Home

Sony DCR-PC5 Camcorder User Manual

1. SD Card Application Setting Setting SD Card Storage Format Selection FTP a O MJPEG Format gt SMTP Max MJPEG Numbers Each JPEG Per Second Language Record AVI Format Audio Setting Enable Record Recording Rate 1 25F 1S P Schedule g Alarm AVI Duration 10 Second s Enable Alarm Motion Detection C Enable SD Card Rewrite SD Card Capacity 58 98 MB SD Card Usage 396 Storage Disk Format SD Format t lt a Ea bere camera 2 You have an option as to which SD card storage format to use the MJPEG or the AVI Click your selected format and click Submit to set it 3 Ifits MJPEG you want fill in the Max MJPEG Numbers entry 4 If AVI is your choice enter its recording rate and duration in seconds and click Submit for their setting Description of function keys MJPEG Format One image per file Max MJPEG Numbers Sets the number of file sequences you can save per second AVI Format audio setting Unlike a single image file this option offers a selected section of a video record Recording Rate Sets your chosen frame rate of frames per second AVI Duration Predetermines the length of each video file in terms of seconds Enable SD Card Rewrite Tick to activate the SD card rewrite function SD Card Capacity The free capacity of the SD card SD Card Usage The percentage of the recorded file on the SD card SD Format Click and press the Yes button to format the
2. 1 Click the title of the camera that was connected 2 Click the right mouse button of the mouse on the live view area then click left to select a camera from the list The video from the new camera will be displayed 3 In the Live View area if you want to change delete the videos of cameras or use the snapshot full screen function you can click the right mouse button again on the live view area then click left to select NOTE When there is a detection of external devices such as a sensor it will display a red color bar on the title displaying area and start to make an alarm sound to warn the user NOTE How to set the preset position Choose a preset position number and then use the Tilt and Pan direction keys to find the camera angle you want Now click the Preset button to save your position You can similarly set other preset positions please note by first changing the position number Now click the Auto Scan button to view preset positions 1 to 8 automatically 70 5 2 4 3 PC Playback i gt Tt S Al cameral ZDEIOAIZ8 LL 13 2 Camera 2008 04 25 11 1508 20 Cam JOORIS 16 53 58 0 Camere AOR 15 05 91 CO Espat Get Expat Bei D gt 92 168 0 140 2008 04 25 15 17 7746 1 Click to choose the recording list by channel Click to choose the recording list by time search O Enter the MONTH DAY YEAR HOUR MINUTE you wish to search and click the button to proceed NOTE The recorded video
3. 18 NOTE When connecting to a network each connected IP Camera must be assigned a unique IP which must be in the same class type as your network address IP addresses are written as four sets of numbers separated by periods for example 192 168 1 1 Therefore if the connected network is identified as Class C for example the first three sets of numbers of the IP Camera s IP address must be the same as the network address If the connected network is identified as Class B the first two sets of numbers of the IP Camera s IP address must be the same as the network address If you have any questions regarding these settings please consult a qualified MIS professional or your ISP 19 4 3 TCP IP Communication Software Follow the procedure below to install the TCP IP communication program in your computer Click the Start menu from your computer and point to the Settings Control Panel Favorites A Documents m yis Settings I Control Panel Lal Printers b A Taskbar amp Start Menu ET Eolder Options 2 Active Desktop By windows Update Eile Edt View Go Favorites Back Forward Up Unda Delete Fropertie Power Printers Regional Management Settings Passwords Telephony Users Wb Client e D object s selected Configures netwe E Mu Computer F 20 Click the Configuration tag and check if the TCP IP is included among the network components list If the TCP IP is i
