Home

Draytek Vigor2130

1. IKE phase 1 proposal Automatic v i IKE phase 2 proposal Automatic PES Perfect Forward Secrecy F Enable it and give it a name In this example the profile name is Demo Enter 0 0 0 0 in the Remote IP field Select Aggressive Mode as IKE phase 1 mode Setup a pre shared key which must be the same as in Vigor2820 Setup the Local Identity and Remote Identity which are for Vigor2130 and Vigor2820 respectively During IPSec Aggressive mode negotiation the VPN client must send its identity to the VPN server for verification The VPN client may also verify the identity of the VPN server which is optional As VPN client Vigor2820 don t verify the identity of VPN server So in this example we just setup vigor2820 as the identity of Vigor2820 Enter Vigor2130 s private network in the Local Network Mask field Enter Vigor2820 s private network in the Remote Network Mask field Use default value Automatic for IKE phase 1 and phase 2 proposals After the VPN is connected you can monitor the status 50 Vigor2130 Series User s Guide Vigor2130 Series User s Guide VPN and Remote Access gt gt LAN to LAN VPN Site to Site Tunnels IPSec Name Endpoint in Status 3DES CBC 192 Demo 172 171 186 STATE_AGGR SHA1 MODP 1024 Add Tunnel Create a LAN to LAN profile VPN and Remote Access gt gt LAN to LAN Profile Index 1 1 Commo
2. Name None Enable Fj Source IP Any Any Time None New Time Object Filter Https oO Status Commtouch Child Protection Select AIl Clear AIl Uncategorised Sites Alcohol And Criminal And 3 Hate And 0O Tobacco O Activity C Gambling 0O Intolerance C Megal Drug Pornography And O Nudity O Soniy C Violence Weapons O School Cheating C Sex Education C Tasteless Child Abuse Images Leisure Select All Clear All C Entertainment C Games O Sports Leisure And C Travel F a C Fashion And Beauty Business Select All Clear All C Business C Job Search C Web Based Email Chating Select All Clear All C Chat CO Instant Messaging Computer Select All Clear All io Forums And Computers And Streaming Media E Anonymizers Newsgroups Technology C Down sites CO And Downloads e Search engines a C Phishing And Fraud And Portals O Social Networking O Spam sites C Malware C Botnets C Hacking CO llegal Softwares Information Security Peer to Peer Other Select All Clear All Advertisement And Dating And Fi Pilipa Arts O Transportation CO Compromised F marita Health And i C Education C Finance CI Government F Medicine C News Non profits And z 2 F NGOs C Personal Sites Politics Real Estate O Religion Fi a C Shopping Translators C General O Cults Greeting Cards C Image Sharing C Network Errors C Par
3. cccccccccccccccccccccccececccccuecececucceaeuecscaeaeuenecsecuausecscauauaeserstauaenenenetes 267 Bl GO Oy Ee OO E E E AEE TE T A E E A E E E 268 4 16 6 Traffic OVErViICQW c cccccccccceccececcecsccucsccucsccusecaucecuucacsecacsececacsecenseausecausecsusecsucenseaensees 269 4 16 7 Detailed Statistics ccccccccccccccccecceceececceccececeucceeeececueeeeuecaecaesataeeaeaeeeeeaesenaeeeeeanseeaeess 270 4 16 8 MAC Address Table cccccccccccececcccecececcccececcccccecenececceaeuenecsccuaunecscauuuenecstauaenenscanas 2 2 4 16 9 DAGP Table i s iesainnivwnidvnitenntadiasancdnednoaiiie beuntuddsdunandnieswduihitwavdwedtaenGudansusiwadiesuanedienutuddears 273 4 16 10 Data Flow MOnitor 0 ccc cc ccccececececececccececececeucauauauauauauauauaeneneneneneauauauausuaeauaenenenenes 274 BV Os Wl LEC Alt E E veieatatecne ss I aaceanan seb E A E A 275 4 16 12 Sessions Table cc cece ccc ec cccccecsceccececececcccucucecscuccucusecseaucusecscueauausecseauausenscauseauauseneeas 276 4 16 13 Ports State ease stectaseeccscteancgbaneceisettacticdatmacsieatacce ans aemurdiaeadeasaaa eeseowacsadeewessisesseensiounieeance 277 Trouble SHOOTING cccccceseeeneeceneeceneecenseceseecensecenescaseecaeesenseseneesenees 279 5 1 Checking If the Hardware Status Is OK or NoOb ccccccccccceeecseeseeeeeeeeeeesaeeeseeeeeeseuaaeeeeeeeess 279 5 2 Checking If the Network Connection Settings on Your Computer Is OK or Not
4. 3 Log out Vigor2130 Web Configurator Application Note FAQ Product Registration All Rights Reserved 4 The following window will be open to ask for username and password Type the new user password in the filed of Password and click Login Password Copyright DrayTek Corp All Rights Reserved Dray Tek Dray Tek 256 Vigor2130 Series User s Guide 5 The main screen with User Mode will be shown as follows Vigor2 130 Series High Speed Gigabit Router System Status a Auto refresh C _Refresi Quick Start Wizard Model Vigor2130Vn Online Status Firmware Version v1 5 2_RC3 gt WAN Build Date Time Fri Mar 23 19 58 16 CST 2012 gt LAN System Date Fri Apr 6 02 59 17 2012 gt NAT System Uptime Tdays 23 41 42 gt Bandwidth Management gt Applications p Certificate Management System gt Wireless LAN CPU Usage 50 0 Connection Mode Static gt USB Application Memory Usage 35276K 62784 K 56 19 Link Status Connected gt VoIP i Ci MAC Address 00 50 7F C9 59 79 gt IPv6 Cached Memory 12972 K 62784 K IP Address 172 16 3 103 4 nia sine IP Mask 255 255 0 0 Ae Halet LAN IPv6 Address fe80 250 7fff fec9 5979 64 Linl MAC Address 00 50 7F C9 59 78 Default Gateway 172 16 1 1 Application Note IP Address 192 168 1 1 Primary DNS 168 95 1 1 FAQ IP Mask 255 255 255 0 Secondary DNS Product Registration IPv6 Address fe80 250 7fff fec9 5978 64 Link DHCP Ser
5. l Access into Vigor2130 web configurator 2 Goto Applications gt gt Dynamic DNS and select one of the service provider in the list Applications gt gt Dynamic DNS Dynamic ONS Configuration Enable Dynamic ONS service Provider dyndns org k Domain name mypersonaldomain dyndns org Username myusername Password Corre IP source My WAN IP Check IP change every 10 minutes w Force IP update every Here we take dyndns org as an example to setup the function 3 Input Domain name Username and Password which required by the DDNS provider 4 Select the IP source as you need If Vigor2130 is behind another NAT device you should choose My Internet IP to discover a real public IP address for the DDNS service To configure freedns afraid org service is different than the other well know free DNS service providers You have to login with your account and password on its website to copy a string which generated in the URL field and lead by a question mark The next is the step by step to show you how to setup it on Vigor2130 1 Go to http freedns afraid org dynamic and login with your normal username and password for the FreeDNS service FreeONS Login UserID m 2 Click Direct URL on the domain you would like to set to your WAN IP address Remember Me Dray Tek 64 Vigor2130 Series User s Guide 1 dynamic update candidates A records chickenkiller com add odin chick nkiller com Direc
6. 190 Vigor2130 Series User s Guide Mone WEP WPA PSK WPA RADIUS WPS Each encryption mode will bring out different web page and ask you to offer additional configuration Click OK to save the settings Wireless Security Configuration For the security of your system choose the proper encryption for data transmission Different encryption mode will bring out different setting encryption ways Wireless Security Configuration Encryption WEP WPA PSK WPA RADIUS WPS None The encryption mechanism is turned off WEP Accepts only WEP clients and the encryption key should be entered in WEP Key Wireless Security Configuration Encryption WEP Configuration Default Key Keyl Key2 Keys Key4 Authentication Mode OPEN OK Available settings are explained as follows Item Description Default Key All wireless devices must support the same WEP encryption bit size and have the same key Key1 Key4 Four keys can be entered here but only one key can be selected at a time The format of WEP Key is restricted to 5 ASCII characters or 10 hexadecimal values in 64 bit encryption level or restricted to 13 ASCII characters or 26 hexadecimal values in 128 bit encryption level The allowed content is the ASCII characters from 33 to Vigor2130 Series User s Guide 191 Dray Te k Dray Tek 126 except and Authentication Mode Choose OPEN or SHARED as the authentication mode OPEN Set
7. 280 5 3 Pinging the Router from Your Computer ccccccsseeeeeeeeeeeeceeeeeseeeeeeeseeeeeeeeeeeessuaaseeeeeenes 282 5 4 Checking If the ISP Settings are OK or NoOt cccccccseecceceeeeeeseeeeceeseeeeeseeeeesseeeeesseaeeeeeas 283 5 5 Forcing Vigor Router into TF TP Mode for Performing the Firmware Upgrade 284 5 6 Backing to Factory Default Setting If Necessary 00 0 ce eccccceecccceseeeceeeeeeseeeeeeeseeeseesaeeeeeas 287 5 7 Contacting Your Dealer ssena niaaa E EEEE E E E a EEEE 288 Dray Tek viii Vigor2130 Series User s Guide Preface The Vigor2130 series are the routers with high speed in data transmission through WAN port and LAN ports With hardware NAT acceleration the rate of Vigor2130 series can be ideal for multi media application With the development of NGN Next Generation Network you may recently hear the news about FTTx deployment in your local area or even have already subscribed the unbundling last mile service e g VDSL2 from local ITSP for FTTx As adopting FTTx the main question for end users is whether your legacy router could fully utilize its bandwidth or not For example you purchase a 120 Mbps Internet connection from your ISP but your existing router cannot support 90 Mbps throughput That s why DrayTek launches Vigor2130 series High speed Gigabit router perfectly complied with VDSL2 environment including Vigor2130 Vigor2130n and Vigor2130Vn for speed wanted custo
8. For additional security of wireless access the Access Control facility allows you to restrict the network access right by controlling the wireless LAN MAC address of client Only the valid MAC address that has been configured can access the wireless LAN interface By clicking the Access Control a new web page will appear as depicted below so that you could edit the clients MAC addresses to control their access rights deny or allow Wireless LAN gt gt Access Control Wireless MAC Address Filter Configuration SSID 1 SSID 2 SSID 3 SSID 4 Delete MAC Address Note Each SSID up to 64 MAC address at one time Add a Mew Entry Available settings are explained as follows Item Description Filter Type Choose the rule for the MAC addresses displayed in this page Allow List all the MAC address of wireless clients listed here are allowed to do wireless connection Deny List all the MAC address of wireless clients listed here will be blocked Add a New Entry Add anew MAC address into the list Delete Delete the selected MAC address in the list This button will appear only an entry of MAC Address has been typed Delete MAC Address 00 20 00 05 30 12 Add a New Entry Click OK to save the configuration Dray Tek 196 Vigor2130 Series User s Guide 4 10 4 Station List Station List provides the knowledge of connecting wireless clients now along with its status code Wireless LAN gt gt Station Lis
9. Item Description SLA Length It is used by an individual organization to create its own local addressing hierarchy and to identify subnets TSPC Tunnel setup protocol client TSPC is an application which could help you to connect to IPv6 network easily Please make sure your IPv4 WAN connection is OK and apply one free account from hexage http go06 net 4105 register asp before you try to use TSPC for network connection TSPC would connect to tunnel broker and requests a tunnel according to the specifications inside the configuration file It gets a public IPv6 IP address and an IPv6 prefix from the tunnel broker and then monitors the state of the tunnel in background After getting the IPv6 prefix and starting router advertisement daemon RADVD the PC behind this router can directly connect to the Internet IPv6 gt gt WAN General Setup WAN IPv6 Configuration Pv Connection Type TSPC User Name Passward Confirm Password Tunnel Broker broker freeneth net Tunnel mode Pvb in IPy4 Tunnel Auto reconnect Delay 0 Keepalive Yes No Keepalive Interval Prefix Length Interface Note Please setup Pvb WWAN as Link Local Only and IPv4 WAN as DHCP for 6rd connection Available settings are explained as follows Item Description User Name Type the name obtained from the broker Vigor2130 is a default username applied from http go6 net 4105 register asp It is su
10. License Information e Provider Activate Please Activate Commtouch or BPjM license first 2 Click Activate to activate the WCF service from MyVigor web site After you registered current router and activate the BPjM service please return to web configurator of Vigor router Refresh this page and the following screen will appear CSM gt gt Web Content Filter License Information e Provider BPM Activate Status Source Filter Https Each item is explained as follows Item Description Enable Check this box and click OK to enable the button of Add a New Entry License Information Click it to display the BPjM license information Activate Click it to activate the WCF service Name Display the profile name for WCF service Dray Tek 138 Vigor2130 Series User s Guide Status Display if such profile is enabled or not If yes a green check mark will be shown here Source Display the range for source IPs Filter Https Display the HTTPS for filtering Such information is supported by Commtouch only Time Display the used time object 3 Check the box of Enable and click OK The Add a New Entry button will be available for you to create a new entry CSM gt gt Web Content Filter Enable License Information e Provider BP M Activate i Name i Status i Source Filter Https i i Time Add a New Entry 4 Click Add a New Entry to open the following page and type all the required infor
11. Negotiation IPSec security methods including Authentication Header AH or Encapsulating Security Payload ESP for the following IKE exchange and mutual examination of the secure tunnel establishment 174 Vigor2130 Series User s Guide Automatic i Automatic ides aes any aes 128 aes 192 aes 256 4 8 4 Remote Dial in Status You can find the summary table of all dial in user status VPN and Remote Access gt gt Remote Dial in Status Auto refresh IPSec Site to Client Status PPTP Site to Client Status User Name Interface Remote IP Local IP Login Time Rx bytes Tx bytes Mo PETE Ghents Available settings are explained as follows Item Description Auto refresh Check this box to make the system refresh this page automatically Refresh Click this button to refresh the page immediately Client Display the name of the VPN IPSec Mobile client Identity Display the remote ID of the VPN client Endpoint Display the IP address of the VPN client IKE Status Display the status of the phase 1 ISAKMP key exchange IKE Alg Display the encryption and authentication algorithm used during phase 1 of the VPN connection Establishment The algorithm is used during exchange of key exchange ESP Status Display the status of the phase 2 IPSec ESP key exchange ESP Alg Display the encryption and authentication algorithm used during phase 2 of the VPN connection Establishment This algorithm is used for transporting dat
12. Note Filesystem with Linux ext4 exts format will have better performance and stability But you will need extra utility ta access ext fexta partition in Windows After clicking OK the following confirmation dialog will appear P 1 An Internet connection is required ta download filesystem i Utilities l 2 All data in this partition will be LOST Are you sure you want to apply the operations ORK E Cancel Simply click OK to continue the procedure D ray Tek 204 Vigor2130 Series User s Guide 4 11 3 File Explorer To review the content of USB diskette via USB port of the router please open USB Application Explorer to browse the files USB Application gt gt File Explorer File Explorer Current Path Hame autobuild Adownloads reeswan tar gz htpO tar itp tar bainua _opkg install Csh code shred Htransmission Select a file Oooo os Upload Rename a x MM RX MM KX M eee ee Note 1 Please do not upload file of which the size is more than 20M 2 Only English file namefolder is supported Available settings are explained as follows Item Refresh Back a Create Current Path Upload Vigor2130 Series User s Guide Description Click this icon to refresh files list Click this icon to return to the upper directory Click this icon to add a new folder Display current folder Click this button to upload the selected file to the USB
13. Type command for Windows 95 98 ME or emd for Windows NT 2000 XP Vista The DOS command dialog will appear w Command Prompt Microsoft Windows AFP Version 5 1 2688 lt C gt Copyright 1985 2001 Microsoft Corp D Documents and Settings fae ping 192 168 1 1 Pinging 192 168 1 1 with 32 bytes of data Reply from 192 168 1 1 bytes 32 time lt ims TTL 255 Reply from 192 168 1 1 bytes 32 time lt ims Reply from 192 168 1 1 bytes 32 time lt ims Reply from 192 168 1 1 bytes 32 time lt ims TTL 255 Ping statistics for 192 168 1 1 Packets Sent 4 Received 4 Lost A loss Approximate round trip times in milli seconds Minimum ms Maximum ms Average Ams D Documents and Settings fae gt _ Type ping 192 168 1 1 and press Enter If the link is OK the line of Reply from 192 168 1 1 bytes 32 time lt Ims TTL 255 will appear If the line does not appear please check the IP address setting of your computer For Mac OS Terminal 1 2 e 4 Dray Tek Double click on the current used Mac OS on the desktop Open the Application folder and get into Utilities Double click Terminal The Terminal window will appear Type ping 192 168 1 1 and press Enter If the link is OK the line of 64 bytes from 192 168 1 1 icmp_seq 0 ttl 255 time xxxx ms will appear 282 Vigor2130 Series User s Guide 806 Terminal bash 80x24 Last login Sat Jan 3 B2 24 16 on ttypi Welcome ta Darwin Vigo
14. Viaor2 of Vigor2130 se High Spend oie i a ries f CELOELELELLE flfiarprs q Your reliable networking solutions partner User s Guide V2 1 Vigor2130 Series High Speed Gigabit Router User s Guide Version 2 1 Firmware Version V1 5 2 Date 21 05 2012 Dr ay Tek ii Vigor2130 Series User s Guide Copyright Information Copyright Declarations Trademarks Copyright 2012 All rights reserved This publication contains information that is protected by copyright No part may be reproduced transmitted transcribed stored in a retrieval system or translated into any language without written permission from the copyright holders The following trademarks are used in this document Microsoft is a registered trademark of Microsoft Corp Windows Windows 95 98 Me NT 2000 XP Vista and Explorer are trademarks of Microsoft Corp Apple and Mac OS are registered trademarks of Apple Inc Other products may be trademarks or registered trademarks of their respective manufacturers Safety Instructions and Approval Safety Instructions Warranty Be a Registered Owner Firmware amp Tools Updates Vigor2130 Series User s Guide Read the installation guide thoroughly before you set up the router The router is a complicated electronic unit that may be repaired only be authorized and qualified personnel Do not try to open or repair the router yo
15. Auto retresh 7t ESP Status Alg ESP_3DES_HMAC_SHA1 STATE_QUICK R2 60 92 Name Endpoint Demo 1 72 17 1 186 Add Tunnel VIDS5 MODP1024 Vigor2130 Series User s Guide 43 Dray Tek VPN configuration on Vigor2820 l Create a LAN to LAN profile VPN and Remote Access gt gt LAN to LAN Profile Index 1 1 Common Settings Profile Name C bee Call Diractic Bota Dial out 0 Dial in niofile Ki Always on Idie i i second s VPN Die Our Through WAN First Yi C Enable PING to keep alive Netbios Naming Packet Pass O Block PING to the IP Multicast via VPN Opass Block for some IGMP IP Camera DHCP Relay etc 2 Dial Out Settings Type of Server I am calling Username Tog Password PPP Authentication FAF CHAP VI Compression Server IP Host Name for VPN IKE Authentication Method sucha avtek com or 123 45 67 89 pre Shared Key ie eee IKE Pre Shared Key 8 Digital Signature x 509 IPSec Security Method 3DES with Authentication Index 1 15 in Schedule Setup L amp E dL lel 3 Dial In Settings Allowed Dial In Type Bete Username IPSec Tunnel sini L2TP with IPSec Policy None v CORP Essien on O off IKE Authentication Method d Specify Remote VPN Gateway Pre Shared Key Peer VPN Server IP i or Peer ib e C Digital Signature X 509 IPSec Security Method Medium AH High ESP DES 3DES AES 4 TCP IP Network Settings My WAN IP 0 0 0 0 RIP Direction Di
16. WAN IP Configuration Connection Type PPTP Settings Username Password Server Address WAN IP Network Settings IP Address Subnet Mask Redial Policy MTU Size Clone MAC Address Enable MAC Address 172 16 5 102 255 255 0 0 Always On Clone MAC Address Available settings are explained as follows Item User Name Password Server Address WAN IP Network Settings IP Address Dray Tek Description Assign a specific valid user name provided by the ISP Assign a valid password provided by the ISP Specify the IP address of the PPTP server You can choose Static IP or DHCP as WAN IP network setting Type the IP address if you choose Static IP as the WAN IP network setting 22 Vigor2130 Series User s Guide Item Subnet Mask Redial Policy Idle Time Out MTU Size Enable Clone MAC Address Description Type the subnet mask if you chose Static IP as the WAN IP If you want to connect to Internet all the time you can choose Always On Otherwise choose Connect on Demand Connect on Demand Always On Set the timeout for breaking down the Internet after passing through the time without any action It means Max Transmit Unit for packet The default setting will be specified by the system automatically Therefore keep this field in blank The router will detect the MAC address automatically Or check the box to enable MAC address cloning It is available when the box of Enable is
17. mode operation If your router can be under an environment with high speed NAT the configuration provide here can help you to deploy and use the router quickly The first screen of Quick Start Wizard is welcome page please click Next Quick Start Wizard Welcome to the Quick Start Wizard The next steps will guide you through a basic setup of the device If you want more advanced setup you should consider setting the device up manually Step 1 Setup the Password Step 2 Setup the Timezone Step 3 Setup the Internet connection WAN Step 4 Setup the Wireless Wi Fi Step 5 Save the configuration Vigor2130 Series User s Guide 17 Dray Te k 2 3 1 Setting up the Password The first screen of Quick Start Wizard is entering login password After typing the password please click Next Quick Start Wizard System Password New Password Confirm Password 2 3 2 Setting up the Time Zone On the next page as shown below please select the Time Zone for the router installed and specify the NTP server s Then click Next for next step Quick Start Wizard Time Configuration Time Zone Dray Tek 18 Vigor2130 Series User s Guide 2 3 3 Setting up the Internet Connection On the next page as shown below please select the appropriate connection type according to the information from your ISP There are five types offered in this page Each connection type will bring out different web page Quick Star
18. s Guide 103 Dray Tek sA LAN gt gt Static Route Static Route Configuration Index Verify current routing table Setto Factory Default Viewing Routing Table Destination Address Gateway Interface Status 192 168 170 0V255 255 255 0 192 168 1 2 LAN Ti 211 100 88 0 255 255 255 0 192 168 1 3 LAN vi 4 2 7 Police Route Go to LAN to open setting page and choose Police Route LAN gt gt Policy Route Policy Route Configuration Set to Factory Default Clear Routing Cache Add Available settings are explained as follows Dray Tek Item Set to Factory Default Clear Routing Cache Index Source Address Destination Address Gateway Interface NAT Status Add Description Click this link to return to the factory default settings Click this link to clear all the routing cache The number 1 to 10 under Index displays current policy router Display the source address of the policy route Display the destination address of the policy route Display the gateway IP address for the policy route Display the interface used by such policy route Display if NAT is done for source subnet or not Display the status of the static route Click it to add a new static route 104 Vigor2130 Series User s Guide To add a new police route please click Add to open the following page LAN gt gt Policy Route Add Policy Route Enable Source IP Address subnet Mask Destination IP Address
19. 4 16 8 MAC Address Table The MAC Address Table contains up to 8192 entries and is sorted first by VLAN ID then by MAC address Each page shows up to 999 entries from the MAC table default being 20 selected through the entries per page input field When first visited the web page will show the first 20 entries from the beginning of the MAC Table The first displayed will be the one with the lowest VLAN ID and the lowest MAC address found in the MAC Table The Start from MAC address and VLAN input fields allow the user to select the starting point in the MAC Table Clicking the Refresh button will update the displayed table starting from that or the closest next MAC Table match In addition the two input fields will assume the value of the first displayed entry allowing for continuous refresh with the same start address The button gt gt will use the last entry of the currently displayed VLAN MAC address pairs as a basis for the next lookup When the end is reached the text no more entries is shown in the displayed table use the l lt lt button to start over Dray Tek 272 Vigor2130 Series User s Guide Diagnostics gt gt MAC Address Table MAC Address Table Auto refresh L Start from VLAN and MAC address 00 00 00 00 00 00 Port Members Type MAC Address WAN LAN1 LAN2 LAN3 LAN4 Dynamic 00 0E A6 2A D5 A1 y Dynamic 00 50 7F 38 60 C5 Dynamic 00 06 1B DO DF Al Dynamic 00 0C 6E E7 79 99 Dynamic 00 O0F A6 16 0
20. 4 7 7 Short Message Service The function of Short Message Service is that Vigor router sends a message to user s mobile through specified service provider to assist the user knowing the real time abnormal situations Vigor router allows you to set up to 8 SMS profiles which will be sent out according to different conditions Applications gt gt SMS5 SMS Configuration Index Profile Service Destination Status 1 To add a new SMS profile please click Add to open the following web page Vigor2130 Series User s Guide 167 Dray Te k Dray Tek Applications gt gt SMS Add 5M5 Enable Profile Name Service Username Password Destination Intervaliseconds User defined Message send atest Message Vigor router will keep on sending the last message for lasting 3 hours when meeting with failure f user defined message is empty system will send sms with default event alert message Available settings are explained as follows Item Enable Profile Name Service Username Password Destination Number Quota Sending Interval User defined Message Send a test Message Description Check the box of Enable to enable SMS function Type a name for such SMS profile Use the drop down list to specify the service provider which offers SMS service Type a user name that the sender can use to register to selected SMS provider Type a password that the sender can use to register to selected
21. Cancel Available settings are explained as follows Item Description DSCP Value DSCP means Differentiated Services Code Point It allows you to assign different QoS level for data transmission in network The valued typed here can be used to match the received IPv4 IPv6 value 6 bits against the two DSCP values in QCE Traffic Class Specify traffic class from Low Normal Medium and High Ifyou choose ToS as QCE Type you have to specify priority class from Low Normal Medium and High Bandwidth Management gt gt QoS Control List QCE Configuration QCE Type ToS Priority 0 C ToS Priority 1C ToS Priority 2 C ToS Priority 3 C ToS Priority 4 C ToS Priority 5 C ToS Priority 6 C ToS Priority T C Vigor2130 Series User s Guide 153 Dray Te k Available settings are explained as follows Item Description ToS Priority 0 Class ToS means Type of Service Use the precedence part of IPv4 IPv6 ToS 3 bits as an index to the eight QoS Class ToS Priority 7 Class values in QCE Traffic Class Specify traffic class from Low Normal Medium and High Ifyou choose Tag Priority as QCE Type you have to specify priority class from Low Normal Medium and High Bandwidth Management gt gt QoS Control List QCE Configuration QCE Type Tag Priority Tag Priority 0 Class Normal Tag Priority 1 Class Tag Priority 2 Class Tag Priority 3 Class Tag Priority 4 Class Tag Priority 5 Class Tag Priority 6
22. Connect your PC or network device to the forth LAN port and type the username and password for PPPoE connection mode Dray Tek 38 Vigor2130 Series User s Guide 3 2 LAN to LAN IPSec VPN between Vigor2130 and Vigor2820 using Main mode In this document we will introduce how to create a LAN to LAN IPSec VPN between Vigor2130 and a Vigor2820 using Main mode We use the following scenario WAN 172 17 1 186 E LAN LAN WAN B casat 192 168 1 0 24 192 168 30 0 24 N oe Voorn Vigor 2820 i VPN IPSec ome Case 1 VPN direction from Vigor2130 to Vigor2820 VPN configuration on Vigor2130 l Create a LAN to LAN profile VPN and Remote Access gt gt LAN to LAN Edit VPN Tunnel General Fnabled Name Remote F IKE phase 1 mode Authentication Type Pre Shared Key Confirm Pre Shared Key Local Identity Remote Identity Networks Local Network Mask Remote Network Mask Demo ia iada 186 Nain Mode ka Pre Shared Key eses ts 192 168 30 0 255 255 255 0 192 168 1 0 255 255 255 0 Advanced Security Settings IKE phase 1 proposal IKE phase 2 proposal Automatic s SHAL IDE Automatic Perfect Forward Secrecy ae r Vigor2130 Series User s Guide Enable it and give it a name In this example the profile name is Demo Enter Vigor2820 s WAN IP address in the Remote IP field Select Main
23. D ra y Ti e k 86 Vigor2130 Series User s Guide WAN gt gt VoIP WAN VoIP WAN Connection Type DHCP Settings Router Name Vigor2130 The same as syslog router name Domain Name fe Domain Name are required for some ISPs Mail 5M5 Alert Alert Types Event types WAN UPEI WAN DOWN DO Available settings are explained as follows Item Description DHCP Setting Router Name Type the name of the router Domain Name Type the domain name obtained from the ISP Mail SMS Alert Alert Types Specify the type of the alert mail SMS or Mail and SMS that Vigor system will use to send a message to the user Mail SMS Mail and sis Event types Specify the event when the system must send a notification to the user by mail and or SMS When PPPoE is selected as connection type you need to configure the following settings WAN gt gt VolP WAN VoIP WAN connection Type PPPoE Settings Username Password Confirm Password MTU Size Mail SMS Alert Event types WANUPE wan Down Vigor2130 Series User s Guide 87 Dray Te k Available settings are explained as follows Item Description PPPoE Setting Username Type the name obtained from the ISP Password Type the password obtained from the ISP Confirm Password Type the password again for confirmation MTU Size It means Max Transmit Unit for packet The default setting will be specified by the system automatically Ther
24. Please follow sections below to check your basic installation status stage by stage Checking if the hardware status is OK or not Checking if the network connection settings on your computer are OK or not Pinging the router from your computer Checking if the ISP settings are OK or not Backing to factory default setting if necessary If all above stages are done and the router still cannot run normally it is the time for you to contact your dealer for advanced help 5 1 Checking If the Hardware Status Is OK or Not Follow the steps below to verify the hardware status l as Check the power line and WLAN LAN cable connections Refer to 1 3 Hardware Installation for details Turn on the router Make sure the ACT LED blink once per second and the correspondent LAN LED is bright If not it means that there is something wrong with the hardware status Simply back to 1 3 Hardware Installation to execute the hardware installation again And then try again Vigor2130 Series User s Guide 279 Dray Te k 5 2 Checking If the Network Connection Settings on Your Computer Is OK or Not Sometimes the link failure occurs due to the wrong network connection settings After trying the above section if the link is stilled failed please do the steps listed below to make sure the network connection settings is OK For Windows The example is based on Windows XP As to the examples for other operation systems pl
25. Sevin 22 e m Hmy Documents a g F My Computer My Recent Emy Network Places Documents P RyS COM Lite _a l Anea eC Immm Desktop COMWSnap3o0 9 TeleDanmark E Tools config v2k2_232_config_1 My Documents f y2k6 250_config_1 My Computer File name contig w My Network Save as type Configuration file w 4 Click Save button the configuration will download automatically to your computer as a file named config cfg The above example is using Windows platform for demonstrating examples The Mac or Linux platform will appear different windows but the backup function is still available Note Backup for Certification must be done independently The Configuration Backup does not include information of Certificate Restore Configuration 1 Goto System Maintenance gt gt Configuration Backup The following windows will be popped up as shown below System Maintenance gt gt Configuration Backup Configuration Backup Restoration Backup Please specify a key and click Backup to download current running configurations as a encrypted file Note You will need the same key to do configuration restoreation Restoration Select a configuration file es 2 Please enter the key and click Restore to upload the configuration file key optional OOOO Dray Tek 258 Vigor2130 Series User s Guide 2 Click Browse button to choose the correct configuration file for uploading to the router 3 Cli
26. frames in good and bad packets received RX 512 1023 Bytes Display the number of 512 1023 byte frames in good and bad packets received RX 1024 1526 Bytes Display the number of 1024 1522 byte frames in good and bad packets received RX 1527 Bytes Display the number of 1527 byte frames in good and bad packets received Rx Low Display the low queue counter of the packet received Rx Normal Display the normal queue counter of the packet received Rx Medium Display the medium queue counter of the packet received Rx High Display the high queue counter of the packet received Rx Drops Display the number of frames dropped due to the lack of receiving buffer Rx CRC Alignment Display the number of Alignment errors packets received Rx Undersize Display the number of short frames lt 64 Bytes with valid CRC Rx Oversize Display the number of long frames according to max length register with valid CRC Rx Fragments Display the number of short frames lt 64 bytes with invalid CRC Rx Jabber Display the number of long frames according tomax_length register with invalid CRC Rx Filtered Display the filtered number of the packet received Tx Packets Display the counting number of the packet transmitted Tx Octets Display the total transmitted bytes Tx Unicast Display the show the counting number of the transmitted unicast packet Tx Multicast Display the show the counting n
27. rec printk 242 M e System Time Time tag from the computer which runs the syslog application Router Time Time tag from router ADSL Status Up Speed Down Speed SHR Margin Loop Att Vigor2130 Series User s Guide 261 Dray Tek 4 15 7 Time and Date It allows you to specify where the time of the router should be inquired from System Maintenance gt gt Time and Date Time Information Current System Time Fri Apr 6 03 03 13 UTC 2012 Time Configuration Use Browser Time Use Internet Time Client Time Zone JTC Automatically Update Interval 10 min NTP Servers Delete pool_ntp org time nist gav time_stdtime gov tw Available settings are explained as follows Item Description Time Information Current System Time Display current time in the box Click Inquire Time to get the current time Time Configuration Use Browser Time Click it to use the browser time for Time and Date settings Use Internet Time Client Click it to use the network time for Time and Date Settings If you click it you will need to specify related information such as Time Zone Update Interval NTP server and so on Time Zone Select the time zone where the router is located Automatically Update Interval Specify a time interval for the router to update current time Add NTP server Click the button to add a new NTP server Delete Click this button to remove an NTP server Click OK to
28. source P Source IP Address source IP Mask Dest IP Dest IP Address Dest IP Mask 192 168 1 3 255 255 255 0 letwork 192 168 1 25 255 255 255 0 Available settings are explained as follows Item IP Protocol Value Source IP Vigor2130 Series User s Guide Description When Other is selected for the IP protocol filter you can enter a specific value here The range is 0 to 255 The default value is 255 A frame meeting this ACE matches this IP protocol value Specify the source IP filter for this ACE Any No source IP filter is specified Host Source IP filter is set to Host Specify the source IP 131 Dray Tek address in the source IP Address field that appears Network Source IP filter is set to Network Specify the source IP address and source IP mask in the source IP Address and source IP Mask fields that appear Source IP Address Type the source IP Address here This option is available when you choose Host or Network as source IP Filter Source IP Mask Type the source IP Mask here This option is available only when you choose Network as source IP Dest IP Specify the destination IP filter for this ACE Any No destination IP filter 1s specified Host Destination IP filter 1s set to Host Specify the destination IP address in the destination IP Address field that appears Network Destination IP is set to Network Specify the destination IP address and destination IP mask i
29. subnet Mask Specify Gateway IP Address Primary DNS Server secondary DNS Server Redial Policy MTU Size Fixed IP IPCP Fixed IP Address IPCP Clone MAC Address Enable F Mail SMS Alert Alert Types Eventtypes PPTP v WAN IF Alias Always On we autos Max MTU 1460 Oves No WAN UPO WAN DOWN O OK Available settings are explained as follows Dray Tek Item PPTP Settings L2TP Settings Description Username Type in the username provided by ISP in this field Password Type in the password provided by ISP in this field Server Address Type in the IP address for PPTP L2TP server WAN IP Network Settings Y ou can choose Static IP or DHCP as WAN IP network setting IP Address Type the IP address if you choose Static IP as the WAN IP network setting Subnet Mask Type the subnet mask if you chose Static IP as the WAN IP Specify Gateway IP Address Type gateway IP address Primary DNS Server You must specify a DNS server IP 76 Vigor2130 Series User s Guide WAN Connection Detection Clone MAC Address Mail SMS Alert Vigor2130 Series User s Guide address here because your ISP should provide you with usually more than one DNS Server If your ISP does not provide it the router will automatically apply default DNS Server IP address 194 109 6 66 to this field Secondary DNS Server You can specify secondary DNS server IP address here because your ISP often provid
30. 0 0 Available settings are explained as follows Item Description Port There is one WAN port and 4 LAN ports in Vigor2130 Here each port will be configured with different ID action rate limiter ID port copy and etc Action Select whether forwarding is permitted Allow or denied Deny The default value is Allow Action Allow Rate Limiter ID Select a rate limiter to apply to this port Available settings include Disabled and 1 to 10 The default value is Dray Tek 116 Vigor2130 Series User s Guide Disabled Rate Limiter ID k 3 A soos mm Counter Counts the number of frames that match this Access Control Entry ACE Refresh Click this button to refresh the number of the counter immediately Clear Click this button to clear the number of the counter on this page Click OK to save the settings Rate Limiter ID Configure the rate limiter for the ACL Access Control List of the router Please click Rate Limiter ID link to access into the following page Firewall gt gt Rate Control Object ACL Rate Limiter Configuration Rate Limiter ID lt le E lt OK Available settings are explained as follows Item Description Rate Limiter ID Rate limiter ID will be applied to WAN port and LAN port Please specify a rate number for each ID The default setting is 1 packet per second Rate Define the rate by choosing from the following drop do
31. 1 Regulatory Information Federal Communication Commission Interference Statement This equipment has been tested and found to comply with the limits for a Class B digital device pursuant to Part 15 of the FCC Rules These limits are designed to provide reasonable protection against harmful interference in a residential installation This equipment generates uses and can radiate radio frequency energy and if not installed and used in accordance with the instructions may cause harmful interference to radio communications However there is no guarantee that interference will not occur in a particular installation If this equipment does cause harmful interference to radio or television reception which can be determined by turning the equipment off and on the use is encouraged to try to correct the interference by one of the following measures Reorient or relocate the receiving antenna Increase the separation between the equipment and receiver Connect the equipment into an outlet on a circuit different form that to which the receiver is connected Consult the dealer or an experienced radio TV technician for help This device complies with Part 15 of the FCC Rules Operation is subject to the following two conditions 1 This device may not cause harmful interference and 2 This device may accept any interference received including interference that may cause undesired operation Please visit http www draytek com user Suppo
32. 2 Such value is used to initialize USB modem Please use the default value If you have any question please contact to your ISP APN Name APN means Access Point Name which is provided and required by some ISPs Modem Dial String Such value is used to dial through USB mode Please use the default value If you have any question please contact to your ISP PPP Username Type the PPP username optional PPP Password Type the PPP password optional Vigor2130 Series User s Guide 79 Dr ay Te k WAN Connection Mode Such function allows you to verify whether network Detection connection is alive or not through ARP Detect or Ping Detect Choose ARP Detect or Ping Detect for the system to execute for WAN detection Ping IP If you choose Ping Detect as detection mode you have to type IP address in this field for pinging Clone MAC Address Enable Enable the feature It is available when the box of Enable is checked Click Clone MAC Address The result will be displayed in the field of MAC Address Enable Clone MAC Address MAC Address 00 0E A6 2A D5 A1 Mail SMS Alert Alert Types Specify the type of the alert mail SMS or Mail and SMS that Vigor system will use to send a message to the user None Iv Mail SMS Mail and SMS Event types Specify the event when the system must send a notification to the user by mail and or SMS After finishing all the settings here please click OK to activate them Dra
33. 2011 07 22 18 47 23 2011 07 22 18 47 18 2011 07 22 18 47 18 2011 07 22 18 47 14 2011 07 22 18 47 14 2011 07 22 18 47 08 2011 07 22 18 47 08 2011 07 22 18 47 03 2011 07 22 18 47 03 2011 07 22 18 46 59 2011 07 22 18 46 59 2011 07 22 18 46 53 2011 07 22 18 46 53 2011 07 22 18 46 48 2011 07 22 18 46 48 2011 07 22 18 46 43 2011 07 22 18 46 43 2011 07 22 18 46 38 2011 07 22 18 46 38 2011 07 22 18 46 33 2011 07 22 18 46 33 2011 07 22 18 46 26 2011 07 22 18 46 28 lt Router Time Jul 22 16 40 27 Jul 22 16 40 27 Jul 22 16 40 22 Jul 22 16 40 22 Jul 22 16 40 18 Jul 22 16 40 18 Jul 22 16 40 12 Jul 22 16 40 12 Jul 22 16 40 07 Jul 22 16 40 07 Jul 22 16 40 03 Jul 22 16 40 03 Jul 22 16 39 57 Jul 22 16 39 57 Jul 22 16 39 52 Jul 22 16 39 52 Jul 22 16 39 48 Jul 22 16 39 48 Jul 22 16 39 42 Jul 22 16 39 42 Jul 22 16 39 37 Jul 22 16 39 37 Jul 22 16 39 32 Jul 22 16 39 32 Level kernel kernel kernel kernel kernel kernel kernel kernel kernel kernel kernel kernel kernel kernel kernel kernel kernel kernel kernel kernel kernel kernel kernel kernel Type Message eth1 2 rec printk 174 eth1 2 rec printk 301 eth1 2 rec printk 61 eth1 2 rec printk 120 ethi 2 rec printk 128 eth1 2 rec printk 172 eth1 2 rec printk 277 ethi 2 rec printk 259 eth1 2 rec printk 251 eth1 2 rec printk 347 eth1 2 rec printk 216 eth1 2
34. 255 255 255 0 0 192 168 1 0 0 0 0 0 255 255 255 0 L 0 211 100 88 0 192 168 1 3 255 255 255 0 0 192 168 10 0 192 168 1 2 255 255 255 0 L 0 0 0 0 0 192 168 5 1 0 0 0 0 0 Each item is explained as follows Item Description Destination Display the IP address for destination network or destination host Gateway Display the gateway address or if none set Genmask Display the netmask for the destination net 255 255 255 255 is for a host destination and 0 0 0 0 is for the default route Flags Different codes represent different routing status Dray Tek 266 Vigor2130 Series User s Guide U route is up H target is a host G use gateway R reinstate route for dynamic routing D dynamically installed by daemon or redirect M modified from routing daemon or redirect A installed by addrconf C cache entry reject route Metric Display the distance to the target usually counted in hops Ref Display number of references to this route Not used in the Linux kernel Use Display count of lookups for the route Depending on the use of F and C this will be either route cache misses F or hits C Iface Display interface to which packets for this route will be sent Refresh Click it to reload the page 4 16 4 ARP Cache Table Click Diagnostics and click ARP Cache Table to view the content of the ARP Address Resolution Protocol cache held in the router The table shows a mapping betwe
35. Class Tag Priority 7 Class Available settings are explained as follows Item Description Tag Priority 0 Class Use the user priority 3 bits as an index to the eight QoS Class values in QCE Tag Priority 7 Class Traffic Class Specify traffic class from Low Normal Medium and High When you finish the setting click OK to save the settings A new ACL profile will be added Bandwidth Management gt gt QoS Control List QoS Control List Configuration Traffic Class Type Value Ethernet Type TCP UDP Port TCP UDP Port a Editing a QCE Dray Te K 154 Vigor2130 Series User s Guide Click to modify the settings of an existing QCE on this page Moving Up Down a QCE Click and to move a QCE up and down Deleting a QCE To delete a QCE in the list simply click G of that one It will be removed immediately 4 6 5 Ports Priority This page allows you to configure QoS settings for each port The classification is controlled by a QCL Quality Control List that is assigned to each port A QCL consists of an ordered list of up to 12 QCEs Quality Control Entry Each QCE can be used to classify certain frames to a specific QoS class This classification can be based on parameters such as VLAN ID UDP TCP port IPv4 IPv6 DSCP or Tag Priority Frames not matching any of the QCEs are classified to the default QoS class for the port Bandwidth Management gt gt Ports Priority Port QoS Conf
36. Click GENERATE to open the following page Vigor2130 Series User s Guide 185 Dray Tek Certificate Management gt gt Generate Certificate Request Generate Certificate General Keylangth 1024 bits sign by hy Root CA You have to build My Root CA first Certificate Subject Country S0 state Location Organization Organization Unit Common Mame Email address Available settings are explained as follows Item Description General Name Type a new name for such certificate Keylength Specify the length of the certificate Sign by My Root CA If you have created a Root CA for yourself the check box will be available for you to activate If you do not check the box then such local certificate might be signed by other Root CA in default Certificate Subject Country ISO Type the abbreviation of your country in this field State Type the state that you live Location Give a brief description your location Organization Type the name of your company Organization Unit Type the department or unit for your company Common Name Type a common name Email address Type an email address for the system to send any information for you Click OK to save the settings and return to previous page Dray Tek 186 Vigor2130 Series User s Guide 4 9 3 Issue Certificate Vigor router can be used as a Root CA to authenticate and issue the certificates request coming from other clients Cer
37. Enable Click it to enable DLNA Server function Disable Click it to disable DLNA Server function Server Name The default name is the router name You can change it if needed Path After storing the files in the USB storage device please specify a path for the files to be accessed for DLNA service is the symbol for the top folder of USB storage OK Save the settings Uninstall Cancel the module installation settings and exit the dialog 4 11 9 Temperature Sensor A USB Thermometer can be attached to Vigor router to monitor the environmental temperature If the temperature is higher the upper limit or lower than the lower limit an alert would be sent out for notification USB Application gt gt Temperature Sensor General Setup Graphic USB Temperature General Settings Enable Temperature Sensor Enable Disable Tenx Technology Thermometer has been detected Display Unit Centigradef C Fahrenheit F Temperature Alert Woper limit ae Lower limit gs Calibration C10 C 10 C cend Temperature Log to Syslog Agent F Send Alert to E Mail Send alarm to the SMS app F SMS Profile Vigor2130 Series User s Guide 213 Dray Te k Available settings are explained as follows Item Description Enable Temperature Enable Enable the function of temperature sensor Sensor Disable Disable the function Display Unit Choose the display unit of the temperature There are two types for you
38. Enable Disable 1 Start IP Address 192 168 110 IP Address 192 168 2 1 Subnet Mask 955 955 955 0 IP Pool Counts Enable Disable Lease Time minutes Force DNS manual setting C Enable PPPoE Passthrough Primary IP Address 2nd Subnet DHCP Server secondary IP Address Available settings are explained as follows Item Description LAN IP Network IP Address Type in private IP address for connecting to a Configuration local private network Default 192 168 1 1 Subnet Mask Type in an address code that determines the size of the network Default 255 255 255 0 24 For IP Routing Usage Click Enable to invoke this function The default setting is Disable IP Address Type in secondary IP address for connecting to a subnet Default 192 168 2 1 24 Subnet Mask An address code that determines the size of the network Default 255 255 255 0 24 2 Subnet DHCP Server Click Enable to invoke this function The default setting is Disable PPPoE Passthrough The router offers PPPoE dial up connection Besides you also can establish the PPPoE connection directly from local clients to your ISP via the Vigor router When PPPoA protocol is selected the PPPoE package transmitted by PC will be transformed into PPPoA package and sent to WAN server Thus the PC can access Internet through such direction DHCP Server Enable Server DHCP stands for Dynamic Host Configuration Configuration Protocol The router by fa
