have connected a USB flash disk Name Category 3 Computer 4 T OEM 44E94 47 BEd A kh PM ASUS e e c Network Infrastructure 2 BUFFALO WZR AMPOGL44 M BUFFALO Airstation Other Devices 1 2 USE over IP D Server 8810 CU 8810c0 192 Storage 1 3 Right click on the USB device that you will want to connect and select Connect to establish the connection You will see the device driver is installing and the status will show at the bottom right corner on your system tray This message will go away once the drivers have been installed completely LA Generic Pash Disk el View device webpage Connect comet Installing device driver software Create Shortcut i Click here for status Properties After the installation is completed the USB device will become available as if it were directly connected to your computer Connecting to an USB Hard Drive 1 Connect the USB cable of the USB hard drive to the USB port on the Network USB over IP Server and make sure both the USB hard drive and the Network USB over IP Server are powered on After the USB hard drive is connected the device icon will display in the Network window Right click on the device icon and select My Computer to bring up My Computer window Or you may simply double click the hard drive icon to bring up My Computer window 25
8. Network USB over IP Server With 1 USB2 0 Port User Manual TABLE OF CONTENTS eicit tone cetera nee ee Mee re cee E EE EU 4 1 IN TROD UG TIO Ni e 5 PRODUCT OVERVIEW 5 COMPONENTS AND FEATURES Dd rse ree nsen EPP 5 HARDWARE INS TALIA Bae oes dose 5 2 THE SOFTWARE INSTALLATION abe a 6 FOR WINDOWS 2000 XP USERS cccccceccccsecccceccccecccuccccucccccuccccaecccacccueseceuccesuecesausceuscceueseeaeseeaes 7 WINDOWS VISTA USERS a a N ee awe 20 3 WEB MANAGEMENT INTERFACE wz ccccccssscccssscccsssccccscccccsccscccscccccscccccccscccseccces 29 FOR WINDOWS 2000 XP USERS cccccccccccecccccccccccccccccccscccceccceecccaecccusccuscceeecesucesausceuseceuecens 29 FOR WINDOWS VISTA USERS u cccccscccceccccccccecccccccccccccccesccuusccecccaeccsesccaeccesceaeseueseceeceaecesssceaesenes 20 WEBJIPAGEJIDESCRIPTION2 Med p mem ocd ne SUE LE LDAP ee 30 4 TRHOUBLESHOOTING reati ta vx ES ORE ERR Eso EE E PER eR ORE pP Es REPE Ree Reo veis ed co Pre aee exe 33 FREQUENTLY ASKED QUESTIONS cccccsecccccccccecccceccccccccusccueccecuececaesecuccsesces
9. P Server InstallShield Wizard InstallShield Wizard Complete Setup has finished installing USB aver IP Server on your computer 5 Once the installation process has been completed you will need to go to the Network window to configure the Network USB over IP Server To do so click on your screen and select Network from the right hand side of the menu 21 Internet Internet Explorer s E mail J A Windows 4 Welcome Center Documents Windows Update Pictures aN PSWizard Music ET Windows Mobility Center 2N Recent Items 5 Windows Meeting Space Computer Connect To Control Panel Default Programs Administrative Tools Printers 6 The Network USB over IP Server icon will appear under other devices on the Network window If the Network USB over IP Server or any other network icons in the network window do not appear then a message will show up across the network screen indicating that Network Discovery is turned off 7 57 p E d Network discovery and file charting ace tamed off Network computer and devices are nct vitible Cbck to change hams Category riori histo atio E Pacta pus y ge Ec di rub 7 To turn Network Discovery on right click on the message then select Turn on network discovery and file sharing from the list Once Network Discovery has been enabled you will be able
10. e the USB device functions normally when you plug it into your computer via USB cable e f the USB device such as USB printer or multi functional printer requires a driver please make sure you have installed it on the computer you wish to use Rebooting your computer after installing USB device driver might also help e Although the Network USB over IP Server could work with a very wide spectrum of USB devices it still has limited support on some USB devices Please refer to the supported device list for details 2 How can t see any servers my Network USB over IP Server listing window after installing it e Please make sure that all of your Network USB over IP Servers are correctly connected to your network Also certain anti virus programs come with firewall functions that might prevent the Network USB over IP Server setup utility from accessing the network Please make sure the Network USB over IP Server setup utility is not being blocked by your anti virus program 3 The connected USB devices are disconnected after my computer wakes up from the computer stand by e The connected devices will automatically be released for other network users in case you forget to release them Please reconnect the USB devices again after your computer wake up 33
11. he USB over IP Server setup utility Select the printer from the list and click on the Connect button 11 2 3 gt USB over IP Server View Help a USB over IP Server8810C0 192 168 0 21 MI HEWLETT PACKARD DESKJET 948C Note If your printer does not show up on the list please try to disconnect and reconnect the printer to the USB port of the Network USB over IP Server Also please make sure the Network USB over IP Server and your printer are powered on The printer will be detected as if it was plugged directly into your computer 1 Found New Hardware HP Photosmart C3100 series 420PM If this printer is connected to your computer for first time then you will need to complete the setup wizard for the printer software and driver installation Please follow the wizard to setup the printer Make sure you have the correct CD or drivers for your printer and follow the on screen steps in the wizard Once the wizard is completed you will be able to use the printer as if it was directly connected to your computer 12 Found New Hardware Wizard This wizard helps you install software for Photosmart C3100 series If your hardware came with an installation CD ue or floppy disk insert it now What you want the wizard ta do C Install fram list or specific location Advanced Click Next to continue Note Please refer to your printer user manual on how to