4. 2 2 ALARM I O 1 amp 2 3 amp 4 5 amp 6 10 11 12 1 ALM OUT A 7 RS 485 D 2 ALM OUT BR 8 RS 485 D 3 ALM IN 9 DC OUT 5V 4 ALM IN 10 GND 5 ALM RST 11 AUDIO IN 6 ALM RST 12 AUDIO OUT ALARM OUT OUTPUT This is an alarm output trigger Connect this to external 5V 20mA devices such as buzzers or lights OV Active ALARM IN INPUT This is an alarm input that can be programmed in the menu z 5V 20mA system to active low tr Ov Active ALARM RESET INPUT This pin connects to an alarm clear device for clearing an 1 DV 20mA alarm OV Active RS 485 D RS 485 D DC OUT 5V GND Ground contact AUDIO IN AUDIO OUT This provides the unit s audio signal to a speaker 2 3 Flank Panel 4 ALM OUT A 7 RS 485 D 1 AES 2 ALM OUT BR 8 RS 485 D 3 ALM IN 9 DC OUT 5V 2 ocirs fs 4 ALM IN 10 GND 3 DHCP 2 5 ALM RST 11 AUDIO IN 6 ALM RST 12 AUDIO OUT E 1 IRIS Auto iris connector This camera works with a DC drive auto iris lens Please refer to the pin assignment marked on the camera when connecting the auto iris lens 2 DIP Switch 1 AES Auto electric shutter 2 DC IRIS Use an auto iris DC drive 3 DHCP Turn On Turn Off to use the DHCP protocol If the switch points upwards the device can change the setup of network function enable disable via the network 4 STATIC IP If the switch points down th
5. MJPEG mode Scroll to choose the image resolution from 352 240 720 240 or 720 480 NTSC 352 288 720 288 or 720 576 PAL H 264 mode Scroll to choose the image resolution from Full D1 Half D1 or CIF Quality Scroll to choose the image quality out of a spectrum of qualities ranging from Highest High Medium and Low to Lowest In H 264 mode you can also set the quality by typing in the value The custom quality value must be in the range between 64 Kbps to 8192 Kbps Viewer type Click to choose the viewer type of the ActiveX or AJAX mode Submit Click to submit the new image setting to the IP Camera Frame rate Click the drop down list to choose the frame rates of SFPS 15FPS 24FPS or 25FPS Fine Tune mode White Balance Scroll to choose the mode from Auto Fluorescent 3200K Indoor 4200K Outdoor 6500K Push Hold Flickerless Mark the Flickerless ON or OFF Click your choices to enable Mirror Mark the Mirror High Speed Shutter Mark the High Speed Shutter ON or OFF Click your choices to ONT or OFF Click your choices to enable enable BLC Mode Scroll to choose from Disable Weighted or Fixed Gain Backlight Select in the backlight level in the blank 0 to 255 Brightness Select your desired qualit
6. SD Card O E ja From 00 00 To 00 00 O Sunda From o00 00 To 00 00 SMTP E B Sunday From 00 00 To no 00 Language Fl E Sunday From 00 W lt TorO0 di Record O Bos From 00 00 To 00 00 Enable Record laz Kat 11 21314 TRETE RALE TETEE Alarm 0 00 00 009 Enable Alarm Motion Detection Remove All Schedules Image Network System Application op Cd 1 Pan Tilt NetworkCam 2 Check uncheck any all of the first seven boxes set vertically in the upper half of the Schedule page to enable disable the programmed recording function and vary the setting of the targeted item while it is enabled 3 Click the Submit button to submit the new schedule setting 4 Click the Remove All Schedules button to clear out all the data of the schedule setting Description of function keys Schedule Check uncheck the first seven boxes in a vertical row on the left to enable disable the programmed scheduled recording function if necessary Vary any of the schedules of the recording setting if necessary please refer to the above description Chart Schedule list Submit Click to submit the new setting to the IP Camera Remove All Schedules Click to clear out all the data of the schedule setting 56 kel Change the Application Setting Alarm Application Enable Setting Please follow the steps below to change the setting via the network if necessary 1 Click the Enable Alarm