39. IP address for it Expire Time It displays the leased time of the specified PC 4 16 10 Data Flow Monitor This page displays the running procedure for the IP address monitored and refreshes the data in an interval of several seconds The IP address listed here is configured in Bandwidth Management You have to enable IP bandwidth limit and IP session limit before invoke Data Flow Monitor If not a notification dialog box will appear to remind you enabling it Click Diagnostics and click Data Flow Monitor to open the web page You can click IP Address TX rate RX rate or Session link for arranging the data display Diagnostics gt gt Data Flow Monitor Page 1 Auto refresh Index IP Address TX rate Kbps RX rate Kbps Hardware NAT rate Kbps Session Action 0 0 192 165 1 10 0 2 Block Note 1 Click Block to prevent specified PC from surfing Internet for 5 minutes 2 The IP blocked by the router will be shown in red 3 lf Hardware MAT is enabled Hardware NAT rate shows TA R amp A bandwidth which goes through Hardware MAT Each item is explained as follows Item Description Page Allow to choose the page to be displayed on this screen Auto refresh Check it to enable auto refresh function Refresh Click it to reload the page Index Display the number of the data flow IP Address Display the IP address of the monitored device Dray Te k 274 Vigor2130 Series User s Guide TX rate kbps Display the tra
40. Internet via NAT router The router will generate the records of NAT sessions for such connection The P2P Peer to Peer applications e g BitTorrent always need many sessions for procession and also they will occupy over resources which might result in important accesses impacted To solve the problem you can use limit session to limit the session procession for specified Hosts In the Bandwidth Management menu click Sessions Limit to open the web page Vigor2130 Series User s Guide 145 Dray Te k Bandwidth Management gt Session Limit Session Limit Configuration Disable Enable Default Session Limit Limitation List Index Start IF Session Limit Specitic Limitation Stat P end session Limit Available settings are explained as follows Item Description Enable Click this button to activate the function of limit session Disable Click this button to close the function of limit session Default Sessions Limit Defines the default session number used for each computer in LAN Limitation List Displays a list of specific limitations that you set on this web page Start IP Defines the start LAN IP address for limit session End IP Defines the end LAN IP address for limit session Sessions Limit Defines the available session number for each host in the specific range of IP addresses If you do not set the session number in this field the system will use the default session limit for the specific lim
41. Mode as IKE phase 1 mode Setup a pre shared key which must be the same as in Vigor2820 Dray Tek 6 Enter Vigor2130 s private network in the Local Network Mask field Enter Vigor2820 s private network in the Remote Network Mask field 7 Use default value Automatic for IKE phase 1 and phase 2 proposals 8 Click OK 9 Accessing the VPN network of Vigor2820 from a PC behind Vigor2130 to initiate the VPN connection for example ping 192 168 1 x from a PC 192 168 30 x Vigor2130 will be triggered to dial the IPSec VPN to Vigor2820 After the VPN is connected you can monitor the status VPN and Remote Access gt gt LAN to LAN VPN Site to Site Tunnels IPSec Auto refresh L IKE ESP Alg Status Alg DES CBC 192 p ESP AES HMAC_SHA1 JHAT MODP 1024 SIATE_QUICK 12 160728 Name Endpoint Demo 1 72 17 1 Add Tunnel Dray Tek 40 Vigor2130 Series User s Guide VPN configuration on Vigor2820 l Create a LAN to LAN profile VPN and Remote Access gt gt LAN to LAN Profile Index 1 1 Common Settings Call Direction Both Dial o CO always on Idle Timeout jo second s C Enable PING to keep alive PING to the IP Profile Name VPN Dial Out Through WAN1 First v Netbios Naming Packet Pass O Block Multicast via VPN Opass Block for some IGMP IP Camera DHCP Relay etc 2 Dial Out Settings Type of Server I
42. Start PIN button The WLAN LED on the router will blink fast when WPS is in progress It will return to normal condition after two minutes You need to setup WPS within two minutes After finishing the settings here please click Next Vigor2130 Series User s Guide 27 Dray Tek 2 3 5 Saving the Wizard Configuration Now you can see the following screen It indicates that the setup is complete Different types of connection modes will have different summary Click Finish and then restart the router Quick Start Wizard Vigor Wizard Setup is now finished Press Finish button to save and finish the wizard setup You will be prompted for the new password Note that the configuration process takes a few seconds to complete 2 4 Online Status The online status shows the system status WAN status and other status related to this router within one page If you select PPPoE as the protocol you will find out a link of Dial PPPoE or Drop PPPoE in the Online Status web page Online Status Auto refresh Pi System Status System Uptime Od 02 42 07 LAN Status IP Address TX Packets RX Packets TX Bytes RX Bytes 192 168 1 1 423 652 2219 5 93684 IPv Address 2000 1 64 Global fe80 200 ff fe00 0 64 Linkt WAN Status IF GW IP Mode Up Time Ire 10 3 102 r2 16 11 Static IP Od 02 41 31 IPv Address fes0 250 ff fe00 2 64 Link Primary DNS Secondary DNS TX Packets RX Packets TX Bytes RX Bytes Loe 95 164 3195 2793
43. Vigor2130 Series User s Guide 4 2 LAN Local Area Network LAN is a group of subnets regulated and ruled by router The design of network structure is related to what type of public IP addresses coming from your ISP t LAN General Setup Ports MAC Address Table VLAN Monitor Port Static Route Policy Route Bind IP to MAC Web Portal Basics of LAN The most generic function of Vigor router is NAT It creates a private subnet of your own As mentioned previously the router will talk to other public hosts on the Internet by using public IP address and talking to local hosts by using its private IP address What NAT does is to translate the packets from public IP address to private IP address to forward the right packets to the right host and vice versa Besides Vigor router has a built in DHCP server that assigns private IP address to each local host See the following diagram for a briefly understanding Internet DHCP Server Public IP Address Private Subnet Router IP Addres In some special case you may have a public IP subnet from your ISP such as 220 135 240 0 24 This means that you can set up a public subnet or call second subnet that each host is equipped with a public IP address As a part of the public subnet the Vigor router will serve for IP routing to help hosts in the public subnet to communicate with other public hosts or servers outside Therefore the router should be set as the gate
44. WPA2 or Auto as WPA mode Auto WPA or WPA2 Enter the IP address of RADIUS server The UDP port number that the RADIUS server is using The default value is 1812 based on RFC 2138 The RADIUS server and client share a secret that is used to authenticate the messages sent between them Both sides must be configured to use the same shared secret 26 Vigor2130 Series User s Guide WPS WPS Wi Fi Protected Setup provides easy procedure to make network connection between wireless station and wireless access point vigor router with the encryption of WPA and WPA2 If you choose WPS as the security configuration you can press Start WPS PIN and Start WPS PBC to complete the wireless connection Quick Start Wizard Wireless System Configuration Enable Wireless LAN SSID DrayTek Wireless Security Configuration WPS Configuration Configure via Push Button start PBC Configure via Client Pincode Oooo start PIN Available settings are explained as follows Item Description Configure via Push Click Start PBC to invoke Push Button style WPS setup Button procedure The router will wait for WPS requests from wireless clients about two minutes The WPS LED on the router will blink fast when WPS is in progress It will return to normal condition after two minutes You need to setup WPS within two minutes Configure via Client Type the PIN code specified in wireless client you wish to PinCode connect and click
45. Wireless LAN gt gt WMM Configuration WMM Configuration Wik Capable Enable Disable APSD Capable O Enable Disable WMM Parameters of Access Point Aifsn CWMin CWMax AckPolicy CI LI m d Available settings are explained as follows Item Description Scan It is used to discover all the connected AP The results will be shown on the box above this button WMM Capable To apply WMM parameters for wireless data transmission please click the Enable radio button APSD Capable The default setting is Disable Aifsn It controls how long the client waits for each data transmission Please specify the value ranging from to 15 Such parameter will influence the time delay for WMM accessing categories For the service of voice or video image please set small value for AC_VI and AC VO categories For the service of e mail or web browsing please set large value for AC BE and AC BK categories CW Min CW Max CWMin means contention Window Min and CWMax means contention Window Max Please specify the value ranging from to 15 Be aware that CWMax value must be greater than CWMin or equals to CWMin value Both values will influence the time delay for WMM accessing categories The difference between AC VI and AC VO categories must Vigor2130 Series User s Guide 199 Dray Te k be smaller however the difference between AC_BE and AC BK categories must be greater Txop It means transmission opportunity For WMM categories of
46. allowed range is 0 to 65535 A frame meeting this ACE matches this TCP source value Type the value if you choose Range as the Source Port Filter The allowed range is 0 to 65535 A frame meeting this ACE matches this TCP source value Specify the TCP port destination filter for this ACE Dest Port Filter Any No TCP destination filter is specified Specific If you want to filter a specific TCP destination filter with this ACE you can enter a specific TCP destination value A field for entering a TCP destination value appears Range If you want to filter a specific TCP destination range filter with this ACE you can enter a specific TCP destination range value A field for entering a TCP destination port range appears Type the value if you choose Specific as the Dest Port filter The allowed range is 0 to 65535 A frame meeting this ACE matches this TCP source value Type the value if you choose Range as the Dest Port filter The allowed range is 0 to 65535 A frame meeting this ACE matches this TCP source value Specify the TCP No more data from sender FIN value for this ACE 129 Dray Tek 0 TCP frames where the FIN field is set must not be able to match this entry 1 TCP frames where the FIN field is set must be able to match this entry Any Any value is allowed TCP SYN Specify the TCP Synchronize sequence numbers SYN value for this ACE 0 TCP frames where the SYN field is set must not be
47. as follows Item Port Packets Bytes Errors Drops Filtered Auto refresh Refresh Clear Vigor2130 Series User s Guide Description Display the interface that data transmission passing through Display the packet sizes for data transmission in receiving and sending Display the number of received and transmitted bytes per port Display the number of the error occurred in data receiving and data sending Display the number of the data lost in receiving and sending Display the number of received frames filtered by the forwarding process Check it to enable auto refresh function Click it to reload the page Click it to clear the counters for all ports 269 Dray Tek 4 16 7 Detailed Statistics This page display detailed statistics for WAN LAN interface Diagnostics gt gt Detailed Statistics Detailed Port Statistics WAN Clear Auto refresh L Receive Total Transmit Total Rx Packets 30616 Tx Packets Rx Octets 15456004 Tx Octets 3133089 Rx Unicast 16309 Tx Unicast 16549 Rx Multicast 5607 Tx Multicast Rx Broadcast 14542 Tx Broadcast Rx Pause 0 Tx Pause Receive Size Counters Rx 64 Bytes 5971 Rx 65 127 Bytes 17150 Rx 128 255 Bytes 3606 Rx 256 511 Bytes 2699 Rx 512 1023 Bytes 1463 Rx 1024 1526 Bytes 7530 Rx 1527 Bytes 0 Receive Queue Counters Rx Low 20334 Tx Low Rx Normal 3931 Tx Normal Rx Medium 14353 Tx Medium Rx High Tx High Receive Error Counters Rx Drops Tx Drops Rx CRC Alignment
48. below You many paste the information of the certificate from other files After pasting the data in this field simply click Upload below The related data will be uploaded onto the router Upload After pasting the information click it to upload the CA data coming from the third party to Vigor router Vigor2130 Series User s Guide 183 Dray Te k If you want to create your Root CA certificate for the router adopting for issuing local certificate and certificate request from the remote client simply click Build RootCA to access into the following page Certificate Management gt gt Build Root CA Generate Certificate General Keylength 1024 bits Certificate Subject Country 50 State Location Organization Organization Unit Common Name Email address Available settings are explained as follows Item Description General Name Type a new name for such certificate Keylength Specify the length of the certificate Certificate Subject Country ISO Type the abbreviation of your country in this field State Type the state that you live Location Give a brief description your location Organization Type the name of your company Organization Unit Type the department or unit for your company Common Name Type a common name for such certificate Email address Type an email address for the system to send any information for you After finished the page click OK to save the settings
49. boost its performance further the Vigor Router is Vigor2130 Series User s Guide 187 Dray Te k also loaded with advanced wireless technology to lift up data rate up to 300 Mbps Hence you can finally smoothly enjoy stream music and video Note The actual data throughput will vary according to the network conditions and environmental factors including volume of network traffic network overhead and building materials In an Infrastructure Mode of wireless network Vigor wireless router plays a role as an Access Point AP connecting to lots of wireless clients or Stations STA All the STAs will share the same Internet connection via Vigor wireless router The General Settings will set up the information of this wireless network including its SSID as identification located channel etc Internet SSID Draytek Channel 6 i Mode WEP only 192 168 1 1 Security Overview Real time Hardware Encryption Vigor Router is equipped with a hardware AES encryption engine so it can apply the highest protection to your data without influencing user experience Complete Security Standard Selection To ensure the security and privacy of your wireless communication we provide several prevailing standards on market WEP Wired Equivalent Privacy is a legacy method to encrypt each frame transmitted via radio using either a 64 bit or 128 bit key Usually access point will preset a set of four keys and it will communicate with e
50. directly when you press the keypad on the phone OutBand Choose this one then the Vigor will capture the keypad number you pressed and transform it to digital form then send to the other side the receiver will generate the Dray Tek 230 Vigor2130 Series User s Guide tone according to the digital form it receive This function is very useful when the network traffic congestion occurs and it still can remain the accuracy of DTMF tone SIP INFO Choose this one then the Vigor will capture the DTMF tone and transfer it into SIP form Then it will be sent to the remote end with SIP message Payload Type rfc2833 Choose a number from 96 to 127 the default value was 101 This setting is available for the OutBand RFC2833 mode After finished the above configuration click OK to save the settings and exit this page 4 12 4 Status From this page you can find codec connection and other important call status for each port VoIP gt gt Status Status Auto refresh LJ Elapse Tx Rx In Out Miss Speaker hh mm ss Pkts Pkts Calls Calls Calls Gain Phone OLE NAA NA 00 00 00 0 0 0 0 0 5 Phones IDLE WA WA 00 00 00 0 0 0 0 0 5 Fort Status Codec PeerlD Log Duration In Out Miss Account ID hh trim Ss Date Time irri dd yyy i hh riti aa o0 O00 O00 OO0 O0 O00 OO0 O0 O00 oo0 O00 00 o0 O00 O00 OO0 O0 O00 OO0 O0 O00 o0 O00 00 o0 O00 O00 OO0 O0 O00 lt o0 00 00 0 00 00 0 00 00 oO0 O0 00 0
51. field Then after clicking OK the router will create the specific new folder in the USB disk In addition if the user types here he she can access into all of the disk folders and files in USB disk Note When write protect status for the USB disk is ON you cannot type any new folder name in this field Only can be used in such case Visible Check this box to make this USB diskette to be seen in Network Neighborhood on Windows of clients in local network Access Specify the access right and apply to all the wireless clients that want to connect to the attached USB disk Dray Tek 208 Vigor2130 Series User s Guide All Users Read only Y All Users Read only All Users Read write specific Users All Users Read only everyone has read only access to the share disk All Users Read write everyone has read write access to the share disk Specific Users Only specific user s can access into the share disk 4 11 6 Bit Torrent Download There are many seeds of BT Torrents in Internet for users to download preferred video file image file and so on In general the downloaded files would be stored in the computer However if the computer is shut down the file downloading also will be terminated Here Vigor router provides a function to download the BT Torrent file into USB storage device The downloading job will not be terminated even 1f the computer is powered off for the file is downloaded and
52. if itis enabled After WAN connection is recovered router will disconnect the 56K connection automatically WAN gt gt Backup Backup Configuration 3G Backup 56K Backup C Enable 56K Backup Phone Number PPP Username PPP Password Note In dual usb mode both WAN and Backup are USB 3G 56K USB Port 2 is for backup WAN Connection Detection Mode ARP wt Mail SMS Alert Event types WANUPL WAN DOWN ZI Available settings are explained as follows Vigor2130 Series User s Guide 91 Dray Te k Item Description 56K Backup Enable 56K Backup Check this box to enable such function Phone Number Type the phone number offered by the ISP for dial out connection PPP Username Type the PPP username optional PPP Password Type the PPP password optional WAN Connection Mode Such function allows you to verify whether network Detection connection is alive or not through ARP Detect or Ping Detect Choose ARP Detect or Ping Detect for the system to execute for WAN detection Ping IP If you choose Ping Detect as detection mode you have to type IP address in this field for pinging Mail SMS Alert Alert Types Specify the type of the alert mail SMS or Mail and SMS that Vigor system will use to send a message to the user Mail and Sits Event types Specify the event when the system must send a notification to the user by mail and or SMS Reset USB Click it to reset the USB device Dray Tek 92
53. length Static IPv6 This type allows you to setup static IPv6 address for WAN IPv6 gt gt WAN General Setup WAN IPv6 Configuration IPv6 Connection Type Static IPv6 IPv6 Address Prefix Length 0 Gateway Pv6 Address Primary ONS Server secondary DNS Server Vigor2130 Series User s Guide 233 Dr ay Te k Available settings are explained as follows Item Description IPv6 Address Type your IPv6 static IP here Prefix Length Type your IPv6 address prefix length here Gateway IPv6 Server Type your IPv6 gateway address here Primary DNS Server Type your IPv6 primary DNS Server address here Secondary DNS Server Type your IPv6 secondary DNS Server address here DHCPv6 Client IA_NA DHCPv6 client mode would use I A_ NA option of DHCPv6 protocol to obtain IPv6 address from server IPv6 gt gt WAN General Setup User defined DMS server Primary ONS Server secondary ONS Server Available settings are explained as follows Item Description Primary DNS Server Type primary DNS Server address here Secondary DNS Server Type secondary DNS Server address here DHCPv6 Client IA_PD DHCPv6 client mode would use IA_ PA option of DHCPv6 protocol to obtain IPv6 prefix from server IPv6 gt gt WAN General Setup WAN IPv6 Configuration IPS Connection Type DHCP 65 Client lA PDO DHCP vs IA PD SLA ID Available settings are explained as follows Dray Te k 234 Vigor2130 Series User s Guide
54. ok oa Dray Tek 54 Vigor2130 Series User s Guide 5 After enabled successfully new media device can be seen in My Network Places The name of the media device is the Server Name configured in Step 4 T My Network Places File Edit View Favorites Tools Help Back ea pa Search Key Folders Ez ee Go Al Local Network Network Tasks le Add a network place Vigor2130 1 Ls View network connections office network 9 Set up 4 home or small 4 Ti Set up a wireless network For a home or small office wy View Workgroup c computers _ Hide icons For networked UFnF devices Other Places Desktop ig My Computer My Documents Note If you cannot see the media device in Network view please check and make sure the UPnP service has been enabled Control Panel gt gt Administrative Tools gt gt Services Services File Action Yiew Help mii eae ae gt E mb S Services Local u Services Local Plug and Play Name Description Status Startup Type Log On As Kams Software Shado Manages s Manual Local System Description Sy Net Logon Supports p Manual Local System hea eal lite ae Ka NetMeeting Remote Enables an Manual Local System no user input Stopping or disabling this Ka Network Connections Manages o Started Manual Local System service will result in system instability Sa Network DDE Provides n Disabled Local System Sa Network DDE DSDM ManagesD Disa
55. or reset the router There is another way to set up time You can inquiry an NTP server a time server on the Internet to synchronize the router s clock This method can only be applied when the WAN connection has been built up Applications gt gt Schedule Schedule Configuration Setting Status Adding a New Schedule Profile You can set up to 15 schedules Click Add to open the following page to create a new schedule profile Vigor2130 Series User s Guide 161 Dray Te k Applications gt gt Schedule Add Schedule Enable Start Date Year Month Date Start Time Hour Minute Action WAN UP wh Weekday Monday Tuesday Wednesday Thursday Friday saturday Sunday Available settings are explained as follows Item Description Enable Check to enable the schedule Start Date Specify the starting date of the schedule Start Time Specify the starting time of the schedule Action Specify which action should be applied during the period of the schedule Action Acts Weekday WAN UP DOWN WAN connection will be activated inactivated based on the time schedule configured here WiFi UP DOWN Wireless W1 Fi connection will be activated inactivated based on the time schedule configured here VPN UP DOWN VPN connection will be activated inactivated based on the time schedule configured here BT UP DOWN BT connection will be activated inactivated based on the time sched
56. particular ports to the specific private IP address port of host in the LAN However other IP protocols for example Protocols 50 ESP and 51 AH do not travel on a fixed port Vigor router provides a facility DMZ Host that maps ALL unsolicited data on any protocol to a single host in the LAN Regular web surfing and other such Internet activities from other clients will continue to work without inappropriate interruption DMZ Host allows a defined internal user to be totally exposed to the Internet which usually helps some special applications such as Netmeeting or Internet Games etc Destined to Internet 220 135 240 207 Protocol Any Port Any FTP Server 192 168 1 7 1 12 The security properties of NAT are somewhat bypassed if you set up DMZ host We suggest you to add additional filter rules or a secondary firewall Click DMZ Host to open the following page NAT gt gt DMZ Host DMZ Host Index Enable Aux WAN IP Private IP all 0 0 0 0 Choose PC Available settings are explained as follows Item Description Enable Check to enable the DMZ Host function Aux WAN IP Such option is available when WAN IP Alias has been configured Private IP Enter the private IP address of the DMZ host or click Choose PC to specify a suitable one Dray Te k 114 Vigor2130 Series User s Guide Choose PC Bring a dialog for you to choose an IP address Click OK to save the settings 4 4 Firewall Basics for Fire
57. print server 05 What types of printers are compatible with Vigor router 06 What are the limitations in the USB Printer Port of Vigor Router 07 What is the printing buffer size of Vigor Router 08 How do configure LPR printing on Mac OSX 09 How do configure LPR printing on My Windows Vista Note 2 Vigor router supports printing request from computers via LAN ports but not WAN port Dray Tek n Vigor2130 Series User s Guide Basic Settings For using the router properly it is necessary for you to change the password of web configuration for security and adjust primary basic settings This chapter explains how to setup a password for accessing into the web configurator of Vigor router and how to adjust settings for accessing Internet successfully 2 1 Accessing Web Page 1 Make sure your PC connects to the router correctly Q Notice You may either simply set up your computer to get IP dynamically from the router or set up the IP address of the computer to be the same subnet as the default IP address of Vigor router 192 168 1 1 For the detailed information please refer to the later section Trouble Shooting of the guide 2 Open a web browser on your PC and type http 192 168 1 1 The following window will be open to ask for username and password Username Password Copyright DrayTek Corp All Rights Reserved Dray Tek 3 Please type admin admin on Username Password and click Lo
58. router Mask Type the mask for the source IP Action Block Packets matching with such rule will be blocked by the router Pass Packets matching with such rule are allowed to pass through the router Syslog Check this box to record the information on Syslog Dray Te K 144 Vigor2130 Series User s Guide Specify a period for filtering the packets with web feature filter Use the drop down list to choose the time setting or click New Time Object to define a time period for you necessity Time Profile None v New Time Object Mone FProfilel Office New Time Object Such link allows you to create new time object for using by web feature filter The method to configure the time object is that same as set in Firewall gt gt Time Object 2 Simply check the box s that you want to block and click OK to save the settings New APP Enforcement profile will be added and shown as below CSM gt gt APP Enforcement APP Enforcement Auto refresh C Enable APF Enforcement Name Source Mask Action Counter Ta p2p block 33831 00 0 0 Ya WEB IM 172 17 3 0 256 255 255 0 block 0 EXxK ty Note Only new connections will be matched 4 6 Bandwidth Management Below shows the menu items for Bandwidth Management t Bandwidth Management Session Limit Bandwidth Limit Port Rate Control Q05 Control List Ports Priority QoS Statistics 4 6 1 Session Limit A PC with private IP address can access to the
59. rules IPv6 gt gt IPv6 Firewall Setup Add IPv6 Firewall Rule Name Protocol source IP Type Source IP source Subnet Destination IP Type Destination IP Destination Subnet Source Start Port source End Por optional Destination Start Port Destination End Port optional Action a Oye Sd Pt Choose PC Available settings are explained as follows Item Name Protocol Source IP Type Source IP Choose PC Source Subnet Choose Subnet Destination IP Type Vigor2130 Series User s Guide Description Type a name for the rule Specify a protocol for this rule single subnet Type the IPv6 address here if you choose Single as Source IP Type Or click Choose PC to select an Ipv6 address Type the subnet mask here if you choose Subnet as Source IP Type Or click Choose Subnet to select an Ipv6 subnet Determine the IP type as the destination 239 Dray Tek Item Destination IP Choose PC Destination Subnet Choose Subnet Source Start Port Source End Port optional Destination Start Port Description Type the IP address here if you choose Single as Destination IP Type Or click Choose PC to select an Ipv6 address Type the subnet mask here if you choose Subnet as Destination IP Type Or click Choose Subnet to select an Ipv6 subnet Type a value as the source start port Such value will be available only TCP UDP 1s selected as the protocol Type a value as
60. save these settings Dray Te k 262 Vigor2130 Series User s Guide 4 15 8 Management This page allows you to manage the settings for access control access list port setup and SMP setup For example as to management access control the port number is used to send receive SIP message for building a session The default value is 5060 and this must match with the peer Registrar when making VoIP calls System Maintenance gt gt Remote Management Management Access Control Allow management from the Internet SNMP Setup Enable HTTP c Enable SNMP C Enable HTTPS c Manager HostIP si Enable SSH o Enable ICMP Ping O Enable FTP o Enable TELNET o Access List List Subnet hlask IP 1 fs 255 255 255 255 32 N 2 258 285 255 256 32 3 255 255 255 255 32 v Available settings are explained as follows Item Allow management from the Internet SNMP Setup Access List Vigor2130 Series User s Guide Description Enable HTTP HTTPS SSH ICMP Ping FTP TELNET Enable the checkbox to allow system administrators to login from the Internet There are several servers provided by the system to allow you managing the router from Internet Check the box es to specify Enable SNMP Check it to enable such service Manager Host IP Set one host as the manager to execute SNMP function Type the IP address to specify the certain host You could specify that the system administrator can only login fro
61. subnet Mask Gateway IP Address Interface Do NAT for Source Subnet Available settings are explained as follows Item Description Enable Check it to enable such route Source IP Address Type the source address for such policy route Subnet Mask Type the subnet mask for such policy route Destination IP Address Type the destination address for such policy route Subnet Mask Type the subnet mask for destination for such policy route Gateway IP Address Type the gateway IP address for the policy route Interface Choose an interface used by such policy route Management WAN WAN VoIP WAN IPT WWAN Management WAN Do NAT for Source Except LAN option any option selected as the Interface Subnet allows you to enable or disable such feature Status Display the status of the policy route After finishing all the settings here please click OK to activate them 4 2 8 Bind IP to MAC This function is used to bind the IP and MAC address in LAN to have a strengthening control in network When this function is enabled all the assigned IP and MAC address binding together cannot be changed If you modified the binding IP or MAC address it might cause you not access into the Internet Click LAN and click Bind IP to MAC to open the setup page Vigor2130 Series User s Guide 105 Dray Te k LAN gt gt Bind IP to MAC Bind IP to MAC Note IP MAC binding presets DHCP Allocations lf you select Strict Bind unspecified LAN clien
62. through and specify an IP address to allow VPN tunnel pass through VPN and Remote Access gt gt Remote Access Control Remote Access Control Setup Enable IPSec VPN Service Enable IPSec VPN Pass through Server inside your LAN Enable PPTP VPN Serice IP Address range for PPTP client 192 166 1 201 192 166 1 250 IP Address range for DHCP client 192 166 1 10 192 166 1 59 MPPE Required Pass Netbios Naming Packet Enable PPTP VPN Pass through Server inside your LAN F 0 0 0 1 Note PPTP connections from iPhone MAC with Encryption need to enable the MPFE Required option Available settings are explained as follows Item Description Enable IPSec VPN If this checkbox is checked the system firewall will allow Service VPN IPSec remote access from WAN side to the router Vigor2130 Series User s Guide 169 Dr ay Te k Enable IPSec VPN Pass through Server inside your LAN Enable PPTP VPN Service Enable PPTP VPN Pass through Server inside your LAN If this checkbox is checked the system firewall will allow VPN IPSec remote access from WAN side to a VPN device on the LAN Type the IP address of the VPN device in the field next to the checkbox If this checkbox is checked the system firewall will allow VPN PPTP remote access from WAN side to the router IP Address range for PPTP client Specify an IP address pool for the local private network that will be assigned to PPTP clients Note the values given he
63. to choose Temperature Alert Type the upper limit and lower limit for the system to send out temperature alert Calibration Type a value used for correcting the temperature error Send Temperature Log to Check the box to enable this function The temperature log Syslog Agent will be recorded on Syslog Send Alert to E Mail Check the box to enable this function The alert will be sent to the e mail address that you offer on the page of System Maintenance gt gt Syslog Mail Alert Setup Send alarm to the SMS app Check the box to enable this function SMS Profile Use the drop down list to choose a SMS profile for sending the alarm OK Save the settings Cancel Cancel the settings Below shows an example of temperature graph Temperature Display Current Temperature 26 5 C Max Temperature 26 5 C Min Temperature 26 5 C Awg Temperature 26 5 C Temperature Graph Display time interval mints Refresh Current temperature maximum temperature minimum temperature and average temperature will be displayed on the screen Dray Te k 214 Vigor2130 Series User s Guide 4 12 VoIP Note This function is used for V models Voice over IP network VoIP enables you to use your broadband Internet connection to make toll quality voice calls over the Internet There are many different call signaling protocols methods by which VoIP devices can talk to each other The most popular pro
64. to configure settings for DLNA Service in Vigor2130 Introduction DLNA Digital Living Network Alliance is a framework which personal computer HDD video recorder television and other digital devices can share each other data through network connection The DLNA devices are divided into two functions One is server side which transmits images music and video and the other is client side which receives data only Some devices support both functions Vigor2130 can install server program onto the connected USB storage device Clients with equipments supporting DLNA can play the files stored in the USB storage device connected to Vigor2130 through the network At present the supported type and format for Video amp Audio are listed as follows Supported Video asf avi dv divx wmv mjpg mjpeg mpeg mpg mpe mp2p Format vob mp2t mlv m2v m4v m4p mp4ps ts ogm mkv rmvb mov qt hdmov Supported Audio aac ac3 aif aiff at3p au snd dts rmi mp1 mp2 mp3 mp4 Format mpa ogg wav pcm Ipcm 116 wma mka ra rm ram flac Supported Image bmp ico gif jpeg jpg jpe ped png pnm ppm qti qtf qtif tif Format tiff Configuration 1 Insert USB storage device into the USB slot of Vigor2130 Then open USB Application gt gt Disk Status to check the connection status If it is connected successfully the general information of that device will be shown on the screen USB Application gt gt Disk Status Disk S
65. web configurator of Vigor router Refresh this page and the following screen will appear CSM gt gt Web Content Filter Enable Fj License Information Provider Commtouch Activate Name Status Source Filter Https Time Each item is explained as follows Item Enable Description Check the box to enable the web content filter 140 Vigor2130 Series User s Guide License Information Display the license information for current used If the WCF mechanism has been activated successfully a green light will be shown on the screen Provider Display the service provider of WCF Activate Click it to activate Commtouch WCF mechanism Name Display the profile name for WCF service Status Display if such profile 1s enabled or not If yes a green check mark will be shown here Source Display the range for source IPs Filter Https Display the HTTPS for filtering Such information is supported by Commtouch only Time Display the used time object 3 Check the box of Enable and click OK The Add a New Entry button will be available for you to create a new entry CSM gt gt Web Content Filter License Information dl Provider Commtouch Activate Name Source Filter Https Add a New Entry Vigor2130 Series User s Guide 141 Dray Te k 4 Dray Tek Click Add a New Entry to open the following page and type all the required information CSM gt gt Web Content Filter
66. web content fiter based on service operated in Germany We recommend only users live in Germany to try fhe RERA VE service This i a free tamate Ro aaa D ro y Ti e k 32 Vigor2130 Series User s Guide 10 In the following page check the box of I have read and accept the above Agreement The system will find out the date for you to activate this version of service Then click Next Confirm Message D about Us Product g Aa pii Name james_fae x Serial 2011031609200201 e VigorACs SI Model Vigor 130 Vigor Series License Number Service Provider i Product End User License Agreement kaal Registration PLEASE READ THIS SOFTWARE LICENSE AGREEMENT LICENSE CAREFULLY BEFORE DOWNLOADING OR OTHERWISE USING THE SOFTWARE BY DOWNLOADING INSTALLING OR USING THE SOFTWARE YOU ARE AGREEING TO BE BOUND BY THE TERMS OF THIS LICENSE IF YOU Do NOT AGREE TO THE TERNS OF THIS LICENSE YOU ARE NOT AUTHORIZED TO DOWNLOAD OR USE THIS SOFTWARE d Customer SUrvey 1 Scope hawe read and accept the above Agreement Please check this bo 11 When this page appears click Register To Io Tef ir CAU ri Apply For A License Number D About Us st Cancel Product Cancel O My Information service Name WCF VigorACS SI ALERE ivati DD 03 16 2011 Register TE Activation Date MM DD YYY YY Product Registration 4 Customer Survey 12 Wait for a moment until the following page ap
67. wireless to authentication open mode SHARED Set wireless to authentication shared mode WPA PSK Accepts only WPA clients and the encryption key should be entered in PSK The WPA encrypts each frame transmitted from the radio using the key which either PSK Pre Shared Key entered manually in this field below or automatically negotiated via 802 1x authentication Wireless Security Configuration Encryption WPA PSK Configuration Type WPA Algorithm WPA Pre Shared Key Available settings are explained as follows Item Description WPA Mode Select WPA WPA2 or Auto as the type WPA Algorithm WPA Pre Shared Key Either 8 63 ASCII characters such as 012345678 or 64 Hexadecimal digits leading by 0x such as 0x321253abcde WPA RADIUS The built in RADIUS client feature enables the router to assist the remote dial in user or a wireless station and the RADIUS server in performing mutual authentication It enables centralized remote access authentication for network management 192 Vigor2130 Series User s Guide Wireless Security Configuration Encryption WPA RADIUS WPA RADIUS Configuration Type WPA Algorithm server IP Address Destination Port shared Secret radius secret Available settings are explained as follows Item Type WPA Algorithm Server IP Address Destination Port Shared Secret WPS Description The WPA encrypts each frame transmitted from the rad
68. 00 Perfect Forward Secrecy ok j Cancel Vigor2130 Series User s Guide 177 Dr ay Te k Available settings are explained as follows Dray Tek Item General Authentication Network Description Enabled Check here to activate this tunnel Always On Check this box to make the WAN connection being activated always Name Specify a name for this tunnel Remote IP Host Name Enter the IP address FQDN of the remote host that located at the other end of the VPN tunnel IKE phase 1 mode Select from Main mode and Aggressive mode The ultimate outcome is to exchange security proposals to create a protected secure channel Main mode is more secure than Aggressive mode since more exchanges are done in a secure channel to set up the IPSec session However the Aggressive mode is faster The default value in Vigor router is Main mode IKE phase 1 mode Main Mode hdl Type There are two types for you to choose for authentication Pre shared Key Pre Shared Ke y Pre Shared Key Such field will be applicable when Pre shared key is selected as the Type for the authentication Input 1 63 characters as pre shared key Confirm Pre Shared key Such field will be applicable when Pre shared key is selected as the Type for the authentication Input 1 63 characters as pre shared key again to confirm it Local Identity Local Identity is on behalf of the IP address while identity authenticating with rem
69. 00 00 OO0 O0 O0 OO0 O0 O0 oO0 O0 00 o0 00 00 0 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 00 IN Each item is explained as follows Item Auto refresh Refresh Port Codec Vigor2130 Series User s Guide Description Check this box to enable an automatic refresh of the page at regular intervals Click it to reload the page It shows the VoIP connection status IDLE Indicates that the VoIP function is idle HANG _UP Indicates that the connection is not established busy tone CONNECTING Indicates that the user is calling out WAIT_ ANS Indicates that a connection is launched and waiting for remote user s answer ALERTING Indicates that a call is coming ACTIVE Indicates that the VoIP connection is launched Indicates the voice codec employed by present channel 231 Dray Tek 4 13 IPv6 PeerID Elapse Tx Pkts Rx Pkts Rx Losts Rx Jitter In Calls Out Calls Miss Calls Speaker Gain Log VB WAN Setup vE LAN Setup eh Firewall Setu H Vo Routing VE Neighbour v6 TSPC Status Vb Management 4 13 1 IPv6 WAN Setup This page defines the IPv6 connection types for WAN interface Possible types contain Link Local only Static IPv6 DHCPv6 and TSPC Each type requires different parameter settings IPv6 gt gt WAN General Setup WAN IPv6 Configuration The present in call or out call peer ID the format may be I
70. 2 24 Dynamic 2 00 1B FC F8 11 40 Dynamic 00 50 7F 14 56 71 Dynamic 00 50 7F 38 60 C6 Each item is explained as follows Item Description Auto refresh Check it to enable auto refresh function Refresh Click it to reload the page Clear Click it to clear the counters for all ports Type Indicate whether the entry is a static or dynamic entry VLAN Display the VLAN ID of that entry MAC Address Display the MAC address of that entry Port Members Display the port of that entry 4 16 9 DHCP Table The facility provides information on IP address assignments This information is helpful in diagnosing network problems such as IP address conflicts etc Click Diagnostics and click DHCP Table to open the web page Diagnostics gt gt DHCP Table DHCP Server Status Auto refresh L Computer Name IP Address MAC Address Expire Time WM_Administrat3 192 166 1127 00 16 41 20 9 23 T Hours 9 Minutes user baleld ced 19 166 1 178 O0 0e a6 2a d5 al Hours 51 Minutes Each item is explained as follows Item Description Auto refresh Check it to enable auto refresh function Vigor2130 Series User s Guide 273 Dray Te k Refresh Click it to reload the page Computer Name It displays the name of the computer accepted the assigned IP address by this router IP Address It displays the IP address assigned by this router for specified PC MAC Address It displays the MAC address for the specified PC that DHCP assigned
71. 2TP IP Address range DHCP Range 192 168 1 10 192 168 1 60 Remote Dial in User Add User Vigor2130 Series User s Guide 173 Dr ay Te k Dray Tek Authentication Advanced Settings Type There are two types for you to choose for authentication Authentication Certificates ka Preshared secret Certificates Type Local Certificate If you choose Certificate as the Type you have to specify one of the local certificates Authentication Local Certificate If you choose Pre Shared Secret as the Type you have to type and confirm the shared secret IPSec remote dial in clients will use the given secret Authentication Type shared secret again Shared secret Type the shared secret manually and confirm it again PSec remote dial in clients will use the given secret Shared secret again Type the shared security again for confirmation Phase 1 IKE Negotiation of IKE parameters including encryption hash Diffie Hellman parameter values and lifetime to protect the following IKE exchange authentication of both peers using either a Pre Shared Key or Digital Signature x 509 The peer that starts the negotiation proposes all its policies to the remote peer and then remote peer tries to find a highest priority match with its policies shal mds group4groupS Automatic ades shal md5 aes any aes 128 aes 192 aes 256 Phase 2 IPSec
72. 36 efelde 21920131 Detailed explanation is shown below Item Description LAN Status IP Address Displays the IP address of the LAN interface TX Packets Displays the total transmitted packets at the Dray Tek 28 Vigor2130 Series User s Guide Item Description LAN interface RX Packets Displays the total received packets at the LAN interface TX Bytes Displays the total transmitted bytes at the LAN interface RX Bytes Displays the total received packets at the LAN interface IPv6 Address Displays the IPv6 address of the LAN interface WAN Status IP Displays the IP address of the WAN interface GW IP Displays the IP address of the default gateway Mode Displays the type of WAN connection e g PPPoE Up Time Displays the total uptime of the interface IPv6 Address Displays the IPv6 address of the LAN interface Primary DNS Displays the primary DNS server address for WAN interface Secondary DNS Displays the secondary DNS server address for WAN interface TX Packets Displays the total transmitted packets at the WAN interface RX Packets Displays the total number of received packets at the WAN interface TX Bytes Displays the total transmitted bytes at the WAN interface RX Bytes Displays the total received packets at the WAN interface Note The words in green mean that the WAN connection of that interface is ready for accessing Internet the words in red mean that the WAN connection of that interface i
73. 386 iso 42 1 MB of 321 6 MB 13 08 35 min 33 seconds remaining Downloading from 4 of 4 peers DL 134 1 KB s UL 0 bytes s Share the file after downloading completed l Access into Vigor2130 web configuration interface and open USB Application gt gt USB General Settings Enable the Disk Sharing function by checking the box and click OK USB Application gt gt USB General Settings USB General Settings Enable FTP Enable Disk Sharing Workgroup Name 2 Open USB Application gt gt Disk Shares Click Add a New Entry USB Application gt gt Disk Shares Disk Shares Add a Mew Entry Dray Tek 60 Vigor2130 Series User s Guide 3 In the following screen add a new entry for the sharing folder name In this case we give a name of bt_folder as Share Name for home folder Click OK USB Application gt gt Disk Share Add Disk Share Identification share Mame bt_folder Comment Settings olume Generic Flash Disk 2010M PORT 1 Wisible d Access Rule ACCESS All Users Read write carce 4 Now PCs in LAN connected to Vigor2130 can open a browser from his her computer Simply type 192 168 1 1 in the field of Address and then click Go a Google Microsoft Internet Explorer Sele File Edit View Favorites Tools Help Et J lt 2 x a A K Search 5p Favorites 4 M ee E 3s Address 192 168 1 1 l
74. 71 Dray Te k Clone MAC Address Enable Enable the feature It is available when the box of Enable is checked Click Clone MAC Address The result will be displayed in the field of MAC Address Enable Clone MAC Address MAC Address 00 0E A6 2A D5 A1 Mail SMS Alert Alert Types Specify the type of the alert mail SMS or Mail and SMS that Vigor system will use to send a message to the user Mail OMS Mail and Sits Event types Specify the event when the system must send a notification to the user by mail and or SMS After finishing all the settings here please click OK to activate them DHCP DHCP allows a user to obtain an IP address automatically from a DHCP server on the Internet If you choose DHCP mode the DHCP server of your ISP will assign a dynamic IP address for your router automatically It is not necessary for you to assign any setting WAN gt gt Internet Access WAN IP Configuration Enable Connection Type DHCP w WAN IP Alias DHCP Settings Router Name Vigor2130 The same as syslogs router name Domain Name Domain Name are required for some ISPs MTU Size Max MTU 1500 WAN Connection Detection Mode ARP w Clone MAC Address Enable F Mail SMS Alert Event types WaNUPE wan pown Dray Tek 72 Vigor2130 Series User s Guide Available settings are explained as follows Item DHCP Settings WAN Connection Detection Clone MAC Address Mail SMS Ale
75. AC VI and AC VO that need higher priorities in data transmission please set greater value for them to get highest transmission opportunity Specify the value ranging from 0 to 65535 ACM It is an abbreviation of Admission control Mandatory It can restrict stations from using specific category class if it is checked Note Vigor1000 provides standard WMM configuration in the web page If you want to modify the parameters please refer to the Wi Fi WMM standard specification AckPolicy Uncheck default value the box means the AP router will answer the response request while transmitting WMM packets through wireless connection It can assure that the peer must receive the WMM packets Check the box means the AP router will not answer any response request for the transmitting packets It will have better performance with lower reliability Click OK to save the settings D ro y Ti e k 200 Vigor2130 Series User s Guide 4 10 7 WDS WDS means Wireless Distribution System It is a protocol for connecting two access points AP wirelessly Usually it can be used for the following application Provide bridge traffic between two LANs through the air Extend the coverage range of a WLAN To meet the above requirement two WDS modes are implemented in Vigor router One is Bridge the other is Repeater Below shows the function of WDS bridge interface LANS LANI Vigor2130 Series User s Guide 201 Dr ay Te