12. inters MFP and USB storage devices to your network allowing all network users access to these USB devices remotely Network Management The Network USB over IP servers support the WEB management which remote management and a warning A standard WEB server is permanent on these Network USB over IP Servers Any standard WEB browser can be used to access and manage these Network USB over IP servers Components and Features 1 USB2 0 Port Network USB over IP server e 1 USB2 0 port High speed e Fast Ethernet network port RJ 45 for 10Base T or 100Base TX e 1 LED to indicate Status 2 LED s to indicate 10 100M link lights e One Setup CD for Windows 2000 XP Vista User s Guide e One external AC power adapter e Built in Reset Button Before you start you should prepare B One Windows 2000 XP Vista computer with CD ROM drive m One USB devices with USB port Hardware Installation Make sure that your USB devices are switched off and that the Network USB over IP Server s power adapter is disconnected 1 Connect your USB device to the USB port of the Network USB over IP Server 2 Connect the Network USB over IP Server to the router or switch HUB with the Ethernet cable Ethernet Cable 3 Connect the power adapter to the Network USB over IP Server When the Link LED lights up the Network USB over IP Server is correctly connected to the network Ethernet Cable Power Adapter 2 The Software Installation
13. n The USB device will then show up on the Network USB over IP Server utility as a green icon The green icon indicates that the USB device is ready to be connected If for any reason the USB device does not show up please click the Search button to refresh the list gt USB over IP Server File View Help Pic uem Flesh Hise Note If your USB device does not show up on the list please try to disconnect and reconnect the USB device to the USB port of the Network USB over IP Server Also please make sure the Network USB over IP Server and your USB device are powered on 2 Select the USB device that you will want to connect and click on the Connect button at the bottom gt USB over IP Server View Help 3 Once the USB device has been connected the green 8 will turn orange to indicate that the connection has been established The USB device now becomes available on your computer and you can use this USB device as if it was directly connected to your computer 10 gt USB over IP Server View Help Ej USB over IP Sereer 8810CD 192 168 0 21 Generic Flash Disk Connecting to an USB Printer or Multi functional Printer 1 Connect the USB cable on your printer or multi functional printer to the Network USB over IP Server and make sure your printer is powered on You will then see the connected printer show up in t
14. n no longer stay connected to your computer however you may reconnect the USB device again once the icon becomes green H 14 O USB over IP Server Help Ej USB over IP Server 192 168 0 26 c Flash Disk Request to Disconnect 1 If the USB device is being used by another computer on your network red 1 will be displayed in front of the USB device name You will not have the option to disconnect the USB device however you may send a courteous message to request that the other user disconnect release the USB device 15 gt USB over IP Server File View Help Search Connect 2 To send the courteous message right click on the USB device and select Request Disconnect A message will then be sent to the user requesting that they disconnect from the USB device 16 2 USB over IP Server File wiew Help USB over Server asc 192 169 021 Generic Flash Dig Note If the occupying user denies this request then you will not be able to send any further requests to the same user for 5 minutes This is to prevent any user from flooding the occupying user will multiple requests within a short period of time The chart list below shows what each colored icon means in the configuration software USB device is available and ready to be connected The device is not connected but has some type of problem such as out of ink USB device has been established and is now connected
15. nected USB devices and IP address information The interface is limited to support up to 4 USB devices USB over IP Server Server Information Device Information TCP IP This page displays the general server information of the USB server Server Information server Name USB over IP Server 3810cC0 Firmware Version 3 100 061 MAC Address 00 40 01 88 10 c0 Server Up Time 376 Ethernet Link 11 USB root port op made 1 Setup You can add or change any existing password on the Network USB over IP Server in this window By default the Network USB over IP Server does not come with a default password You can change the network settings according to your network specification If you would like to give the Network USB over IP a static IP address you will need to Disable DHCP in the DHCP Setting menu Once DHCP is disabled enter the desired IP address on the IP 30 address field along with the subnet mask and click Save amp Restart button to reboot the Network USB over IP Server Please note that if the Network USB over IP Server has a set password you will need to enter it into the password field box USB over IP Server o This setup page allows you to configure general system settings of the USB server Server Settings server Name USB over IP Server 88 Loco Administrator s Password Current Password Must provide If Available Mew Password Confirm New Password Save amp Restar
16. rmance of your computer and the number of active Network USB over IP Server on your network it may take up to 3 minutes for your computer to recognize all Network USB over IP Server This is because Windows Vista needs time to probe the entire network before it loads the necessary driver to run the Network USB over IP Server Once the driver has been loaded the option to Connect to the USB device will be made available when right clicking an USB device e 3 Generic Flash Disk 8810c0 m rug View device webpage ts not installed or Waiting for booting to finish Create Shortcut Properties 28 3 WEB Management Interface For Windows 2000 XP Users To Access WEB management interface in Windows 2000 XP in the USB over IP Server setup utility select the USB over IP Server on the list and click on the Config button gt USB over IP Server View Help Pic Flash ok For Windows Vista Users To Access WEB management interface in Windows Vista in the Network window right click on the USB over IP Server icon and select View device webpage 20 g y USB over IP Server 8810cQ L T 192 168 0 26 Uninstall View device webpage Create Shortcut Properties WEB Page Description The left panel of the WEB management interface provides a list of different options to choose from Status Displays the current Network USB over IP Server con