76. AES MDS 3DES SHAI 3DES MDS 3DES MDS 3DES SHAI AES 256 MDS AES 256 SHAI AES 128 MDS AES 128 SHAI AES 192 MDS AES 192 SHAI AES 256 MDS AES 256 SHAI Vigor2130 Series User s Guide Case 2 VPN direction from Vigor2820 to Vigor2130 VPN configuration on Vigor2130 l Create a LAN to LAN profile VPN and Remote Access gt gt LAN to LAN Edit VPN Tunnel General Enabled Name Demo Remote IP fated bse IKE phase 1 mode Main Mode Authentication Type Pre Shared Key Pre Shared Key eso Confirm Pre Shared Key eos Local Identity Networks Local Network Mask 192 168 30 0 i 255 255 255 0 Remote Network Mask j 255 255 255 0 Advanced Security Settings IKE phase 1 proposal ut omatic SHAL NDS IKE phase 2 proposal Perfect Forward Secrecy Enable it and give it a name In this example the profile name is Demo Enter WAN IP address of Vigor2820 in the Remote IP field Select Main Mode as IKE phase 1 mode Setup a pre shared key which must be the same as in Vigor2820 Enter Vigor2130 s private network in the Local Network Mask field Enter Vigor2820 s private network in the Remote Network Mask field Use default value Automatic for IKE phase and phase 2 proposals Se tS st eS Nn After the VPN is connected you can monitor the status VPN and Remote Access gt gt LAN to LAN VPN Site to Site Tunnels IPSec
77. AN to WAN in bridge mode and type a different VLAN ID number WAN gt gt 802 10 VLAN Tag Configuration 807 10 VLAN Tag Configuration Q E Enable Multi VLAN Setup WAN VLAN Setting WAN VLAN ID Ba 2 VoIP WAN VLAN Setting Enable VolP WAN Setup VoIP WAN VLAN ID E 93 VolP WAN Settin LAN VLAN Setting VLAN Enable ID P1 P2 P3 P4 LAWNAT Bridge L Brdgez oO Bridge3 4 a6 Note Pi is reseaned for NAT Route use Cancel Vigor2130 Series User s Guide 35 Dray Te k ll Example Chart of Structure WAN VLAN ID 84 LAN VLAN ID 86 VoIP WAN VLAN ID 93 PPPoE VID 84 SS DHCP VID 93 v PPPoE VID 86 PC 1 connects to the first LAN port of Vigor2130 and accesses Internet with WAN VLAN PC 2 connects to the forth LAN port of Vigor2130 and accesses Internet with LAN VLAN FXS 1 Phone connects to the FXS 1 port of Vigor2130 registers sends and receives phone call with VoIP WAN Functions Configuration 1 Open WAN gt gt Internet Set PPPoE as the Connection Type and fill in the Username and Password offered by your ISP WAN gt gt Internet Access WAN IP Contiguration Enable F Connection Type PPPoE PPPoE Settings Usemame 84005755 hinet net Password eeeece Confirm Password LELLI Redial Policy Always On MTU Size WAN Connection Detection Mode ARP Ping IP OO0 Clone MAC Address Enable Dray Tek 36 Vigor2130 Series User s Guide 2 O
78. Bypass Login means no need to type username and password for accessing into Internet The user still can see the bulletin and the web page redirected Disable Bypass All means no need to type username and password And no bulletin will be displayed IP Bind List It displays a list for the IP bind to MAC information Add It allows you to add the one you choose from the ARP table or the IP MAC address typed in Add and Edit to the table of IP Bind List Edit It allows you to edit and modify the selected IP address and MAC address that you create before Delete You can remove any item listed in IP Bind List Simply click and select the one and click Delete The selected item will be removed from the IP Bind List Note Before you select Strict Bind you have to bind one set of IP MAC address for one PC If not no one of the PCs can access into Internet And the web configurator of the router might not be accessed Click OK to save the settings Vigor2130 Series User s Guide 107 Dray Te k 4 2 9 Web Portal Web portal a management program used for clients allows you to set login account e bulletin and URL redirection LAN gt gt Web Portal Web Portal Login Account Setting Timeout Setting Welcome Message Enable HTTP Enable HTTPS Disable Note Enable Login control all network traffic Disable Login only control WWV traffic Common account D P Share accounts in User Configura
79. CMP Type Filter Source IP etwo ICMP Type Value Source IP 00 0 ICMP Code Filter Address ICMP Code Value Source IP Mask Dest IP Dest IP Address Dest IP Mask Available settings are explained as follows Item Description Source IP Specify the Source IP filter for this ACE Network Any No source IP filter is specified Host Source IP filter is set to Host Specify the source IP address in the Source IP Address field that appears Network Source IP filter is set to Network Specify the source IP address and source IP mask in the Source IP Address and Source IP Mask fields that appear Source IP Address Type the Source IP Address here This option is available when you choose Host or Network as Source IP Source IP Mask Type the Source IP Mask here This option is available only when you choose Network as source Source IP Dest IP Filter Specify the destination IP filter for this ACE Dray Te k 124 Vigor2130 Series User s Guide Any No destination IP filter 1s specified Host Destination IP filter 1s set to Host Specify the destination IP address in the Dest IP Address field that appears Network Destination IP filter is set to Network Specify the destination IP address and destination IP mask in the DIP Address and Dest IP Mask fields that appear Dest IP Address Type the Dest IP Address here This option is available when you choose Host or Network as destination Dest IP Dest IP Mask Type t
80. CP UDP Port TCP UDP Port TCP UDP Port DSCP a Type Value Traffic Class 23 High 5060 High 25 a0 110 Medium Medium Medium Medium Low Note A QCL consists of an ordered list of up to 12 QCEs Available settings are explained as follows Item QCL QCE Type Type Value Traffic Class Description QCL QoS Control List allows users to set up to five QCL groups Each QCL group can contain 12 QCE QoS Control Entry settings QoS Control List Configuration QCE Type TCPAUOP Port 22 23 Display the type of QCE QoS Control Entries Display the value specified for the QCE QoS Control Entry Display the class of the data transmission for the QCE QoS Control Entry Adding a New QCE under QCL Click D to add a new QCE for the selected QCL Different QCE type will bring out different web settings Ifyou choose Ethernet Type as QCE Type you have to type value for it and specify traffic class from Low Normal Medium and High Vigor2130 Series User s Guide 151 Dray Tek Bandwidth Management gt gt QoS Control List QCE Configuration QCE Type Ethernet Type Ethernet Type Value x FFFF Trafic Class Available settings are explained as follows Item Description Ethernet Type Value Either 8 63 ASCII characters such as 012345678 or 64 Hexadecimal digits leading by 0x such as 0x321253abcde Traffic Class Specify traffic class from L
81. Confirm Password Po Allow Disk Sharing Allow IPSEC L2TP Allow PPTP Allowed Dial In Type Remote Dial in Client Assign Static IP Address F OoOo d Allow FTP Allow TELNET C Allow Web Fortal Login F Note PPTP IPSEC user may also need the Remote Access Control settings Available settings are explained as follows Item Description Enable Check this box to enable such user profile Username Type a name for this user Full Name Type full name for this user Password Type the password for this user Confirm Password Type the password again for confirmation Allow Disk Sharing Check this box to have the remote user share the disk information Allow IPSEC L2TP Check this box to let the remote user connecting to this device through IPSEC L2TP Allow PPTP Check this box to let the remote user connecting to this device through PPTP When such user profile needs to have PPTP LAN to LAN connection the following three items must be adjusted Allowed Dial In Type Specify the type Remote Dial In Client LAN to LAN for PPTP connection Assign Static IP Address Type a static IP address if remote Dial In Client is selected as Dial In Type Local Network Mask Traffic between this subnet and the subnet specified in Remote Network Mask will travel through the VPN tunnel Type the address es if LAN to LAN is selected as Dial In Type Remote Network Mask Add a static route to direct all Vigor2130 Se
82. D F ay Ti e k 110 Vigor2130 Series User s Guide 4 3 NAT Usually the router serves as an NAT Network Address Translation router NAT is a mechanism that one or more private IP addresses can be mapped into a single public one Public IP address is usually assigned by your ISP for which you may get charged Private IP addresses are recognized only among internal hosts When the outgoing packets destined to some public server on the Internet reach the NAT router the router will change its source address into the public IP address of the router select the available public port and then forward it At the same time the router shall list an entry in a table to memorize this address port mapping relationship When the public server response the incoming traffic of course is destined to the router s public IP address and the router will do the inversion based on its table Therefore the internal host can communicate with external host smoothly The benefit of the NAT includes Save cost on applying public IP address and apply efficient usage of IP address NAT allows the internal IP addresses of local hosts to be translated into one public IP address thus you can have only one IP address on behalf of the entire internal hosts Enhance security of the internal network by obscuring the IP address There are many attacks aiming victims based on the IP address Since the attacker cannot be aware of any private IP addresses the NAT funct
83. Dray Te k 184 Vigor2130 Series User s Guide 4 9 2 Local Certificate This page displays the certificate which will be authenticated for network connection Note that it must be issued by Trusted CA Certificate first You have to generate a local certificate to be signed by trusted CA no matter My Root CA or other Root CA After that import the signed certificate to this page Certificate Management gt gt Local Certificate Installed Certificates Auto refresh Local Certificates Name Subject Issuer Valid From Expires Status Mio Ceriicates Installed Available settings are explained as follows Item Description Auto refresh Click the button to refresh current page automatically Refresh Click the button to refresh current page whenever you want Name Display the name of the certificate Subject Display the subject information Issuer Display the name of the issuer Valid From Display the starting time for the valid Root CA Expires Display the ending time for the valid Root CA Status Display if such certificate is Active illegal and available certificate or Requesting needed to be signed by CA GENERATE Allows you to create a new local certificate and local certificate request Later it can be issued by Trusted CA Next import the issued information in this page to be the local certificate for network connection IMPORT Allows you to import a certificate which has been issued by Trusted CA Certificate
84. E Standard 802 3 half duplex flow control operation Restart It determines whether the MAC retransmits frames after an excessive collision has occurred If set a frame is not dropped after excessive collisions but the backoff sequence is restarted This is a violation of IEEE Standard 802 3 but is useful in non dropping half duplex flow control operation Power Control The Configured column allows for changing the power savings mode parameters per port Disabled All power savings mechanisms disabled ActiPHY Link down power savings enabled PerfectReach Link up power savings enabled Enabled Both link up and link down power savings enabled Refresh Click this button to refresh the information for LAN port After finishing all the settings here please click OK to activate them Dray Tek 98 Vigor2130 Series User s Guide 4 2 3 MAC Address Table This page allows you to set timeouts for entries in dynamic MAC Table and configure the static MAC table here LAN gt MAC Address Table MAC Address Table Configuration Aging Configuration Disable Automatic Aging Age Time J0 seconds MAC Table Learnina Auto Disable Secure Static MAC Table Configuration Port Members Delete VLAN ID MAC Address LAN1 LAN LAN LANA Add New Static Entry Available settings are explained as follows Item Description Aging Configuration Disable Automatic Aging Stop the MAC table aging timer the learned MAC
85. Ej co Links Web Images Videos Maps News Shopping Gmail more iGoogle Search settings Sign in Advanced Search Language Tools Google Search I m Feeling Lucky Vigor2130 Series User s Guide 61 Dray Tek 6 Dray Tek The sharing disk with the name of bt_folder created above will be shown as the following figure E 192 168 1 1 Microsoft Internet Explorer File Edit view Favorites Tools Help Back S P Search a Folders E Address g 1192 168 1 1 v aN 4 bt_folder Network Tasks a Add a network place View network connections Set up a home or small office network y 2 Set up a wireless network For a home or small office gly View workgroup computers cy Show icons for networked UPnP devices Other Places gly Unknown ig My Computer My Documents Cy Shared Documents Gay Printers and Faxes Double click bt_ folder to view the files in the disk bt_folder on Samba Server 192 168 1 1 Microsoft Internet Explorer File Edit View Favorites Tools Help v Eco ink File and Folder Tasks a downloads Make a new folder a Publish this Folder to the Web opkg install Other Places Samba Server 192 168 1 1 My Documents Shared Documents i My Computer My Network Places Details 62 FinalDataEnterprise_20_2 transmission Vigor2130 Series User s Guide torrents Microsoft I
86. Filter Specify the destination IP filter for this ACE DIP Filter l Network Any No destination IP filter is specified Host Destination IP filter is set to Host Specify the destination IP address in the destination IP Address field that appears Network Destination IP filter is set to Network Specify the destination IP address and destination IP mask in the destination IP Address and destination IP Mask fields that appear Dray Tek 128 Vigor2130 Series User s Guide Dest IP Address Dest IP Mask Source Port Filter Source Port No Source Port Range Dest Port Filter Dest Port No Dest Port Range TCP FIN Vigor2130 Series User s Guide Type the destination IP Address here This option is available when you choose Host or Network as destination IP filter Type the destination IP Mask here This option is available only when you choose Network as destination IP filter Specify the TCP port source filter for this ACE source Port Filter Any No TCP source filter 1s specified Specific If you want to filter a specific TCP source filter with this ACE you can enter a specific TCP source value A field for entering a TCP source value appears Range If you want to filter a specific TCP source range filter with this ACE you can enter a specific TCP source range value A field for entering a TCP source port range appears Type the value if you choose Specific as the Source Port Filter The
87. LA with other DS domain owners to define the service level provided toward traffic from different domains Then each DS node in these domains will perform the priority treatment This is called per hop behavior PHB The definition of PHB includes Expedited Forwarding EF Assured Forwarding AF and Best Effort BE AF defines the four classes of delivery or forwarding classes and three levels of drop precedence in each class Vigor routers as edge routers of DS domain shall check the marked DSCP value in the IP header of bypassing traffic thus to allocate certain amount of resource execute appropriate policing classification or scheduling The core routers in the backbone will do the same checking before executing treatments in order to ensure service level consistency throughout the whole QoS enabled network Private Network DS domain 1 DS domain 2 However each node may take different attitude toward packets with high priority marking since it may bind with the business deal of SLA among different DS domain owners It s not easy to achieve deterministic and consistent high priority QoS traffic throughout the whole network with merely Vigor router s effort In the Bandwidth Management menu click QoS Control List to open the web page Dray Tek 150 Vigor2130 Series User s Guide Bandwidth Management gt gt QoS Control List QoS Control List Configuration acl MR QCE Type TCP UDP Port TCP UDP Port TCP UDP Port T
88. LAM iP ShowHide soll LAN eee SSID 1 DrayTek O0 o SSID 2 Show Y DrayTek SSID 3 soll 4 Wireless Wlode Mixed 11b 11g4 11ni Channel Width Channel Channel 11 2462MHz Extension Channel Channel 7 2442MHz Tx Power 100 Enable Green AP Enable IGMP Snooping Isolate LAN Wireless clients stations with the same SSID cannot access wired PCs on LAN Isolate Member Wireless clients stations with the same SSID cannot access for each other SSID 1 SSID 2 SSID 3 SSID 4 Wireless Security Confiquration WPS Configuration configure via Push Button Stat PBC Configure via Client PinCode OoOo Available settings are explained as follows Item Description General Setting Enable Wireless LAN Check the box to enable the wireless function Show Hide Choose Show to make the SSID being seen by wireless clients Choose Hide to prevent from wireless sniffing and make it Vigor2130 Series User s Guide 189 Dr ay Te k Dray Tek Wireless Security Configuration harder for unauthorized clients or STAs to join your wireless LAN SSID It means the identification of the wireless LAN SSID can be any text numbers or various special characters The default SSID is DrayTek We suggest you to change it Isolate LAN Check this box to make the wireless clients stations not accessing the PC with wired connection Isolate Member Check this box to make the wireless clients stations with the same SSID not access
89. MF Relay Display DTMF mode that configured in the advanced settings page of Phone Index Tone Settings Region Select the proper region which you are located If you cannot find out a suitable one please choose User Defined and fill out the corresponding values for dial tone ringing tone busy tone congestion tone by yourself for VoIP phone If you choose User Defined the Advanced button will be available for you to click to set the detailed configuration Advanced setting allows you to adjust tone settings manually if you choose User Defined TOn1 TOffl TOn2 and TOff2 mean the cadence of the tone pattern TOn and TOn2 represent sound on TOffl and TOff2 represent the sound off 226 Vigor2130 Series User s Guide VoIP gt gt Phone Setting Tone Settings Region Low Freq High Freq Toni T off 1 Ton2 Hz Hz G msec msec 7 msec Poon Dial tone 0 0 0 0 0 0 Ringing tone 0 a 0 o 10 0 Busy tone a 0 a 0 0 0 Also you can specify each field for your necessity It is recommended for you to use the default settings for VoIP communication RTP Symmetric RTP Check this box to invoke the function To make the data transmission going through on both ends of local router and remote router not misleading due to IP lost for example sending data from the public IP of remote router to the private IP of local router you can check this box to solve this problem Dynamic RTP Port Start Specifies th
90. P or Domain The format is represented as hours minutes seconds Total number of transmitted voice packets during this connection session Total number of received voice packets during this connection session Total number of lost packets during this connection session The jitter of received voice packets Accumulation for the times of in call Accumulation for the times of out call Accumulation for the times of missing call The volume of present call Display logs of VoIP calls IPv6 Connection Type Link Local Onh IPvo Address Prefix Length Link Local Only fed0 250 rte00 2 Dray Tek 232 Vigor2130 Series User s Guide WAN IPv6 Configuration IPvo Connection Type Link Local Only w Link Local Only Link Local Onl Static IPv6 ee eE sig Client IA_NA Prefix Length DHCP 6 Client A_PD ACCU Link Local Only Link Local address is used for communicating with neighbouring nodes on the same link It is defined by the address prefix fe80 10 You don t need to setup Link Local address manually for it is generated automatically according to your MAC Address IPv6 gt gt WAN General Setup IPv6 Address Prefix Length OK Available settings are explained as follows Item Description IPv6 Address The least significant 64 bits are usually chosen as the interface hardware address constructed in modified EUI 64 format Prefix Length Display the fixed value 64 for prefix
91. P Filter Type the Sender IP Mask here This option is available only when you choose Network as Sender IP Filter Specify the target IP filter for this specific ACE Target IP Filter Choose Any to filter all of the packets Choose Host to filter the packets from the host with the address typed in Target IP Address filed Choose Network to filter the packets within the network defined in Target IP Address and Target IP Mask fields Type the Target IP Address here This option is available when you choose Host or Network as Target IP Filter Type the Target IP Mask here This option is available only when you choose Network as Target IP Filter Specify whether frames packets can meet the action according to the sender hardware address field SHA settings ARP SMAC Match 0 means sender hardware address is not equal to the SMAC 122 Vigor2130 Series User s Guide RARP DMAC Match IP Ethernet Length IP Ethernet Vigor2130 Series User s Guide address 1 means sender hardware address is equal to the SMAC address Any means any value is allowed Specify whether frames can hit the action according to their target hardware address field THA settings RARP DMAC Match 0 means target hardware address is not equal to the SMAC address 1 means s target hardware address is equal to the SMAC address Any means any value is allowed Specify whether frames packets can meet the action according t
92. PPPoE PPTP L2TP or DHCP server Primary IP Address You must specify a DNS server IP address here because your ISP should provide you with usually more than one DNS Server If your ISP does not provide it the router will automatically apply default DNS Server IP address 194 109 6 66 to this field Secondary IP Address You can specify secondary DNS server IP address here because your ISP often provides you more than one DNS Server If your ISP does not provide it the router will automatically apply default secondary DNS Server IP address 194 98 0 1 to this field The default DNS Server IP address can be found via Online Status If both the Primary IP and Secondary IP Address fields are left empty the router will assign its own IP address to local users as a DNS proxy server and maintain a DNS cache If the IP address of a domain name is already in the DNS cache the router will resolve the domain name immediately Otherwise the router forwards the DNS query packet to the external DNS server by establishing a WAN e g DSL Cable connection After finishing all the settings here please click OK to activate them D ro y Ti e k 96 Vigor2130 Series User s Guide 4 2 2 Ports Ports page is used to change the setting for LAN ports You can set or reset the following items All of them are described in detail below LAN gt gt Ports Forn Configuration Refresh Speed Flow Control Excessive i Maximum Power Frame
93. Pre Shared Key eee Confirm Pre Shared Key eee l Local Identity Wi g or2130 Remote Identity Wvigor2 620 Hetworks IKE phase 1 proposal Automatic l IKE phase 2 proposal Automatic st Perfect Forward Secrecy Fi 2 Enable it and give it a name In this example the profile name is Demo Enter Vigor2820 s WAN IP address in the Remote IP field 4 Select Aggressive Mode as IKE phase 1 mode Dray Tek 46 Vigor2130 Series User s Guide 5 Setup a pre shared key which must be the same as in Vigor2820 6 Setup the Local Identity and Remote Identity which are for Vigor2130 and Vigor2820 respectively During IPSec Aggressive mode negotiation the VPN client must send its identity to the VPN server for verification The VPN client may also verify the identity of the VPN server which is optional In this example we setup vigor2130 as the identity of Vigor2130 and vigor2820 as the identity of Vigor2820 7 Enter Vigor2130 s private network in the Local Network Mask field Enter Vigor2820 s private network in the Remote Network Mask field 8 Use default value Automatic for IKE phase 1 and phase 2 proposals 9 Click OK 10 Accessing the VPN network of Vigor2820 from a PC behind Vigor2130 to initiate the VPN connection for example ping 192 168 1 x from a PC 192 168 30 x Vigor2130 will be triggered to dial the IPSec VPN to Vig
94. SMS provider Type the mobile phone number that you want it to receive the SMS Type the total number of the messages that the router will send out Type the shortest time interval for the system to send SMS For example it is set with 60 seconds If WAN1 disconnects for three times within 60 seconds the system will send the SMS notification just for once Type a brief description which will be sent to the receiver when such profile is enabled and selected Send one SMS to the user just for test 168 Vigor2130 Series User s Guide 2 When you finished the configuration click OK to save and return to previous page Applications gt gt SMS SMS Configuration Profile Service Destination Status warning textmarketer 09552013 vA Add 4 8 VPN and Remote Access A Virtual Private Network VPN is the extension of a private network that encompasses links across shared or public networks like the Internet In short by VPN technology you can send data between two computers across a shared or public network in a manner that emulates the properties of a point to point private link Below shows the menu items for VPN and Remote Access VPN and Remote Access Remote Access Control PPTP Remote Dialin PSec Remote Dialin Remote Dial in Status LAN to LAN 4 8 1 Remote Access Control Enable the necessary VPN service as you need If you intend to run a VPN server inside your LAN you should enable IPSec VPN Pass
95. Security There are four types for security Disabled WEP TKIP and Key or Peer Mac Address field valid or not Choose one of the types for the router Please disable the unused link to get better performance Key Type 8 63 ASCII characters or 64 hexadecimal digits leading by 0x Peer Mac Address Four peer MAC addresses are allowed Dray Te k 202 Vigor2130 Series User s Guide to be entered in this page at one time Phy Mode There are three types of transmission rates developed by different techniques for Phy Mode Data will be transmitted via communication channel CCK If 802 11b wireless mode is used please choose such type as the Phy Mode OFDM If 802 11g wireless mode is used please choose such type as the Phy Mode HTMIX If 802 1 1b g n wireless mode is used please choose such type as the Phy Mode Both clients local and remote must use the same Phy Mode to have the same transmission rate Click OK to save the settings 4 11 USB Application USB storage disk can be regarded as an FTP server By way of Vigor router clients on LAN can access write and read data stored in USB storage disk After setting the configuration in USB Application you can type the IP address of the Vigor router and username password created in USB Application gt gt FTP User Setting on the FTP client software Thus the client can use the FTP site USB storage disk through Vigor router USB Application Disk Status F
96. T KaZaA Gnutella WinMX eMule and others Internet Camera etc Ensure that you keep the application involved up to date to avoid falling victim to any security exploits To add a new open port click Add New Entry NAT gt gt Open Port Enable Mame Protocol TCP UDP WAN IF Start Fort End Port optional Local Host Local Port optional Dray Te k 112 Vigor2130 Series User s Guide Available settings are explained as follows Item Enable Name Protocol WAN IP Start Port End Port optional Local Host Local Port optional Click OK to save the settings Vigor2130 Series User s Guide Description Check this box to enable this function Specify the name for the defined network service Specify the transport layer protocol It could be TCP UDP and TCP UDP TCP UDP TCP UDP TCP UDP Specify one WAN IP address to be used by such profile The default setting is ALL which mean such profile can be applied for all the WAN IP addresses 102 WARN IP Alias Specify the starting port number of the service offered by the local host Specify the ending port number of the service offered by the local host Enter the private IP address of the local host If it is configured the forwarded traffic 1s mapped to this port on the local host 113 Dray Tek 4 3 3 DMZ Host As mentioned above Port Redirection can redirect incoming TCP UDP or other traffic on
97. The connection status and control status will be able to be activated The NAT Traversal of UPnP enables the multimedia features of your applications to operate This has to manually set up port mappings or use other similar methods The screenshots below show examples of this facility Address S Network Connections IP Broadband Connection on Router Status P7 Eg Broadband a y Network Tasks General hinet m Disconnected WAN Miniport PPPOE E Create a new connection Set up a home or small Internet Gateway office network Status Connected Diaki Duration 00 19 06 See Al f ee Also eee Speed 100 0 Mbps i Network Troubleshooter SA Disconnected x zdj S DrayTek ISDN PRP Activity Internet Internet Gateway My Computer Other Places Internet Gateway w a G Control Panel ir IP Broadband Connection on 7 r Rout E My Network Places sane Pake 3 My Documents 3 Sent 404 734 i My Computer Recenved 1 115 BBE __LAN or High Speed Internet Details Local Area Connection 4 Enabled Co Realtek RTL8139 810x Family Network Connections System Folder The UPnP facility on the router enables UPnP aware applications such as MSN Messenger to discover what are behind a NAT router The application will also learn the external IP address Vigor2130 Series User s Guide 165 Dr ay Te k and configure port mappings on the router Subsequently such a facility forw
98. Tx Late Exc Coll Rx Undersize Rx Oversize Rx Fragments Rx Jabber Rx Filtered Transmit Size Counters Tx 64 Bytes Tx 65 127 Bytes Tx 128 255 Bytes Tx 256 511 Bytes Tx 512 1023 Bytes Tx 1024 1526 Bytes Tx 1527 Bytes Transmit Queue Counters Transmit Error Counters Each item is explained as follows Item WAN LAN Auto refresh Refresh Clear Receive Total Receive Size Counters Dray Tek Description Choose WAN or LAN to display the corresponding statistics Check it to enable auto refresh function Click it to reload the page Click it to clear the counters for all ports Rx Packets Display the counting number of the packet received Rx Octets Display the total received bytes Rx Unicast Display the counting number of the received unicast packet Rx Broadcast Display the counting number of the received broadcast packet Rx Pause Display the counting number of the received pause packet RX 64 Bytes Display the number of 64 byte frames in 270 Vigor2130 Series User s Guide Receive Queue Counters Receive Error Counters Transmit Total Transmit Size Counters Vigor2130 Series User s Guide good and bad packets received RX 65 127 Bytes Display the number of 65 127 byte frames in good and bad packets received RX 128 255 Bytes Display the number of 128 255 byte frames in good and bad packets received RX 256 511 Bytes Display the number of 256 511 byte
99. User s Guide 4 8 3 IPSec Remote Dial in This page allows you to configure IPSec Site to Client settings VPN and Remote Access gt gt Remote Dial in Setup IPSec Site to Client Mobile VPN Mobile VPN Type Mobile VPN Type Disabled h Authentication Type Pre shared Secret Shared Secret shared Secret again Advanced Security Settings Phase 1 IKE shal md5 group2 gqroup5 Phase 2 IPSec shat md5 Available settings are explained as follows Item Description Mobile VPN Type This usually applies to those are remote dial in user or node LAN to LAN which uses dynamic IP address and IPSec related VPN connections such as L2TP over IPSec and IPSec tunnel L TP lPsec Dynamic VPN IPsec L2TP lPsec Disabled Ignore the configurations set in this page Dynamic VPN IPSec Traffic between this subnet and the client will travel through the VPN tunnel If you choose this type please specify the IP address and subnet mask for local network Mobile VPN Type Mobile VPN Type Dynamic VPN IPsec Local Network Mask 0 0 0 0 0 0 0 0 L2TP IPSec The range must not overlap the DHCP address range 1f enabled and must allow for at least one IP address Example 0 10 137 240 10 10 137 245 If you choose this type please specify the IP address range for L2TP IPSec mode IPSec Site to Client Mobile VPN Mobile VPN Type Mobile YPN Type L2TP IPsec v L
100. WAN IP Configuration Connection Type PPPoE sername Password Confirm Password Redial Policy Always On ha Clone MAC Address Enable Clone MAC Address lt Back Next gt cancel Available settings are explained as follows Item Description User Name Assign a specific valid user name provided by the ISP Password Assign a valid password provided by the ISP Redial Policy If you want to connect to Internet all the time you can choose Always On Otherwise choose Connect on Demand Connect on Demand Connect on Demand Idle Time Out Set the timeout for breaking down the Internet after passing through the time without any action Vigor2130 Series User s Guide 21 Dray Te k Item MTU Size Enable Clone MAC Address Description It means Max Transmit Unit for packet The default setting will be specified by the system automatically Therefore keep this field in blank The router will detect the MAC address automatically Or check the box to enable MAC address cloning It is available when the box of Enable is checked Click Clone PC Address The result will be displayed in the field of MAC Address Enable Clone MAC Address MAC Address 00 0E A6 2A D5 A1 After finishing the settings here please click Next PPTP L2TP If you click PPTP L2TP as the protocol please manually enter the Username Password provided by your ISP and all the required information Quick Start Wizard
101. X 10Mbps HDX If flow control is enabled by checking Configured box both parties can send PAUSE frame to the transmitting device s if the receiving port is too busy to handle If not there will be no flow control in the port It drops the packet if too much to handle Current Rx indicates whether pause frames on the port are obeyed Current Tx indicates whether pause frames on the port are transmitted This module offers 1518 9600 Bytes length to make the long packet for data transmission There are two modes for you to choose when excessive collision happened in half duplex condition Discard Restart Discard It determines whether the MAC drops frames after an excessive collision has occurred If yes a frame is dropped after excessive collision This is IEEE Standard 802 3 half duplex flow control operation Restart It determines whether the MAC retransmits frames after an excessive collision has occurred If set a frame is not dropped after excessive collisions but the backoff sequence 1s restarted This is a violation of IEEE Standard 802 3 but is useful in non dropping half duplex flow control operation The Configured column allows for changing the power savings mode parameters per port Enabled ha Disabled All power savings mechanisms disabled ActiPHY Link down power savings enabled PerfectReach Link up power savings enabled Enabled Both link up and link down power savings enable
102. a and the choice will affect the performance of the VPN tunnel User Name Display the dial in user account Interface Display the connection name assigned by the router Remote IP Display IP address of remote client Local IP Display the given local IP address of a client Vigor2130 Series User s Guide 175 Dray Tek Login Time Display the system time that the user logs in Rx bytes Display the data total received for such client Tx bytes Display the data total transmitted for such client 4 8 5 LAN to LAN Here you can manage LAN to LAN connections by maintaining a table of connection profiles You may set parameters including specified connection peer ID connection type and corresponding security methods etc The router supports two VPN tunnels for IPSec and PPTP by providing up to 2 profiles The following figure shows the summary table VPN and Remote Access gt gt LAN to LAN VPN Site to Site Tunnels IPSec Auto refresh le Up Time Packets Bytes Packets Bytes 123 61 2164761 Add Tunnel Name Endpoint IKE Alg ESP Alg VPN Site to Site Tunnels PPTP Name Remote IP Virtual Network Tk Rx Wo PETE Tunnels Add Tunnel Available settings are explained as follows Up Time Packets Bytes Packets Bytes Item Description Auto refresh Check this box to make the system refresh this page automatically Refresh Click this button to refresh the page immediately Name Indicate the nam
103. a proper way for your VoIP call Mone w None 224 Vigor2130 Series User s Guide SIP Port Domain Realm Proxy Act as Outbound Proxy Display Name Account Number Name Authentication ID Phone Number Password Expiry Time Ring Port Ring Pattern Set the port number for sending receiving SIP message for building a session The default value is 5060 Your peer must set the same value in his her Registrar Set the domain name or IP address of the SIP Registrar server Set domain name or IP address of SIP proxy server By the time you can type port number after the domain name to specify that port as the destination of data transmission e g nat draytel org 5065 Check this box to make the proxy acting as outbound proxy The caller ID that you want to be displayed on your friend s screen Enter your account name of SIP Address e g every text before Check the box to invoke this function and enter the name or number used for SIP Authorization with SIP Registrar If this setting value is the same as Account Name it is not necessary for you to check the box and set any value in this field Check the box to invoke this function The number typed here will be sent out as the caller ID The password provided to you when you registered with a SIP service The time duration that your SIP Registrar server keeps your registration record Before the time expires the router will send another re
104. able to match this entry 1 TCP frames where the SYN field is set must be able to match this entry Any Any value is allowed TCP RST Specify the TCP RST value for this ACE 0 TCP frames where the RST field is set must not be able to match this entry 1 TCP frames where the RST field is set must be able to match this entry Any Any value is allowed TCP PSH Specify the TCP Push Function PSH value for this ACE 0 TCP frames where the PSH field is set must not be able to match this entry 1 TCP frames where the PSH field is set must be able to match this entry Any Any value is allowed TCP ACK Specify the TCP Acknowledgment field significant ACK value for this ACE Dray Tek 130 Vigor2130 Series User s Guide TCP URG 0 TCP frames where the ACK field is set must not be able to match this entry 1 TCP frames where the ACK field is set must be able to match this entry Any Any value is allowed Specify the TCP Urgent Pointer field significant URG value for this ACE 0 TCP frames where the URG field is set must not be able to match this entry 1 TCP frames where the URG field is set must be able to match this entry Any Any value is allowed Choose IPv4 as the Frame Type You will see IP Parameters on the bottom of the page If you choose Other as IP Protocol Filter you will get the page as the following IP Parameters IP Protocol Filter IP Protocol Value
105. ach station using only one out of the four keys WPA Wi Fi Protected Access the most dominating security mechanism in industry is separated into two categories WPA personal or called WPA Pre Share Key WPA PSK and WPA Enterprise or called WPA 802 1x In WPA Personal a pre defined key is used for encryption during data transmission WPA applies Temporal Key Integrity Protocol TKIP for data encryption while WPA2 applies AES The WPA Enterprise combines not only encryption but also authentication Since WEP has been proved vulnerable you may consider using WPA for the most secure connection You should select the appropriate security mechanism according to your needs No matter which security suite you select they all will enhance the over the air data protection and or privacy on your wireless network The Vigor wireless router is very flexible and can support multiple secure connections with both WEP and WPA at the same time Below shows the menu items for Wireless LAN Dray Tek 188 Vigor2130 Series User s Guide t Wireless LAN s General Setup F Access Control station List 5 Point Discovery ehh Configuration E Wi D B 4 10 2 General Setup By clicking the General Setup a new web page will appear so that you could configure the SSID and the wireless channel Please refer to the following figure for more information Wireless LAN gt gt General Setup General Setting ms Isolate Isolate Enable Wireless
106. address will not age out automatically The default setting is enabled Check the box to disable this function if required Age Time Delete a MAC address idling for a period of time from the following MAC Table which will not affect static MAC address Range of MAC Address Aging Time is 10 1000000 seconds The default Aging Time is 300 seconds MAC Table Learning List the port members which apply dynamic learning mechanism or not Auto Enable this port MAC address dynamic learning mechanism Disable Disable this port MAC address dynamic learning mechanism only support static MAC address setting Secure Disable this port MAC address dynamic learning mechanism and copy the dynamic learning packets to CPU Static MAC Table Specify static MAC address with VLAN ID to apply aging Config configuration Delete Click the button to remove the VLAN setting VLAN ID Specify the interface for the port members MAC Address It is a six byte long Ethernet hardware address and usually expressed by hex and separated by hyphens For example 00 40 C7 D6 00 02 WAN LANI1 4 Check the port to apply this VLAN Vigor2130 Series User s Guide 99 Dray Te k setting To add a new static MAC entry click Add new static entry A new entry will be shown as follows Choose a VLAN ID and type a new MAC address Next specify port member for this table Finally click OK to save the changes Static MAC Table Configuratio
107. aeeseeceeeeessauaaseeeeeessssaaeeeeeeess 199 AOF AND a E se psnooeeusenneeceesd tec soeeccimadecteeccamsaeeeee 201 4 11 USB Applicat M ssicciesinedivesnseessveenceavenedinsseteedatneedeeienwesadsaseetendatsneueanedusvudeosmenstnetedeedxtnecendeeo ete 203 AT Dek AUIS e E E E A 203 4 11 2 Formal DISK exXl2 3 wscsenctecasannentataastanad e ea a A eA AE aaae 204 ATF XO ONC a E a 205 4 11 4 FTP User Management cccccccssseecceeseeecceseeeceaseeceeaeeeseaseeessaeeesseuseeeseeseeessaeees 206 BV IS INS ear E ee eines ous meiss E E sates E 207 4 11 6 Bit Torrent Download ce ccccecccceececceeeeceeeeecaeeeeseeeeeseuceeseeesseueeesueessaeeesseeeseeeeesanees 209 4 11 7 iTunes Server on cece cece eeeecccccceeeeecececaeeeeeeceaessceeeceuseeeeessaseeeeeeceeeseceeesseaeceeesaaaeeeeesaeenens 211 4 11 8 DLNA S IrVel ccccccccscsccsssesssseseseeeeeeeeececeeeeseessaaassssseeeeeeeeeeeeeseeesseeaaaaseeeeeeeeeeeesenes 212 4 11 9 Temperature SQNSOM cccccccccceseccceeeceeeeseeeceeeeeeeeeeeeceeeeseeeeeeceeeesssssaaaeeeeeeesssaaaeseeeees 213 PA ON ig e tear gacieea cena cg ate E E 215 a VAM I Al E E A E EEEE EE EEEE EE T ETENE A 216 4122 SIP ACCOUNTS erisnimien iTr sseearetscancvedeassscossaasaaconestse 223 412a PHONE SENOS saosin co adn aceon canaratsdycataensedssavsdqacoiesaaacseacie tos arere erdia aiii 226 AA a E E E suqeusedscemauatesiescopssuessosnausseesateasten anaes 231 Al NPG ee S wncignne adiaasaat aie gaeessnouscatoses as
108. age you need to go back to Control Panel gt Printers and edit the property of the new printer you have added amp Brother HL 1070 Properties General Sharing Ports Advanced Device Settings 9 a Brother HL 1070 Print to the following port s Documents will print to the first free checked port Port Description O 3 250 Standard TCP IP Port 1 Standard TCP IP Port 1 Standard TCP IP Port 1 Standard TCP IP Port 1 Standard TCP IP Port 1 Standard TCP IP Port Local Pot Printer Epson Stylus COLOR 1160 HP LaserJet 1300 Brother HL 1070 PDF995 11 Select LPR on Protocol type p1 number 1 as Queue Name Then click OK Next please refer to the red rectangle for choosing the correct protocol and UPR name Configure Standard TCP IP Port Monitor Port Settings Port Name IP_ 192 168 1 1 Printer Name or IP Address 192 168 1 1 Protocol Raw LPR Raw Settings LPR Settings e Queue Name CILPR Byte Counting Enabled C SNMP Status Enabled Vigor2130 Series User s Guide 13 Dr ay Te k The printer can be used for printing now Most of the printers with different manufacturers are compatible with vigor router Note 1 Some printers with the fax scanning or other additional functions are not supported If you do not know whether your printer is supported or not please visit www draytek com to find ou
109. age will be displayed USB Application gt gt Bit Torrent Download BT Default General Settings BT Function Enable Disable Stan e Listening Fort 49152 B5535 1025 65535 hax Peer Connections 1 100 Traffic Control Rate Limit Enable Enable Disable Max Download Rate KBps 2040 Max Upload Rate KBps 0 2040 Web Client Authentication Enable Enable Disable User Name fF e Password i ia Web Client Port Open Web Client Remote Management Enable Disable SL Lipo Note Format usb disk as NTFS will be more reliable 8 Click the link of Open Web Client to open another window AO Ume i A 0 Transfers HO0Bis O0Bis OSE Downloading Seeding Paused Filter EM Dray Tek 58 Vigor2130 Series User s Guide 9 Click Open A pop up dialog will appear ler Open Remove Pause Resume Pause All Resume All Lt ia kahl loll 0 Transfers Downloac Seeding Pausi Upload Torrent Files ent file to upload Select File Or enter a URL po C Start when added 10 Click Select File to open the following dialog Choose the seed of BT torrent file and click Open Sel dapper server ioop 10 olen Ej edubunt 8 04 1 addon hppa iso torent E edubuntu 8 04 1 addon ia64 iso torrent E edubunty 6 04 1 addon powerpe 130 torrent Ej edubunt 9 O4 addon spare iso torent E jeos 8 04 3 jeos 1396 iso torent fl kubuntu 9 04 altemate lp
110. ained as follows Item Description Connection Status It will bring out different pages to represent IPv6 disconnection connecting and connected Tunnel Information Display interface name used to send TSPC prefix tunnel mode local endpoint addresses remote endpoint address TSPC Prfix TSPC Prefixlen prefix length tunnel broker and so on Tunnel Status Disconnected The remote client doesn t connect to the tunnel server Connecting The remote client is connecting to the tunnel server Connected The remote client has been connected to the tunnel server Activity Sent sent to the tunnel RX bytes Received received from the tunnel RX bytes When the router connects to the tunnel broker the router will use RADVD to transmit the prefix to the PC on LAN Next the PC will generate one set of IPv6 public IP see the figure below Users can use such IP for connecting to IPv6 network Vigor2130 Series User s Guide 245 Dray Te k Microsoft Windows XP Chick 5 1 2600 LCG Copyright 19785 2601 Microsoft Corp C Documents and Settings user ipconfig Mindows IP Configuration Connect ion specif ic IP Address Subnet Mask IP Address IP Address IP Address Default Gateway 192 168 1 188 255 255 2558 2081 2 5cH 1583 74662 d9cl azesi4c52 21458 2681 ScH 1583 27408 221b fcfF feda 7AF6 FeR 21b fcfF fFeda 7AF6x9 172 168 1 1 fegh 250 78 FF sFe38 26135549 When your PC obtain
111. ained from AICCU service provider for IPv6 connection For the default setting simply use the word any For more details please refer to http www sixxs net tools aiccu This page defines the IPv6 connection types for LAN interface Possible types contain DHCPv6 Server and RADVD Each type requires different parameter settings IPv6 gt gt LAN General Setup LAN IPv6 Configuration IPv6 Address IPv6 Link local Address Enable Autoconfigquration Configuration Type IPv6 Start Address IPv6 End Address 2000 1 JBA fe80 200 f fe00 0 2000 0 0 0 10 ______ M 2000 0 0 0 FF M Available settings are explained as follows Item LAN IPv6 Configuration Vigor2130 Series User s Guide Description IPv6 Address Type static IPv6 address for LAN 237 Dray Tek Item Description IPv6 Link local Address It is used for communicating with neighbouring nodes on the same link It is defined by the address prefix fe80 10 You don t need to setup Link Local address manually for it is generated automatically according to your MAC Address RADVD Stateless The router advertisement daemon radvd sends Router Advertisement messages specified by RFC 2461 to a local Ethernet LAN periodically and when requested by a node sending a Router Solicitation message These messages are required for IPv6 stateless auto configuration Enable Check this box to enable RADVD function for IPv6 connection Adverti
112. al analog telephone 4 Connect detachable antennas to the router for Vigor2130 series n model 5 Connect one end of the power cord to the power port of this device Connect the other end to the wall outlet of electricity 6 Power on the router 7 Check the ACT and WAN LAN LEDs to assure network connections Analog Phone Analog Phone Power Adapter f m e al By Fak ue Power Switch l DO a For the detailed information of LED status please refer to section 1 1 Caution Each of the Phone ports can be connected to an analog phone only Do not connect the phone ports to the land line jack Such connection might damage your router Dray Tek 8 Vigor2130 Series User s Guide Stand Installation The Vigor2130 must be placed erectly Therefore you have to install a stand onto the router to make it standing firmly Please follow the figures listed below to finish the installation Vigor2130 Series User s Guide 9 Dr ay Te k 1 5 Printer Installation Dray Tek You can install a printer onto the router for sharing printing All the PCs connected this router can print documents via the router The example provided here is made based on Windows XP 2000 For Windows 98 SE Vista please visit www draytek com Printer Name 192 168 1 1 Port Name IP_192 168 1 1 Printer Before using it please follow the steps below to configure settings for connected computers or wir
113. am calling Username PPTP Password IPSec Tunnel PPP Authentication L2TP with IPSec Policy tone VJ Compression Server IP Host Name for VPN IKE Authentication Method such as draytek com or 123 45 67 89 Pre Shared Key IKE Pre Shared Key Digital Signature x 509 NONE IPSec Security Method O Medium AH i me High ESP DES without Authentication Index 1 15 in Schedule Setup _ 3 Dial In Settings Allowed Dial In Type PPTP Username 299 Password IPSec Tunnel L2TP with IPSec Policy None VJ Compression on O off IKE Authentication Method yl Specify Remote VPN Gatewa Pre Shared Key Peer VPN Server IP E X fi 17 1 25 gt LIKE Pre Shared Key escesegsen or Peer 1D C Digital Signature x 509 None IPSec Security Method Medium AH High ESP DES M 3pes M aes 4 TCP IP Network Settings RIP Direction From first subnet to remote network you have to My WAN IP Disable Remote Gateway IP 0 0 0 0 192 168 30 0 255 255 255 0 More Remote Network IP Route v Remote Network Mask Change default route to this VPN tunnel Only single WAN supports this Enable it and give it a name In this example the profile name is test Select Dial in as Call Direction In Dial Out Settin
114. aneeeaseeaecannnuasetee 232 4131 IPV WAN SOU a iosaictasecte taunted eet EERE aE EE E 232 rT Gwe TIPS EANES Ue EE A 237 413 3 IPv6 Fir wall SetU sccisicniinniiiin a 238 AT AAYO R O N ee E E E 242 A Mao I VO INCIG MO OUI tes ctetesixtanectaaeteronahecdmeotan comaetanddencleeasucataeadeectdueintitmactapivarasamenenseeiancuens 243 AT VO NEE UII S wares E E A 244 4 19 7 IPVO Management rawesivennceraicanamiedsananainetauncsncanteiends vemonidnsanenddeamociviantesiesunonaintedencnawsans 247 OMe SON N E depos sucetsciavntesct E E E E 248 4 14 1 Use r ONAN IO I essaia aa Taaa e a E 248 4 15 System Maintenance cccccccsssssecececccceeessseeeeeccceeeeuseeeeeseeaeaaeeeeeeeeeesaaaeeeeeeesssseaasseeeeeees 251 Ws VOY SOI OLS a E EE 251 Ae TROO eee ee ee ene ee ee 253 MDs OV SUSI ASS VOI ages aa a a E E E a 254 BA Oe SCP ao SWO a EE E 255 415 6 Conngurauon BACKI seisseen a a a 257 Aloe OV SIOG Mil AlE cie a e a 259 Aa Te aa VAN Ge a E A 262 ATSO Manage MON e a E a 263 4 15 9 Reboot Syster menune dieenri sanas niten EEr EE AROE On Ear ADELE EINEAN OENE Ee aoe 264 4 15 10 Firmware Upgrade isc vce ce oe sng cecauecucennaeasapatmesacennacceesavex Senet saetecesenessedesesauiessasoseee 264 Vigor2130 Series User s Guide vii Dray Tek AVG DONOS HC S sansa muda nesnanesranendeasantnmansnacusteutsme E EE R A EE 265 A VO FMC e A 265 A162 rac ROUIGO osna a E AE T A E EE E ESR EAER 266 A103 ROUNO TADIC enira A ATT 266 4 16 4 ARP Cache Table
115. ards packets from the external ports of the router to the internal ports used by the application Advanced Settings eT Services Select the services running on your network that Internet users can ACCESS O Ftp Exarnple menmsar 192 168 29 11 131735 60654 UDP mshmegr 192 168 29 11 7824 13251 UDF This connection allows you to connect to the Internet through a menmsgr 192 168 29 11 8789 63231 TCP shared connection on another computer eae Show icon in notification area when connected eS Edit ais E i tell mrm The reminder as regards concern about Firewall and UPnP Can t work with Firewall Software Enabling firewall applications on your PC may cause the UPnP function not working properly This is because these applications will block the accessing ability of some network ports Security Considerations Activating the UPnP function on your network may incur some security threats You should consider carefully these risks before activating the UPnP function gt Some Microsoft operating systems have found out the UPnP weaknesses and hence you need to ensure that you have applied the latest service packs and patches gt Non privileged users can control some router functions including removing and adding port mappings The UPnP function dynamically adds port mappings on behalf of some UPnP aware applications When the applications terminate abnormally these mapp
116. aytek com Any Any None w URL Start IP Any End IP Any Type the host name of URL for filtering Click Add a New Entry to add the host name of URL one by one Web Host Filter Setting facebook com Current Host Filters i Se Delete Enable Host Start IP End IP HTTPS Time New Time Object vigor com 192 168 1 15 192 168 1 18 None x Host Start IP Any End IP Any Add a New Entry Note HTTPS block need a learning period to take effect 137 Dray Tek 4 5 2 Web Content Filter We all know that the content on the Internet just like other types of media may be inappropriate sometimes As a responsible parent or employer you should protect those in your trust against the hazards With Web filtering service of the Vigor router you can protect your business from common primary threats such as productivity legal liability network and security threats For parents you can protect your children from viewing adult websites or chat rooms Note Be aware that Web Content Filter WCF is not a built in service of Vigor router but a service powered by Commtouch If you want to use such service trial or formal edition you have to perform the procedure of activation first For the service of formal edition please contact with your dealer for detailed information For BPjM service 1 Open CSM gt gt Web Content Filter The following page will be displayed CSM gt gt Web Content Filter
117. b portal page Login A window will be opened and ask you to type username ID and password P W for accessing into the web page Bypass disable login A window will be opened for you to accessing into the web page It is not necessary for you to type username ID and password P W Online Status A window will be opened and display the connection status for PC s in LAN The administrator can know which PC tries to access into Internet and how long the Internet accessing lasts Bulletin Type words or sentences here It will be displayed for web portal page In addition it can be displayed on the login dialog at the bottom When you finished the above settings click OK to save the settings Note To disable web portal click Disable for Login for Bulletin Board and for Redirect When the web portal is enabled a green light will be displayed on the top of the page When the web portal is disabled a red light will be displayed Below shows an example of web portal page with the information typed in Welcome Message and Bulletin CR Webportal Windows Internet Explorer e 192 168 1 1 Welcome to Vigor Web Portal Username Password Vigor Provides unprecedented speeds on fiber broadband network Support hardware NAT Up to 800 Mbps downstream upstream Workable for extreme high speed multimedia streaming VoIP facilities for low cost call Easy to use firewall and secure VPN
118. bled Local System Ka Network Location amp Collects an Started Manual Local System Ka Network Provisionin Manages X Manual Local System Ba NT LM Security Sup Provides s Manual Local System aS Se Plug and Play w Started Local System Sa Print Spooler Loads files Started Automatic Local System 8s Protected Storage Provides pr Started Automatic Local System 8 Q05 RSVP Provides n Manual Local System 4 Remote Access fut Creates a Manual Local System Ka Remote Access Con Createsa Started Manual Local System Remote Desktop He Manages 4 Manual Local System 4 Remote Procedure Provides th Started Automatic Network 5 4 Remote Procedure Managest Manual Network 5 4 Remote Registry Enables re Started Automatic Local Service Extended Vigor2130 Series User s Guide 55 Dr ay Te k 6 For the users of Windows7 please use Windows Media Player WMP to browse and play the files stored in the new service device o x E Windows Media Player ees OU b Vigor2130 1 BK SANH be as zag HARIO BASAR WUBAAMIC SRIF P LIMFARS AAN P A zee mi IEL z EE L gt JEROAN 4 Prk O AFHI 4 an BF z PBFA uena Using IXIA1 send 100 000 tagged Using IXIA send 100 000 tagged Using IXIA send 100 000 tagged unicast packets to IXIA2 VID unicast packets to IXIA2 Vibe unicast packets to IXIAS VID iea DETAR RAWE E E Using IXIA1 snd 100 000 ta
119. by an act of God or subjected to abnormal working conditions The warranty does not cover the bundled or licensed software of other vendors Defects which do not significantly affect the usability of the product will not be covered by the warranty We reserve the right to revise the manual and online documentation and to make changes from time to time in the contents hereof without obligation to notify any person of such revision or changes Web registration is preferred You can register your Vigor router via http www draytek com Due to the continuous evolution of DrayTek technology all routers will be regularly upgraded Please consult the DrayTek web site for more information on newest firmware tools and documents http www draytek com i Dray Tek European Community Declarations Manufacturer DrayTek Corp Address No 26 Fu Shing Road HuKou County HsinChu Industrial Park Hsin Chu Taiwan 303 Product Vigor2130 Series Router DrayTek Corp declares that Vigor2130 Series of routers are in compliance with the following essential requirements and other relevant provisions of R amp TTE Directive 1999 5 EEC The product conforms to the requirements of Electro Magnetic Compatibility EMC Directive 2004 108 EC by complying with the requirements set forth in EN55022 Class B and EN55024 Class B The product conforms to the requirements of Low Voltage LVD Directive 2006 95 EC by complying with the requirements set forth in EN60950
120. cate the peer with certificates issued by those trusted CA servers Here you can generate and manage the local digital certificates and set trusted CA certificates Remember to adjust the time of Vigor router before using the certificate so that you can get the correct valid period of certificate Below shows the menu items for Certificate Management Certificate Management Trusted CA Certificate Local Certificate issue Certificate Vigor2130 Series User s Guide 181 Dray Te k 4 9 1 Trusted CA Certificate The CA certification authority certificate specified in this page is the issuer of the certificates for both clients requesting for network connection It allows you to import the third party certificate authenticated by other certification authority CA or build My RootCA to be used as a CA for signing the local certicate Just create a new Trust CA Certificate first Certificate Management gt gt Trusted CA Certificate Auto refresh Other Root CA Certificate Name Subject Issuer Valid From Expires Status Mo Cerdficates Installed My Root CA Certificate Name Subject Issuer Valid From Expires Status Mo Cerntticates Installed Build Foot CA Available settings are explained as follows Item Description Other Root CA You can import several Root CA certificates to meet Certificate different requests Name Display the name of the certificate Subject Display a brief description for t
121. ce making network connection through WPS When the LED lights up the WPS connection will be on Of o On Off The WPS is off Blinking Waiting for wireless client sending requests for connection about two minutes Interface Description WLAN Press the button once to enable WLAN LED on or disable WLAN LED off wireless connection WAN Connector for accessing the Internet LAN Connectors for local networked devices 1 2 3 4 USB 1 2 Connector for USB storage device Pen Driver Mobile HD or printer or 3G backup USB1 USB2 Phonet Phone2 WLAN Dray Tek 6 Vigor2130 Series User s Guide Interface Description Phone2 Phonel Connector of analog phone for VoIP communication Factory Reset Restore the default settings Usage Turn on the router ACT LED 1s blinking Press the hole and keep for more than 5 seconds When you see the ACT LED begins to blink rapidly than usual release the button Then the router will restart with the factory default configuration PWR Connector for a power adapter ON OFF Power Switch Vigor2130 Series User s Guide 7 Dray Te k 1 4 Hardware Installation Before starting to configure the router you have to connect your devices correctly 1 Connect this device to a modem with a RJ 45 cable 2 Connect one port of 4 port switch to your computer with a RJ 45 cable This device allows you to connect 4 PCs directly 3 Connect Phone port to a convention
122. ce name eth0 eth1 fp etc that used to transfer packets with addresses matching the prefix The IPv6 address prefix Display the distance to the target usually counted in hops It is not used by recent kernels but may be needed by routing daemons Display the lifetime of the route Display the largest size in bytes of a packet Display the largest size in bytes of an unfragmented piece of a routing advertisement Display the number of network segments on which the packet is allowed to travel before discarded Check this box to enable an automatic refresh of the page at regular intervals Click it to reload the page 242 Vigor2130 Series User s Guide 4 13 5 IPv6 Neighbour IPv6 uses neighbor discovery protocol to find out neighbors on the same link IPv6 gt gt IPv6 Neighbour IPv6 ARP Table Each item is explained as follows Item Description Device The interface name of the link where the neighbor is on IP Address The IPv6 address of the neighbor MAC Address The link layer address of the neighbor State Possible states include incomplete address resolution is in progress reachable neighbor is reachable stale neighbor s may be unreachable but not verified until a packet is sent delay neighbor may be unreachable and a packet was sent probe neighbor may be unreachable and probes are sent to verify the reachability Auto refresh Check this box to enable an automatic refre
123. cenienaceies 112 A OZ FO SU N E E E E E toons ddiemeenh A E E E E A E 114 AA FOWA eree a a cet tried a TaN 115 AA PoS DEl N 6 i r AEA 115 AA Poris COMMOUM Aio serre a saa tuaceiu meta 116 4 4 3 Access COO WIG Uainiyscssncsnna ate seven crcaernaatsauncyaiadousomeasan casanussinsindn dala igusattnc amas ees 119 44A ane CONO oan a di aiac a eeatae easonw eran a A caammenmneecsnn 132 Ma MEOD O T cca cena a vine connecter cetera eaten vi aso coun oanneddeaeon E dee tueceemaeieia einem canis 135 ACSW cence secatnesanectantanentsacenuetanscututesec E du deuebiaysccbenisecets 136 4 5 1 URL Content Filter 0 ccc ccc ccc cccccccececcececcecsccecsccuceccuceceucacsecacseucucseausseautecaesecsreanss 136 4 5 2 Web Content Filte r ccccccccccccccccecccceccccecccecuccecueaucuceucaeausucaucecaeausecaeaecsuaeseuaeseraeeeees 138 4 5 3 APP Enforcement ccccccccececececececccecucccccucccccauauauauauauauauauauaenunenenenenuavauaueueueuaenenenenes 143 4 6 Bandwidth Management cccceccceeeeeeeeeeeeeeeeeeeeeeeeeeeeaeaaeeeseesaaaeeeeesseaeeeeesseaeeeeeesseneeeeenas 145 4 6 1 Session Limit cccccccccccecececcccececcccccecccececueaeuecscueauuececseueaenecscauaunenscsuuaenerscauaunersreeaenens 145 4 6 2 Bandwidth Limit icsicccescedeccatasticacsteevede aeecd edeteayc aude deesadsavesdstdeseedsucavent edodeataterdesaneanvasduanca 147 4 6 3 Port Rate Control ccccccccccccccccccececcececcccecccecuececueaucacaucueaesecaucecaeu
124. checked Click Clone PC Address The result will be displayed in the field of MAC Address Enable Clone MAC Address MAC Address 00 06 A6 24 D5 A1 After finishing the settings here please click Next 2 3 4 Setting up the Wireless Connection Now you have to set up the wireless connection For the user of Vigor2130 please skip this step Quick Start Wizard Wireless System Configuration Enable Wireless LAN SSID Broadcast SSID Wireless Security Configuration Encryption Available settings are explained as follows Item Enable Wireless LAN SSID Broadcast Vigor2130 Series User s Guide Description Check the box to enable the wireless function Choose Show to make the SSID being seen by wireless clients Choose Hide to prevent from wireless sniffing and make it harder for unauthorized clients or STAs to join your wireless LAN 23 Dray Tek Item SSID Encryption WEP Description It means the identification of the wireless LAN SSID can be any text numbers or various special characters The default SSID is DrayTek We suggest you to change it Select an appropriate encryption mode to improve the security and privacy of your wireless data packets None Each encryption mode will bring out different web page and ask you to offer additional configuration If you choose WEP as the security configuration you have to specify encryption key Key 1 Key 4 and authentication mo
125. ck Restore button and wait for few seconds the following picture will tell you that the restoration procedure is successful Note If the file you want to restore has been encrypted you will be asked to type the encrypted key before clicking Restore 4 15 6 Syslog Mail Alert SysLog function is provided for users to monitor the router There is no bother to directly get into the Web Configurator of the router or borrow debug equipments System Maintenance gt gt Syslog Mail Alert Setup Syslog Access Setup Enable LI server IP Address Po Destination Port Log Level User access log Mail Alert Setup Enable SMTP Server SMTP Port Mail To Mail From User Name Password E Mail Alert Event User Login C Device Reboot Available settings are explained as follows Item Description Syslog Access Setup Enable Syslog Access Check Enable to activate the function of Syslog Router Name Assign a name of this device Server IP Address The IP address of the Syslog server Destination Port Assign a port for the Syslog protocol Log Level Choose the severity level for the system log entry Vigor2130 Series User s Guide 259 Dray Te k User Access Log Check this box to record the user logging information Mail Alert Setup Enable Check Enable to activate function of mail alert Send a Test e mail Click this button to let the system send a test e mail to the speci
126. condary ONS Server MTU Size Auto MaxMTU 1500 WAN Connection Detection Mlode ARP wf Ping IP ooo Clone MAC Address Enable Mail SMS Alert Event types WANUPL WAN DOWN CI Available settings are explained as follows Item Description Static IP Settings IP Address Type the IP address Subnet Mask Type the subnet mask Gateway IP Address Type the gateway IP address Primary DNS Server You must specify a DNS server IP address here because your ISP should provide you with usually more than one DNS Server If your ISP does not provide it the router will automatically apply default DNS Server IP address 198 95 1 1 to this field Secondary DNS Server You can specify secondary DNS server IP address here because your ISP often provides you more than one DNS Server If your ISP does not provide it the router will automatically apply default secondary DNS Server IP address 4 2 2 1 to this field MTU Size It means Max Transmit Unit for packet The default setting will be specified by the system automatically Therefore keep this field in blank WAN Connection Mode Such function allows you to verify whether network Detection connection is alive or not through ARP Detect or Ping Detect Choose ARP Detect or Ping Detect for the system to execute for WAN detection Ping IP If you choose Ping Detect as detection mode you have to type IP address in this field for pinging Vigor2130 Series User s Guide
127. ctors Before you use the Vigor router please get acquainted with the LED indicators and connectors first 1 3 1 For Vigor2130 Status Explanation a Blinking The router is powered on and running Activity normally Off The router is powered off HPA WAN ri 1 2 3 4 Off The port is disconnected USBI 2 On A USB device is connected and active _ VPN On The VPN tunnel is active QoS On The QoS function is active DoS On The DoS DDoS function is active Blinking It will blink while detecting an attack Interfac Description e WAN LAN Connectors for local networked devices 1 2 3 4 USB Connector for USB storage device Pen Driver Mobile 1 2 HD or printer or 3G backup Dray Tek 2 Vigor2130 Series User s Guide TUL a m Interface Description Factory Reset Restore the default settings Usage Turn on the router ACT LED is blinking Press the hole and keep for more than 5 seconds When you see the ACT LED begins to blink rapidly than usual release the button Then the router will restart with the factory default configuration PWR Connector for a power adapter ON OFF Power Switch Vigor2130 Series User s Guide J Dray Te k 1 3 2 For Vigor2130n LED SIGI Explanation Activity normally HPA WAN TA eel USB1 2 Qos WLAN Blinking It will blink while wireless traffic goes through WPS Press this button for 2 seconds to wait Button for client device mak
128. ctory default acts a DHCP server for your network so it automatically dispatch Vigor2130 Series User s Guide 95 Dray Te k related IP settings to any local user configured as a DHCP client It is highly recommended that you leave the router enabled as a DHCP server if you do not have a DHCP server for your network You can configure the router to serve as a DHCP server for the 2nd subnet Check the box to enable DHCP server setting Enable Relay Agent Check it to enable such function It allows you to specify which subnet that DHCP server is located the relay agent should redirect the DHCP request to DHCP Server IP Address When Relay Agent is enabled you have to type the IP address of the DHCP server Start IP Address Enter a value of the IP address pool for the DHCP server to start with when issuing IP addresses If the 2nd IP address of your router is 220 135 240 1 the starting IP address must be 220 135 240 2 or greater but smaller than 220 135 240 254 IP Pool Counts Enter the number of IP addresses in the pool The maximum is 10 For example if you type 3 and the 2nd IP address of your router is 220 135 240 1 the range of IP address by the DHCP server will be from 220 135 240 2 to 220 135 240 11 Lease Time It allows you to set the leased time for the specified PC Force DNS manual setting Enable Force router to use DNS servers in this page instead of DNS servers given by the Internet Access server
129. d Click this button to refresh the information for WAN port 89 Dray Tek After finishing all the settings here please click OK to activate them 4 1 4 Backup This page is used to setup 3G 56K backup function If you enable 3G 56K backup make sure your WAN connection type is not in 3G 56K mode When the WAN connection is broken router will try to keep the connection with 3G 56K mode After WAN connection is recovered router will disconnect the 3G 56K connection automatically If both USB ports connected with 3G modem and 56K modem and both 3G Backup and 56K Backup modes are enabled the system will determine which one 3G Backup or 56K Backup will be selected as backup mode according to the detected physical connection automatically 3G Backup WAN gt gt Backup Backup Configuration 36 Backup C Enable 36 Backup SIM FIN code Modem Initial String Modem Initial String2 APN Name Modem Dial String PPP Username PPP Password 56K Backup default AT amp F ATEOVIX1 amp D2 amp C1S0 defaultATEOV1X1 amp D2 amp C1S0 0 defaultinternet defaultATDT 99 Note In dual usb mode both WAN and Backup are USB 3G6 56K USB Port 2 is for backup WAN Connection Detection Mode Ping IP Mail SMS Alert Alert Types Event types None w WANUPL WAN DOWN O Item 3G Backup Dray Tek Available settings are explained as follows Description Enable 3G Backup Check this box to enable such fu
130. d DTMF mode Advanced setting is provided for fitting the telecommunication custom for the local area of the router installed Wrong settings might cause inconvenience for users VoIP gt gt Phone Setting Advance Settings gt gt Phone 1 Caller ID Type FSK_ETSI UK Volume Gain DTMF Mic Gain 1 10 DTMF Mode Speaker Gain 1 10 Payload Type RFC2833 96 127 Hoi MISC Dial Tone Power Level 1 50 Ring Frequency 10 50HZ C Pound key as ordinary number Available settings are explained as follows Item Description Caller ID Type Choose one of the selections as caller ID type Volume Gain Mic Gain 1 10 Speaker Gain 1 10 Adjust the volume of microphone and speaker by entering number from 1 10 The larger of the number the louder the volume 1s MISC Dial Tone Power Level This setting is used to adjust the loudness of the dial tone The smaller the number is the louder the dial tone is It is recommended for you to use the default setting Ring Frequency This setting is used to drive the frequency of the ring tone It is recommended for you to use the default setting Pound key as ordinary number Check this box to make key can be sent out as a number DTMF DTMF Mode There are four DTMF modes for you to choose OTMPF mode InBand InBand OutBand RF C2033 SIP INFO cisco format SIP IMFO nortel format InBand Choose this one then the Vigor will send the DTMF tone as audio
131. d priority to specify which packets should be discarded Vigor2130 Series User s Guide 149 Dray Tek or in another term dropped from an overflowing queue packets of sensitive applications mentioned above might be the ones to drop off How this will affect application performance There are two components within Primary configuration of QoS deployment Classification Identifying low latency or crucial applications and marking them for high priority service level enforcement throughout the network Scheduling Based on classification of service level to assign packets to queues and associated service types The basic QoS implementation in Vigor routers is to classify and schedule packets based on the service type information in the IP header For instance to ensure the connection with the headquarter a teleworker may enforce an index of QoS Control to reserve bandwidth for HTTPS connection while using lots of application at the same time One more larger scale implementation of QoS network is to apply DSCP Differentiated Service Code Point and IP Precedence disciplines at Layer 3 Compared with legacy IP Precedence that uses Type of Service ToS field in the IP header to define 8 service classes DSCP is a successor creating 64 classes possible with backward IP Precedence compatibility In a QoS enabled network or Differentiated Service DiffServ or DS framework a DS domain owner should sign a Service License Agreement S
132. de open or shared All wireless devices must support the same WEP encryption bit size and have the same key Quick Start Wizard Wireless System Configuration Enable Wireless LAN SSID Broadcast SSID Wireless Security Configuration Encryption WEF Configuration Default Key keyi Reve keyg keyg Authentication Mode Four keys can be entered here but only one key can be selected at a time The keys can be entered in ASCII or Hexadecimal Choose the key you wish to use by using the Default Key drop down list Dray Tek 24 Vigor2130 Series User s Guide WPA PSK If you choose WPA PSK as the security configuration you have to specify WPA mode algorithm and pre shared key Quick Start Wizard Wireless System Configuration Enable Wireless LAN SSID Broadcast SSID Wireless Security Configuration Encryption WPA PSK Configuration Type WPA Algorithm WPA Pre Shared Key Available settings are explained as follows Item Description Type The WPA encrypts each frame transmitted from the radio using the key which either PSK Pre Shared Key entered manually in this field below or automatically negotiated via 802 1x authentication Select WPA WPA2 or Auto as WPA mode Auto WPA or WPA2 WPA WPAZ Auto WPA or WPA WPA Algorithm Choose the WPA algorithm TKIP AES or Auto WPA Pre shared Key The keys can be entered in ASCII or Hexadecimal Check the key you wish to use WPA RADIUS Rem
133. diskette The uploaded file in the USB diskette can be shared for other user through FTP 205 Dray Tek 4 11 4 FTP User Management This page allows you to change user setting for USB storage disk Before modifying settings in this page please insert a USB disk and configure settings in User gt gt User Configuration first Otherwise an error message will appear to warn you At present the Vigor router can support USB storage disk with versions of FAT16 32 and NTFS only Therefore before connecting the USB storage disk into the Vigor router please make sure the memory format for the USB storage disk is FAT16 32 or NTFS USB Application gt gt FTP User Management FIP General Settings Enable FTP FIP User Management User Name Volume Path Access Rights vincent HOS F2251 b LATZO f Read write HOS 2251 bY LATZO sh code Read only Read only HOS 242451 b LATZO fautobuild Read only HOS 2251 BYLAT20 H Read write autotest HOS 22451 bYLATZO fautoabuild Read only Available settings are explained as follows Item Description Enable FTP Check this box to enable FTP connection User Name It displays the username that user uses to login to the FTP server Volume It displays the proper volume for the connected USB disk Path It displays the directory name for the connected USB disk Access Rights It displays the access right for the connected USB disk Click the name link under User Name to open
134. dress Use the folowing ONS server addresses ar ees For Mac OS 1 Double click on the current used Mac OS on the desktop 2 Open the Application folder and get into Network 3 On the Network screen select Using DHCP from the drop down list of Configure IPv4 aa Network Aae a Show All Displays Sound Network Startup Disk Location Automatic Show Built in Ethernet TCP IP PPPoE AppleTalk Proxies IP Address 5 Renew DHCP Lease Subnet Mask 255 255 255 0 DHCP Client ID If required Router 192 168 1 1 DNS Servers Optional Search Domains Optional IPv6 Address fe80 0000 0000 0000 020a 95ff fe8d 72e4 rr Click the lock to prevent further changes Assist me Apply Now Vigor2130 Series User s Guide 281 Dr ay Te k 5 3 Pinging the Router from Your Computer The default gateway IP address of the router is 192 168 1 1 For some reason you might need to use ping command to check the link status of the router The most important thing is that the computer will receive a reply from 192 168 1 1 If not please check the IP address of your computer We suggest you setting the network connection as get IP automatically Please refer to the section 5 2 Please follow the steps below to ping the router correctly For Windows l 2 4 Open the Command Prompt window from Start menu gt Run
135. e Check this box to display all of the data via UDP and TCP Choose one of the protocols to be displayed the corresponding information in this page You can check a range of certain devices by specifying the source and destination IP address es with the port number Display the sessions based on the state chosen here ESTABLISHED oh SENT CLOSE Click this button to search the information based on the 276 Vigor2130 Series User s Guide conditions specified Clear Clear all of the information displayed in this page 4 16 13 Ports State Click Diagnostics and click Ports State to open the list page There are for LAN ports and one WAN port in your router Through this page you can know which port is using and you can get the detailed statistics for each port by moving and clicking the mouse on the connected one Port State Overview Auto refresh L Each item is explained as follows Item Description Auto refresh Check it to enable auto refresh function Refresh Click it to reload the page if you change the LAN port connection Or you can check Auto refresh to reload the page by the system automatically Vigor2130 Series User s Guide 277 Dray Tek This page is left blank D ra y Ti e k 278 Vigor2130 Series User s Guide Trouble Shooting This section will guide you to solve abnormal situations if you cannot access into the Internet after installing the router and finishing the web configuration
136. e i mm dd yyyy Internet Connection C Cable ADSL C Fiber C 3G C WiMAX 6 When the following page appears your router information has been added to the database Your device has been successtully added to the database Vigor2130 Series User s Guide 31 Dr ay Te k 7 Now you have finished the product registration 8 After clicking OK you will see the following page Your router has been registered to myvigor website successfully If you have not activated web content filter service by using Service Activation Wizard you can activate the service from this step Please click the serial number link Dray Tek i Home s Search Hy Information D about Us f Welcome james_fae Product Last Login Time 2011 03 16 01 45 09 a Last Login From 172 16 32 150 tira Current Login Time 2011 03 16 18 20 31 X VigorACS SI Current Login From 172 16 3 146 RowNo 5s M PageNo Ada lt Yigor Series our Device List Product Registration 9 Customer SUEY 2011031609200201 vigor 2130 Wigor 2130 9 From the Device s Service section click the Trial Dray Tek My Product D about Us a Device Information Product Nickname vigor2130 x Serial 2011031609200201 O My Information Model Vigor2130 Series T VigorACS SI Vigor Series as e i oe ice ae T Prodid DENES SSEMIEE Expired License Registration 4 Customer Survey BP ih is the
137. e 2 key lifetime For security reason the lifetime of key should be defined The default value is 3600 seconds You may specify a value in between 600 and 86400 seconds Perfect Forward Secrecy The IKE Phase 1 key will be reused to avoid the computation complexity in phase 2 The default value is inactive this function Click OK to save the settings Vigor2130 Series User s Guide 179 Dray Tek Adding a VPN Tunnel for PPTP Click Add Tunnel to open the following page VPN and Remote Access gt gt LAN to LAN Add PPTP Dial Out Tunnel Dial Out General Settings Enabled Always On Mame Remote IP Authentication User Name Password WIFFE Networks Local Network Mask Remote Metwork Mask Foute MAT Mode Change default route to this WPN tunnel Edit PPTP Dial In Tunnel PPTP Dial in Tunnel Add Tunnel Available settings are explained as follows Item Dial Out General Setting Authentication Networks Dray Tek Description Enabled Check here to activate this tunnel Always On Check this box to make the WAN connection being activated always Name Specify a name for this tunnel Remote IP Enter the IP address name of the remote host that located at the other end of the VPN tunnel User Name Type a name for this tunnel for authentication Password Type a password for this tunnel for authentication MPPE Check this box to enable the function of MPPE for such tunn
138. e Phone Phones Note Ifthe domain of the incoming call is different fram the domain found in SIP accounts the call should be blocked For Block IP Address this function can block incoming calls through Phone port coming from IP address Such control also can be done based on preconfigured schedules VoIP gt gt DialPlan Setup Call Barring Block IP Address C Enable Interface Phone Phones Vigor2130 Series User s Guide 221 Dray Te k 4 12 1 4 Regional This page allows you to process incoming or outgoing phone calls by regional Default values common used in most areas will be shown on this web page You can change the number based on the region that the router is placed VoIP gt gt DialPlan Setup Enable Regional Last Call Return Miss Last Call Return In 12 Last Call Return Qut ila Call Forward AI Act 72 number Call Forward Deact a it Call Forward Busy Act 90 numbert Call Forward Mo Ans Act oe number Do Not Disturb Act Hide caller ID Act Call Waiting Act 78 t 67 H 56 Do Not Disturb Deact 79 4 BE 4 57 re Hide caller ID Deact Call Waiting Deact Available settings are explained as follows Item Enable Regional Last Call Return Miss Last Call Return In Last Call Return Out Call Forward All Act Call Forward Deact Call Forward Busy Act Call Forward No Ans Act Do Not Dist
139. e la lo amp I Status V Active XC _ Inactive Click any index number to display the dial plan setup page VoIP gt gt DialPlan Setup Phone Book Index No 1 Enable Phone Wurnber Display Name SIP URL Dial Out Account Available settings are explained as follows Item Description Enable Click this to enable this entry Phone Number The speed dial number of this index This can be any number you choose using digits 0 9 and Display Name The Caller ID that you want to be displayed on your friend s screen This let your friend can easily know who s calling without memorizing lots of SIP URL Address SIP URL Enter your friend s SIP account Dial Out Account Choose one of the SIP accounts for this profile to dial out It is useful for both sides caller and callee that registered to different SIP Registrar servers If caller and callee do not use Vigor2130 Series User s Guide 217 Dray Te k the same SIP server sometimes the VoIP phone call connection may not succeed By using the specified dial out account the successful connection can be assured After finished the above configuration click OK to save the settings and exit this page 4 12 1 2 Digit Map For the convenience of user this page allows users to edit prefix number for the SIP account with adding number stripping number or replacing number It is used to help user having a quick and easy way to dial out through VoIP inter
140. e medium queue counter of the packet received Display the high queue counter of the packet received Display the number of frames dropped due to excessive collision late collision or frame aging Display the number of Frames late collision or excessive collision Error which switch transmitted Below shows the menu items for Applications Applications Dynamic DNS Schedule SMP IGMP Status UPnP Configuration Wake on LAN SM5 4 7 1 Dynamic DNS The ISP often provides you with a dynamic IP address when you connect to the Internet via your ISP It means that the public IP address assigned to your router changes each time you access the Internet The Dynamic DNS feature lets you assign a domain name to a dynamic WAN IP address It allows the router to update its online WAN IP address mappings on the specified Dynamic DNS server Once the router is online you will be able to use the registered domain name to access the router or internal virtual servers from the Internet It is particularly helpful if you host a web server FTP server or other server behind the router Before you use the Dynamic DNS feature you have to apply for free DDNS service to the DDNS service providers Basically Vigor routers are compatible with the DDNS services supplied by most popular DDNS service providers such as www dyndns org www no ip com www dtdns com www changeip com www dynamic nameserver com You should visit their websites to
141. e of the LAN to LAN profile Endpoint Display the IP address of the VPN client IKE Alg Display the encryption and authentication algorithm used during phase 1 of the VPN connection Establishment The algorithm is used during exchange of key exchange ESP Alg Display the encryption and authentication algorithm used during phase 2 of the VPN connection Establishment This algorithm is used for transporting data and the choice will affect the performance of the VPN tunnel Tx Packets Tx Bytes Display the data transmission packets bytes through VPN tunnel by IPSec or PPTP Rx Packets Rx Bytes Display the data receiving packets bytes through VPN tunnel by IPSec or PPTP Dray Tek 176 Vigor2130 Series User s Guide Up Time Display the duration time of the IPSec PPTP connection Add Tunnel Click it to add a new VPN tunnel via IPSec PPTP protocol Adding a VPN Tunnel for IPSec Click Add Tunnel to open the following page VPN and Remote Access gt gt LAN to LAN Add IPSec VPN Tunnel General Enabled Always On Remote IPYHost Mame Authentication Type Pre Shared Key Pre Shared Key Confirm Pre Shared Key Local Identity Remote Identity Networks Local Network lt Mask Remote Network Wask Change default route to this YPN tunnel Advanced Security Settings IKE phase 2 proposal shal md5 IKE phase 1 key lifetime 20000 1200 86400 IKE phase 2 key lifetirne 3600 1200 864
142. e start port for RTP stream The default value is 10050 Dynamic RTP Port End Specifies the end port for RTP stream The default value is 15000 RTP TOS It decides the level of VoIP package Use the drop down list to choose any one of them IPF precedence 1 IP precedence 2 IP precedence 3 IP precedence 4 IP precedence 5 IPF precedence b IPF precedence AF Class Low Drop AF Class Medium Drop AF Class High Drop AP Classe Low Drop AP Class Medium Drop AF Classe High Drop AF Classa Low Drop AF Class Medium Drop AF Classs High Drop AP Class4 Low Drop AP Class4 Medium Drop AF Class4 High Drop EF Class Vigor2130 Series User s Guide 227 Dray Te k Detailed Settings for Phone Port Click the number link for Phone port you can access into the following page for configuring Phone settings VoIP gt gt Phone Setting Phone 1 Call Feature Prefer Cod G 729A 8 BKbps Call Forwarding ss n SPURL E sige Codes l a Packet Size _ _ ae Voice Active Detector CI DNDiDe Not Disturb Mode LI CLIR hide caller ID Default SIP Account LI Call Waiting C Play dial tone only when account registered C Call Transfer Available settings are explained as follows Dray Tek Item Description Call Feature Hotline Check the box to enable it Type in the SIP URL in the field for dialing automatically when you pick up the phone set Call Forwarding There are four opti
143. e this function After finished the above configuration click OK to save the settings and exit this page 4 12 2 SIP Accounts In this section you set up your own SIP settings When you apply for an account your SIP service provider will give you an Account Name or user name SIP Registrar Proxy and Domain name The last three might be the same in some case Then you can tell your folks your SIP Address as in Account Name Domain name As Vigor VoIP Router is turned on it will first register with Registrar using AuthorizationUser Domain Realm After that your call will be bypassed by SIP Proxy to the destination using AccountName Domain Realm as identity Note Selection items for Ring Port will differ according to the router you have VoIP gt gt SIP Accounts SIP Accounts List Index Profile Domain Realm Proxy Account Name Ring Port Status LJ Phonet L Phone LJ Phonet LJ Phone J Phonet L Phonez LJ Phone J Phone LJ Phonet L Phone LJ Phonet Phone R success registered an SIP server fail to register on SIP server 1 2 4 5 6 Available settings are explained as follows Item Description Index Click this link to access into next page for setting SIP account Profile Display the profile name of the account Domain Realm Display the domain name or IP address of the SIP registrar server Proxy Display the domain name or IP address of the SIP proxy server Account Name Display the account
144. ease refer to the similar steps or find support notes in www draytek com 1 Goto Control Panel and then double click on Network Connections Webwork Connections 2 Right click on Local Area Connection and click on Properties Disable Status Repair Bridge Connections Create Sharkcut Rename Properties 3 Select Internet Protocol TCP IP and then click Properties ethO Properties General Authentication Advanced Connect using BS ASUSTek Broadcom 440 10 100 Ir Configure This connection uses the following items El Client tor Microsoft Networks a File and Printer Sharing for Microsoft Networks fm 0s Packet Scheduler Internet Protocol TCP IP Description Transmission Control Protocol lnternet Protocol The default wide area network protocol that provides communication across diverse interconnected networks Show icon in notification area when connected Notify me when this connection has limited or no connectivity Dray Tek 280 Vigor2130 Series User s Guide 4 Select Obtain an IP address automatically and Obtain DNS server address automatically Internet Protocol TCP IP Properties General Alternate Configuration You can get IP settings assigned automatically if your network supports thie capability Otherwise you need to ask your network administrator for the appropriate IP settings Obtain an IP address automatically Use the following IP ad
145. ecscauauceuaeseuaeeeeaeeeees 149 4 6 4 QOS Control LIST csicicscncesansscccsnnieucentsvadeubsvalvesduveada eduteveandeeeninavwannvonsuteadnnwbecencdisteiainteancveats 149 AOD TOMS FROY preria EE E ER A an seulvedunaswouseinadinasmwantudoegss 155 4 6 6 QoS Statistics ccccccccccceccecccecceccecccceccuccececucceccecuucuececaucuececaecausueauseceuuaueececsuuaesenees 156 M AOE O a A E aeubace ca consetedoneencuunanansesetace 159 4 7 1 Dynamic DNS stipe crecctnetosainnueetcce te sstaleondieasseusteratanetatesmtnnsiatonsdautoudtoniecatnedealnebiantmetesaingig 159 URA E E 216 0 ee ee EE ee ne ee E 161 BT 3 VANE i A AE E itu samedunnbamigasenawtcassiviacdnaetain dawn astienpbouieuiaustandusubuwnastbohseieudiansdddwabenichs 163 4 7 4 IGMP Status vesanvinninnewitasnanvnhsapsesveschanewd antdadnevadanddsunndeastannatienWesadabvunsecvesehawnnttaneeadunansners 164 Aro EME COniguUaiO N soss a S aE 164 4 7 6 Wake On LAN 2 cccccceccececceccecceccccecceccecaccuccuececuececucueuucaucaecuusucaucaucuuaecseseusueaesesaeeeeeas 166 4 7 7 Shorn MESSAGE Service s es renine en nadania ia eaaa aa Nana annaa Na Aaaa ANa aAa 167 4 8 VPN and Remote ACCESS ccccccecececececececececucucucucucucecacacaeauauauacseueacaeaeaeauauauauatauauauauaeaeas 169 Dray Tek vi Vigor2130 Series User s Guide 4 8 1 Remote Access Control c ccccccccececcccecccececcececcecuecececuucueuececseueuecauuecuuaecsuauceeaeeeeacaenes 169 49 2 PPIP Remote DAMA cscsacecnee
146. ed Click Clone MAC Address The result will be displayed in the field of MAC Address Enable Clone MAC Address MAC Address 00 0E A6 24 D5 A1 Alert Types Specify the type of the alert mail SMS or Mail and SMS that Vigor system will use to send a message to the user 7 Dray Tek None iw Mail SMS Mail and SMS Event types Specify the event when the system must send a notification to the user by mail and or SMS After finishing all the settings here please click OK to activate them Dray Tek 78 Vigor2130 Series User s Guide 3G USB Modem If your router connects to a 3G modem and you want to access Internet via 3G modem choose 3G as connection type and type the required information in this web page WAN gt gt Internet Access WAN IP Configuration Enable Connection Type 36 USB Modem WAN IP Alias 36 USB Modem Settings SIM PIN code Modem Initial String default ATAF Modem Initial String2 ATEOV1X1 amp D2 amp C180 default ATEOW1X1 amp D28C180 0 APN Name defaultinternet Modem Dial String default ATDT 99 PPP Username PPP Password WAN Connection Detection Mode Ping IP Clone MAC Address Enable C Mail SMS Alert Event types WAN UFO WAN DOWN O Setto Default Available settings are explained as follows Item Description 3G USB Modem Settings SIM PIN code Type PIN code of the SIM card that will be used to access Internet Modem Initial String1
147. efore keep this field in blank Mail SMS Alert Alert Types Specify the type of the alert mail SMS or Mail and SMS that Vigor system will use to send a message to the user None ed Mail SMS Mail and SMS Event types Specify the event when the system must send a notification to the user by mail and or SMS After finishing all the settings here please click OK to activate them 4 1 3 Ports Ports page is used to change the setting for WAN port You can set or reset the following items All of them are described in detail below WAN gt gt Ports Fort Configuration Refresh Flow Control Excessive Port Link Current Curent Configured Maximum Collision Power Configured Configured Frame Mode Control WAN 100fdx 1Gbps FDX 1522 Enabled Available settings are explained as follows Item Description Port It displays current network interface Link It displays current connection status Green light means the WAN connection is successful Speed Current It displays current speed that the router uses Configured You can use the drop down list to choose the required speed for the router If you have no idea in configuring speed simple use the default setting Auto Dray Tek 88 Vigor2130 Series User s Guide Flow Control Maximum Frame Excessive Collision Mode Power Control Refresh Vigor2130 Series User s Guide 1Gbps FDX 100Mbps FDX 100Mbps HDX 10Mbps FD
148. el Local Network Mask Traffic between this subnet and the subnet specified in Remote Network Mask will travel through the VPN tunnel Remote Network Mask Add a static route to direct all traffic destined to this Remote Network IP Address Remote Network Mask through the VPN connection 180 Vigor2130 Series User s Guide Route NAT Mode If the remote network only allows you to dial in with single IP please choose NAT Mode otherwise please choose Route Mode Change default route to this VPN tunnel Check this box to change the default route into such VPN tunnel Edit PPTP Dial in Tunnel PPTP Dial In Tunnel If it is required click Add Tunnel link to access into VPN and Remote Access gt gt PPTP Remote Dial in page for adding other dial in tunnel Refer to the section 4 8 2 for detailed information Click OK to save the settings 4 9 Certificate Management A digital certificate works as an electronic ID which is issued by a certification authority CA It contains information such as your name a serial number expiration dates etc and the digital signature of the certificate issuing authority so that a recipient can verify that the certificate is real Here Vigor router support digital certificates conforming to standard X 509 Any entity wants to utilize digital certificates should first request a certificate issued by a CA server It should also retrieve certificates of other trusted CA servers so it can authenti
149. el Vigor2130Vn Firmware Version v1 5 2_RC3 Build Date Time Fri Mar 23 19 58 16 CST 2012 System Date Fri Apr 6 03 32 38 2012 System Uptime days 00 15 03 System WAN CPU Usage 41 6 Connection Mode Static Memory Usage 35708K 62784 K 56 87 TEIP RIESE we ress 00 50 7F C9 59 Cached Momary 13276 K f 62784 K IP Address 172 16 3 103 IP Mask 255 255 0 0 LAN IPv6 Address fe80 250 7fff fec9 5979 64 Linl MAC Address 00 50 7F C9 59 78 Default Gateway 172 16 1 1 IP Address 192 168 1 1 Primary DNS 168 95 1 1 IP Mask 255 255 255 0 Secondary DNS IPv6 Address fe80 250 7fff fec9 5978 64 Link DHCP Server Yes Wireless MAC Address 00 50 7F C9 59 78 E SSID DrayTek Channel 11 v lt Note The home page will change slightly in accordance with the type of the router you have Go to System Maintenance page and choose System Password System Maintenance gt gt System Password System Password Old Password Mew Password Confirm Mew Password Type a new password in New Password and Confirm New Password fields Then click OK to continue 16 Vigor2130 Series User s Guide 6 Now the password has been changed Next time use the new password to access the Web Configurator for this router Username Password Copyright DrayTek Corp All Rights Reserved Dray 1 ek 2 3 Quick Start Wizard g Notice Quick Start Wizard for user mode operation is the same as for admin