17. secceaucesaucceuseceuecens 33 Trademarks Windows 2000 XP Vista are registered trademarks of Microsoft Corp All other brands and product names are trademarks of their respective companies Copyright No part of this publication may be reproduced in any form or by any means or used to make any derivative such as translation transformation or adaptation without the express written consent of the manufacturer as stipulated by the United States Copyright Act of 1976 FCC Warning This equipment has been tested and found to comply with the limits for a Class B digital device pursuant to subpart J of Part 15 of the FCC Rules These limits are designed to provide reasonable protection against harmful interference when the equipment is operated in a commercial environment This equipment generates uses and can radiate radio frequency energy and if not installed and used in accordance with the instruction manual may cause harmful interference to radio communications Operation of this equipment in a residential area is likely to cause harmful interference in which the user will be required to correct the interference at their own expense All contents are subject to change without prior notice C FC Part No US8810U2 V1 0 1 Introduction Product Overview The Network USB over IP Servers enhance capability by letting you place your USB devices at convenient locations directly on the Ethernet network It s designed to connect your USB pr
18. t Misc Allow you to restore the Network USB over IP Server back to factory default And the firmware link will allow you to upload the latest firmware on the Network USB over IP Server Click on Browse to specify the firmware location on your computer Once the location path of firmware has been set click Firmware Upgrade to begin the update Please note that if the Network USB over IP Server has a set password you will need to enter it into the password field box 3l USB over IP Server Factory Default Firmware Upgrade Click Factory Default then OK to reload all default settings in the USB server Warning All current settings will be erased e Click Firmware Upgrade to browse to your firmware directory and reload the USB server with new firmware Confirm Password Password Must provide If Available Restart The Restart window will allow you to reboot the Network USB over IP Server Please note that if the Network USB over IP Server has a set password you will need to enter it into the password field box USB over IP Server This page allows you to restart the USB server Restart The USB Server Do you want to save settings and restart the USB server now Confirm Password Password Must provide If Available 32 4 Troubleshooting Frequently Asked Questions 1 How come can t connect to my USB device to my computer through Network USB over IP Server e Make sur
19. the menu Once the USB device has been disconnected it will no longer be connected to your computer and you can unplug the USB cable of the USB device from the Network USB over IP Server ay USB TO IDE 8810c0 m di View device webpage My Computer Disconnect Create Shortcut Properties If you would like to reconnect the USB device simply right click on the USB device icon And then select Connect again to establish the connection Request to Disconnect 1 If you would like to use an USB device that is being occupied by another user you may send a courteous message asking the user to disconnect release the USB device You may do this by right clicking on the USB device icon and then you can select Request Remote to Disconnect A message will then be sent to the user requesting that they disconnect from the USB device e 3 Generic Flash Disk 8810c0 m ag View device webpage Create Shortcut Properties Note If the occupying user denies this request then you will not be able to send any further requests to the same user for 5 minutes This is to prevent any user from flooding the occupying user will multiple requests within a short period of time Remark After a system reboot you might not be able to connect to any USB device for a short period of time When right clicking on an USB device you will see the following message instead of the option to Connect 2l Depending on the perfo
20. ver you can upgrade the firmware and reboot the Network USB over IP Server 19 lt gt Server Setting Network Settings Server Name USB over IP Server 8810C0 IP Address Subnet Cancel Backup Firmware Update Firmware Change Password Heset Server For Windows Vista Users 1 Insert the setup CD into your computer A welcome screen should appear with a menu of options including the option to install the proper Network USB over IP Server software access the User Manual or Exit out of the welcome menu 2 Click OK to start the installation process Choose Setup Languaqe El UE Select the language for this installation from the choices below English United States 3 During the driver installation a Windows Vista security message will appear Select Install this driver software anyway to continue 20 em tm UE hl Windows Security t3 Windows can t verity the publisher of this driver software isl J Don t install this driver software You should check your manufacturer s website for updated driver software for your device gt Install this driver software anyway Only install drrver software obtained from your manufacturer s website or disc Unsigned software from other sources may harm your computer or steal information iw See details 4 Click on Finish to complete the installation process USB over I
Download Pdf Manuals
Related Search