150. eless clients 1 Connect the printer with the router through USB parallel port 2 Open Start gt Settings gt Printer and Faxes i 4 Documents b E Settings l po Search Help and Support aj Run Log OFF coco lee _ Turn OFF Computer BG Control Panel E Network Connections amp Printers and Faxes of Taskbar and Start Menu Start d fo o 4 Internet Explorer Mace 3 Open File gt Add a New Computer A welcome dialog will appear Please click Next 10 Vigor2130 Series User s Guide Add Printer Wizard Welcome to the Add Printer Wizard This wizard helps you install a printer or make printer connections e If you have a Plug and Play printer that connects LD through a USB port for any other hot pluggable port such as IEEE 1394 infrared and so on you do not need to use this wizard Click Cancel to close the wizard and then plug the printer s cable S Printers and Faxes Edit View Favorites Tools into your computer or point the printer toward your Add Printer T computer s infrared port and turn the printer on Server Properties S a Sea Windows will automatically install the printer for you set Up Faxing To continue click Next Create Shortcut N Delete Rename Properties lt amp 4 Click Local printer attached to this computer and click Next Add Printer Wizard Local or Network Printer The wizard needs to know which type of pri
151. ely for Voice traffic over Internet but you just get your data a little slower and it is tolerable for data traffic t VoIP DialPlan FIP ACCOUNTS Phone settings tatus 4 12 1 DialPlan This page allows you to set phone book and digit map for the VoIP function Click the Phone Book Digit Map Call Barring and Regional links on the page to access into next pages for dialplan settings VoIP gt gt DialPlan Setup DialPlan Confiquration Phone Book Digit Map Call Barring Regional 4 12 1 1 Phone Book In this section you can set your VoIP contacts in the phonebook It can help you to make calls quickly and easily by using speed dial Phone Number There are total 60 index entries in the phonebook for you to store all your friends and family members SIP addresses Loop through and Backup Phone Number will be displayed if you are using Vigor2820V for setting the phone book Dray Tek 216 Vigor2130 Series User s Guide VolP gt gt DialPlan Setup Phone Book Setup Index Phone number Display Name SIP URL Mal Dut Status Account Default Default Default Default Default Default Default Default Default Default Default Default Default Default Default Default Default Default Default Default lt lt 1 20 21 40 41 60 gt gt ext gt gt 21 40 41 60 Next as 1 2 3 4 5 al fi a g AAR AK KR KKK KK KK KK KK RK OK OR bi IS k lo Ale lm l
152. en an Ethernet hardware address MAC Address and an IP address Diagnostics gt gt View ARP Cache Table Ethernet ARP Cache Table Clear Refresh IP Address MAC Address Netbios Name Interface 172 16 3 166 00 26 6C E4 6C 02 WAN 192 168 1 1 00 50 7F CF 46 D LANI 192 168 1 10 E0O CB 4E Da 48 T7T95 CARRIE OCTCB251 LANI Available settings are explained as follows Item Description Clear Click it to clear the whole table Refresh Click it to reload the page Vigor2130 Series User s Guide 267 Dray Te k 4 16 5 System Log Click Diagnostics and click System Log to open the web page Diagnostics gt gt System Log System Log Information Auto refresh Level ALL Type ALL ka Time Jan 10 07 28 29 Jan 10 07 28 28 Jan 10 07 28 27 Jan 10 07 26 27 Jan 10 OF 46 27 Jan 10 07 28 27 Jan 10 07 28 27 Jan 10 07 28 26 Jan 10 07 28 26 Jan 10 07 26 26 Jan 10 07 28 26 Jan 10 07 28 26 Jan 10 07 26 26 Jan 10 07 28 26 Level notice notice notice info info info info info info Info warn warn warn warn Message root t2880 NIC mac 00 50 7F 22 33 44 COO RC O0x30 1 AB 1 root t2880 NIC mac O0 50 F 22 53 44 COO RO Ox30 gt 1 AB 1 root t2880 NIC mac O0 50 F 42 53 44 COO RO OxS0 gt 1 AB5 1 ifconfig SIQCGIFFLAGSS No such device Hfeontig SIQCGIFFLAGS Mo such device ifconfig SIQCGIFFLAGSS No such device ifconfig SIQCGIFFLAGSS No such device kernel bi lan port 2fral entering f
153. er to detect it If the disk is detected it will be shown as the following figure USB Application gt gt Disk Status Disk Status Safely Remove Disk Manufacturer Model Size Free Capacity Status a Generic Flash Disk 2011M 1 76 In use Refresh Devices 4 Make sure that WAN connection has been established Online Status Auto refresh System Uptime Od 02 00 14 System Status LAN Status IP Address TX Packets RX Packets TX Bytes RX Bytes 192 168 1 1 4063 4568 1494410 673774 IPv6 Address 2000 1 64 Global feso 200 ff fe00 0 64 Link WAN Status IP GW IP Mode Up Time 1f2 16 3 102 172 156 1 1 Static IP Od 00 37 21 IPv6 Address feed 200 tf fe00 0 64 Clink Primary DNS Secondary DNS TX Packets RX Packets TX Bytes RX Bytes log ois dak Le Le 20301 155002 eocld a 5 Open USB Application gt gt Bit Torrent Download Click Install to install BT module from Internet to USB device USB Application gt gt Bit Torrent Download Press the button to install BT module Note Internet connection is required Install Vigor2130 Series User s Guide SI Dray Te k 6 Simply wait for a few minutes to finish the installation USB Application gt gt BT Install BT Installation Output BT module is being installed to USB device please wait a moment during installation Note Please don t leave the page till installation process is done 7 When the installation is finished the following p
154. ervice in VigOr2130 cccccceeeeeeseeeeeeeeeeeeeaesseeeeeeess 53 3 5 How to download BT Torrent to USB Device via Vigor ROUTET cccccesseeeeeeeeeeeeeeeeeens 57 Vigor2130 Series User s Guide v Dray Te k Web Configuration leaeeen ene ee ie nete aenn Eee mene ene arse nen Mesa Mere Mirae tert wee ieee me aone meres oer 67 BEAD IRIN E E E E E E A ona adie AE E E E E A E 67 4 1 1 Internet ACCESS esc doccccanaebadeiscadacatedcesiccusndeaeduuadastesinedsceinscanneuzeccecbeduas scans oscenwedapiduensadeaees 69 4 1 2 MUlti VLAN c ccccccccceccececcecceccececceccucecceccucseceucecaecaucuucecaucaecuececsececaucaucuececaeceuseueaneass 84 7A IRS A ped 2 ee es ne eee ee eee ne eer ene 88 Belg ACU wea sascnmsenin stneduvin ovens a 90 ADA AE EE IE E E EE E A A EAE AE 93 BA General 1S UO sesioen a ESEE EE EEEE E a EEEE EES 95 A22 PONM e E en ee E 97 4 2 3 MAC Address Tabole ccccccccccccccecececcccececucccecececueuuuececeeueuenecscauauaucecseauauuenseetscauauneneces 99 AD Fe NIN ee E Seance EAN 100 AZ MIO ITO OM E E E E E E E te 101 APB A FOUL E E E E a dick EEE P E AE E AET 102 nT ck G12 ae i a E E EE A A P E E E E E NE 104 ADO Bui ag E E E A P A Caden ost E E E E EE S E EE E A 105 BE VV SO OPA crite E EEE E E E EA ue el E E E A ET 108 e T e T E Mameaweuaameaieedensaassamenes 111 4 3 1 Hardware NAT cesavencccverssccavsavacacvemotedesancadddseweld a A aA E iai 112 2 OG eae seca pce E E E eee ea
155. es you more than one DNS Server If your ISP does not provide it the router will automatically apply default secondary DNS Server IP address 194 98 0 1 to this field Redial Policy If you want to connect to Internet all the time you can choose Always On Otherwise choose Connect on Demand and Connect on Demand ha Internet after passing through the time without any action When you choose Connect on Demand you have to type value here MTU Size It means Max Transmit Unit for packet The default setting will be specified by the system automatically Therefore keep this field in blank Fixed IP IPCP Usually ISP dynamically assigns IP address to you each time you connect to it and request In some case your ISP provides service to always assign you the same IP address whenever you request In this case you can fill in this IP address in the Fixed IP field Please contact your ISP before you want to use this function Click Yes to use this function Fixed IP Address IPCP Type in a fixed IP address in the box if you click Yes for Fixed IP IPCP Mode Such function allows you to verify whether network connection is alive or not through ARP Detect or Ping Detect Choose ARP Detect or Ping Detect for the system to execute for WAN detection Ping IP If you choose Ping Detect as detection mode you have to type IP address in this field for pinging Enable Enable the feature It is available when the box of Enable is check
156. escription Enable Click it to enable BT download function after powering your computer Disable Click it to disable BT download function after powering your computer Start Start the BT download process Stop Stop the BT download process Type the port number to listen for incoming peer connection Type a number of the peers that can connect to the router at one time Transmission rate can be limited by clicking Enable If it is enabled please specify the maximum rate for download and upload respectively Type the maximum rate for data downloading per second The range is 0 2048KB Type the maximum rate for data uploading per second The range 1s 0 2048KB Enable Click it to enable authentication function Each wireless clients or PC in LAN must type the username and password for authentication to the remote control services Disable Click it to disable authentication function Type a name for authentication 210 Vigor2130 Series User s Guide Password Type a password for authentication Web Client Port Type a port number for accessing Open Web Client Remote Management Enable Click it to enable remote control for BT torrent download Disable Click it to disable remote management function OK Save the settings Uninstall Cancel the module installation settings and exit the dialog For the detailed information of BT Torrent application please refer to Chapter 5 4 11 7 iT
157. et Also they can access Internet via wireless function of Vigor router and enjoy the powerful firewall bandwidth management VPN VoIP features of Vigor router Mobile Coffee shop Internet VolP lt Web surfing E Mail N Instant messaging etc VPN 3 56 HSDPA USB Modem After connecting into the router 3G USB Modem will be regarded as the backup WAN port Therefore when WAN is not available the router will use 3 5G for supporting automatically The supported 3G USB Modem will be listed on DrayTek web site Please visit www draytek com for more detailed information Dray Tek 68 Vigor2130 Series User s Guide Below shows the menu items for WAN WAN Multi vLAN Ports Backup 4 1 1 Internet Access This page allows you to set WAN configuration with different modes Use the Connection Type drop down list to choose one of the WAN modes The corresponding page will be displayed WAN gt gt Internet Access WAN IP Configuration Enable Connection Type DHCP Settings Router Name Domain Name MTU Size WAN Connection Detection Mode Ping IP Clone MAC Address Enable WAN IP Alias The same as syslog s router name i Domain Name are required for some ISPs 36 USB Modem 46 USB Modem Available settings are explained as follows Item WAN IP Configuration Vigor2130 Series User s Guide Description Enable Check the box to enable the WAN IP configuration Co
158. etting Add Adding a New Time Object You are allowed to add many time objects for your request Follow the steps listed below to add a new profile 1 Click Add to open the following time object setting page Firewall gt gt Time Object Add Time Object Profile Start Date 2012 03 30 Year Month Date End Date m Daytime D E E Weekdays F Monday F Tuesday F Wednesday Thursday Friday Saturday F Sunday Available settings are explained as follows Item Description Profile Type a name for such object Start Date Specify the starting date of the time object End Date Specify the end date of the time object Daytime Specify the starting time and the ending time of this object Or click All Day to specify the whole day as time setting Weekday Specify which days in one week should perform the schedule Clear Check the box to clear all the days selected All Check the box to select all days Vigor2130 Series User s Guide 135 Dray Tek 2 After finishing the settings click OK to save and exit the page Firewall gt gt Time Object Time Object Configuration Index Profile Setting i Time Mon Tue Wed Thu Fri Date starting from 2072 03 30 until 2072 04 05 4 5 CSM CSM is an abbreviation of Content Security Management which is used to control IM P2P usage filter the web content and URL content to reach a goal of security management CSM FURL Content F
159. f the alert mail SMS or Mail and SMS that Vigor system will use to send a message to the user None al Mail SMS Mail and SMS Event types Specify the event when the system must send a notification to the user by mail and or SMS After finishing all the settings here please click OK to activate them 4G USB Modem I f your router connects to a 4G USB modem and you want to access Internet via it choose 4G USB Modem as connection type and type the required information Dray Tek WAN gt gt Internet Access WAN IP Configuration Enable Connection Type 46 USB Modem WAN IF Alias 46 USB Modem Settings Support modem Samsung B3730 MTU Size 1000 1360 SIM PIN code Network Mode 46 36 26 w default 4G 3G 26 APN Name Clone MAC Address Enable C Mail 5M5 Alert Event types WAN UPEI WAN DOWN PI Available settings are explained as follows Item Description 4G USB Modem Settings MTU Size It means Max Transmit Unit for packet The default setting will be specified by the system automatically SIM PIN Code Type PIN code of the SIM card that will be used to access Internet Network Mode Choose the connection mode for network You can use 4G only for connection 3G only for connection 2G only for connection or 4G 3G 2G specified by the router system automatically The default setting is 4G 3G 2G 82 Vigor2130 Series User s Guide 45 36 26 2G Only APN Na
160. face VoIP gt gt DialPlan Setup Digit Map Setup Enable Match Prefix Mode OP Number i i Route Note Min Len and Max Len should be between O 25 Available settings are explained as follows Item Description Enable Check this box to invoke this setting Match Prefix The phone number set here is used to add strip or replace the OP number Mode None No action Add When you choose this mode the OP number will be added with the prefix number for calling out through the specific VoIP interface Strip When you choose this mode the OP number will be deleted by the prefix number for calling out through the specific VoIP interface Take the above picture Prefix Table Setup web page as an example the OP number of 886 will be deleted completely for the prefix number is set with SS6 Replace When you choose this mode the OP number will be replaced by the prefix number for calling out through the specific VoIP interface Take the above picture Prefix Table Setup web page as an example the prefix number of 03 will be replaced by 8863 For example dial number of 031111111 will be changed to 88631111111 and sent to Dray Tek 218 Vigor2130 Series User s Guide SIP server Mode OP Number The front number you type here 1s the first part of the account number that you want to execute special function according to the chosen mode by using the prefix number Min Len Set the minimal length of the d
161. fied e mail address SMTP Server The IP address of the SMTP server Mail To Assign a mail address for sending mails out Mail From Assign a path for receiving the mail from outside User Name Type the user name for authentication Password Type the password for authentication E mail Alert Event Check the box of User Login to send alert message to the e mail box while the router detecting the item s you specify here Click OK to save these settings For viewing the Syslog please do the following l 2 Dray Tek Just set your monitor PC s IP address in the field of Server IP Address Install the Router Tools in the Utility within provided CD After installation click on the Router Tools gt gt Syslog from program menu fag Router Tools 4 2 1 gD About Router Tools ER Firmware Uperade Utility El Uninstall Router Tools Visit DrayTek Web Site From the Syslog screen select the router you want to monitor 260 Vigor2130 Series User s Guide DrayTek Syslog 4 5 0 DrayTek Log Filter HA EH gt lt Keak Syslog Utility 192 165 1 5 WAN Information v vigor2130 LAN Information Keyword TX Packets Apply to All v Firewall YPN v User Access Connection WAN IPPBX Others RX Packets WAN IP Gateway IP TX Rate RX Rate 95896 100203 System Time 2011 07 22 18 47 23
162. ge Cached Memory Display the used cached memory and the remaining memory MAC Address Display the MAC address of the LAN Interface IP Address Display the IP address of the LAN interface IP Mask Display the subnet mask address of the LAN interface IPv6 Address Display the link local IPv6 address of the LAN interface DHCP Server Display if the DHCP server is active or not MAC Address Display the MAC address of the wireless LAN SSID Display the SSID of the router Channel Display the channel that wireless LAN used Connection Mode Display current connection type used Link Status Display the connection status MAC Address Display the MAC address of the WAN Interface IP Address Display the IP address of the WAN interface IP Mask Display the subnet mask address of the WAN interface IPv6 Address Display the IPv6 address of the WAN interface Default Gateway Display the gateway address of the WAN interface Primary DNS Display the specified primary DNS setting Secondary DNS Display the specified secondary DNS setting 252 Vigor2130 Series User s Guide 4 15 2 TR 069 Vigor router with TR 069 is available for matching with VigorACS server Such page provides VigorACS and CPE settings under TR 069 protocol All the settings configured here is for CPE to be controlled and managed with VigorACS server Users need to type URL username and password for the VigorACS server t
163. gged Using IXIA1 send 100 000 Using IXIA1 snd 100 000 unicast packets to IXIA3 VID untagged unicast packet to IXI untagged unicast packets to IXIA For other systems please use VLC media player downloaded from Internet to browse locate and play the files Select one or more files to open i B My Documents bly Recent i My Computer Documents JA 34 Floppy f Local Disk C Local Disk D Desktop da DYE Drive E O Shared Documents i My Documents aT My Network Places ab Entire Network My Documents Microsoft Windows Network i F Vigor 30 93 4 bt_folder on Samba Server Vigor213 My Computer gt Fe 3 Firmware pgrade_ 3 1 6 2 gt Router Tools 4 1 2 1 i hiy Network Files of type All Files H E 12 Abways Open VLC media player Media Playback Audio wideo Tools View Help ps a mym E S H E 12 4lways Open 1 00 00 05 03 04 Notes Before removing USB storage device please DISABLE DLNA service and then remove the device The audio and video files might not be played normally due to unrecognized equipment set in client D F ay Ti e k 56 Vigor2130 Series User s Guide 3 5 How to download BT Torrent to USB Device via Vigor Router Download BT Torrent 1 Plug USB storage disk into the USB slot of Vigor2130 Access into the web configuration interface of Vigor2130 2 Open USB Application gt gt Disk Status 3 Wait for few seconds for the rout
164. ggested for you to apply another username and password Password Type the password assigned with the user name Confirm Password Type the password again to make the confirmation Tunnel Broker Type the address for the tunnel broker IP FQDN or an optional port number Tunnel Mode IPv6 in IPv4 Tunnel Let the broker chose the tunnel mode appropriate for the client Vigor2130 Series User s Guide 235 Dray Tek Auto reconnect Delay Keepalive Keepalive Interval Prefix Length Interface AICCU IPv6 in IPv4 Native Request an IPv6 in IPv4 tunnel IPv6 in IPv4 NAT Traversal Request an IPv6 in UDP of IPv4 tunnel for clients behind a NAT IPv6 in lPv4 NAT Traversal ha IPvo in lPv4l Tunnel IPv6 in lPv4 Native Pvo in lPv4 NAT Traversal After passing the time set here the client will retry to connect in case of failure or keepalive timeout 0 means not retry Yes Keep the connection between TSPC and tunnel broker always on TSPC will send ping packet to make sure the connection between both ends is normal No The client will not send keepalives Type the time for the interval between two keepalive messages transferring from the client to the broker Type the required prefix length for the client network Display LAN interface name The name of the OS interface that will be configured with the first 64 of the received prefix from the broker and the router advertisement daemon is started to ad
165. gin Q Notice If you fail to access to the web configuration please go to Trouble Shooting for detecting and solving your problem 4 The web page can be logged out according to the chosen condition The default setting is Auto Logout which means the web configuration system will logout after 5 minutes without any operation Change the setting for your necessity of W auto Logout L OF 1 0 min Vigor2130 Series User s Guide IS Dray Te k 2 2 Changing Password Please change the password for the original security of the router l 4 Dray Tek Open a web browser on your PC and type http 192 168 1 1 A pop up window will open to ask for username and password Please type admin admin as Username Password for accessing into the web configurator with admin mode pil the Main Screen will appear Vigor2 130 Series High Speed Gigabit Router Quick Start Wizard Online Status gt WAN gt LAN gt NAT gt Firewall gt CSM gt Bandwidth Management gt Applications gt VPN and Remote Access gt Certificate Management gt Wireless LAN gt USB Application gt VoIP gt IPV6 gt User gt System Maintenance gt Diagnostics Application Note FAQ Product Registration g All Rights Reserved Dray Tek o Vath System Status Auto refresh O Refrest Mod
166. gister request to SIP Registrar again Set Phone 1 and or Phone 2 as the default ring port s for this SIP account Choose a ring tone type for the VoIP phone call After finished the above configuration click OK to save the settings and exit this page Vigor2130 Series User s Guide 225 Dray Tek 4 12 3 Phone Settings This page allows user to set phone settings for Phone 1 and Phone 2 respectively However it changes slightly according to different model you have Dray Tek VoIP gt gt Phone Setting Phone List Index Port Call Feature Codec Gain Mic Speaker Default SIP Account DTMF Relay 1 Phone G F 29A 6 5 5 InBand a Phone G F 29A 6 55 InBand Tone Settings RTP O Symmetric RTP Uvnamic RTP Port Start 10050 Dynamic RTP Port End 10500 RTP TOS 1001110100001 Available settings are explained as follows Item Description Phone List Port there are two phone ports provided here for you to configure Phone1 Phone2 allows you to set general settings for PSTN phones Call Feature A brief description for call feature will be shown in this field for your reference Codec Display the codec used for such phone entry Gain Display the volume gain settings for Mic Speaker that configured in the advanced settings page of Phone Index Default SIP Account draytel_ 1 is the default SIP account You can click the number below the Index field to change SIP account for each phone port DT
167. gs part select IPSec Tunnel and press the Advanced button a ee E In Dial In Settings part please enable Specify Remote VPN Gateway and enter WAN IP address of Vigor2130 in the Peer VPN Server ID field Vigor2130 Series User s Guide 41 Dray Te k Dray Tek Setup a pre shared key which must be the same as in Vigor2130 Enter Vigor2130 s private network in the Remote Network IP Mask field Click OK Note Vigor2130 supports the following proposals by default For phase 1 Mode Selection When you select Automatic When you select 3DES When you select AES any When you select AES 128 When you select AES 192 When you select AES 256 For phase 2 Mode Selection When you select Automatic When you select 3DES When you select AES any When you select AES 128 When you select AES 192 When you select AES 256 42 Proposals will be sent 3DES MDS Group 5 3DES SHA1 Group 5 3DES SHA1 Group 2 3DES MDS Group 2 3DES MDS Group 5 3DES SHA1 Group 5 3DES SHA1 Group 2 3DES MD5 Group 2 AES MD5 Group 5 AES SHA1 Group 5 AES MDS5 Group 2 AES SHA1 Group 2 AES 128 MD5 Group 5 AES 128 SHA1 Group 5 AES 128 MD5 Group 2 AES 128 SHA1 Group 2 AES 192 MD5 Group 5 AES 192 SHA1 Group 5 AES 192 MD5 Group 2 AES 192 SHA1 Group 2 AES 256 MD5 Group 5 AES 256 SHA1 Group 5 AES 256 MD5 Group 2 AES 256 SHA1 Group 2 Proposals will be sent AES SHAI
168. h valid CRC Display the number of short frames lt 64 bytes with invalid CRC Display the number of long frames according to max_length register with invalid CRC Display the filtered number of the packet received Display the counting number of the packet transmitted Display the total transmitted bytes Display the show the counting number of the transmitted unicast packet Display the show the counting number of the transmitted multicast packet Display the counting number of the transmitted broadcast packet Show the counting number of the transmitted pause packet Display the number of 64 byte frames in good and bad packets transmitted Display the number of 65 127 byte frames in good and bad packets transmitted Display the number of 128 255 byte frames in good and bad packets transmitted Display the number of 256 511 byte frames in good and bad packets transmitted Display the number of 512 1023 byte frames in good and 158 Vigor2130 Series User s Guide Tx 1024 1526 Bytes Tx 1527 Bytes Tx Low Tx Normal Tx Medium Tx High Tx Drops Tx lat Exc Coll 4 7 Applications bad packets transmitted Display the number of 1024 1522 byt frames in good and bad packets transmitted Display the number of 1527 byte frames in good and bad packets transmitted Display the low queue counter of the packet transmitted Display the normal queue counter of the packet transmitted Display th
169. hat such device will be connected However URL username and password under CPE client are fixed that users cannot change it The default CPE username and password are vigor and password You will need it when you configure VigorACS server System Maintenance gt gt TR 069 Setting ACS and CPE Settings ACS Settings URL Username Password Event Code Last Inform Response Time NA CPE Settings Enable URL Port Username Password Periodic Inform Settings Enable Interval Time second s Available settings are explained as follows Item Description ACS and CEP Settings ACS Server On Choose the interface for the router connecting to ACS server Management WAM Management VAN ACS Settings Such data must be typed according to the ACS Auto Configuration Server you want to link Please refer to VigorACS user s manual for detailed information URL Type the URL for VigorACS server If the connected CPE needs to be authenticated please set URL as the following and type username and password for VigorACS server http IP address of VigorACS 8080 ACSServer services ACSServlet Vigor2130 Series User s Guide 253 Dray Te k Item Description If the connected CPE does not need to be authenticated please set URL as the following http IP address of VigorACS 8080 ACSServer services UnAuthACSsServlet Username Password Type username and password for ACS Server for authenticati
170. have a MyVigor Account 7 Create an account now lf you are having difficulty logging in contact aur customer service Customer Senmice S673 507 2727 or Dray Tek 30 Vigor2130 Series User s Guide 4 The following page will be displayed after you logging in MyVigor From this page please click Add or Product Registration Dray Tek P Home o o E My Information D About Us Welcome james_fae Product Last Login Time 2011 03 16 01 45 09 Last Login From 172 16 2 150 Current Login Time 2011 03 16 18 20 31 ee VigorACs SI Current Login From 172 16 3 146 Vigor Series RowNo 5 _ PageNo Your Device List Serial Number r b ll My Information Product Registration D Customer SUEY 5 When the following page appears please type in Nickname for the router and choose the right registration date from the popup calendar it appears when you click on the box of Registration Date After adding the basic information for the router please click Submit D About Us My Product Search for this site Product FF Registration Device wi My Information VigorACS SI Serial number 2011031609200201 Vigar Senes Nickname vigors 130 Product Registration Date 03 16 2011 Segenanee Usage h Customer Survey Product Rating Your opinion so far No of Employees In total within your company Supplier vhere you bought it from Date of Purchas
171. he Dest IP Mask here This option is available only when you choose Network as destination Dest IP ICMP Type Filter Specify the ICMP filter for this ACE Any E Any Any No ICMP filter is specified Specific If you want to filter a specific ICMP filter with this ACE you can enter a specific ICMP value A field for entering an ICMP value appears ICMP Type Value If you choose Specific as ICMP Type Filter you have to type the ICMP Type Value manually The allowed range is 0 to 255 A frame meeting this ACE matches this ICMP value ICMP Code Filter Specify the ICMP code filter for this ACE Any No ICMP code filter is specified ICMP code filter status is don t care Specific If you want to filter a specific ICMP code filter with this ACE you can enter a specific ICMP code value A field for entering an ICMP code value appears ICMP Code Value If you choose Specific as ICMP Code Filter you have to type the ICMP Type Value manually The allowed range is 0 to 255 A frame meeting this ACE matches this ICMP value Choose IPv4 as the Frame Type You will see IP Parameters on the bottom of the page If you choose UDP as IP Protocol Filter you will get the page as the following Vigor2130 Series User s Guide 125 Dray Tek Dray Tek IP Parameters IP Protocol Filter Source IP source IP Address source IP Mask Dest IP Dest IP Address Dest IP Mask UDP Parameters source Port Filter source Port No lo s
172. he content of the certificate Issuer Display the name of the issuer Valid From Display the starting time for the valid Root CA Expires Display the ending time for the valid Root CA Status Display if such certificate is active or not IMPORT Allow to import existed certificate from other CA My Root CA Certificate You can create one Root CA certificates to meet different requests Name Display the name of the certificate Subject Display a brief description for the content of the certificate Issuer Display the name of the issuer Valid From Display the starting time for the valid Root CA Expires Display the ending time for the valid Root CA Status Display if such certificate is Active or not Build RootCA Allow to build user defined Root CA certificate Dray Te k 182 Vigor2130 Series User s Guide You can import other Root CA certificates made by others and upload to Vigor router as CA Simply click IMPORT to access into the following page Certificate Management gt gt Other Root CA Certificate Upload CA Certificate Upload PEM format CA Test Certificate file Paste Certificate below Available settings are explained as follows Item Description Name Type a new name for such certificate Certificate file Use the Browse button to specify the file Upload After choosing the certificate file above click this button to upload onto the router Paste Certificate
173. he packets with web feature filter Use the drop down list to choose the time setting or click New Time Object to define a time period for you necessity New Time Object Mone New Time Object Such link allows you to create new time object for using by web feature filter The method to configure the time object is that same as set in Firewall gt gt Time Object 1 hipt Akdi A del oe org Tim Obati Macrosoll Internat Enpl r r Firewall gt Time Object Abd Vise Object Frohe Tune Start Dat aut 0 a Year Month Date i End Date sA Dayiima w v AllDay Witakdays Monday Tuesday Woedneeday Thursday F Fiday ElSstwday Fl Sunday Clear an 2 Click OK to save the settings 3 The new added traffic control profile will be shown as follows Firewall gt gt Traffic Control C Enable Traffic Control Advanced rules let you customize the firewall to your needs Only new connections will be matched Packets belonging to already open connections are automatically allowed to pass the firewall Name Protocol Source Destination Action y On Duty Any LAN WAN ACCEPT EXXX Dray Tek 134 Vigor2130 Series User s Guide You can click to open the selected profile for any modification click GJ to delete the selected profile 4 4 5 Time Object The time object can be applied to firewall rules only Firewall gt gt Time Object Time Object Configuration Index Profile S
174. here The unit is second OK Save the settings Uninstall Cancel the module installation settings and exit the dialog 4 11 8 DLNA server DLNA Digital Living Network Alliance is a framework which personal computer HDD video recorder television and other digital devices can share each other data through network connection The DLNA devices are divided into two functions One is server side which transmits images music and video and the other is client side which receives data only Some devices support both functions Vigor2130 can install server program onto the connected USB storage device Clients with equipments supporting DLNA can play the files stored in the USB storage device connected to Vigor2130 through the network USB Application gt gt DLNA Server Press the button to install DLNA Server Note Internet connection is required Install Click Install to install the DLNA Server for the router and the USB storage device USB Application gt gt DLNA Server Install DLNA Installation Output Show Data When the server installation is finished you will see the following screen Dray Te k 212 Vigor2130 Series User s Guide USB Application gt gt DLNA Server Settings DLNA Server Enable Disable Refresh shares server Name Vigor 130 Path downloads Note Please disable DLMA function before you unplug USB disk Available settings are explained as follows Item Description DLNA Server
175. i Dest Port Filter Dest Port Range o 5035 Available settings are explained as follows Item Source IP Source IP Address Source IP Mask Dest IP Dest IP Address Dest IP Mask Description Specify the source IP filter for this ACE Any No source IP filter is specified Host Source IP filter is set to Host Specify the source IP address in the Source IP Address field that appears Network Source IP filter is set to Network Specify the source IP address and source IP mask in the Source IP Address and Source IP Mask fields that appear Type the Source IP Address here This option is available when you choose Host or Network as source Source IP Type the Source IP Mask here This option is available only when you choose Network as source Source IP Specify the destination IP filter for this ACE DIF Filter l Any No destination IP filter is specified Host Destination IP filter is set to Host Specify the destination IP address in the destination IP Address field that appears Network Destination IP filter is set to Network Specify the destination IP address and destination IP mask in the destination IP Address and destination IP Mask fields that appear Type the destination IP Address here This option is available when you choose Host or Network as destination IP Type the DIP Mask here This option is available only when you choose Network as destination DIP 126 Vigor2130 Series Use
176. i Collision Configured Configured Mode Control Auto Enabled ka Available settings are explained as follows Item Description Port It displays current network interface Link It displays current connection status Green light means the WAN connection is successful Speed Current It displays current speed that the router uses Configured You can use the drop down list to choose the required speed for the router If you have no idea in configuring speed simple use the default setting Auto 1Gbps FDX 100Mbps FDX 100Mbps HDX 10Mbps FDX Flow Control If flow control is enabled by checking Configured box both parties can send PAUSE frame to the transmitting device s if the receiving port is too busy to handle If not there will be no flow control in the port It drops the packet if too much to handle Current Rx indicates whether pause frames on the port are obeyed Current Tx indicates whether pause frames on the port are transmitted Maximum Frame This module offers 1518 9600 Bytes length to make the long packet for data transmission Excessive Collision Mode There are two modes for you to choose when excessive collision happened in half duplex condition Vigor2130 Series User s Guide 97 Dray Te k Discard Discard Restart Discard It determines whether the MAC drops frames after an excessive collision has occurred If yes a frame is dropped after excessive collision This is IEE
177. ia iso torrent E mythbuntu 8 04 1 alternate i396 iso torrent E natty desktop i306 iso torrent crdownload File japper swenamied io w sven Note Before uploading torrent files to the router please search from Internet and store the seed of the BT torrent on our hard disk first Vigor2130 Series User s Guide 59 Dr ay Te k 11 Next the router will start to download the file to the USB disk You can add new seed of torrent file one by one by clicking Open to let the router download them at one time or ey kallal bl at Open Remove Pause Resume Pause All Resume All 6 Transfers Mote Transmission is allocating disk space for 2 Downloading Seeding Paused edubuntu 3 04 1 addon hppa iso 64 0 KB of 275 6 MB 0 02 remaining time unknown Downloading from 0 of 1 peers DL 0 bytes s UL 0 bytes s edubuntu 8 04 1 addon ia64 iso 64 0 KB of 288 8 MB 0 02 remaining time unknown Downloading from 0 of 1 peers DL 0 bytes s UL 0 bytes s edubuntu 3 04 1 addon powerpc iso 16 0 KB of 282 6 MB 0 remaining time unknown Downloading from 0 of 1 peers DL 0 bytes s UL 0 bytes s edubuntu 3 04 1 addon sparc iso 64 0 KB of 254 7 MB 0 0296 remaining time unknown Downloading from 0 of 1 peers DL 0 bytes s UL 0 bytes s edubuntu 9 04 addon amd64 iso 8 17 MB of 326 5 MB 2 5 1 hr 24 min remaining Es Downloading from 2 of 2 peers DL 64 3 KB s UL 0 bytes s edubuntu 9 04 addon
178. ial number for applying the prefix number settings Take the above picture Prefix Table Setup web page as an example if the dial number is between 7 and 9 that number can apply the prefix number settings here Max Len Set the maximum length of the dial number for applying the prefix number settings Route Choose the one that you want to enable the prefix number settings from the saved SIP accounts Please set up one SIP account first to make this interface available This item will be changed according to the port settings configured in VoIP gt gt Phone Settings After finished the above configuration click OK to save the settings and exit this page Vigor2130 Series User s Guide 219 Dray Tek 4 11 1 3 Call Barring Call barring is used to block phone calls coming from the one that 1s not welcomed VoIP gt gt DialPlan Setup Call Barring Setup Index Call Direction Barring Type Barring Number URL URI 1 2 a 4 5 z Ti o z E lt lt 1 10 11 20 gt gt Advanced Block Anonymous Block Unknown Domain Block IP Address Click any index number to display the dial plan setup page VoIP gt gt DialPlan Setup Call Barring Index No 1 Call Direction IT kd Barring Type specific URFURL Interface Interface Status ae KK KK KK OK OM Available settings are explained as follows Item Description Enable Click this to enable this entry Call Direction Barring Type Dray Tek Dete
179. igor2130 Series User s Guide Diagnostics gt gt Detailed Statistics Detailed Port Statistics WAN Receive Total Rx Packets 6320 Rx Octets 1729133 Rx Unicast 3129 Rx Multicast 200 Rx Broadcast 2991 Rx Pause Receive Size Counters Clear Auto refresh LI Transmit Total Tx Packets 249 Tx Octets 996250 Tx Unicast 2489 Tx Multicast 0 Tx Broadcast 3 Tx Pause Transmit Size Counters Rx 64 Bytes Rx 65 127 Bytes Rx 128 255 Bytes Rx 256 511 Bytes Rx 512 1023 Bytes Rx 1024 1526 Bytes Rx 1527 Bytes Receive Queue Counters Rx Low Rx Normal Rx Medium Rx High Receive Error Counters Rx Drops Rx CRC Alignment Rx Undersize Rx Oversize Rx Fragments Rx Jabber Rx Filtered Tx 64 Bytes Tx 65 127 Bytes Tx 128 255 Bytes Tx 256 511 Bytes Tx 512 1023 Bytes Tx 1024 1526 Bytes Tx 1527 Bytes Transmit Queue Counters Tx Low 1385 Tx Normal 0 Tx Medium 1107 Tx High Transmit Error Counters Tx Drops Tx Late Exc Coll Each item is explained as follows Item Rx Packets Rx Octets Rx Unicast Rx Broadcast Rx Pause RX 64 Bytes RX 65 127 Bytes RX 128 255 Bytes RX 256 511 Bytes RX 512 1023 Bytes Vigor2130 Series User s Guide Description Display the counting number of the packet received Display the total received bytes Display the counting number of the received unicast packet Display the counting number of the received broadcast packet Display the counting number
180. iguration Queuing Weighted Default Class QCL Queuing Mode Tr Horia Medium High Normal v Normal Normal oR E Available settings are explained as follows Item Description Port Indicate the interface for the physical port WAN port LAN port and Wireless Port Default Class Use the drop down list to choose the priority for each port Default Class QCL QoS Control List Use the drop down list to choose the QCL number defined in QoS Control List for the port Vigor2130 Series User s Guide 155 Dray Te k Queuing Mode Use the drop down list to choose suitable mode Queuing Mode Queuing Weighted Use the drop down list to choose 1 2 4 or 8 as the queue weighted number Click OK to save the settings 4 6 6 QoS Statistics This page displays statistics for QoS setting Click WAN LAN link to check detailed information for each interface Bandwidth Management gt gt QoS Statistics Queuing Counters Auto refresh j Low Queue Normal Queue Medium Queue High Queue Receive Transmit Receive Transmit Receive Transmit Receive Transmit 375086 138760 1904408 0 93214 36158 1057 0 0 0 0 0 0 0 g 36342 63039 1735 18607 T3682 53388 5 0 0 0 0 0 0 g 0 0 0 i 0 0 0 0 0 0 0 Inbound Status Outbound Status Low Low Normal Normal Medium Medium High High 10 a 30 pps a 5 10 pps Click WAN LANI LAN2 LAN3 LAN4 link to check detailed information for each interface Dray Tek 156 V
181. ilter Web Content Filter PF APP Enforcement 4 5 1 URL Content Filter To provide an appropriate cyberspace to users URL Content Filter not only to limit illegal traffic from to the inappropriate web sites but also prohibit other web feature where malicious code may conceal Vigor router also can prevent user from accidentally downloading malicious codes from web pages It s very common that malicious codes conceal in the executable objects such as ActiveX Java Applet Proxy and so on In addition Vigor router allows you to filter certain host specified with IP address Note The priority of URL content filters is higher than Web Content Filter CSM gt gt URL Content Filter Web Feature Filter Filters O Proxy O Java J Activex Time New Time Object Web URL Filter Setting Filter all URL keywords e g http apps facebook com silvergames Current Web URL Filters Delete Enable URL Start IP Time New Time Object URL O Start IP Ay End IP Any Add a New Entry aie S H Web Host Filter Setting Current Host Filters Delete Enable Start IP HTTFS Time New Time Object Host __ Stat P End IP fei a Neos Enig Note HTTPS block need a learning period to take effect Available settings are explained as follows Item Description Dray Tek 136 Vigor2130 Series User s Guide Web Feature Filter Web URL Filter Setting Web Host Filter Setting Vigor2130 Series User s Guide If you do not chec
182. imit Available settings are explained as follows Item Description Disable Click this button to close the function of limit bandwidth Enable Click this button to activate the function of limit bandwidth Default TX limit Define the default speed of the upstream for each computer in LAN Default RX limit Define the default speed of the downstream for each computer in LAN Vigor2130 Series User s Guide 147 Dray Te k Specific Limitation This section is allowed to configure the user defined limitation for bandwidth Limitation List Display a list of specific limitations that you set on this web page Start IP Bandwidth limit can be applied on certain IP range That s only the PCs within the range will be influenced by the bandwidth limitation set here Please define the start IP address for the specific limitation End IP Define the end IP address for the specific limitation TX Limit Define the limitation for the speed of the upstream to be applied as specific limitation If you do not set the limit in this field the system will use the default speed for the specific limitation you set for each index RX Limit Define the limitation for the speed of the downstream to be applied as specific limitation If you do not set the limit in this field the system will use the default speed for the specific limitation you set for each index Add Add the specific speed limitation onto the list above Edit Allows you to edi
183. ined as follows Item Description Ethernet Type Filter Choose Any to set the parameter with any value set by the router automatically or choose Specific to specify certain value the range is 0x0000 to OxXFFFF Ethernet Type Parameters Etherl ype Filter Ethernet Type Value Choose ARP as the Frame Type you will get ARP Parameters option as the following ARP Parameters ARP PARP ARP SMAC Match Request Reply Any a RARP DMAC Sender IP Filter Match sender IF Soe IP Ethernet Address 132 168 1 1 Length Sender IP Mask 255 255 255 0 IP Target IP Filter etwork Ethernet Target IP Address Target IP Mask Available settings are explained as follows Item Description ARP RARP Choose the ARP RARP that you want to filter Vigor2130 Series User s Guide 121 Dray Te k Dray Tek Request Reply Sender IP Filter Sender IP Address Sender IP Mask Target IP Filter Target IP Address Target IP Mask ARP SMAC Match ARP RARP Other Choose the request or replay that you want to filter Request Reply Sender IF Filter Choose Any to filter all of the packets Choose Host to filter the packets from the host with the address typed in Sender IP Address filed Choose Network to filter the packets within the network defined in Sender IP Address and Sender IP Mask fields Type the Sender IP Address here This option is available when you choose Host or Network as Sender I
184. ing Operation Mode Upgrade Backup Setting Router IP 197 165 1 1 BU Message Vigor2130 Series User s Guide 285 Dr ay Te k If the message of Request Timeout Transfer Abort appears please check if the connection between the computer and the Vigor is active or not And if the message of Incorrect No file name Transfer Abort appears please check if the firmware you download is correct for your Vigor router 1 Firmware Upgrade Utility aea Firmware Upgrade Utility ama Operation Mode Operation Mode Upgrade Upgrade Backup Setting Backup Setting Router IP Router IP mesa Ga bern Firmware File Firmware File Port Note Please turn off the Firewall protection while upgrading the firmware with Windows Vista The Firewall function can be turned off via Control Panel gt gt Security Center gt gt Firewall Dray Tek 286 Vigor2130 Series User s Guide 5 6 Backing to Factory Default Setting If Necessary Sometimes a wrong connection can be improved by returning to the default settings Try to reset the router by software or hardware Warning After pressing factory default setting you will loose all settings you did before Make sure you have recorded all useful settings before you pressing Q Software Reset You can reset the router to factory default via Web page Go to System Maintenance and choose Reboot System on the web page The following screen wi
185. ing for each other Wireless Mode Choose the wireless mode for this router At present only 802 11B B N mix is available Channel Width 20 40 the router will use 20Mhz or 40Mhz for data transmission and receiving according to the station capability Such channel can increase the performance for data transmission 20 the router will use 20Mhz for data transmitting and receiving between the AP and the stations 2040 MHz o 2040 MHZ Channel It means the channel of frequency of the wireless LAN The default channel is 11 You may switch channel if the selected channel is under serious interference If you have no idea of choosing the frequency please select Auto to let system determine for you Extension Channel Such channel will be brought out automatically when you determine the Channel selection It can help to extend the bandwidth for wireless connection Such value can be modified manually Tx Power Set the power percentage for transmission signal of access point The greater the value is the higher intensity of the signal will be Enable Green AP Such function is used to reduce the power consumption Green AP for the access point When there is no station connected the power consumption of access point will be reduced Enable IGMP Snooping Check it to enable IGMP snooping for WLAN client Encryption Select an appropriate encryption mode to improve the security and privacy of your wireless data packets
186. ing network connection through WPS When the LED lights up the WPS connection will be on On The WPS is off Blinking Waiting for wireless client sending requests for connection about two minutes Interface Description WLAN Press the button once to enable WLAN LED on or disable WLAN LED off wireless connection WAN Connector for accessing the Internet LAN Connectors for local networked devices 1 2 3 4 USB 1 2 Connector for USB storage device Pen Driver Mobile HD or printer or 3G backup Dray Tek 4 Vigor2130 Series User s Guide unu a TIMI i r Interface Factory Reset Description Restore the default settings Usage Turn on the router ACT LED is blinking Press the hole and keep for more than 5 seconds When you see the ACT LED begins to blink rapidly than usual release the button Then the router will restart with the factory default configuration PWR Connector for a power adapter ON OFF Power Switch Vigor2130 Series User s Guide Dray Tek 1 3 3 For Vigor2130Vn LED SIECLE Explanation Activity normally HPA WAN PAN an USBI 2 Phonel On The phone connected to this port is Phone2 off hook Off The phone connected to this port is on hook Blinking A phone call comes WLAN Wireless access point is ready Blinking It will blink while wireless traffic goes through WPS Press this button for 2 seconds to wait Button for client devi
187. ings may not be removed 4 7 6 Wake On LAN A PC client on LAN can be woken up by the router it connects When a user wants to wake up a specified PC through the router he she must type correct MAC address of the specified PC on this web page of Wake On LAN of this router In addition such PC must have installed a network card supporting WOL function By the way WOL function must be set as Enable on the BIOS setting Dray Tek 166 Vigor2130 Series User s Guide Applications gt gt Wake on LAN Wake on LAN Note Wake on LAN integrates with Bind IP ta MAC function only binded PCs can wake up through IF Wake by MAC Address IPF Address MAC Address rok EE RE EL Result a Available settings are explained as follows Item Description Wake by Two types provide for you to wake up the bond IP If you choose Wake by MAC Address you have to type the correct MAC address of the host in MAC Address boxes If you choose Wake by IP Address you have to choose the correct IP address Wake by MAC Address MAC Address P Address IP Address The IP addresses that have been configured in LAN gt gt Bind IP to MAC will be shown in this drop down list Choose the IP address from the drop down list that you want to wake up MAC Address Type any one of the MAC address of the bond PCs Wake Up Click this button to wake up the selected IP See the following figure The result will be shown on the box
188. io using the key which either PSK Pre Shared Key entered manually in this field below or automatically negotiated via 802 1x authentication Select WPA WPA2 or Auto as WPA mode Auto WPA or WPA2 Enter the IP address of RADIUS server The UDP port number that the RADIUS server is using The default value is 1812 based on RFC 2138 The RADIUS server and client share a secret that is used to authenticate the messages sent between them Both sides must be configured to use the same shared secret WPS Wi Fi Protected Setup provides easy procedure to make network connection between wireless station and wireless access point vigor router with the encryption of WPA and WPA2 Vigor2130 Series User s Guide 193 Dray Tek Wireless Security Configuration Encryption WPS Configuration amp Configure via Push Button Stat PBC Configure via Client PinCode start PIN OK Available settings are explained as follows Item Description Configure via Push Click Start PBC to invoke Push Button style WPS setup Button procedure The router will wait for WPS requests from wireless clients about two minutes The WPS LED on the router will blink fast when WPS is in progress It will return to normal condition after two minutes You need to setup WPS within two minutes Configure via Client Type the PIN code specified in wireless client you wish to PinCode connect and click Start PIN button The WLAN LED on the
189. ion can protect the internal network On NAT page you will see the private IP address defined in RFC 1918 Usually we use the 192 168 1 0 24 subnet for the router As stated before the NAT facility can map one or more IP addresses and or service ports into different specified services In other words the NAT function can be achieved by using port mapping methods Below shows the menu items for NAT NAT Hardware NAT Open Port DMZ Host Vigor2130 Series User s Guide 111 Dray Te K 4 3 1 Hardware NAT Hardware base Acceleration Engine also named Protocol Processing Engine API is the function that DrayTek provides to extremely speed up the NAT performance While the hardware acceleration mechanism 1s activated most of the bandwidth usage will be concentrated on the specific sessions which increase transmission speed to get ultimately accelerated With Hardware NAT LAN to WAN NAT throughput can be over 900M bps But be sure that your PC has Giga Ethernet and connect with CAT6 Ethernet cable NAT gt gt Hardware NAT Hardware NAT Configuration Enabled o Click OK to save the settings 4 3 2 Open Ports Open Ports allows you to open a range of ports for the traffic of special applications NAT gt gt Open Port Port Forwarding Status Name Protocol Start Port End Port Local Host Local Port No Port Forwarding Add New Entry Common application of Open Ports includes P2P application e g B
190. itation you set for each index Add Adds the specific session limitation onto the list above Edit Allows you to edit the settings for the selected limitation Delete Remove the selected settings existing on the limitation list When you finish adding a new session limit simply click OK Dray Tek 146 Vigor2130 Series User s Guide 4 6 2 Bandwidth Limit The downstream or upstream from FTP HTTP or some P2P applications will occupy large of bandwidth and affect the applications for other programs Please use Limit Bandwidth to make the bandwidth usage more efficient In the Bandwidth Management menu click Bandwidth Limit to open the web page Bandwidth Management gt gt Bandwidth Limit Bandwidth Limit Configuration Disable Enable DefaultTXLimit 0 Kbps Default RX Limit 0 Kbps Limitation List Specific Limitation stati ooo endiP ooo TXLimit Kbps RXLimit Kbps C Smart Bandwidth Limit For any LAN IP excluding 2nd subnetIP NOT in Limitation List when session number exceeds 1000 TX Limit Kbps RX Limit Kbps Note 1 Bandwidth limit only works for NEV sessions Original sessions are controlled by Hardware NAT 2 Default TX Limit and Default RX Limit do not work if Hardware NAT is enabled 3 Ifthe IP is controlled by bandwidth limit throughput would be lower than 85Mbps To activate the function of limit bandwidth simply click Enable and set the default or user defined upstream and downstream l
191. k In Bridge mode the router will connect to up to four Vigor2130 which use the same mode and all wired Ethernet clients of every Vigor2130 will be connected together You can use this mode to connect a network to other networks which is physically isolated Please note that when you set to this mode Vigor2130 will not accept regular wireless clients anymore In Repeater mode the router will connect to up to four Vigor2130 which use the same mode and all wired Ethernet clients of every Vigor2130 will be connected together You can use this mode to connect a network to other networks which is physically isolated When you use this mode this access point is still able to accept wireless clients Click WDS from Wireless LAN menu The following page will be shown Wireless LAN gt gt WDS Settings WDS Settings Mode Phy Mode WDSt1 WDS3 Enable Peer Mac Address Enable Peer Mac Address LLL LA LAL EEE EEEE Security Security Disabled WEF TKIP AES Disabled WEP TKIP AES ky oo Key WDS WOS4 Enable Peer Mac Address Enable Peer Mac Address LLL LA ELL LL Security Security Disabled WEF TKIP AES Disabled WEP TKIP AES Available settings are explained as follows Item Description Mode Choose the mode for WDS setting Disable mode will not invoke any WDS setting Bridge Mode is designed to fulfill the first type of application Repeater Mode is for the second one Bridge Mode v Bridge Mode Repeater Mode
192. k IP Mask field Click OK Note Vigor2130 supports the following proposals by default For phase 1 Mode Selection When you select Automatic When you select 3DES When you select AES any When you select AES 128 When you select AES 192 When you select AES 256 For phase 2 Mode Selection When you select Automatic When you select 3DES When you select AES any When you select AES 128 When you select AES 192 When you select AES 256 Vigor2130 Series User s Guide 49 Proposals will be sent 3DES SHAI Group 2 3DES MD5 Group 5 AES MD5 Group 5 AES 128 MD5 Group 5 AES 192 MD5 Group 5 AES 256 MD5 Group 5 Proposals will be sent AES 128 MD5 AES 128 SHA 1 AES 192 MD5 AES 192 SHA 1 AES 256 MD5 AES 256 SHA1 3DES SHAI 3DES MD5 3DES MD5 3DES SHA1 AES 256 MD5 AES 256 SHA1 AES 128 MD5 AES 128 SHA1 AES 192 MD5 AES 192 SHAI AES 256 MD5 AES 256 SHA1 Dray Tek Case 2 VPN direction from Vigor2820 to Vigor2130 VPN configuration on Vigor2130 l a ek eS E 10 Dray Tek Create a LAN to LAN profile VPN and Remote Access gt gt LAN to LAN Edit VPH Tunnel General Enabled Name Demo Remote IP 0 0 0 0 gt IKE phase 1 mode Aggressive Mode Authentication Type Pre Shared Key Pre Shared Key eee Confirm Pre Shared Key eee Local Identity Remote Identity vigor2820 Networks
193. k any box here it means Vigor router will not prevent users from accidentally downloading malicious codes conceal in the executable objects from web pages Filters Choose any one of the items to be filtered by such router Time Specify a period for filtering the packets with web feature filter Use the drop down list to choose the time setting or click New Time Object to define a time period for you necessity Time None New Time Object None New Time Object Such link allows you to create new time object for using by web feature filter The method to configure the time object is that same as set in Firewall gt gt Time Object g https kd 52130 dyndns org Time Object Microsoft Internet Explorer Firewall gt gt Time Object Add Time Object Profile Time2 Start Date 2011 05 x 20 x Year Month Date End Date z a v Daytime ik 4 All Day Weekdays Monday M Tuesday M Wednesday Thursday Friday Saturday M Sunday Any URL that you want to filter by Vigor router simply type the URL Start IP and End IP in the specified fields and click Add a New Entry The new added one will be displayed on the screen After pressing OK it will be filtered whenever you visit Web URL Filter Setting Filter all URL keywords e g facebook silvergames Current Web URL Filters Delete Enable URL Start IP End IP Time New Time Object www dr
194. ked Domains C Private IP Address O Each item is explained as follows Item Name Enable Source IP Description Type a profile name for WCF service Click it to enable such profile Type the IP address with mask address e g 192 168 1 0 255 255 255 0 to indicate a network or type 192 168 1 10 255 255 255 255 to indicate a single IP to be filtered by WCF mechanism 142 Vigor2130 Series User s Guide Time Filter Https Status Children Protection Leisure B usiness Chating Com puter Other OK Back Apply the time object to such profile Choose any one of the time object profiles from the drop down list You can create another one by clicking the link of New Time Object Check it to enable the HTTPS filtering of WCF Display current used WCF mechanism Check the box to make such item filtered by this profile Save the settings Return to previous page 5 Type the required information such as source IP address and subnet mask Check the items that you want to filter 6 After finished the configuration click OK to save the settings 4 5 3 APP Enforcement You can define policy profiles for IM Instant Messenger P2P Peer to Peer Protocol application This page allows you to set 32 profiles for different requirements CSM gt gt APP Enforcement APP Enforcement Enable APP Enforcement auto refresh CI Note Only new connections will be matched Available settings are explained a
195. le to open the list page This page displays the session information for UDP and or TCP Also you can specify the IP range to observe the corresponding information for your necessity Diagnostics gt gt Sessions Table Protocal Protocol UDF TEE UDF UOP UOP UDF TCP TCP UOP TCP UDF Tee UDP TCP TCP Source IP Port Source IP Port 192 168 1 192 168 1 192 168 1 192 165 1 192 165 1 192 168 1 192 168 1 192 166 1 192 165 1 192 165 1 192 168 1 192 168 1 192 168 1 192 165 1 192 168 1 10 33542 10 4626 10 33542 10 3354 10 3354 10 3354 10 4546 10 4834 10 33544 10 4536 10 3354 10 4831 10 33542 10 4532 10 4713 Page Auto refresh C State Dest IP Port 61 194 25401702421 192 168 1 1 60 61 194 234 1702412 61 194 234 170 2419 61 194 234 170 2414 61 194 234 1 70 2425 213 146 158 12 443 61 194 254 17027425 61 194 234 170 2425 61 194 234 17027 425 61 194 234 1 7027425 114 39 201 14 443 169 254 210 477 27 425 220 1350 59 124 445 99 255 122 230443 Show ALL State ESTABLISHED ESTABLISHED SYN SENT ofl SENT ESTABLISHED ESTABLISHED ESTABLISHED Each item is explained as follows Item Page Auto refresh Refresh Shall ALL Protocol Source IP Port Dest IP Port State Search Dray Tek Description Allow to choose the page to be displayed on this screen Check it to enable auto refresh function Click it to reload the pag
196. ll appear Choose Using factory default configuration and click OK After few seconds the router will return all the settings to the factory settings System Maintenance gt gt Reboot System Reboot System Do You want to reboot your router Using current configuration Using factory default configuration Hardware Reset While the router is running ACT LED blinking press the Factory Reset button and hold for more than 5 seconds When you see the ACT LED blinks rapidly please release the button Then the router will restart with the default configuration Factory Reset After restore the factory default setting you can configure the settings for the router again to fit your personal request Vigor2130 Series User s Guide 287 Dray Te k 5 7 Contacting Your Dealer If the router still cannot work correctly after trying many efforts please contact your dealer for further help right away For any questions please feel free to send e mail to support draytek com Dray Tek 288 Vigor2130 Series User s Guide
197. low shows the menu items for Firewall Firewall Dias EEE Ports Configuration Access Control List Trattic Control Time Object 4 4 1 DoS Defense Click Firewall and click DoS Defense to open the setup page Firewall gt gt DoS Defense Storm Control Configuration Frame Type Rate pps Unicast 1 Multicast Broadcast Available settings are explained as follows Vigor2130 Series User s Guide 115 Dray Te k Item Description Frame Type Set the Unicast storm rate control multicast storm rate control and a broadcast storm rate control for your router Status Check this box to enable storm control status for the frame type Rate The unit is packet per second pps Use the drop down list to set the rate for data transmission The rate is 2 n where n is equal to or less than 15 or No Limit The unit of the rate can be either pps packets per second or kpps kilopackets per second The configuration indicates the permitted packet rate for unicast multicast or broadcast traffic across the switch Click OK to save the settings 4 4 2 Ports Configuration This page is used to configure the ACL Access Control List parameters for each port These parameters will affect data packets received on a port unless the data packets match a specific ACE Access Control Entry Firewall gt gt Ports Configuration Ports Configuration Clear Rate Limiter ID Counter Disabl 17411 Disable 0 14505
198. m a specific host or network defined in the list A maximum of three IPs subnet masks is allowed IP Indicate an IP address allowed to login to the router Subnet Mask Represent a subnet mask allowed to login to the router 263 Dray Tek 4 15 9 Reboot System The Web Configurator may be used to restart your router for using current configuration Click Reboot System from System Maintenance to open the following page System Maintenance gt gt Reboot System Reboot System Do You want to reboot your router Using current configuration Using factory default configuration Click OK The router will take 5 seconds to reboot the system Note When the system pops up Reboot System web page after you configure web settings please click OK to reboot your router for ensuring normal operation and preventing unexpected errors of the router in the future 4 15 10 Firmware Upgrade Before upgrading your router firmware you need to install the Router Tools The Firmware Upgrade Utility is included in the tools The following web page will guide you to upgrade firmware by using an example Note that this example is running over Windows OS Operating System Download the newest firmware from DrayTek s web site or FTP site The DrayTek web site is www draytek com or local DrayTek s web site and FTP site is ftp draytek com Click Maintenance gt gt Firmware Upgrade to launch the Firmware Upgrade Utility System Main
199. mation CSM gt gt Web Content Filter New Time Object BPiM Youth Protection Select All Clear All F Youth Protection Each item is explained as follows Item Description Name Type a profile name for WCF service Enable Click it to enable such profile Source IP Type the range for source IPs Time Apply the time object to such profile Choose any one of the time object profiles from the drop down list You can create another one by clicking the link of New Time Object Status Display current used WCF mechanism Youth Protection Check the box to make such item filtered by this profile Vigor2130 Series User s Guide 139 Dray Te k OK Save the settings Back Return to previous page After finished the configuration click OK to save the settings A new entry is added successfully on the web page CSM gt gt Web Content Filter Enable License Information Provider BPjM Activate Name Status Source Filter Https Time Child_Protection Ti Any Any x None Add a New Entry For Commtouch service l Dray Tek Open CSM gt gt Web Content Filter The following page will be displayed CSM gt gt Web Content Filter Provider License Information e Activate Please Activate Commtouch or BPjM license first Click Activate to activate the WCF service from MyVigor web site After you registered current router and activate the Commtouch service please return to
200. me APN means Access Point Name which is provided and required by some ISPs WAN Connection Mode Such function allows you to verify whether network Detection connection is alive or not through ARP Detect or Ping Detect Choose ARP Detect or Ping Detect for the system to execute for WAN detection Ping IP If you choose Ping Detect as detection mode you have to type IP address in this field for pinging Clone MAC Address Enable Enable the feature It is available when the box of Enable is checked Click Clone MAC Address The result will be displayed in the field of MAC Address Enable Clone MAC Address MAC Address 00 0E A6 24 D5 A1 Mail SMS Alert Alert Types Specify the type of the alert mail SMS or Mail and SMS that Vigor system will use to send a message to the user Mail and Sits Event types Specify the event when the system must send a notification to the user by mail and or SMS Vigor2130 Series User s Guide 83 Dray Te k 4 1 2 Multi VLAN Vigor2130 series offers multi VLAN function to make the data transmission with security Data transmitting through the Ethernet port for connecting to Internet can be tagged with an ID number specified here for ensuring the security In addition each LAN port also can be tagged with an ID number in local network to reach the goal of protection If all the boxes are checked it means that Internet connection and data transmission can be done via 4 VLAN gro
201. mers With high throughput performance and secured broadband connectivity provided by Vigor2130 series you can simultaneously engage these bandwidth intensive applications such as high definition video streaming online gaming and Internet telephony access 1 1 Features Gigabit WAN port and embedded hardware NAT deliver ultra fast speed from WAN to LAN Gigabit LAN ports stream content to wired devices with unprecedented speeds 2 USB ports provides fast access to an external USB hard drive Embedded DLNA server iTune server supports stream content to Media Players Up to 800 Mpbs throughput for downstream Advanced QoS for Data Music VoIP and Video Easy to use firewall VolP facilities for low cost call V model 1 2 Web Configuration Buttons Explanation Several main buttons appeared on the web pages are defined as the following ote Save and apply current settings ELT Cancel current settings and recover to the previous saved settings OSE Clear all the selections and parameters settings including selection from drop down list All the values must be reset with factory default settings Add new settings for specified item Edit Edit the settings for the selected item cL ce Delete Delete the selected item with the corresponding settings Vigor2130 Series User s Guide l Dray Te k Note For the other buttons shown on the web pages please refer to Chapter 4 for detailed explanation 1 3 LED Indicators and Conne
202. n Port Members Delete VLAN ID MAC Address WAN LAN1 LAN LAN LAN4 LAN 00 00 00 00 00 00 O d dl m d Add new static entry 4 2 4 VLAN Virtual LAN function provides you a very convenient way to manage hosts by grouping them based on the physical port You can also manage the in out rate of each port Go to LAN page and select VLAN The following page will appear VLAN function is enabled in default LAN gt gt VLAN Frivate VLAN Membership Configuration Fort Members Delete PVLAN ID LAN2 LAN3 Add New Private VLAN Click this button to add a new private VLAN The router allows you to add up to 4 VLAN LAN gt gt VLAN Private VLAN Membership Configuration Port Members Delete LAN LAN3 To add or remove a VLAN please refer to the following example 1 VLAN 1 is consisted of hosts linked to P1 P4 2 After checking the box to enable VLAN function you will check the table according to the needs as shown below Dray Tek 109 Vigor2130 Series User s Guide LAN gt gt VLAN Private VLAN Membership Configuration Port Members Delete LAN LANS CI a C OK 3 To remove VLAN click the Delete button for the one you want to remove and click OK to save the results 4 2 5 Monitor Port It is used to monitor the traffic of the network For example we assume that LAN and LAN2 are Monitor Port and Monitor ingress Port respectively thus the traffic received by LAN2 will be copied to LAN1 f
203. n Main Router so that user A and B locating in different subnet can talk to each other via the router Assuming the Internet access has been configured and the router works properly use the Main Router to surf the Internet create a private subnet 192 168 10 0 using an internal Router A 192 168 1 2 create a public subnet 211 100 88 0 via an internal Router B 192 168 1 3 have set Main Router 192 168 1 1 as the default gateway for the Router A 192 168 1 2 Before setting Static Route user A cannot talk to user B for Router A can only forward recognized packets to its default gateway Main Router Dray Te k 102 Vigor2130 Series User s Guide Internet Set Static Route Router C 1 Click the LAN Static Route and click Add Check the Enable box Please add a static route as shown below which regulates all packets destined to 192 168 10 0 will be forwarded to 192 168 1 2 Click OK LAN gt gt Static Route Add Static Route Enable Destination IP Address 192 168 10 0 subnet Mask 255 255 255 0 Gateway IP Address 192 168 1 2 Optional for PPP mode Interface PA Return to Static Route page Click Add again to add another static route as show below which regulates all packets destined to 211 100 88 0 will be forwarded to 192 168 1 3 LAN gt gt Static Route Add Static Route Enable Destination IF Address subnet Mask Gateway IP Address Optional for PPP mode Interface Vigor2130 Series User
204. n Settings Profile Name 4 Enable this praf VPN Dial Out Through WaNi First Netbios Naming Packet Pass O Block Multicast via VPN Opass Block for some IGMP IP Camera DHCP Relay etc 2 Dial Out Settings test Type of Server I am calling Call Direction T always om Idle Timeout CI Enable PING to keep alive PING to the IP Auto refresh LI ESP Alg Status STATE_QUICK 12 2828 VPN configuration on Vigor2820 Bo 1 Dial Out Dial in o second s Sas Username Password IPSec Tunnel L2TP with IPSec Policy None Server IP Host Name for VPN such as draytek com or 123 45 67 89 PPP Authentication VJ Compression IKE Authentication Method Pre Digital Signature x 509 None IPSec Security Method Index 1 15 in Schedule Setup bE L LI 3 Dial In Settings Allowed Dial In Type PPTP IPSec Tunnel L2TP with IPSec Policy None vv Username Password VJ Compression 22 on O off IKE Authentication Method CIl Specify Remote VPN Gateway Peer VPN Server IP Damm Pre Shared Key IKE Pre Shared Key or Peer ID p C Digital Signature x 509 IPSec Security Method High ESP 4 TCP IP Network Settings 0 0 0 0 0 0 0 0 x 192 168 30 0 My WAN IP Remote Gateway IP Remote Netw
205. n the destination IP address and destination IP mask fields that appear Dest IP Address Type the Dest IP Address here This option is available when you choose Host or Network as destination IP filter Dest IP Mask Type the Dest IP Mask here This option is available only when you choose Network as destination IP filter 4 4 4 Traffic Control There are some limitations that transmitting and receiving packets through WLAN or VPN tunnel cannot be controlled well in hardware The function of Traffic Control is designed specifically to customize firewall rule for managing the traffic in and out Firewall gt gt Traffic Control J Enable Traffic Control Advanced rules let you customize the firewall ta your needs Only new connections will be matched Packets belonging to already open connections are automatically allowed to pass the firewall Name Protocol Source Destination Action Mo Jrafie Contra Available settings are explained as follows Item Description Enable Traffic Control Check the box to enable such function Add Entry Click it add a new firewall rule Dray Te k 132 Vigor2130 Series User s Guide Adding a New Traffic Control Profile You are allowed to add many traffic control rules for your request 1 Click Add Entry the following screen will be shown Firewall gt gt Traffic Control Add Rule L Enable Name Source Destination Protocol source Part Destination Part source Address address ma
206. name of SIP address before Vigor2130 Series User s Guide 223 Dray Tek Ring Port Status Specify which port will ring when receiving a phone call Show the status for the corresponding SIP account R means such account is registered on SIP server successfully means the account is failed to register on SIP server Click any index number to access into the following page VoIP gt gt SIP Accounts SIP Account Index No 1 Item Profile Name Register via SIP Port Domain Realm Proxy L Act as outbound proxy Display Name Account Number Name C Authentication ID C Phone Number Password Expiry Time Ring Port Ring Pattern fs 11 char max C Call without Registration 68 char mar 63 char max fs 23 char max I 68 char max Pod 63 char ma Po 6 char ma PY 68 char max C Phone1 C Phone Available settings are explained as follows Profile Name Register via Dray Tek Description Assign a name for this profile for identifying You can type similar name with the domain For example if the domain name is draytel org then you might set draytel in this field If you want to make VoIP call without register personal information please choose None and check the box to achieve the goal Some SIP server allows user to use VoIP function without registering For such server please check the box of Call without Registration Choosing Auto is recommended The system will select
207. nction SIM PIN code Type PIN code of the SIM card that will be used to access Internet Modem Initial String1 2 Such value is used to initialize USB modem Please use the default value If you have any question please contact to your ISP APN Name APN means Access Point Name which is provided and required by some ISPs Modem Dial String Such value is used to dial through USB mode Please use the default value If you have any 90 Vigor2130 Series User s Guide question please contact to your ISP PPP Username Type the PPP username optional PPP Password Type the PPP password optional WAN Connection Mode Such function allows you to verify whether network Detection connection is alive or not through ARP Detect or Ping Detect Choose ARP Detect or Ping Detect for the system to execute for WAN detection Ping IP If you choose Ping Detect as detection mode you have to type IP address in this field for pinging Mail SMS Alert Alert Types Specify the type of the alert mail SMS or Mail and SMS that Vigor system will use to send a message to the user None w Mail SM5 Mail and Sits Event types Specify the event when the system must send a notification to the user by mail and or SMS Reset USB Click it to reset the USB device Default Click it to retrieve the factory settings for current page 56K Backup When the WAN connection is broken router will try to keep the connection with 56K mode
208. ng routers print server and host PCs needs an IP address to identify its location on the network To avoid address conflicts IP addresses are publicly registered with the Network Information Centre NIC Having a unique IP address is mandatory for those devices participated in the public network but not in the private TCP IP local area networks LANs such as host PCs under the management of a router since they do not need to be accessed by the public Hence the NIC has reserved certain addresses that will never be registered publicly These are known as private IP addresses and are listed in the following ranges Vigor2130 Series User s Guide 67 Dray Te k From 10 0 0 0 to 10 255 255 255 From 172 16 0 0 to 172 31 255 255 From 192 168 0 0 to 192 168 255 255 What are Public IP Address and Private IP Address As the router plays a role to manage and further protect its LAN it interconnects groups of host PCs Each of them has a private IP address assigned by the built in DHCP server of the Vigor router The router itself will also use the default private IP address 192 168 1 1 to communicate with the local hosts Meanwhile Vigor router will communicate with other network devices through a public IP address When the data flow passing through the Network Address Translation NAT function of the router will dedicate to translate public private addresses and the packets will be delivered to the correct host PC in the local area network Th
209. nloads root f Add a New Entry Available settings are explained as follows Item Enable Disk Sharing Workgroup Name Share Name Comment Path Vigor2130 Series User s Guide Description Check this box to share the information on USB storage disk It provides easy sharing of files printers and other network resources for the computers collected under such group on LAN It displays the name to be known by other computers in local network It displays the description for the disk sharing It displays the directory name for the connected USB disk 207 Dray Tek Visible It displays the status of the connected USB disk To add a new entry for disk sharing please click Add a New Entry to open the following page USB Application gt gt Disk Share Add Disk Share Identification Settings Volume HOS 2257 bYLATZO Ei 356 PORT Visible F Access Rule ACCESS All Users Read only Available settings are explained as follows Item Description Share Name Type a name to be known by other computers in local network The name must not contain spaces or special characters Comment Type the brief description for the disk sharing The words here will be seen in Network Neighborhood on Windows client computers Volume Select the proper volume for the connected USB disk Home Folder It determines the range for the client to access into The user can enter a directory name in this
210. nnection Type Use the Connection Type drop down list to choose one of the WAN modes The corresponding page will be displayed 56K Modem 4G USB Modem WAN IP Alias If you have multiple public IP addresses and would like to utilize them on the WAN interface please use WAN IP Alias You can set up to 8 public IP addresses other than the current one you are using Such function can 69 Dray Tek be applied to each connection type hitp ff 192 168 1 1 WAN IP Alias Microsoft Internet Explorer Seles WAN IP Alias Multi NAT Index Enable Aux WAN IP Y 172 16 3 102 Below shows the configuration page for each connection type Static For static IP mode you usually receive a fixed public IP address or a public subnet namely multiple public IP addresses from your DSL or Cable ISP service providers In most cases a Cable service provider will offer a fixed public IP while a DSL service provider will offer a public subnet If you have a public subnet you could assign an IP address or many IP address to the WAN interface To use Static as the accessing protocol of the internet please choose Static mode from Connection Type drop down menu The following web page will be shown D F ay Ti e k 70 Vigor2130 Series User s Guide WAN gt gt Internet Access WAN IP Configuration Enable Connection Type Static IP ww WAN IP Alias Static IP Settings IP Address subnet Mask Gateway IP Address Primary DNS Server se
211. ns the session limitation for this access control list will be applied to 1f matching with the rule defined in this page Action Rate Limiter Select a rate limiter to apply to this port Available settings include Disabled and 1 to 10 The default value is Disabled Click the Rate Limiter link to configure different rates for each ID Rate Limiter Disabled v 2 3 A 5 T 2 9 IP Parameters Parameters displayed here will be changed according to the Frame Type you select When you finish the setting click OK to save the settings A new ACL profile is created Firewall gt gt Access Control List Access Control List Configuration Auto refresh Clear Counter Delete All Status Ingress Port Frame Type Action Rate Limiter Counter IP i Any vi Any oTaP 192 168 1 42 32 Permit Disabled DesIP Any Note This hardware based feature is available for wired connection only You can click to open the selected profile for any modification click GJ to delete the selected profile D F ay Ti e k 120 Vigor2130 Series User s Guide Detailed Explanation for Frame Type Frame Type selection will lead different options for configuration Choose Ethernet Type as the Frame Type you will get Ethernet Type Parameters option as the following ACE Configuration Enable Ingress Port Frame Type Ethernet Type In Ethernet Type Parameters EtherType Filter Any Ww Available settings are expla
212. nsmission speed of the monitored device RX rate kbps Display the receiving speed of the monitored device Hardware NAT rate Display the data processing rate of the monitored device if hardware NAT is enabled Sessions Display the session number that you specified in Limit Session web page Action Block can prevent specified PC accessing into Internet within 5 minutes Auto efresh L Session Action 1 Block Unblock the device with the IP address will be blocked in five minutes The remaining time will be shown on the session column 4 Auto refresh Session Action 5 Unblock 4 16 11 Traffic Graph Click Diagnostics and click Traffic Graph to pen the web page Choose WAN Bandwidth Sessions daily or weekly for viewing different traffic graph Click Refresh to renew the graph at any time Diagnostics gt gt Traffic Graph Show Chart WAN Bandwidth Y Refresh Min s 1 Refresh i ii ain 3l Lie ind a pA a Vigor2130 Series User s Guide 275 Dray Te k The horizontal axis represents time Yet the vertical axis has different meanings For WANI Bandwidth chart the numbers displayed on vertical axis represent the numbers of the transmitted and received packets in the past For Sessions chart the numbers displayed on vertical axis represent the numbers of the NAT sessions during the past 4 16 12 Sessions Table Click Diagnostics and click Sessions Tab
213. nter to set up Select the option that describes the printer you want to use _ Automatically detect and install my Plug and Play printer O A network printer or a printer attached to another computer e Toset up a network printer that is not attached to a print server J use the Local printer option 5 In this dialog choose Create a new port Type of port and use the drop down list to select Standard TCP IP Port Click Next Add Printer Wizard Select a Printer Port Computers communicate with printers through ports Select the port you want your printer to use If the port is not listed you can create a new port Use the following port LPT Recommended Printer Port ers Use the LP7 1 port to communicate with a local printer is port should look something like thi Create a new port Type of port Vigor2130 Series User s Guide 11 Dr ay Te k 6 Inthe following dialog type 192 168 1 1 router s LAN IP in the field of Printer Name or IP Address and type IP_192 168 1 1 as the port name Then click Next Add Standard CP IP Printer Port Wizard Add Port For which device do you want to add a port Enter the Printer Name or IP address and a port name for the desired device Printer Name or IP Address 192 168 1 1 Port Name IP_192 168 1 1 7 Click Standard and choose Generic Network Card Add Standard ICP IP Printer Port Wizard Additional Por
214. nternet Explorer File Edit View Favorites Tools Help Back 7 amp S P Search Key Folders ia If you want to check the BT Torrent files downloaded from Internet to USB disk access into bt_folder gt gt downloads ess C 192 168 1 1 bt_folder downloads JELI File and Folder Tadi 8 04 1 addon hppa iso part edubuntu 8 04 1 addon ua64 iso part a Make a new Folder LJ d irc eae edubuntu 8 04 1 addon sparc iso part _ edubuntu 9 04 addon i386 iso part edubuntu 8 04 1 addon powerpc iso part Other Places B transmission My Documents G Shared Documents ig My Computer My Network Places Details Vigor2130 Series User s Guide 63 Note While the file is downloading the file extension name will be part Dray Tek 3 6 How to configure Dynamic DNS Service on Vigor2130 DDNS stands for Dynamic DNS Simply put using this service gives a name to your IP If you are hosting something on your line people wouldn t have to bother typing your IP They can just type in your domain name It also helps when your ISP only provides dynamic IP address Users won t need to discover what your new IP is they can simply type your domain name Vigor2130 supports dyndns org no ip org chang 1p com zoneedit com and freedns afraid org Here we are going to show you how to setup this function on Vigor2130 Here is the way to configure well known free dynamic DNS service like dyndns org no ip org etc
215. o the ARP RARP hardware address length HLN and protocol address length PLN settings IP Ethernet Length 0 means ARP RARP frames packets where the hardware address length is equal to Ethernet 0x06 and the protocol address length is equal to IPv4 0x04 must not match this entry 1 means ARP RARP frames packets where the hardware address length is equal to Ethernet 0x06 and the protocol address length is equal to IPv4 0x04 must match this entry Any Any value is allowed Specify whether frames packets can meet the action according to their ARP RARP hardware address space HRD settings IP 0 ARP RARP frames where the hardware address space is equal to Ethernet 1 must not match this entry 1 ARP RARP frames where the hardware address space is equal to Ethernet 1 must match this entry Any Any value is allowed Specify whether frames can hit the action according to their ARP RARP protocol address space PRO settings 123 Dray Tek Ethernet 0 ARP RARP frames where the protocol address space is equal to IP 0x800 must not match this entry 1 ARP RARP frames where the protocol address space is equal to IP 0x800 must match this entry Any Any value is allowed Choose IPv4 as the Frame Type You will see IP Parameters on the bottom of the page If you choose ICMP as IP Protocol Filter you will get the page as the following IP Parameters ICMP Parameters IP Protocol Filter ICMI I
216. of the received pause packet Display the number of 64 byte frames in good and bad packets received Display the number of 65 127 byte frames in good and bad packets received Display the number of 128 255 byte frames in good and bad packets received Display the number of 256 511 byte frames in good and bad packets received Display the number of 512 1023 byte frames in good and 157 Dray Tek Dray Tek RX 1024 1526 Bytes RX 1527 Bytes Rx Low Rx Normal Rx Medium Rx High Rx Drops Rx CRC Alignment Rx Undersize Rx Oversize Rx Fragments Rx Jabber Rx Filtered Tx Packets Tx Octets Tx Unicast Tx Multicast Tx Broadcast Tx Pause Tx 64 Bytes Tx 65 127 Bytes Tx 128 255 Bytes Tx 256 511 Bytes Tx 512 1023 Bytes bad packets received Display the number of 1024 1522 byte frames in good and bad packets received Display the number of 1527 byte frames in good and bad packets received Display the low queue counter of the packet received Display the normal queue counter of the packet received Display the medium queue counter of the packet received Display the high queue counter of the packet received Display the number of frames dropped due to the lack of receiving buffer Display the number of Alignment errors packets received Display the number of short frames lt 64 Bytes with valid CRC Display the number of long frames according to max_length register wit
217. off and power on the Vigor Router Release the Factory Reset button when the ACT LED and its neighbor LED blink simultaneously There are different LED blinking methods in describing TFTP mode status Vigor2130 ACT LED amp its neighbor LED blink simultaneously Change your PC IP address to 192 168 1 10 Open Firmware Upgrade Utility and key in Router IP 192 168 1 1 manually Install Router Tools on one computer that connects to Vigor Router s LAN port Make sure the computer can ping Vigor s LAN IP Default IP is 192 168 1 1 Run Router Tools gt gt Firmware Upgrade Utility Input Vigor s LAN IP manually or use the button to select Indicate the firmware location Note There are two firmware types The rst firmware format will make the configurations be back to default settings after upgrading firmware The all firmware format will remain the former configurations after upgrading firmware Input the Password if you have set one then click Send 1 Firmware Upgrade Utility Aela Operation Mode Upgrade Backup Setting Router IP 192 168 1 1 m Firmware file Fs vigor2130_41 2 04v2130_0120 all 2C Password Time uk Sec There is a bar showing the upgrading process 284 Vigor2130 Series User s Guide Operation Mode Upgrade Backup Setting Router IP Waiting Detecting router activity Please wait Don t power off or reset router during wait
218. on For example if you want to use such CPE with VigorACS you can type as the following Username acs Password password Test With Inform Click it to send the event code specified below for test Event Code It is used to be sent out for test Last Inform Response Time Display the response time for the last notification CPE Settings Such information is useful for Auto Configuration Server Enable Check the box to allow the CPE Client to connect with Auto Configuration Server Port Sometimes port conflict might be occurred To solve such problem you might change port number for CPE Username Type a name for VigorACS to access into Vigor router s web configurator Password Type a password for VigorACS to access into Vigor router s web configurator Periodic Inform Settings Enable Check the box for the system to send inform message to ACS server periodically with the time set in the box of interval time Interval Time Please set interval time or schedule time for the router to send notification to CPE Or uncheck Enable to close the mechanism of notification 4 15 3 System Password This page allows you to set new password for admin operation System Maintenance gt gt System Password System Password Old Password New Password Contin Mew Password Available settings are explained as follows Item Description Old Password Type in the old password The factory default se
219. ons for you to choose Disable is to close call forwarding function Always means all the incoming calls will be forwarded into SIP URL without any reason Busy means the incoming calls will be forwarded into SIP URL only when the local system is busy No Answer means if the incoming calls do not receive any response they will be forwarded to the SIP URL by the time out Mo Answer Busy or Mo Answer SIP URL Type in the SIP URL e g aaa draytel org or abc iptel org as the site for call forwarded Time Out Set the time out for the call forwarding The default setting is 30 sec DND Do Not Disturb mode Set a period of peace time without disturbing by VoIP phone call During the period the one who dial in will listen busy tone yet the local user will not listen any ring tone CLIR hide caller ID Check this box to hide the caller ID on the display panel of the phone set Call Waiting Check this box to invoke this function A 228 Vigor2130 Series User s Guide notice sound will appear to tell the user new phone call is waiting for your response Click hook flash to pick up the waiting phone call Call Transfer Check this box to invoke this function Click hook flash to initiate another phone call When the phone call connection succeeds hang up the phone The other two sides can communicate then Codecs Prefer Codec Select one of five codecs as the default for your VoIP calls The codec used for each call
220. or monitoring LAN gt gt Monitor Port Monitor Port C Enable Monitor Port WAN Monitor Port Monitor ingress port Monitor egress port Note Monitor WAN port is justfor debug it may resultin loop condition Available settings are explained as follows Item Description Enable Monitor Port Check to enable this function Monitor Port Click the one of the LAN ports to specify it for monitoring Monitor ingress port Check to set up the port s for being monitored It only monitors the packets received by the port you set up Monitor egress port Check to set up the port s for being monitored It only monitors the packets transmitted by the port you set up Vigor2130 Series User s Guide 101 Dray Te k 4 2 6 Static Route Go to LAN to open setting page and choose Static Route LAN gt gt Static Route Static Route Configuration set to Factory Default viewing Routing Table Available settings are explained as follows Item Description Set to Factory Default Click this link to return to the factory default settings View Routing Table Click this link to view the routing table Index The number 1 to 10 under Index displays current static router Destination Address Display the destination address of the static route Status Display the status of the static route Add Click it to add a new static route Add Static Routes to Private and Public Networks Here is an example of setting Static Route i
221. or2820 After the VPN is connected you can monitor the status VPN and Remote Access gt gt LAN to LAN VPN Site to Site Tunnels IPSec Auto refresh C IKE ESP Name Endpoint ciii Alg Status Alg 3DES_CBC_192 en Demo 172 17 1 186 STATE_AGGR 2 SHAT She ae Se ee MODP 1024 eee Add Tunnel Vigor2130 Series User s Guide 47 Dray Te k VPN configuration on Vigor2820 l Create a LAN to LAN profile VPN and Remote Access gt gt LAN to LAN Profile Index 1 1 Common Settings Call Direction Both pial Gut Dial in LJ Always on Ee Idle Timeout 0 second s C Enable PING to keep alive PING to the IP Profile Name It est VPN Dial Out Through WAN First Netbios Naming Packet Pass O Block Multicast via VPN Opass Block for some IGMP IP Camera DHCP Relay etc 2 Dial Out Settings Type of Server I am calling Username Password IPSec Tunnel PPP Authentication L2TP with IPSec Policy None VJ Compression Server IP Host Name for VPN IKE Authentication Method such as draytek com or 123 45 67 89 Pre Shared Key IKE Pre Shared Key 8886880 Digital Signature X 509 IPSec Security Method Medium 4H i ESP SDES with Authentication we Indexf 1 15 in Schedule Setup bE L EL 3 Dial In Settings Allowed Dial In Type Username TET PPTP IPSec Tunnel Password i L2TP with IPSec Policy None v vJ Com
222. ork IP Remote Network Mask RIP Direction From first subnet to remote network you have to do Medium AH DES 3DES AES single WAN supports this Change default route to this VPN tunnel Only 5I Alg ESP AES HMAC MDS Dray Tek 2 Enable it and give it a name In this example the profile name is test 3 Select Dial Out as Call Direction and enable Always on 4 Select IPSec Tunnel and enter Vigor2130 s WAN IP address in the Server IP Host Name for VPN field 5 Setup a pre shared key which must be the same as in Vigor2130 6 Select ESP High and 3DES with Authentication 7 Press the Advanced button IKE advanced settings IKE phase 1 mode Main mode Aggressive mode IKE phase 1 proposal DES_WD5_62 DES_SHAI_G2 3DES_MD5_G2 SDES_SHAI_G2 V IKE phase 2 proposal 3DES_5HA1 3DES_MDE v IKE phase 1 key lifetime 28800 900 86400 IKE phase 2 key lifetime 3600 600 86400 Perfect Forward Secret Disable Enable Local ID C wigor2820 OK Close 8 In the pop up window please select Aggressive mode and select DES_MD5_G2 DES_SHA1_G2 3DES_MD5_G2 3DES_SHA1_G2 as IKE phase 1 proposal Enter vigor2820 in the Local ID field Click OK to return to the profile setting page 9 Enter Vigor2130 s private network in the Remote Network IP Mask field 10 Click OK Dray Tek a2 Vigor2130 Series User s Guide 3 4 How
223. ormat Disk ext2 3 File Explorer FTF User Management Disk Shares Bil Torrent Download iTunes Server DLNA Server Temperature Sensor 4 11 1 Disk Status This page can display current using status of the USB storage disk If you want to remove the disk from USB port in router please check the box of Safely Remove Disk first And then remove the USB storage disk later USB Application gt gt Disk Status Disk Status safely Remove Disk Manufacturer Model Size Free Capacity Status Fi HDS72251 BYLAT20 1546 6 36 In use Refresh Devices Available settings are explained as follows Vigor2130 Series User s Guide 203 Dr ay Te k Item Description Safely Remove Disk Check this box and then you can remove the USB disk safely Manufacturer Display the manufacturer of the disk Model Display the type of the disk Size Display the storage space of the disk Free Capacity Display the free disk space of the disk Status Display current usage status of the disk Update Check the box of Safely Remove Disk then click this button to update the disk status Refresh Devices Click this button to refresh the disk status 4 11 2 Format Disk ext2 3 Under Linux environment USB disk can be formatted in ext2 or ext3 to have good stability and efficiency for data transmitting USB Application gt gt Format USB Storage Format USB Storage Partition Volume JetFlash TS2GJF130 1 1955M vfat PORT
224. ortal However the login page will be shown in HTTP format and can run under different browser without the trouble of compatibility Enable HTTPS Click it to enable the function of web portal However the login page will be shown in HTTPS 108 Vigor2130 Series User s Guide Account Setting Timeout Setting Welcome Message Bulletin Board Redirect Bypass Disable View Current Portal Vigor2130 Series User s Guide format HTTPS is safer than HTTP Disable Click it to skip the login procedure Common account Any user who wants to surf Internet must type account and password first When the username and password authenticated by the system are correct the user can be allowed to access into Internet ID Type a user account for accessing into the Internet P W Type a password for accessing into the Internet Share account in User Configuration Choose this option if you want to use settings configured in User gt gt User Configuration Enable Click it to enable the timeout configuration Disable Click it to disable the timeout configuration Logout at xxx every day If it is checked the system will terminate the web accessing job at the same time everyday Logout every xxx minutes If it is checked the system will terminate the web accessing job with the interval configured here Logout after shutdown If it is checked the system will terminate the web accessing job after
225. orwarding state kernel br lan topology change detected propagating kernel br lan port 2 raU entering learning state kernel Update MAC S 00 50 22 35 47 kernel Update MAC A 00 50 7f 22 3346 kernel Update MAC 11 00 50 7f 22 33 45 kernel Update MACMIS00 50 7f 22 33 44 Available settings are explained as follows Item Auto refresh Refresh Export Clear Time Level Type Message Dray Tek Description Check it to enable auto refresh function Click it to reload the page Click it to export the log as a text file Click it to clear the information Display the time of the system log entry Display the severity level of the system log entry You can specify the level from the drop down list to display the log just for the selected level Display the type or subsystem of the system log entry You can specify the type from the drop down list to display the log just for the selected type Display a short description of the system log entry 268 Vigor2130 Series User s Guide 4 16 6 Traffic Overview This page offers an overview of general traffic statistics for all connecting ports Diagnostics gt gt Traffic Overview Port Statistics Overview Packets Receive 38471 0 18630 0 0 Auto refresh L Bytes Errors Drops Filtered Receive Transmit Receive Transmit Receive Transmit Receive 15432151 3128250 0 0 0 3349573 13192564 0 0 0 0 i 0 Each item is explained
226. os eessen a 19 2 3 4 Setting up the Wireless CONNECTION cceeeccccccceeeeeeeeeeeeeeeeeeeeaeeeeeeeeeesseeaseeeeeeeeessaeaaeses 23 2 320 Saving the Wizard Configuratio scenes cccccintcncdcuciecsiceneba ede sentanteanieboreatweeeacaeastasuncbebeacdeadiatee 28 ON oN E E sure eee tenet E E E E E EEE E 28 2 5 Saving CONFIQUIATION cccccceccesseeseececeeeeeaeeessecceeeeeeeaeesesceeesseseuseeceeeessseeasseeeeeeesssaaaeeeeeeees 29 2 6 Registering Vigor ROUtELM cccccssseeeccssseecceeeeecseeeeceeseeessaeeeceaseeeseseeessageeesegeeesseseeeeeeas 30 Tutorials and Applications cccccccesseeesseeseeeeseeeeseeeeseeeeaeeeesseeeneeeeneeeeneeoeneees 35 3 1 How to Configure Multi VLAN in Vigor Router 0 ccccceeeeeeeeeeeeeeeeeeaaaeeeeeeeeeeeeeeeeeeeeeeaaaaaas 35 3 2 LAN to LAN IPSec VPN between Vigor2130 and Vigor2820 using Main mode 05 39 Case 1 VPN direction from Vigor2130 to VigoOr2820 2 00 ceeececeeeeeeeeeeeeeeeeeeeeeaaeeeeeeeeeeeesaaeaees 39 Case 2 VPN direction from Vigor2820 to Vigor2130 eeeeceeeeeeeeeeeeeeeeeeeeeeaaeaeeeeeeeeesaaaaaes 43 3 3 LAN to LAN IPSec VPN between Vigor2130 and Vigor2820 using Agressive mode 46 Case 1 VPN direction from Vigor2130 to VigoOr2820 2 0 0 eeececeeeeeeeeeeeeeeeeeeeeeeaeeeeeeeeeseesaaeaees 46 Case 2 VPN direction from Vigor2820 to Vigor2130 eeeeceeceeeeeeeeeeeeeeeeeeeeeaeeeeeeeeeeeeaaaeaes 50 3 4 How to configure settings for DLNA S
227. ote Authentication Dial In User Service RADIUS is a security authentication client server protocol that supports authentication authorization and accounting which is widely used by Internet service providers It is the most common method of authenticating and authorizing dial up and tunneled network users The built in RADIUS client feature enables the router to assist the remote dial in user or a wireless station and the RADIUS server in performing mutual authentication It enables centralized remote access authentication for network management Vigor2130 Series User s Guide 25 Dr ay Te k If you choose WPA Raduus as the security configuration you have to specify WPA mode algorithm Radius server Radius server port and Radius server secret respectively Quick Start Wizard Wireless System Configuration Enable Wireless LAN SSID Broadcast SSID Wireless Security Configuration Encryption WPA RADIUS Configuration Type WPA Algorithm Server IP Address Destination Port Shared Secret k Show DrayTek WPARADIJS WPA TKIF 0 0 0 0 ol radius secret Available settings are explained as follows Item Type WPA Algorithm Server IP Address Destination Port Shared Secret Dray Tek Description The WPA encrypts each frame transmitted from the radio using the key which either PSK Pre Shared Key entered manually in this field below or automatically negotiated via 802 1x authentication Select WPA
228. ote VPN server The length of the ID is limited to 47 characters Remote Identity This field defines the identity of the remote end Local Certificate If you choose Certificate as the Type you have to specify one of the local certificates Local Network Mask Traffic between this subnet and the subnet specified in Remote Network Mask will travel through the VPN tunnel Remote Network Mask Add a static route to direct all traffic destined to this Remote Network IP Address Remote Network Mask through the VPN connection For IPSec this is the destination clients IDs of phase 2 quick mode Change default route to this VPN tunnel Check the box to change the default route to this configured VPN tunnel 178 Vigor2130 Series User s Guide Advanced Security IKE Phase 1 proposal Propose the local available Settings authentication schemes and encryption algorithms to the VPN peers and get its feedback to find a match Pabwbel Wb hoy at AES128 SHAT G14 AESI92 MDS G14 AESI92 SHAT G14 AES266 MDS G14 AES266 SHAT G14 Automatic IKE Phase 2 proposal Propose the local available algorithms to the VPN peers and get its feedback to find a match Automatic v i Automatic ides aes any aes 126 aes 192 aes 2756 IKE phase 1 key lifetime For security reason the lifetime of key should be defined The default value is 28800 seconds You may specify a value in between 900 and 86400 seconds IKE phas
229. oup whenever you want IGMP Proxy Channel Such function is selected for WAN gt gt Multi VLAN If IPTV WAN or VoIP WAN is not configured in WAN gt gt Multi VLAN you have to choose WAN as IGMP Proxy Channel Vigor2130 Series User s Guide 163 Dr ay Te k IPTV WAN Disable EIPTV WAN Disable VOIP WANIDisable WAN IGMP Snooping Snooping Enabled Check the box to enable this function Configuration Unregistered IPMC Flooding enabled Check the box to enable unregistered IPMC traffic flooding Port Related Fast Leave Check the box to fast leave from the LAN Configuration port Click OK button to activate the settings You will see your setting has been saved 4 7 4 IGMP Status This page display current IGMP status Applications gt gt IGMP Status IGMP Snooping Status Auto refresh C Clear Statistics V1 Reports V2 Reports V3 Reports V Leave Receive Receive Receive Receive 0 0 0 IGMP Groups Port Members 2 3 Each item is explained as follows Item Description V1 3 Reports Receive Display the number of Received V1 V3 Reports V2 Leave Receive Display the number of Received V2 Leave Groups Display current IGMP groups Maximum number of group for each VLAN can be set is 128 Port Members Display the LAN ports in this group Refresh Click this button to refresh the page immediately Clear Click this button to clear the settings on this page 4 7 5 UPnP Configuration The UPnP Unive
230. ow Normal Medium and High Ifyou choose VLAN ID as QCE Type you have to type the ID number for it and specify traffic class from Low Normal Medium and High Bandwidth Management gt gt QoS Control List QCE Configuration QCE Type VLAN ID Traffic Class Available settings are explained as follows Item Description VLAN ID Type the number as VLAN ID tagged on the transmitted packet Traffic Class Specify traffic class from Low Normal Medium and High If you choose TCP UDP Port as QCE Type you have to type the port number for it and specify traffic class from Low Normal Medium and High Bandwidth Management gt gt QoS Control List QCE Configuration QCE Type TCP UDP Port TCP UDP Port TCP UDP Port Range Tratic Class Medium Dray Te k 152 Vigor2130 Series User s Guide Available settings are explained as follows Item Description TCP UDP Port Click Single or Range If you select Range you have to type in the starting port number and the end porting number on the boxes below TCP UDP Port Type in the starting port number and the end porting Range number here if you choose Range as the type Traffic Class Specify traffic class from Low Normal Medium and High Ifyou choose DSCP as QCE Type you have to type value for it and specify traffic class from Low Normal Medium and High Bandwidth Management gt gt QoS Control List QCE Configuration QCE Type DSCP Value Traffic Class
231. ox to let the remote user connecting to this device through PPTP Allowed Dial In Type LAN to LAN Remote Dial in Client LAN to LAN Allowed Dial In Type Remote Dial in Client Allowed Dial In Type Remote Dial in Client Assign Static IP Address Assign Static IP Address Check the box and type the IP address LAN to LAN Allowed Dial In Type LAN to LAN Local Network Mask 0 0 0 0 0 0 0 0 Remote Network Mask 0 0 0 0 7 0 0 0 0 When such user profile needs to have PPTP LAN to LAN connection the following three items must be adjusted Local Network Mask Traffic between this subnet and the subnet specified in Remote Network Mask will travel through the VPN tunnel Remote Network Mask Add a static route to direct all traffic destined to this Remote Network IP Address Remote Network Mask through the VPN connection Check this box to let the remote user connecting to FTP server via this router Check this box to let the remote user to adjust the settings of router by TELNET Check this box to let the remote user to adjust the settings of router by web When you finish the settings simply click OK to save the configuration The new user will be created and displayed on the page Vigor2130 Series User s Guide 249 Dray Tek User gt gt User Configuration Users Status Username Full Name Disk Sharing IPSEC L2TP PPTP FIP Telnet Web Portal Login Ti carrie car
232. pears DrayTek Service Activation Service Name Start Date Expire Date status web Content filter 2011 03 28 2011 04 27 Commtouch Please check if the license fits with the service provider of your signature To ensure normal operation for your router update your signature again is recommended Copyright DrayTek Corp All Rights Reserved Close 13 Click Close Vigor2130 Series User s Guide 33 Dr ay Te k This page 1s left blank D roa y Ti e k 34 Vigor2130 Series User s Guide Tutorials and Applications 3 1 How to Configure Multi VLAN in Vigor Router Vigor2130 supports the function of Multi VLAN firmware version 1 4 0 and after It can specify a VLAN ID for WAN port and offers more advanced environmental application for the users through the bridge technique in WAN port and LAN port I Way to Configure To enable such function please do the following 1 Open WAN gt gt 802 1Q VLAN Tag Configuration Check the box of Enable Multi VLAN Setup 2 Fill in the VLAN ID number in the field of WAN VLAN ID 3 Ifthe router you have supports VoIP you can configure VoIP WAN setting for using by VoIP interface of the router 4 In LAN VLAN setting check the box of Enable L
233. pen WAN gt gt 802 1Q VLAN Tag Configuration to configure Multi VLAN Refer to the following graphic WAN gt gt 602 10 VLAN Tag Configuration 807 10 VLAN Tag Configuration Enable MMult WLAN Setup WAN VLAN Setting WAN VLAN ID ga VoIP WAN VLAN Setting Enable VolP WAN Selup VolP WAN VLAN ID 93 Vol WAN Setting LAN VLAN Setting VLAN Enable ID Fi P2 P3 P4 LAN NAT Bdge LI Bridge2 E Bndge3 B6 Note Pl is reserved for MAT Route use 3 Open WAN gt gt VoIP WAN to configure VoIP WAN Setting WAN gt gt VoIP WAN VoIP WAN Connection Type DHCP DHCP Settings Router Name Viger2130 The same as syslog s router name Domain Name Domain Name are required for some ISPs OK Cano Note At present only DHCP PPPoE and Static connection types are available Vigor2130 Series User s Guide 37 Dray Te k 4 Open VoIP gt gt SIP Accounts Specify the connection interface for VoIP in the field of Register via VoIP gt gt SIP Accounts SIP Account Index No 1 Profile Name Register via SIP Port Domain Realm Proxy Act as outbound proxy Display Name Account Number Name Authentication ID Password Expiry Time Ring Port Ring Pattem iptel 11 char max YoIP WAN Call without Registration 5060 Iptel ong 63 char max iptel org 63 char max B55 23 char max B55 63 char max Boo 63 char max ALLEL 63 char max mne LAL W Phonei C Phone y sec 5
234. pression on off IKE Authentication Method Specify Remote VPN Gatewa Pre Shared H Peer VPN Server IH or Peer WS wigor2130 gt IPSec Security Method Medium AH High ESP DES I 3pes M AES 4 TCP IP Network Settings My WAN IP RIP Direction Disable Remote Gateway IP first subnet to remote network you have to Oo Remote Network IP Route v Remote Network Mask Change default route to this VPN tunnel Only single WAN supports this 2 Enable it and give it a name In this example the profile name is test Dray Tek 48 Vigor2130 Series User s Guide Select Dial in as Call Direction In Dial Out Settings part select IPSec Tunnel and press the Advanced button In the pop up window please enter vigor2820 in the Local ID field Click OK to return to the profile setting page IKE advanced settings Main mode Aggressive mode DES_MD5_G2 DES_SHA1_G2 3DES_MD5_G2 3DES_SHAL_G2 v SDES_SHAL SDES_MDS v IKE phase 1 mode IKE phase 1 proposal IKE phase 2 proposal IKE phase 1 key lifetime 28800 900 86400 IKE phase 2 key lifetime 3600 600 86400 Perfect Forward Secret Disable Enable Local ID vigor2320 In Dial In Settings part please enable Specify Remote VPN Gateway and enter vigor2130 in the Peer ID field Setup a pre shared key which must be the same as in Vigor2130 Enter Vigor2130 s private network in the Remote Networ
235. r s Guide Source Port Filter Specify the UDP port source filter for this ACE source Port Filter Any No UDP source filter 1s specified Specific If you want to filter a specific UDP source filter with this ACE you can enter a specific UDP source value A field for entering a UDP source value appears Range If you want to filter a specific UDP source range filter with this ACE you can enter a specific UDP source range value A field for entering a UDP source port range appears Source Port No Type the value if you choose Specific as the Source Port Filter The allowed range is 0 to 65535 A frame meeting this ACE matches this UDP source value Source Port Range Type the value if you choose Range as the Source Port Filter The allowed range is 0 to 65535 A frame meeting this ACE matches this UDP source value Dest Port Filter Specify the UDP port destination filter for this ACE Dest Port Filter Any No UDP destination filter is specified Specific If you want to filter a specific UDP destination filter with this ACE you can enter a specific UDP destination value A field for entering a UDP destination value appears Range If you want to filter a specific UDP destination range filter with this ACE you can enter a specific UDP destination range value A field for entering a UDP destination port range appears Dest Port No Type the value if you choose Specific as the Dest Port Filter The allowed range i
236. re should not be the same as IP address range for DHCP Client IP Address range for DHCP client Display the range of IP address assigned by DHCP server MPPE Check this box to encrypt data transmission via PPTP connection Pass Netbios Naming Packet Check the box to make the data transmission passing through the hosts on both sides of VPN Tunnel while connecting Uncheck the box when there is conflict occurred between the hosts on both sides of VPN Tunnel in connecting such function can block data transmission of Netbios Naming Packet inside the tunnel If this checkbox is checked the system firewall will pass VPN PPTP remote access from WAN side to a VPN server in the LAN Type the IP address of the VPN server in the field next to the checkbox 4 8 2 PPTP Remote Dial in You can manage remote access by maintaining a table of remote user profile so that users can be authenticated to dial in via VPN connection The router provides access accounts for dial in users Users Users Status Username Full Name Disk Sharing IPSEC L2TP PPTP FTF Telnet Mio users defined Add a Mew User Note This page is similar to the page under User gt gt User Configuration Dray Tek 170 Vigor2130 Series User s Guide Adding a New User 1 Click Add a New User to open the following page User gt gt User Configuration Please install Samba Server before enable Disk Sharing Add User Enable User Settings
237. register your own domain name for the router Open Applications gt gt Dynamic DNS to get the following page Vigor2130 Series User s Guide 159 Dray Tek Applications gt gt Dynamic DNS Dynamic ONS Configuration Add Force Update Available settings are explained as follows Item Index Setting Status Add View Log Force Update Description Display the number that you can click to edit the settings Display the domain name of the profile If no domain is specified it will display Host instead Display the situation of the DDNS If it is enabled a check sign will be shown in this field Allow to create a new profile Display the update information DDNS profile Force the router updates its information to DDNS server Adding a New DDNS Profile Click Add to open the following page to create a new DDNS profile Applications gt gt Dynamic DNS Add Dynamic DNS Enable Dynamic DNS Service Provider Domain name Username Password IP source Check IP change every Force IP update every dyndns org ka chronic6633 chronic6633 seeveeceees My WANIP Available settings are explained as follows Dray Tek Item Enable Dynamic DNS Service Provider Domain name Username Password IP Source Description Check this box to enable the current account Select the service provider for the DDNS account Type in one domain name that you applied previously Use the drop down list
238. rieni x va y va v v Add a New User Editing Deleting User Settings To edit a user click the name link under Username to open the following page Modify the settings except Username and then click OK to save and exit it If you want to remove such user settings simply click Delete User User gt gt User Configuration Please install Samba Server before enable Disk Sharing Edit User Enable User Settings Username carrie Full Name carieni Password Confirm Password Allow Disk Sharing Allow IPSEC L2TP Allow PPTP Allowed Dial In Type LAN to LAN v Local Network Mask Remote Network Mask Allow FTP Allow TELNET Allow Web Portal Login Note PPTPVIPSEC user may alsa need the Remote Access Control settings OK Delete User Dray Tek 250 Vigor2130 Series User s Guide 4 15 System Maintenance For the system setup there are several items that you have to know the way of configuration Status User Password Configuration Backup Syslog Mail Alert Time and Date Management Reboot System and Firmware Upgrade Below shows the menu items for System Maintenance t System Maintenance System Status TR 069 System Password lser Password Configuration Backup Syslog Mail Alert ime and Date Firtihware UW Hota de 4 15 1 System Status The System Status provides basic network settings of Vigor router It includes LAN and WAN interface information Also you could get the current running firmware
239. ries User s Guide 171 Dray Te k traffic destined to this Remote Network IP Address Remote Network Mask through the VPN connection Allow FTP Check this box to let the remote user connecting to FTP server via this router Allow TELNET Check this box to let the remote user to adjust the settings of router by TELNET Allow Web Portal Check this box to let the remote user to adjust the settings Login of router by web 2 When you finish the settings simply click OK to save the configuration The new user will be created and displayed on the page User gt gt User Configuration Users Status Username Full Name Disk Sharing IPSEC L2TP PPTP FIP Telnet Web Portal Login vi carrie carrieni x y v v vO x Add a New User Editing Deleting User Settings To edit a user click the name link under Username to open the following page Modify the settings except Username and then click OK to save and exit it If you want to remove such user settings simply click Delete User User gt gt User Configuration Please install Samba Server before enable Disk Sharing Edit User Enable User Settings Username carrie Full Name carieni Password Confirm Password Allow Disk Sharing Allow IPSEC L2TP Allow PPTP Allowed Dial In Type Remote Dial in Client Assign Static IP Address Allow FTP Allow TELNET Allow Web Portal Login Note PPTP IPSEC user may also need the Remote Access Control settings Dray Te k 172 Vigor2130 Series
240. rla draytekd ping 192 168 1 1 PING 192 168 1 1 192 168 1 1 56 data bytes 64 bytes from 192 165 1 1 tcomp_seq 6 ttl 255 times8 755 ms 64 bytes from 192 165 1 1 icmp_seg 1 ttl 255 times8 697 ms t bytes from 192 165 1 1 icmp_seg 2 ttl 255 times6 716 ms 64 bytes from 192 165 1 1 icmp_seg 3 ttl 255 timesh 731 ms 64 bytes from 192 168 1 1 tcmp_seq 4 ttl 255 timesh 72 ms AE 192 168 1 1 ping statistics EF packets transmitted 5 packets received 6 packet loss round trip minfgaygemax 0 697 6 7236 755 ms Vigoria draytekd fj 5 4 Checking If the ISP Settings are OK or Not Open WAN gt gt Internet Access page and then check whether the ISP settings are set correctly Use the Connection Type drop down list to choose Static IP DHCP PPPoE PPTP L2TP 3G USB Modem for reviewing the settings that you configured previously WAN Wiulti LAN SS Backup WAN gt gt Internet Access WAN IP Configuration Enable Connection Type Static WAN IP Alias Static IP Settings IF Address 172 16 5 102 subnet Mask 55 255 0 0 Gateway IP Address 172 16 1 1 Primary DNS Server 160 95 1 1 secondary ONS Server 0 0 0 0 MTL Size Auto hax MTU 1500 WAN Connection Detection Kinda ARP Vigor2130 Series User s Guide 283 Dr ay Te k 5 5 Forcing Vigor Router into TFTP Mode for Performing the Firmware Upgrade l 2 SS A A e eA 10 l1 Dray Tek Press and hold the Factory Reset button The system will power
241. rmine the direction for the phone call IN incoming call OUT outgoing call IN amp OUT both incoming and outgoing calls Determine the type of the VoIP phone call URI URL or number 220 Vigor2130 Series User s Guide specific URVURL Specific URVURL Specific Number Specific URI URL or This field will be changed based on the type you selected for Specific Number barring Type Interface All means all the phone calls will be blocked with such mechanism After finished the above configuration click OK to save the settings and exit this page Additionally you can set advanced settings for call barring such as Block Anonymous Block Unknown Domain or Block IP Address Simply click the relational links to open the web page For Block Anonymous this function can block the incoming calls without caller ID on the interface Phone port specified in the following window Such control also can be done based on preconfigured schedules VoIP gt gt DialPlan Setup Call Barring Block Anonymous Enable Interface CI Phonel Phonez Note Block the incoming calls which do not have the caller ID For Block Unknown Domain this function can block incoming calls through Phone port from unrecognized domain that is not specified in SIP accounts Such control also can be done based on preconfigured schedules VoIP gt gt DialPlan Setup Call Barring Block Unknown Domain C Enable Interfac
242. rnet Access WAN IP Configuration Enable Connection Type PPPoE Ww WAN IP Alias PPPoE Settings Username 37 68631 ip hinet net Password Confirm Password MTU Size auto Ma MTU 1492 Fixed IP IPCP Oves No Fixed IP Address IPCP 0 0 0 0 Service Name WAN Connection Detection Mode ARP Clone MAC Address Enable F Mail SMS Alert Event types WAN UFO WAN DOWN DO Available settings are explained as follows Item Description PPPoE Settings Username Type in the username provided by ISP in this field Password Type in the password provided by ISP in this field Redial Policy If you want to connect to Internet all the time you can choose Always On Otherwise choose Connect on Demand Connect on Demand iw Connect on Demand Always On Idle Time Out Set the timeout for breaking down the Internet after passing through the time without any action When you choose Connect on Demand you have to type value here MTU Size It means Max Transmit Unit for packet The default setting will be specified by the system automatically 74 Vigor2130 Series User s Guide Fixed IP IPCP Usually ISP dynamically assigns IP address to you each time you connect to it and request In some case your ISP provides service to always assign you the same IP address whenever you request In this case you can fill in this IP address in the Fixed IP field Please contact your ISP before you want to use this func
243. router will blink fast when WPS 1s in progress It will return to normal condition after two minutes You need to setup WPS within two minutes It is the simplest way to build connection between wireless network clients and vigor router Users do not need to select any encryption mode and type any long encryption passphrase to setup a wireless client every time He she only needs to press a button on wireless client and WPS will connect for client and router automatically Wireless Card Installed Connection via WPS Set SSID and lt gt Encryption WPA WPA2 PIN Code Note Such function is available for the wireless station with WPS supported There are two methods to do network connection through WPS between AP and Stations pressing the Start PBC button or using PIN Code On the side of Vigor2130 series which served as an AP press WPS button once on the front panel of the router or click Start PBC on web configuration interface On the side Dray Te K 194 Vigor2130 Series User s Guide of a station with network card installed press Start PBC button of network card WLAN Card If you want to use PIN code you have to know the PIN code specified in wireless client Then provide the PIN code of the wireless client you wish to connect to the vigor router PIN Code WLAN Card ccl M Definea _ PIN Code of Station PIN Code Vigor2130 Series User s Guide 195 Dray Te k 4 10 3 Access Control
244. rsal Plug and Play protocol is supported to bring to network connected devices the ease of installation and configuration which is already available for directly connected PC peripherals with the existing Windows Plug and Play system For NAT routers the major feature of UPnP on the router is NAT Traversal This enables applications inside Dray Te K 164 Vigor2130 Series User s Guide the firewall to automatically open the ports that they need to pass through a router It is more reliable than requiring a router to work out by itself which ports need to be opened Further the user does not have to manually set up port mappings or a DMZ UPnP is available on Windows XP and the router provide the associated support for MSN Messenger to allow full use of the voice video and messaging features Applications gt gt UPnP Configuration UPnP Configuration Enable UPnP Download Speed Upload Speed Available settings are explained as follows Item Description Enable UPnP Enable UPnP function You have to type the download and upload speed Download Speed Enter the maximum sustained WAN download speed in kilobits second Such information can be requested by UPnP clients Upload Speed Enter the maximum sustained WAN upload speed in kilobits second Such information can be requested by UPnP clients After setting Enable UPnP setting an icon of IP Broadband Connection on Router on Windows XP Network Connections will appear
245. rt Description Router Name Type in a name for the router It must be the same as the name used in Syslog Domain Name Type the domain name e g draytek to fit the request of some ISPs MTU Size It means Max Transmit Unit for packet The default setting will be specified by the system automatically Therefore keep this field in blank Mode Such function allows you to verify whether network connection is alive or not through ARP Detect or Ping Detect Choose ARP Detect or Ping Detect for the system to execute for WAN detection Ping IP If you choose Ping Detect as detection mode you have to type IP address in this field for pinging Enable Enable the feature It is available when the box of Enable is checked Click Clone MAC Address The result will be displayed in the field of MAC Address Enable Clone MAC Address MAC Address 00 0E A6 24 D5 A1 Alert Types Specify the type of the alert mail SMS or Mail and SMS that Vigor system will use to send a message to the user Mail and Sits Event types Specify the event when the system must send a notification to the user by mail and or SMS After finishing all the settings here please click OK to activate them Vigor2130 Series User s Guide 73 Dray Tek PPPoE To choose PPPoE as the accessing protocol of the internet please select PPPoE from the Internet Access menu The following web page will be shown Dray Tek WAN gt gt Inte
246. rtDLRTTECE php This product is designed for 2 4GHz WLAN network throughout the EC region and Switzerland with restrictions in France Please see the user manual for the applicable networks on your product Dray Tek iv Vigor2130 Series User s Guide Table of Contents PE ACC vcore tae sts se ete E eee ise de A en ea vee eee cesses enemas nee cece caeeca ecm es sareaes 1 WA TAOS S onc caine E A E A E E E E E 1 1 2 Web Configuration Buttons Explanation ccccccccccccceeeseeeeseeeeeeeesesaeeeeeeeeessaaeeeeeeeeeessaaeaeees 1 1 3 LED Indicators and COMMECIONS ic cseiesessicecetet aceinenta ceteeindastcaceteecdenedasidchieatntdeiiuiesantdcdnedesdebeereaceneenaics 2 To FOr VIOT O sa trcenatecacess tone attow E texas eae E E E E E E E R E 2 Te FOr VIO ONE O searre e E I E E E E S 4 Too ON VON i ON ee a E E E E 6 1 4 Hardware MINS cle VION sericea E E aa EA E a aA 8 AES O eaan A A E au mncasamncsrnaguasareneearaian 9 Dao TION motala to senise e E a E 10 BASIS SENOS sce race ct ere E E A EE NERE 15 2 1 ACCESSING Web Page ccccccccssssecccceeeeeeececsaeececceseaseceeeseaasceeseeeaaeceeessaageceessaseeeessaaseeeessaeas 15 2 2 Changing PassWord sesiicssicaienraiannii annenin ai ai iaaa aiii nia aaa 16 2 QUICK tar Wia cases capsvo2naimatapscinaaaseunhtcncsatiocunniiisved a EEEn 17 aes a pend upe Fa SWO e a ee ee eee eee 18 2 32 peng up the Time ZOMG iicn T cn catcnu cieseneecietane 18 2 3 3 Setting up the Internet ConnectiON
247. s 500 It is restricted to 500 1000000 when the Policer Unit is set in kbps and it is restricted to 1 1000 when the Policer Unit is set in Mbps Policer Unit Determine the unit kbps Mbps for policer Shaper Enabled Check this box to enable shaper function Shaper Rate Tx Type the number for shaper function The default value 1s 500 It is restricted to 500 1000000 when the Shaper Unit is set in kbps and it is restricted to 1 1000 when the Shaper Unit is set in Mbps Shaper Unit Determine the unit kbps Mbps for shaper function Click OK to save the settings 4 6 4 QoS Control List Deploying QoS Quality of Service management to guarantee that all applications receive the service levels required and sufficient bandwidth to meet performance expectations is indeed one important aspect of modern enterprise network One reason for QoS is that numerous TCP based applications tend to continually increase their transmission rate and consume all available bandwidth which is called TCP slow start If other applications are not protected by QoS it will detract much from their performance in the overcrowded network This is especially essential to those are low tolerant of loss delay or jitter delay variation Another reason is due to congestions at network intersections where speeds of interconnected circuits mismatch or traffic aggregates packets will queue up and traffic can be throttled back to a lower speed If there s no define
248. s 0 to 65535 A frame meeting this ACE matches this UDP source value Dest Port Range Type the value if you choose Range as the Dest Port Filter The allowed range is 0 to 65535 A frame meeting this ACE matches this UDP source value Vigor2130 Series User s Guide 127 Dray Tek Choose IPv4 as the Frame Type You will see IP Parameters on the bottom of the page If you choose TCP as IP Protocol Filter you will get the page as the following IP Parameters TCP Parameters IP Protocol Filter TCF Source Por Filter Source IP Jetwork Source Port No Source IP Dest Port Filter Address source IP Mask Dest IP Network Dest IP Address 192 168 1 25 Dest IP Mask Dest Port Range TCP FIN TCP SYN TCP RST TCP PSH TCP ACK TCP URG Available settings are explained as follows Item Description Source IP Specify the source IP filter for this ACE Any No source IP filter is specified Host Source IP filter is set to Host Specify the source IP address in the source IP Address field that appears Network Source IP filter is set to Network Specify the source IP address and source IP mask in the source IP Address and source IP Mask fields that appear Source IP Address Type the source IP Address here This option is available when you choose Host or Network as source source IP filter Source IP Mask Type the SIP Mask here This option is available only when you choose Network as source IP filter Dest IP
249. s User s Guide 247 Dray Tek 4 14 User 4 14 1 User Configuration This page allows you to set user s setting that allowed to use PPTP FTP IPSEC L2TP connection User gt gt User Configuration Users Status Username Full Name Disk Sharing IPSEC L2TP PPTP FIP Telnet Web Portal Login v came carrieni x i v v v x Add a New User Adding a New User Click Add a New User to open the following page User gt gt User Configuration Please install Samba Server before enable Disk Sharing Add User L Enable User Settings Username Full Name Passward Canfirm Password Allow Disk Sharing Allow IPSEC L2TP Allow PPTP Allowed Dial In Type Assign static IP Address Allow FTP Allow TELNET Allow Web Portal Login Available settings are explained as follows Item Description Enable Check this box to enable such user profile Username Type a name for this user Full Name Type full name for this user Password Type the password for this user Confirm Password Type the password again for confirmation Allow Disk Sharing Check this box to have the remote user share the disk information Dray Tek Vigor2130 Series User s Guide Item Allow IPSEC L2TP Allow PPTP Allow FTP Allow TELNET Allow Web Portal Login Description Before enable this function please install Samba Server first Check this box to let the remote user connecting to this device through IPSEC L2TP Check this b
250. s allowed to connect with the router Add to WDS Settings AP s MAC address ILENE Bridge Repeater Available settings are explained as follows Item Description CH Display the channel for the scanned AP SSID Display the SSID of the scanned AP BSSID Display the MAC address of the scanned AP Security Display the encryption type of the scanned AP Signal Display the strength in percentage of the signal of the scanned AP Scan It is used to discover all the connected AP The results will be shown on the box above this button Add to If you want the found AP applying the WDS settings please type in the AP s MAC address on the bottom of the page and click Bridge or Repeater Next click Add to Later the MAC address of the AP will be added on WDS settings page Dray Tek 198 Vigor2130 Series User s Guide 4 10 6 WMM Configuration WMM is an abbreviation of Wi Fi Multimedia It defines the priority levels for four access categories derived from 802 1d prioritization tabs The categories are designed with specific types of traffic voice video best effort and low priority data There are four accessing categories AC BE AC BK AC VI and AC VO for WMM APSD automatic power save delivery is an enhancement over the power save mechanisms supported by Wi Fi networks It allows devices to take more time in sleeping state and consume less power to improve the performance by minimizing transmission latency
251. s follows Item Enable APP Enforcement Add Entry Adding a New Rule Description Check this box to enable such function Only new network connection will be influenced by such rule Click it add a new blocking rule You are allowed to add many firewall rules for your request Simply click Add Entry the following screen will be shown There are four tabs IM P2P Protocol and Misc displayed on this page Each tab will bring out different items that you can choose to disallow allow people using Vigor2130 Series User s Guide 143 Dray Tek 1 Click Add Entry to open the following time object setting page CSM gt APP Enforcement Add Rule Enable Mame Source IP Mask Action syslog Time Profile New Time Object IM P P Protocol Misc Protocol C SoulSeek SoulSeek LJ eDonkey eDonkey eMule Shareaza Cl FastTrack Kaza BearShare iMesh L OpenFT KCeasy FilePipe Cl Gnutella OpenNap Ll BitTorrent BearShare Limewire Shareaza Foxy KCeasyj Lopster ANap V inLop BitTorrent BitSpirit BitComet Other P2P Applications C Xunlei Thunder L agaa LIPP365 FOCO LJ Clubbox ClAres ClezFeer 1 Pando C Huntmine C Kuwe Available settings are explained as follows Item Description Enable Check the box to enable such rule Name Type a name of the rule for identification Source IP Type IP address in LAN Packets passing through such IP address will be filtered by the
252. s not ready for accessing Internet 2 5 Saving Configuration Each time you click OK on the web page for saving the configuration you can find messages showing the system interaction with you Ready indicates the system is ready for you to input settings Settings Saved means your settings are saved once you click Finish or OK button Vigor2130 Series User s Guide 29 Dray Tek 2 6 Registering Vigor Router You have finished the configuration of Quick Start Wizard and you can surf the Internet at any time Now it is the time to register your Vigor router to MyVigor website for getting more service Please follow the steps below to finish the router registration 1 Please login the web configuration interface of Vigor router by typing admin admin as User Name Password pm A f Username Password Copyright DrayTek Corp All Rights Reserved Dr ay Te k 2 Click Support Area gt gt Production Registration from the home page Application Note FAQ Product Registration Logout 3 A Login page will be shown on the screen Please type the account and password that you created previously And click Login Please take a moment to register Membership Registration entitles you to upgrade firmware for your purchased product and receive news about upcoming products and services UserName james_fae Auth Code txxhdd If you cannot read the word click here Forgotten password Don t
253. s the IPv6 address please connect to http www ipv6 org If your PC access Internet via IPv6 connection your IPv6 address will be shown on the web page immediately Refer to the following figure Dray Tek IPv6 Welcome to the IPv6 Information Page How To IPv6 enabled applications IPv6 specifications Mailing List CONTENTS FAQ 246 Other Site IPv6 accessible servers Implementations Vigor2130 Series User s Guide 4 13 7 IPv6 Management This page allows you to manage the settings for IPv6 access control including settings of HTTP HTTPs SSH FTP and TELNET by using IPv6 protocol Check the box and type the port number respectively to enable the remote management of services IPv6 gt gt Management IPv6 Management Access Control Allow management from the Internet Enable HTTP Port Enable HTTPs LJ Port 44 Enable SSH C Port 22 Enable ICMP Ping F Enable FTP C Por Enable TELNET C Port Note Pv6 Firewall function only check pure IPv6 packet It doesnt support IPv6 over Pv4 Tunneling protocol like TSPC Available settings are explained as follows Item Description Allow management from Enable HTTP HTTPS SSH ICMP Ping FTP TELNET the Internet Enable the checkbox to allow system administrators to login from the Internet There are several servers provided by the system to allow you managing the router from Internet Check the box es to specify the service Vigor2130 Serie
254. sable Remote Gateway IP From first subnet to remote network you have to do Remote Network IP Route ka Remote Network Mask Change default route to this VPN tunnel Only single WAN supports this 2 Enable it and give it a name In this example the profile name is test Dray Tek 44 Vigor2130 Series User s Guide 3 Select Dial Out as Call Direction and enable Always on Select IPSec Tunnel and enter Vigor2130 s WAN IP address in the Server IP Host Name for VPN field aa Setup a pre shared key which must be the same as in Vigor2130 Select ESP High and 3DES with Authentication Enter Vigor2130 s private network in the Remote Network IP Mask field Click OK ot SY Vigor2130 Series User s Guide 45 Dray Tek 3 3 LAN to LAN IPSec VPN between Vigor2130 and Vigor2820 using Agressive mode In this document we will introduce how to create a LAN to LAN IPSec VPN between Vigor2130 and a Vigor2820 using Aggressive mode We use the following scenario WAN 172 17 1 186 LAN _ LAN 4192 168 30 0 24 a geass 192 168 1 0 24 172 17 1 25 VT Veo a Vigor 2820 Case 1 VPN direction from Vigor2130 to Vigor2820 VPN configuration on Vigor2130 l Create a LAN to LAN profile VPN and Remote Access gt gt LAN to LAN Edit VPN Tunnel General Enabled z Name Demo Remote IP IKE phase 1 mode Aggressive Mode Y Authentication Type Pre Shared Key M
255. scdccnodescaediaamaeideasetedaanoiencescteuninaasesediendmosasenedsecioeereseteaswecseecs 170 4 8 3 IPSec Remote Dial in ccccccccccccssssececcceeeeeecceeuecececeeaseceescaeaseceeesuaeeeeessauesesensageeeess 173 4 8 4 Remote Dial in Status cccccccccccccsssecececeeseececccaeeececesaeeeeeeeeeaeeeeessuaeeeeessaaeeeesessaaass 175 AOISEAN TO LAN erre eee E E E ee 176 4 9 Certificate MANAGeMEN cccccccccceceeeeesseeceeeeeeeaeeeseeeeeeeesseeaseeeeeeeessaaesseeceeeseuaaeeeeeeeeseaas 181 4 9 1 Trusted CA Certificate sco sehcncs cccssezssacieacesaessuessaehsndebeesscadssaudeusveacdendebesteeeasachiedeasaccendes 182 4 9 2 Local ertiliCale serincennrigncnneiui rannan atann E ANAE Oan TEEDE Ea 185 4 9 3 Issue Certificate sctss catctonseasassancenecenosd savas caderie situps eni rE kaa ANANE ARa ATERATA nekaa iniaa 187 410 Wireless LAN spss pe area Sete aie tarieecisnaitisnntseisssoclosenctsesentgncc oso tenun EEE E 187 410 1 BASIC CONMCE OS penine E seen see EE E ESEE EEEa 187 4 10 2 General SetU a A EE EE Ea EEE EEE 189 4 10 3 Access GOMUIO lie sescccceneneticeesncctioced asiesienatadenh ieee d swand cin laieslsaniees deacnetcncbageeisede2eseestadeudoeasdaces 196 4 10 4 Station LIST rresia ee r i a Ea eE E vet aee REE EER E 197 4 10 5 Access Point Discovery ccccseececcceeeeeceseeecseeeeeeaeeeeeessaueeessaeeessaaseeeseeeeessaneessaaeees 198 4 10 6 WMM Configuration cccccccesccccceeeceeeeseeeceeeeeeeeeeseeceeeess
256. sement lifetime The lifetime associated with the default router in units of seconds It s used to control the lifetime of the prefix The maximum value corresponds to 18 2 hours A lifetime of 0 indicates that the router is not a default router and should not appear on the default router list DHCPv6 Stateful IPv6 Start Address IPv6 End Address Type the start and end address for IPv6 server 4 13 3 IPv6 Firewall Setup This page allows users to set firewall rules for IPv6 packets Note Section 4 4 Firewall is configured for IPv4 packets only IPv6 gt gt IP v6 Firewall IPvi Firewall List Name Protocol Source IP Destination IP Source Port Destination Port Action Note Pv Firewall function only check pure IPv6 packet t doesnt support IPvb over IPv4 Tunneling protocol like TSPC Add Mew Rule Delete All Each item is explained as follows Item Description Name Display the name of the rule Protocol Display the protocol TCP UDP ICMPv6 the rule uses Source IP Display the source IP address of such rule Destination IP Display the destination IP address of such rule Source Port Display the source port number of such rule Destination Port Display the destination port number of such rule Action Display the status accept or drop of such rule Dray Tek 238 Vigor2130 Series User s Guide Adding a New Rule Click Add New Rule to configure a new rule for IPv6 Firewall Note You can set up to 20 sets of IPv6
257. sh of the page at regular intervals Refresh Click it to reload the page Vigor2130 Series User s Guide 243 Dray Te k 4 13 6 IPv6 TSPC Status IPv6 TSPC status web page could help you to diagnose the connection status of TSPC TSPC log contains some debug information from program If TSPC has not configured properly the router will display the following page when the user tries to connect through TSPC connection IPv6 gt gt IPv6 TSPC Status Status Log Connection Status Tunnel Information Tunnel Status Activity Sent me Received When TSPC configuration has been done the router will start to connect The connecting page will be shown as below Status Loy Connection Status Tunnel Information Tunnel Status Activity Sent Received When the router detects all the information the screen will be shown as follows One set of TSPC prefix and prefix length will be obtained after the connection between TSPC and Tunnel broker built Dray Te k 244 Vigor2130 Series User s Guide Status Log Connection Status Tunnel Information Tunnel Interface eth Tunnel Mode IPv6 in IPv4 Native Local Endpoint Addresses 598 115 226 178 2001 05c0 1400 000b 0000 0000 0000 2505 Remote Endpoint Addresses 061 171 72 11 2U017 05cU 1400 000b 0000 0000 0000 2604 Tunnel Broker broker freeneth net Tunnel Status Connected Activity Sent 3 Received B25 fT 1472489 Each item is expl
258. shoot IP connection for your router Diagnostics gt gt Ping ICMP Ping P OUPVE IP Address Domain Ping Size Available settings are explained as follows Item Description IPv4 IPv6 Click IPv4 or IPv6 for performing the ICMP Ping function IP Address Type in the IP address of the Host IP that you want to ping Ping Size Type in the payload size of the ICMP packet Values range from 8 bytes to 1400 bytes Start Click this button to start the ping work The result will be displayed on the screen Vigor2130 Series User s Guide 265 Dr ay Te k 4 16 2 Trace Route Click Diagnostics and click Trace Route to open the web page This page allows you to trace the routes from router to the host Simply type the IP address of the host in the box and click Run The result of route trace will be shown on the screen Diagnostics gt gt Trace Route Trace Route IPV4 OUPV6 IP Address Domain 0 0 0 0 Available settings are explained as follows Item Description IPv4 IPv6 Click IPv4 or IPv6 for performing the ICMP Ping function IP Address Domain Type in the IP address domain of the Host IP that you want to trace Start Click this button to start the route tracing work The result will be displayed on the screen 4 16 3 Routing Table Click Diagnostics and click Routing Table to open the web page Diagnostics gt gt Routing Table Routing Table Destination Gateway Genmask Metric 192 168 5 0 0 0 0 0
259. shutdown the computer Type a brief description e g Welcome to DrayTek which will be shown on the heading of the login dialog When you want to access into the web configurator of Vigor router the system will ask you to offer username and password first At that moment the background of the web page is blank and no heading will be displayed on the Login window This page allows you to specify background URL and the heading on the Login window if you have such requirement Enable Enable the function of Bulletin The content typed in Bulletin will be displayed on the login dialog Disable Disable the function of Bulletin Disable Click it to disable the function of redirection Redirect to bulletin page Any user who wants to access into Internet through this router will be redirected to view the information specified on Bulletin Redirect to URL xxx Any user who wants to access into Internet through this router will be redirected to the URL specified here first It is a useful method for the purpose of advertisement For example force the wireless user s in hotel to access into the web page that the hotel wants the user s to visit Such function will perform according to the selection configured in Link to IP MAC binding list Click this LAN gt gt Bind IP to MAC link to open the page to configure the settings if required Click the buttons of Login or Bypass disable login to view 109 Dray Tek the we
260. sk Destination Address address mask Source MAC Address Action Time Profile Teu L___d c Ex 192 166 1044 Ex 172 16 0 0 16 EL EL EL EL EL New Time Object Available settings are explained as follows Item Enable Name Source Destination Protocol Source Port Destination Port Source Address Destination Address Source MAC Address Vigor2130 Series User s Guide Description Check the box to enable such rule Type a name of the rule for identification Specify the interface for the starting point Specify the interface for the ending point Specify the protocol s which this filter rule will apply to Type a fixed port number or a range of port number for such rule Available value is 1 65535 Type WAN IP or LAN IP address based on the WAN or LAN interface specified in Source Destination fields Note that the format for this field must be address mask e g 192 168 1 123 or 172 16 9 0 24 Specify the MAC address for the packets 133 Dray Tek Action Choose the action to perform for the filtered packet Accept Packets matching with such rule can pass through the router Drop Packets matching with such rule will be discarded immediately Reject Packets matching with such rule cannot pass through the router and become packets with TCP reset or ICMP port unreachable packets ACCEPT DROP REJECT Time Profile Specify a period for filtering t
261. t Station List Index IP Address Auto refresh MAC Address Connected Time SSID Auth Encrypt Mode Mo Staton Available settings are explained as follows Item Auto refresh Refresh Index IP Address MAC Address Connected Time SSID Auth Encrypt Mode Vigor2130 Series User s Guide Description Check this box to force the system refreshing the table automatically Click this button to refresh current page Display the number of the connected station Display the WAN IP address for the connected station Display the MAC Address for the connected station Display the connection time for the connected station Display the SSID of the connected station Display the authentication of the connected station Display the encryption type adapted by the connected station Display the connection mode used by the connected station 197 Dray Tek 4 10 5 Access Point Discovery Vigor router can scan all regulatory channels and find working APs in the neighborhood Based on the scanning result users will know which channel is clean for usage Note During the scanning process about 5 seconds no client is allowed to connect to Vigor The table will list channel SSID BSSID Security and the Signal strength of working APs in the neighborhood Wireless LAN gt gt Access Point Discovery Access Point Discove Security ignali Scan Note During the scanning process 5 seconds no station i
262. t Information Required The device could not be identified The detected device is of unknown type Be sure that 1 The device is properly configured 2 The address on the previous page is correct Either correct the address and perform another search on the network by returning to the previous wizard page or select the device type if you are sure the address is correct 8 Completing the Add Standard TCP IP Printer Port Wizard You have selected a port with the following characteristics SNMP No Protocol RAW Pot 9100 Device 192 163 1 1 Port Name IP_192 168 1 1 Adapter Type Generic Network Card To complete this wizard click Finish i Cancel Dray Tek 12 Vigor2130 Series User s Guide 9 Now your system will ask you to choose right name of the printer that you installed onto the router Such step can make correct driver loaded onto your PC When you finish the selection click Next Add Printer Wizard Install Printer Software The manufacturer and model determine which printer software to use mr Select the manufacturer and model of your printer If your printer came with an installation disk click Have Disk If your printer is not listed consult your printer documentation for compatible printer software Manufacturer E Eidi AST lt a Canon y ee fle zy This driver is digitally signed windows Update Tell me why driver signing is important 10 For the final st
263. t URL Wget Script Edit Record 61 216 233 182 3 Copy the character strings from the right of the in the address bar VFZqg TIRVIVRNMG9BOVFpZTFYMDolNjwOTMe http Treedns atraid org dynamic update php 4 Login to Vigor2130 by WUI and go to Application gt gt Dynamic DNS page Applications gt gt Dynamic DNS Dynamic DNS Configuration Enable Dynamic DNS service Provider freedns afraid org Domain name reedns afraid org Username fri Password IP source My VVAN IP ow Check IP change every Force IP update every Select freedns afraid org and fill in the username as you applied for the service 5 Past the strings what you copied on step3 on password field 6 Click OK to save the configuration Now you can check the service by using nslookup command on your computer or check the syslog information on Vigor2130 Vigor2130 Series User s Guide 65 Dr ay Te k This page 1s left blank D roa y Ti e k 66 Vigor2130 Series User s Guide 4 Web Configuration This chapter will guide users to execute advanced full configuration through admin mode operation 1 Open a web browser on your PC and type http 192 168 1 1 The window will ask for typing username and password 2 Please type admin admin on Username Password for administration operation Now the Main Screen will appear Be aware that Admin mode will be displayed on the bottom left side Vigor2 130 Series Dra
264. t Wizard WAN IP Configuration Connection Type Clone MAC Address Enable Static IP You will receive a fixed public IP address or a public subnet namely multiple public IP addresses from your DSL or Cable ISP service providers In most cases a Cable service provider will offer a fixed public IP while a DSL service provider will offer a public subnet If you have a public subnet you could assign an IP address or many IP address to the WAN interface Quick Start Wizard WAN IP Configuration Connection Type Static IP IP Address Subnet Mask Gateway Primary DNS Server Secondary DNS Server Clone MAC Address Enable Cancel Available settings are explained as follows Item Description Vigor2130 Series User s Guide 19 Dray Tek Item IP Address Subnet Mask Gateway Primary DNS Server Secondary DNS Server Enable Clone MAC Address Description Type the IP address Type the subnet mask Type the gateway IP address Type in the primary IP address for the router Type in secondary IP address for necessity in the future The router will detect the MAC address automatically Or check the box to enable MAC address cloning It is available when the box of Enable is checked Click Clone PC Address The result will be displayed in the field of MAC Address Enable Clone MAC Address MAC Address 00 0E A6 24 D5 A1 After finishing the settings here please click Next DHCP I
265. t is not necessary for you to type any IP address manually Simply choose this type and the system will obtain the IP address automatically from DHCP server Quick Start Wizard WAN IP Configuration Connection Type Clone MAC Address Available settings are explained as follows Item Enable Clone MAC Address Dray Tek Description The router will detect the MAC address automatically Or check the box to enable MAC address cloning It is available when the box of Enable is checked Click Clone PC Address The result will be displayed in the field of MAC Address 20 Vigor2130 Series User s Guide Item Description Enable Clone MAC Address MAC Address 00 0E A6 2A D5 A1 After finishing the settings here please click Next PPPoE PPPoE stands for Point to Point Protocol over Ethernet It relies on two widely accepted standards PPP and Ethernet It connects users through an Ethernet to the Internet with a common broadband medium such as a single DSL line wireless device or cable modem All the users over the Ethernet can share a common connection PPPoE is used for most of DSL modem users All local users can share one PPPoE connection for accessing the Internet Your service provider will provide you information about user name password and authentication mode If your ISP provides you the PPPoE connection please select PPPoE for this router The following page will be shown Quick Start Wizard
266. t the printer list Open Support gt FAQ find out the link of Printer Server and click it then click the What types of printers are compatible with Vigor router link About DrayTek Products Support Partners Home gt Support gt FAQ FAQ Basic 01 What are the differences among these firmware file formats 02 How could get the telnet command for routers 03 How can backup restore my configuration settings 04 How do reset clear the router s password 05 How to bring back my router to its default value D6 How do tell the type of my Vigor Router is AnnexA or AnnexB For ADSL model only 07 Ways for firmware upgrade 08 Why is SNMP removed in firmware 2 3 6 and above for Vigor2200 Series routers 09 failed to upgrade Vigor Router s firmware from my Mac machine constantly what should do 10 How to upgrade firmware of Vigor Router remotely Contact Us FAQ Basic Advanced YPN DHCP Wireless VoIP QoS ISDN Firewall IP Filter Printer Server R ocesesecoececcosecoccesssoesecessesecesseseos USB ISDN TA 11h FAQ Printer Server 01 How do configure LPR printing on Windows2000 XP 02 How do configure LPR printing on Windows98 Me 03 How do configure LPR printing on Linux boxes 04 Why there are some strange print out when try to print my documents through Vigor210 4P 2300 s
267. t the settings for the selected limitation Delete Remove the selected settings existing on the limitation list Smart Bandwidth Limit Check this radio button to configure the default limitation for bandwidth for any LAN IP not included in the Limitation List When session number exceeds type the value here as a threshold to apply the smart bandwidth limit TX limit Define the default speed of the upstream for each computer in LAN RX limit Define the default speed of the downstream for each computer in LAN When you finish adding a new bandwidth limit click OK D ro y Ti e k 148 Vigor2130 Series User s Guide 4 6 3 Port Rate Control A policer can limit the bandwidth of received frames It is located in front of the ingress queue And a shaper can limit the bandwidth of transmitted frames It is located after the ingress queues This page allows you to configure the WAN port rate limit for Policers and Shapers Bandwidth Management gt gt Port Rate Control Rate Limit Configuration Policer Policer Policer Shaper Shaper Shaper Enabled Rate Rx Unit Enabled Rate Tx Unit a a Mote Shaper must be enabled for Weighted Clueuing Mode osl Available settings are explained as follows Item Description Port Represent WAN interface Policer Enabled Check this box to enable policer function to limit the bandwidth of received frames Policer Rate Rx Type the number for policer function The default value i
268. tatus Refresh Devices Vigor2130 Series User s Guide 53 Dray Tek 2 Make sure Internet connection is done Open USB Application gt gt DLNA Server and click Install to install DLNA service into the USB storage device USB Application gt gt DLNA Server Press the button to install DLNA Server Note Internet connection is required Install USB Application gt gt DLNA Server Install DLNA Installation Output CL EEE Retry 3 During the process of installation you can click Show Detail to view the installation procedure USB Application gt gt DLNA Server Install DLNA Installation Output Blt el J Detail Content Configuring libdina Installing libdina 0 2 3 1 to usb Downloading http vigor2130 qooglecode com files libdina 0 2 3 1_arrn ipk Installing libdina 0 2 5 1 to usb Downloading http vigor2130 googlecode com files libdIna_O 2 3 1_arm ipk Installing libdina 0 2 3 1 to usb Downloading http Mvigor2130 googlecode com files libdina_0 2 3 1_arm ipk Installing libdina 0 2 5 1 to usb 4 After finished the service installation the configuration page will be open automatically Please click Enable and type a name in the field of Server Name Then click OK to activate DLNA service USB Application gt gt DLNA Server Settings DLNA Server Enable Disable server Mame Vigaor2130 Path Note Please disable DLNA function before you unplug USB disk
269. tenance gt gt Firmware Upgrade Firmware Upgrade Current Firmware Version v1 5 2 RC3 Select a firmware file PT Click Upgrade to upload the file Upgrade TEITP Firmware Upgrade from LAN Firmware Upgrade Procedures Click OK to start the TFTP server Open the Firmware Upgrade Utility or other 3 party TFTP client software Check that the firmware filename ts correct Click Upgrade on the Firmware Upgrade Utility to start the upgrade After the upgrade is compelete the TFTP server will automatically stop running Do you want to upgrade firmware Note 1 TFTP upgrade fram LAN side would be more stable 2 Change firmware extension fram all to rst ta do factory default after upgrade 3 It is strongly recommended that you do a configuration backup before upgrading Dray Te k 264 Vigor2130 Series User s Guide Click Browse to locate the newest firmware and click Upgrade During the process of upgrade do not turn off your router 4 16 Diagnostics Diagnostic Tools provide a useful way to view or diagnose the status of your Vigor router Below shows the menu items for Diagnostics t Diagnostics Ping Trace Route Routing Table ARP Cache Table System Log Traffic Overview Detailed Statistics MAC Address Table DHCP Table Data Flow Monitor ELETE Sessions Table Ports State 4 16 1 Ping Click Diagnostics and click Ping to open the web page It is used to trouble
270. the setting web page USB Application gt gt FTP User Setting FTP User Configuration User Mame autotest Volume HOSY2251 bYLATZU Bl 35G PORT Home Folder fautobuild Access Rule Read only Available settings are explained as follows Item Description Volume Select the proper volume for the connected USB disk Dray Tek 206 Vigor2130 Series User s Guide Home Folder Access Rule Disallow FTP It determines the range for the client to access into The user can enter a directory name in this field Then after clicking OK the router will create the specific new folder in the USB diskette In addition if the user types here he she can access into all of the disk folders and files in USB diskette Note When write protect status for the USB diskette is ON you cannot type any new folder name in this field Only can be used in such case Select the access right for the USB disk Read only Read only Read write Disconnect the FTP service for the select ed user When you finish the settings simply click OK to save the configuration 4 11 5 Disk Shares This page can define the folder which will be shared while Samba File Sharing is enabled USB Application gt gt Disk Shares Samba General Settings Enable Disk Sharing Workgroup Mame Disk Shares Share Name shed Downloads root Comment Path Visible shang Hai RO download code shrd BT downloads dow
271. the source end port Such value will be available only TCP UDP is selected as the protocol Type a value as the destination start port Such value will be available only TCP UDP 1s selected as the protocol Destination End Port Type a value as the destination end port Such value will be optional available only TCP UDP is selected as the protocol Action Set the action that the router will perform for the packets through the protocol of IPv6 ACCEPT ACCEPT DROP ACCEPT If the IPv6 packets fit the condition listed in this page the router will let it pass through DROP If the IPv6 packets fit the condition listed in this page the router will block it Example Refer to the following example 1 Use TSPC mode to connect to IPv6 network PC get ipv6 IP 2001 5c0 1503 7400 30e4 139d 53c8 3ale 2 Connect PC to http www ipv6 org with IPv6 IP address A message will appear from the web page Welcome to the IP v6 Information Page You are using IPv6 from 2001 5c0 1503 7400 30e4 139d 53c8 3ale 3 Set firewall rule to block all TCP traffic from this IP address 4 Open IPv6 gt gt IPv6 Firewall Setup and press Add New Rule Dray Tek 240 Vigor2130 Series User s Guide IPv6 gt gt IPv6 Firewall IPv6 Firewall List Name Protocol Source IP Destination IP Source Port Destination Port Action Add New Rule Delete All In the following dialog please configure the page with the following values IPv6 gt gt IPv6 Fire
272. tificate Management gt gt Issue Certificate Issue Remote Certificate Request Issue Paste Cerificate below Available settings are explained as follows Item Description Certificate file Use the Browse button to specify the file Issue After choosing the certificate file above click this button to issue the certificate Paste Certificate below You many paste the information of the certificate from other files After pasting the data in this field simply click Issue above 4 10 Wireless LAN This function is used for n models 4 10 1 Basic Concepts Over recent years the market for wireless communications has enjoyed tremendous growth Wireless technology now reaches or is capable of reaching virtually every location on the surface of the earth Hundreds of millions of people exchange information every day via wireless communication products The Vigor n model a k a Vigor wireless router is designed for maximum flexibility and efficiency of a small office home Any authorized staff can bring a built in WLAN client PDA or notebook into a meeting room for conference without laying a clot of LAN cable or drilling holes everywhere Wireless LAN enables high mobility so WLAN users can simultaneously access all LAN facilities just like on a wired LAN as well as Internet access The Vigor wireless routers are equipped with a wireless LAN interface compliant with the standard IEEE 802 11n draft 2 protocol To
273. ting WAN gt gt VoIP WAN sas r a Vigor router supports IPTV application traditional television channel movie or VoD service through the second WAN IP under PPPoE connection mode Enable IPTV WAN Setup Check the box to enable IPTV WAN configuration IPTV WAN VLAN ID Voice sent out through the WAN port will be tagged with VLAN ID number specified here The range of ID number you can type is from 2 4096 IPTV WAN Setting Click this link to open IPTV WAN setting WAN gt gt IPTV WAN IPTV WAN Connection Type None v Mail SMS Alert i Alert Types None v Event types WAN UPO WAN DOwN gO Cancel Enable Management WAN Setup Check the box to enable IPTV WAN configuration Management WAN VLAN ID Voice sent out through the WAN port will be tagged with VLAN ID number specified here The range of ID number you can type is from 2 4096 Management WAN Setting Click this link to open Management WAN setting WAN gt gt Management WAN Management WAN Connection Type None Mail SMS Alert Alert Types None v Event types WANUPO waN DOWN O Cancel LAN NAT Such value is constant and fixed All the data will be transmitted by NAT through WAN port Bridge 1 2 3 LAN port P2 P4 selected here will ask a Public IP address from ISP for transmitting data from PC directly without NAT The range of ID number you can type is from 2 4096 Each ID setting must be unique and different
274. tion Enable Disable LJ Logout at f everyday 24H clock C Logout every minutes 1 50000 C Logout after shutdown ARP timeout the maximum character length is 1000 lt hi gt Welcome to lt font color red gt Vigor lt font gt Web Portal lt hi gt Bulletin Board Redirect Bypass Disable View Current Portal Bulletin O Enable Disable Disable Redirect to bulletin page Redirect to URL http www draytek com e g http www google com Link to IP MAC binding li Bypass disable login Online Status ithe maximum character length is 2000 lt hi gt lt b gt lt font color red gt Vigor lt font gt lt b gt lt hi gt Provides unprecedented speeds on fiber broadband network lt p gt Support hardware NAT lt p gt Up to 800 Mbps downstream upstream p gt Workable for extreme high speed multimedia streaming lt p gt VoIP facilities for low cost call lt p gt Easy to use firewall and secure VPN lt p gt Note disable Login Bulletin Board Redirect After Login disable Web Portal Examples of Welcome Message and Bulletin 1 lt b gt Message lt b gt 2 lt h1 gt lt font color red gt Title lt font gt lt h1 gt lt p gt Message lt p gt Available settings are explained as follows Dray Tek Item Login Description Different login method specified here will lead to different login page 4 Enable HTTP Click it to enable the function of web p
275. tion Click Yes to use this function Fixed IP Address IPCP Type in a fixed IP address in the box if you click Yes for Fixed IP IPCP WAN Connection Mode Such function allows you to verify whether network Detection connection is alive or not through ARP Detect or Ping Detect Choose ARP Detect or Ping Detect for the system to execute for WAN detection Ping IP If you choose Ping Detect as detection mode you have to type IP address in this field for pinging Clone MAC Address Enable Enable the feature It is available when the box of Enable is checked Click Clone MAC Address The result will be displayed in the field of MAC Address Enable Clone MAC Address MAC Address 00 0E A6 24 D5 A1 Mail SMS Alert Alert Types Specify the type of the alert mail SMS or Mail and SMS that Vigor system will use to send a message to the user Mail and Sits Event types Specify the event when the system must send a notification to the user by mail and or SMS After finishing all the settings here please click OK to activate them Vigor2130 Series User s Guide 75 Dray Tek PPTP L2TP To use PPTP L2TP as the accessing protocol of the internet please choose PPTP L2TP from Connection Type drop down menu The following web page will be shown WAN gt gt Internet Access WAN IP Configuration Enable Connection Type PPTP Settings Username Password server Address WAN IP Network Settings IP Address
276. to choose the desired domain Type in the login name that you set for applying domain Type in the password that you set for applying domain Determine the IP source for DDNS server 160 Vigor2130 Series User s Guide My WAN IP Use IP configured for WAN interface for DDNS server My Internet IP Use true IP for DDNS server My Internet IP bly WAN IP hy Internet IP Check IP change every Set the interval for checking the information Force IP update every Force the router updates its information to DDNS server with the interval set here Click OK button to activate the settings You will see your setting has been saved Applications gt gt Dynamic DNS Dynamic ONS Configuration Index Setting Status Host Ti Host chronic6633 Y Force Update 4 7 2 Schedule The Vigor router has a built in real time clock which can update itself manually or automatically by means of Network Time Protocols NTP As a result you can not only schedule the router to dialup to the Internet at a specified time but also restrict Internet access to certain hours so that users can connect to the Internet only during certain hours say business hours The schedule is also applicable to other functions You have to set your time before set schedule In System Maintenance gt gt Time and Date menu press Inquire Time button to set the Vigor router s clock to current time of your PC The clock will reset once if you power down
277. tocols are SIP MGCP Megaco and H 323 These protocols are not all compatible with each other except via a soft switch server The Vigor V models support the SIP protocol as this is an ideal and convenient deployment for the ITSP Internet Telephony Service Provider and softphone and is widely supported SIP is an end to end signaling protocol that establishes user presence and mobility in VoIP structure Every one who wants to talk using his her SIP Uniform Resource Identifier SIP Address The standard format of SIP URI is sip user password host port Some fields may be optional in different use In general host refers to a domain The userinfo includes the user field the password field and the sign following them This is very similar to a URL so some may call it SIP URL SIP supports peer to peer direct calling and also calling via a SIP proxy server a role similar to the gatekeeper in H 323 networks while the MGCP protocol uses client server architecture the calling scenario being very similar to the current PSTN ISDN network After a call is setup the voice streams transmit via RTP Real Time Transport Protocol Different codecs methods to compress and encode the voice can be embedded into RTP packets Vigor V models provide various codecs including G 711 A u law G 723 G 726 and G 729 A amp B Each codec uses a different bandwidth and hence provides different levels of voice quality The more band
278. transferred from the router to the USB storage device directly Click USB Application gt gt Bit Torrent Download USB Application gt gt Bit Torrent Download Press the button to install BT module Note Internet connection is required Install Click Install to install the BT module for the router and the USB storage device USB Application gt gt BT Install BT Installation Qutput BT module is being installed to USB device please wait a moment during installation Note Please don t leave the page till installation process is done When the module installation is finished you will see the following screen Vigor2130 Series User s Guide 209 Dray Te k USB Application gt gt Bit Torrent Download BT Default General Settings BT Function Listening Port Wax Peer Connections Traffic Control Rate Limit Enable Max Download Rate Max Upload Rate Enable Disable e iso _ 8595 1025 e655 a 100 Enable Disable 100 KBnsi 0 2048 Web Client Authentication Enable User Mame Password Web Client Port Remote Management KBps 0 2048 Enable Disable 9091 Open Web Client Enable Disable Note Format usb disk as NTFS will be more reliable Available settings are explained as follows Item BT Function Listening Port Max Peer Connections Rate Limit Enable Max Download Rate Max Upload Rate Authentication Enable User Name Dray Tek D
279. ts cannot access the Internet Enable Disable Strict Bind ARP Table Select All Sornt Refresh IP Bind List Select All Sort Index IP Address Mac Address Add and Edit Mac Address i i B B Comment OoOO f L Show Comment Web Portal Default Bypass Login Disable Bypass All Available settings are explained as follows Item Description Enable Click this radio button to invoke this function However IP MAC which is not listed in IP Bind List also can connect to Internet Disable Click this radio button to disable this function All the settings on this page will be invalid Strict Bind Click this radio button to block the connection of the IP MAC which is not listed in IP Bind List ARP Table This table is the LAN ARP table of this router The information for IP and MAC will be displayed in this field Each pair of IP and MAC address listed in ARP table can be selected and added to IP Bind List by clicking Add below Add and Edit IP Address Type the IP address that will be used for the specified MAC address Mac Address Type the MAC address that is used to bind with the assigned IP address Comment Type a brief description for the entry Show Comment Check it to display the content of the comment Web Portal Default means the user needs to type username and password for accessing into the Internet through web logging Dray Tek 106 Vigor2130 Series User s Guide
280. tting for Dray Te k 254 Vigor2130 Series User s Guide password is blank New Password Type in new password in this filed Confirm Password Type in the new password again When you click OK the login window will appear Please use the new password to access into the web configurator again 4 15 4 User Password This page allows you to set new password for user operation System Maintenance gt gt User Password User Password Old Password New Password Confirm Mew Password Available settings are explained as follows Item Description Old Password Type in the old password The factory default setting for password is blank New Password Type in new password in this filed Confirm Password Type in the new password again When you click OK the login window will appear Please use the new password to access into the web configurator again Below shows an example for accessing into User Operation with User Password 1 Type anew password in the field of New Password and click OK System Maintenance gt gt User Password User Password Old Password Confirm Mew Password Corre Note Default user password is none Please change the user password first otherwise no one can login with user mode 2 The following screen will appear Simply click OK Vigor2130 Series User s Guide 255 Dray Te k System Maintenance gt gt User Password Your configuration is saved Password changed successfully
281. ule configured here Acts Specify how often the schedule will be applied Once The schedule will be applied just once Routine Weekday Specify which days in one week should perform the schedule Dray Te k 162 Vigor2130 Series User s Guide Click OK button to activate the settings You will see your setting has been saved Applications gt gt Schedule Schedule Configuration Index Setting Status 2012 Mar 30 0 0 ROUTINE Mon Thur WAN UP y 2012 Mar 30 0 0 ROUTINE Wed WAN UP y 4 7 3 IGMP IGMP snooping means multicast traffic will be forwarded to ports that have members of that group If you disable IGMP snooping the system will make multicast traffic treated in the same manner as broadcast traffic Applications gt gt IGMP IGMP Proxy Configuration beneral Configuration IGMP Proxy Enabled IGMP Proxy Channel IPTV WAN Disable IGMF Proxy is to act as a multicast proxy for hosts on the LAN side Enable IGMP Proxy if you will access any multicast group IGMP Snooping Configuration beneral Configuration Snooping Enabled Unregistered IPM Flooding enabled C Port Related Configuration Fast Leave d O d O Available settings are explained as follows Item Description IGMP Proxy IGMP Proxy Enabled Check the box to enable this Configuration function The IGMP proxy can act as a multicast proxy for hosts on LAN sides If you enable such function you can access any multicast gr
282. umber of the transmitted multicast packet Tx Broadcast Display the counting number of the transmitted broadcast packet Tx Pause Show the counting number of the transmitted pause packet Tx 64 Bytes Display the number of 64 byte frames in 271 Dray Tek good and bad packets transmitted Tx 65 127 Bytes Display the number of 65 127 byte frames in good and bad packets transmitted Tx 128 255 Bytes Display the number of 128 255 byte frames in good and bad packets transmitted Tx 256 511 Bytes Display the number of 256 511 byte frames in good and bad packets transmitted Tx 512 1023 Bytes Display the number of 512 1023 byte frames in good and bad packets transmitted Tx 1024 1526 Bytes Display the number of 1024 1522 byt frames in good and bad packets transmitted Tx 1527 Bytes Display the number of 1527 byte frames in good and bad packets transmitted Transmit Queue Counters Tx Low Display the low queue counter of the packet transmitted Tx Normal Display the normal queue counter of the packet transmitted Tx Medium Display the medium queue counter of the packet received Tx High Display the high queue counter of the packet received Transmit Error Counters Tx Drops Display the number of frames dropped due to excessive collision late collision or frame aging Tx lat Exc Coll Display the number of Frames late collision or excessive collision Error which switch transmitted
283. unes Server iTunes server is one of the most popular programs for managing media content on a computer Vigor router provides a function to support iTunes service that users can play music files e g mp3 from the USB storage device on Vigor router directly USB Application gt gt iTunes Server Press the button to install iTunes Server Note Internet connection is required Install Click Install to install the iTunes Server for the router and the USB storage device USB Application gt gt iTune Server Install iTune Installation Output Me When the server installation is finished you will see the following screen USB Application gt gt iTunes Server Settings iTunes Server Enable Disable Server Mame Path RFescan Interval Note Please disable iTunes function before you unplug USB disk Vigor2130 Series User s Guide 211 Dray Te k Available settings are explained as follows Item Description iTunes Server Enable Click it to enable iTunes Server function Disable Click it to disable iTunes Server function Server Name The default name is the router name You can change it if needed Path After storing the media files in the USB storage device please specify a path for the files to be accessed for 1Tunes service is the symbol for the top folder of USB storage Rescan Interval The USB storage disk will be scanned by 1Tunes Server again based on the time interval set
284. ups WAN gt gt 802 10 VLAN Tag Configuration 802 10 VLAN Tag Configuration J Enable Multi VLAN Setup WAN VLAN Setting WAN VLAN ID Untagged VoIP WAN VLAN Setting Enable VoIP WAN Setup VoIP WAN VLAN ID jio VolP WAN Setting IPTV WAN VLAN Setting Enable IPTV WAN Setup IPTV WAN VLAN ID 8 IPTV WAN Setting Management WAN VLAN Setting Enable Management WAN Setup Management WAN VLAN ID ja Management WAN Setting LAN VLAN Setting VLAN LANJNAT Bridge Bridge Bridges Note P1 is reserved for NAT Route use Available settings are explained as follows Dray Tek Item Description 802 1Q VLAN Tag Enable Multi VLAN Setup Check the box to enable Configuration Multi VLAN configuration WAN VLAN Setting WAN VLAN ID Data sent out through the WAN port will be tagged with VLAN ID number specified here The range of ID number you can type 1s from 2 4096 Untagged Check this box to untag VLAN ID for data transmission through WAN VoIP WAN VLAN Setting Enable VoIP WAN Setup Check the box to enable VoIP WAN configuration VoIP WAN VLAN ID Voice sent out through the WAN 84 Vigor2130 Series User s Guide IPTV WAN VLAN Setting Management WAN VLAN Setting LAN VLAN Setting Vigor2130 Series User s Guide port will be tagged with VLAN ID number specified here The range of ID number you can type 1s from 2 4096 VoIP WAN Setting Click this link to open VoIP WAN set
285. urb Act Do Not Distrub Deact Hide caller ID Act Dray Tek Description Check this box to enable this function Sometimes people might miss some phone calls Please dial number typed in this field to know w You have finished an incoming phone call however you want to call back again for some reason Please dial number typed in this field to call back to that one Dial the number typed in this field to call the previous outgoing phone call again Dial the number typed in this field to forward all the incoming calls to the specified place Dial the number typed in this field to release the call forward function Dial the number typed in this field to forward all the incoming calls to the specified place while the phone is busy Dial the number typed in this field to forward all the incoming calls to the specified place while there is no answer of the connected phone Dial the number typed in this field to invoke the function of DND Dial the number typed in this field to release the DND function Dial the number typed in this field to make your phone number ID not displayed on the display panel of remote 222 Vigor2130 Series User s Guide end Hide caller ID Deact Dial the number typed in this field to release this function Call Waiting Act Dial the number typed in this field to make all the incoming calls waiting for your answer Call Waiting Deact Dial the number typed in this field to releas
286. urself Do not place the router in a damp or humid place e g a bathroom The router should be used in a sheltered area within a temperature range of 5 to 40 Celsius Do not expose the router to direct sunlight or other heat sources The housing and electronic components may be damaged by direct sunlight or heat sources Do not deploy the cable for LAN connection outdoor to prevent electronic shock hazards Keep the package out of reach of children When you want to dispose of the router please follow local regulations on conservation of the environment We warrant to the original end user purchaser that the router will be free from any defects in workmanship or materials for a period of two 2 years from the date of purchase from the dealer Please keep your purchase receipt in a safe place as it serves as proof of date of purchase During the warranty period and upon proof of purchase should the product have indications of failure due to faulty workmanship and or materials we will at our discretion repair or replace the defective products or components without charge for either parts or labor to whatever extent we deem necessary tore store the product to proper operating condition Any replacement will consist of a new or re manufactured functionally equivalent product of equal value and will be offered solely at our discretion This warranty will not apply if the product is modified misused tampered with damaged
287. us all the host PCs can share a common Internet connection Get Your Public IP Address from ISP In ADSL deployment the PPP Point to Point style authentication and authorization 1s required for bridging customer premises equipment CPE Point to Point Protocol over Ethernet PPPoE connects a network of hosts via an access device to a remote access concentrator or aggregation concentrator This implementation provides users with significant ease of use Meanwhile it provides access control billing and type of service according to user requirement When a router begins to connect to your ISP a serial of discovery process will occur to ask for a connection Then a session will be created Your user ID and password is authenticated via PAP or CHAP with RADIUS authentication system And your IP address DNS server and other related information will usually be assigned by your ISP Network Connection by 3G USB Modem For 3G mobile communication through Access Point is popular more and more Vigor router adds the function of 3G network connection for such purpose By connecting 3G USB Modem to the USB port of Vigor router it can support HSDPA UMTS EDGE GPRS GSM and the future 3G standard HSUPA etc Vigor router with 3G USB Modem allows you to receive 3G signals at any place such as your car or certain location holding outdoor activity and share the bandwidth for using by more people Users can use four LAN ports on the router to access Intern
288. ver Yes All Rights Reserved Wireless MAC Address 00 50 7F C9 59 78 SSID DrayTek Channal 11 Settings to be configured in User Mode will be less than settings in Admin Mode 4 15 5 Configuration Backup Backup the Configuration Follow the steps below to backup your configuration 1 Goto System Maintenance gt gt Configuration Backup The following windows will be popped up as shown below System Maintenance gt gt Configuration Backup Configuration Backup Restoration Backup Please specify a key and click Backup ta download current running configurations as a encrypted file Key optional ooo Note You will need the same key to do confiquration restoreation Restoration Select a configuration file es cc Please enter the key and click Restore to upload the confiquration file 2 Type a key arbitrarily for encrypting the file Keep the key in mind You will need it whenever you want to restore such file Click Backup button to get into the following dialog Click Save button to open another dialog for saving configuration as a file Vigor2130 Series User s Guide 257 Dr ay Te k File Download You are downloading the File config chg From 192 168 1 1 Would you like to open the file or save it to your computer Always ask before opening this type of file 3 In Save As dialog the default filename is config cfg You could give it another name by yourself
289. version or firmware related information from this presentation System Status Auto refresh C Refrest Model gt Vigor2130Vn Firmware Version v1 5 2 RC3 Build Date Time Fri Mar 23 19 56 16 CST 2012 System Date Fri Apr 6 02 46 03 2012 System Uptime days 23 26 27 WAN CPU Usage 0 0 Connection Mode Static Memory Usage 34996K 62784 K 55 74 eae ane aon z ai E C ress 00 50 7F 09 59 75 CACHO MESRNY 12952 K 60784 K IP Address 172 16 3 103 IP Mask 255 255 0 0 IPv Address fe80 250 7 fff fec9 5979 64 Linl MAC Address 00 50 7F C9 59 78 Default Gateway 172 16 1 1 IP Address 192 168 1 1 Primary DNS 168 95 1 1 Secondary DNS IP Mask 255 255 255 0 IPv6 Address fe80 250 7fff fec9 5978 64 Link DHCP Server Yes Wireless MAC Address 00 50 7F C9 S59 78 SSID DrayTek Channel 11 Each item is explained as follows Item Description Model Display the model name of the router Firmware Version Display the firmware version of the router Build Date Time Display the date and time of the current firmware built Vigor2130 Series User s Guide 251 Dray Te k System Date System Uptime System LAN Wireless WAN Dray Tek Display current time and date for the system server Display the connection time for the system server CPU Usage Display the percentage of the CPU usage of your system Memory Usage Display the size of the memory usage and the percenta
290. vertise that prefix on the interface It stands for Automatic IPv6 Connectivity Client Utility which can be used for NAT Traversal and gets IPv6 connectivity easily This page defines the AICCU connection types for LAN interface IPv6 gt gt WAN General Setup WAN IPv6 Configuration Pv Connection Type AICO ha AICCU User Name Password Conti Password Server Tunnel mode Tunnel ID Note Please setup IPv6 WWAN as Link Local Only and Pv WAM as DHCP for 6rd connection Available settings are explained as follows Item User Name Dray Tek Description Type the name obtained from the service provider It is suggested for you to apply another username and password 236 Vigor2130 Series User s Guide Password Confirm Password Server Tunnel mode Tunnel ID 4 13 2 IPv6 LAN Setup from other ISP such as http www sixxs net Type the password assigned with the user name Type the password again to make the confirmation Type the default server address tic sixxs net Choose one of the tunnel modes AYIYA allows tunnels to be created even behind firewalls and NAT s Heartbeat sends a packet to the PoP Point of Presence serving IPv6 in IPv4 tunnel then enables the tunnel on the PoP side Each account applied by the user from AICCU service provider supports 2 or more services for IPv4 to IPv6 IPv6 to IPv4 with different tunnel IDs Simply type tunnel ID characters obt
291. wall While the broadband users demand more bandwidth for multimedia interactive applications or distance learning security has been always the most concerned The firewall of the Vigor router helps to protect your local network against attack from unauthorized outsiders It also restricts users in the local network from accessing the Internet Furthermore it can filter out specific packets that trigger the router to build an unwanted outgoing connection Denial of Service DoS Defense The DoS Defense functionality helps you to detect and mitigate the DoS attack The attacks are usually categorized into two types the flooding type attacks and the vulnerability attacks The flooding type attacks will attempt to exhaust all your system s resource while the vulnerability attacks will try to paralyze the system by offending the vulnerabilities of the protocol or operation system The DoS Defense function enables the Vigor router to inspect every incoming packet based on the attack signature database Any malicious packet that might duplicate itself to paralyze the host in the secure LAN will be strictly blocked and a Syslog message will be sent as warning if you set up Syslog server Also the Vigor router monitors the traffic Any abnormal traffic flow violating the pre defined parameter such as the number of thresholds is identified as an attack and the Vigor router will activate its defense mechanism to mitigate in a real time manner Be
292. wall Setup Add IPv6 Firewall Rule Name Protocol source IP Type source IP Choose PC Source Subnet Destination IP Type Destination IP Destination Subnet 64 Choose Subnet Source Start Fort source End Part optional Destination Start Port Destination End Port optional 5 Connect PC to http www ipv6 org with IPv6 IP address again A message will appear from web page Welcome to the IPv6 Information Page You are using IPv4 from 114 37 132 219 Vigor2130 Series User s Guide 241 Dray Tek 4 13 4 IPv6 Routing This page displays the routing table for the protocol of IPv6 IPv6 gt gt IPv6 Routing Table IPvb Routing Table Device br lan eth eth fp br lan eth 1 br wan ath 2 ral Prefix 2000 64 feat feo feo feo feo feo feo feat eat HbA fh iar ba ear bd eat Metric 256 256 256 256 256 256 256 256 Each item is explained as follows Item Device Prefix Metric Expires MTU Advmss Hoplimit Auto refresh Refresh Dray Tek Expires 15451 sec 15507 sec 1550bsec 15506sec 15501 sec 15501 sec BOBS sec bObS sec 2963 sec MTU 1500 1500 1500 1500 1500 1500 1500 1500 1500 Auto refresh C Advmss Hoplimit 1440 1440 1440 1440 1440 1440 1440 1440 1440 4294967295 4294967295 4294967295 4294967295 4294967295 4294967295 4294967295 4294967295 4294967 295 Description Display the interfa
293. way for public hosts Vigor2130 Series User s Guide 93 Dr ay Te k Internet Public IP Address 220 135 240 207 Private Subn Router IP What is Routing Information Protocol RIP Vigor router will exchange routing information with neighboring routers using the RIP to accomplish IP routing This allows users to change the information of the router such as IP address and the routers will automatically inform for each other What is Static Route When you have several subnets in your LAN sometimes a more effective and quicker way for connection is the Static routes function rather than other method You may simply set rules to forward data from one specified subnet to another specified subnet without the presence of RIP What are Virtual LANs and Rate Control You can group local hosts by physical ports and create up to 4 virtual LANs To manage the communication between different groups please set up rules in Virtual LAN VLAN function and the rate of each Internet Dray Tek 94 Vigor2130 Series User s Guide 4 2 1 General Setup This page provides you the general settings for LAN Click LAN to open the LAN settings page and choose General Setup LAN gt gt General Setup Ethernet TCP IP and DHCP Setup LAN IP Network Configuration DHCP Server Configuration O Enable Server Disable Server For NAT Usage IF Address 192 168 1 1 Subnet Mask 255 255 255 0 DHCP Server IP Address 0 0 0 0 For IP Routing Usage
294. width a codec uses the better the voice quality however the codec used must be appropriate for your Internet bandwidth Usually there will be two types of calling scenario as illustrated below Calling via SIP Servers First the Vigor V models of yours will have to register to a SIP Registrar by sending registration messages to validate Then both parties SIP proxies will forward the sequence of messages to caller to establish the session If you both register to the same SIP Registrar then it will be illustrated as below Alice Bob sip alicetdraytel com sip boba draytel com Vigor2130 Series User s Guide 215 Dray Te k The major benefit of this mode is that you don t have to memorize your friend s IP address which might change very frequently if it s dynamic Instead of that you will only have to using dial plan or directly dial your friend s account name if you are with the same SIP Registrar Peer to Peer Before calling you have to know your friend s IP Address The Vigor VoIP Routers will build connection between each other Vigor VoIP Routes Vigor VoIP Router Our Vigor V models firstly apply efficient codecs designed to make the best use of available bandwidth but Vigor V models also equip with automatic QoS assurance QoS Assurance assists to assign high priority to voice traffic via Internet You will always have the required inbound and outbound bandwidth that is prioritized exclusiv
295. will be negotiated with the peer party before each session and so may not be your default choice The default codec is G 729A B it occupies little bandwidth while maintaining good voice quality Prefer Codec G 711A BdkKbps G71IMU 64Kbps G 7294 8 Kbps G 723 6 4kbps If your upstream speed is only 64Kbps do not use G 711 codec It is better for you to have at least 256Kbps upstream if you would like to use G 711 Single Codec If the box is checked only the selected Codec will be applied Packet Size The amount of data contained in a single packet The default value is 20 ms which means the data packet will contain 20 ms voice information Packet Size Voice Active Detection This function can detect if the voice on both sides is active or not If not the router will do something to save the bandwidth for other using Click On to invoke this function click off to close the function voice Active Detector Default SIP Account You can set SIP accounts up to six groups on SIP Account page Use the drop down list to choose one of the profile names for the accounts as the default one for this phone setting Play dial tone only when account registered Check this box to invoke the function After finished the above configuration click OK to save the settings and exit this page Vigor2130 Series User s Guide 229 Dray Te k In addition you can press the Advanced button to configure volume gain MISC an
296. with WAN VLAN ID 85 Dray Tek VoIP IPTV Management WAN Setting VoIP IPTV Management WAN is the interface specified for the usage of VoIP IPTV Management Based on the connection type selected you need to specify different settings When Static IP is selected as connection type you need to configure the following settings WAN gt gt VoIP WAN VoIP WAN Connection Type Static IP Settings IP Address subnet Mask Gateway IP Address Primary DNS Server secondary DNS Server Mail SMS Alert Available settings are explained as follows Item Description Static IP Settings IP Address Type the IP address obtained from ISP for the usage of VoIP Subnet Mask Type the Subnet mask obtained from ISP for the usage of VoIP Gateway IP Address Type the gateway IP address obtained from ISP for the usage of VoIP Primary DNS Server Type the IP address of primary DNS server obtained from ISP for the usage of VoIP Secondary DNS Server Type the IP address of secondary DNS server obtained from ISP for the usage of VoIP Mail SMS Alert Alert Types Specify the type of the alert mail SMS or Mail and SMS that Vigor system will use to send a message to the user None w Mail SM5 Mail and Sits Event types Specify the event when the system must send a notification to the user by mail and or SMS When DHCP is selected as connection type you need to configure the following settings
297. wn Vigor2130 Series User s Guide 117 Dray Te k Click OK to save the settings Dray Tek 118 Vigor2130 Series User s Guide 4 4 3 Access Control List This page can define which kind of packet can access the router The packet can be defined with input port Frame type Rate MAC type VLAN ID tag and etc For IPv4 we can also define the protocol type source IP and destination IP Firewall gt gt Access Control List Access Control List Configuration Auto reftesh CI Status Ingress Port Frame Type Action Rate Limiter Counter Note This hardware based feature is available for wired connection only Adding a New Access Control Profile Click to add a new specific session limitation onto the list Firewall gt gt Access Control List ACE Configuration Ingress Port Action Frame Type IPv4 Rate Limiter IP Parameters IP Protecal Filter source IP Any v Dest IP Any b OK Available settings are explained as follows Item Description ACE Configuration Ingress Port define which port the packet coming from The policy IDs are defined in Firewall gt gt Port Configuration Each Policy ID might have more than one port grouped Ingress Port Frame Type Frame Type Such option differs according to the Vigor2130 Series User s Guide 119 Dray Tek selection you choose we will explain it in detailed later Ingress Port Frame Type Action it mea
298. y Tek 1 l High Speed Gigabit Router System Status Auto Logout Auto refresh O Refresh Quick Start Wizard Model Vigor2130Vn Online Status Firmware Version v1 5 2_RC3 gt WAN Build Date Time Fri Mar 23 19 58 16 CST 2012 gt LAN System Date Thu Mar 29 05 06 52 2012 gt NAT System Uptime Odays 01 48 41 gt Firewall gt CSM System WAN gt ee f Bandwidth Management CU Usao 250 ge ee Memory Usage 32412K 62784 K 51 62 ERE Z gt VPN and Remote Access MAC Address 00 50 7F C9 59 79 gt Certificate Management Cached Memory 11436 K 62784 K IP Address 172 16 3 103 gt Wireless LAN IP Mask 255 255 0 0 gt USB Application LAN IPv6 Address fe80 250 7fff fec9 5979 64 Link goer MAC Address 00 50 7F C9 59 78 es ragga rik IP Address 192 168 1 1 sak Aa a aii gt Sust Maint IP Mask 255 255 255 0 a a IPv6 Address fe80 250 7fff fec9 5978 64 Link Diagnostics DHCP Server Yes Application Note FAQ Port Profile Reg In Out Product Registration Phonel No 0 0 Phone2 No 0 0 All Rights Reserved W 4 1 WAN Quick Start Wizard offers user an easy method to quick setup the connection mode for the router Moreover if you want to adjust more settings for different WAN modes please go to Internet Access group Basics of Internet Protocol IP Network IP means Internet Protocol Every device in an IP based Network includi
299. y Tek 80 Vigor2130 Series User s Guide 56K Modem If your router connects to a 56K modem and you want to access Internet via 56K modem choose 56K Modem as connection type and type the required information in this web page WAN gt gt Internet Access WAN IP Configuration Enable Connection Type 56K Modem WAN IP Alias 56K Modem Settings Phone Number PPP Username PPP Password WAN Connection Detection Mode ARP a Clone MAC Address Enable F Mail SMS Alert Event types WAN UPC wan Down C Available settings are explained as follows Item Description 56K Modem Settings Phone Number Type the phone number offered by the ISP for dial out connection PPP Username Type the PPP username optional PPP Password Type the PPP password optional WAN Connection Mode Such function allows you to verify whether network Detection connection is alive or not through ARP Detect or Ping Detect Choose ARP Detect or Ping Detect for the system to execute for WAN detection Ping IP If you choose Ping Detect as detection mode you have to type IP address in this field for pinging Clone MAC Address Enable Enable the feature It is available when the box of Enable is checked Click Clone MAC Address The result will be displayed in the field of MAC Address Enable Clone MAC Address MAC Address 00 0E 46 24 D5 A1 Vigor2130 Series User s Guide 81 Dray Te k Mail SMS Alert Alert Types Specify the type o

Draytek Vigor2130

Contents

Download Pdf Manuals

Related Search

Related Contents