7. 2000 01 04 23 11 10 LOCAL IP ADDRESS IS 192 168 0 43 7 8 RS485 Setting Update 2000 01 04 23 09 15 FTP CLIENT SERVICE SHUTDOWN 9 2000 01 04 23 09 15 DNS SERVICE SHUTDOWN 10 2000 01 04 23 09 15 SNTP SERVICE SHUTDOWN 11 2000 01 04 23 09 15 SMTP SERVICE SHUTDOWN 12 2000 01 04 23 09 15 DHCP CLIENT SERVICE SHUTDOWN 13 2000 01 04 23 09 15 ARP SERVICE SHUTDOWN 14 2000 01 04 23 09 15 LOAD 161 FILE S TO FLASH FILE SYSTEM 15 2000 01 04 23 09 15 IMAGE MODE IS JPEG 16 2000 01 04 23 09 15 SYSTEM BOOTING 17 2000 01 04 23 09 05 admin FROM 192 168 0 91 SET IMAGE MODE TO JPEG 18 2000 01 04 23 05 07 admin LOGIN OK FROM 192 168 0 91 19 2000 01 04 23 05 06 DHCP CLIENT CONNECTION FAILED 20 2000 01 04 23 05 06 LOCAL IP ADDRESS IS 192 168 0 43 First Page Next 20 l Gv Image Network System Application 2000 01 04 23 09 15 SYSTEM ETHERNET RE CONNECT camera 2 Choose one of the three buttons shown on the page to view an event when necessary The three buttons are titled First Page Previous 20 and Next 20 Description of function keys First Page Displays the first page Previous 20 Displays the previous 20 pages Next 20 Displays the next 20 pages 50 5 1 5 Change the Application Setting Please follow the steps below to change the application setting through the network if necessary e Change the Application Setting FTP Application Setting Please follow the steps below to c
8. 25 5 1 MICROSOFT INTERNET EXPLORER sssseseseseesesensnnnnnnrsnnnnnonrnrnenrnrnrrrnrnne 26 Dek Connecting the IP Canierd eener 26 e EE Hams e EC 28 5 1 3 Change Eer 32 SE Changethe E Ee E 43 5 1 5 Change the Application EE 51 3 1 6 Change the SD eer een 59 Sls Change the Pan Hilt Settini EE 60 SS PPPOE K DIN ssi ahah E Eege 61 5 2 THE IP CAMERA CMS CENTRAL MANAGEMENT SYSTEM 00000008 63 S25 Ite duction 10 te E 63 5222 Install tne CES im your PG eek cs Seier vl aedeagal aos Seefe ege 64 3 2 3 Login the Eege 65 J24 Operaio eer 67 6 ADVANCED OPERATION cccccccsseeeeeeeeeeeseeeeneeeeeseeseaneeseeneesenessaaes 80 Po OPEGCIFIG ATION Sie sesaias act cece tate a A a E a ER OERE 84 8 FUNCTIONS of chent Eeer ee 85 APPENDIX EN EE ane dee ates ec 86 APPENDIX 2 IP Camera UPnP How 10 seccceeeeseeeeeeneeeseeneeeseenneees 88 APPENDIX 3 The ARP function NEE 98 APPENDIX 4 Register as a DDNS member cccccesseeeeeeseeeeeeeeees 100 APPENDIX S FAQ ee Ee 104 SAFETY PRECAUTIONS All the following safety and operational instructions to prevent harm or injury to the operator s or other persons should be read carefully before the unit is activated WARNING To prevent fire or shock hazard avoid exposing this unit to rain or moisture Do not block ventilation openings Do not place anything on top of the unit that might spill or fall into it Do not attempt to service this unit yourself as op
9. Click to open the Modify User Group window 2 Enter the information of the Group Name and Description then select the Authority 3 Set the member list from the available user list 4 Now press Modify EH Delete User Group 1 Select a group from the group list 2 Now press Yes Group Information Provides the selected user s information of Group Name Description and Member 3 Custom Click the KASEEGSH icon to enter the Custom setting page PUser Interface Seth SA Ui rt User Interface Settings Image Settings Language Aspect Ratio English English AUTO Date Format 2007 02 25 YYYY MM DD Sequence Settings Font q 9 Time Interval EY v Seconds Path Settings Folder for Snapshot Images D My Pictures Folder for Export AVI Clips C Documents and Settings cloudy My User Interface Settings 1 Language Select a language from the drop down list 2 Date Format Select the date format from the drop down list 3 Font Click L to select the font Path Settings 75 gt 1 Folder for Snapshot Images Click to select 2 Folder for Export AVI Clips Click d to select the path to save the AVI files Image Settings Select the aspect ratio NOTE The STRETCH status Images are resized to full screen status The aspect ratio status When you resize images they will retain their natural proportions
10. You can just click the right button of the mouse on the functioning schedule bar in orange color to cancel it 3 To enlarge the display size of the working area please click the left button of the mouse on the numeral bar oo lo h2 jos on the other hand please click the right button to narrow it Note The largest column length is 4 times the default size of the working area 3 The schedule bar 1 Click and drag the left and right edges of the schedule bar to adjust the starting and ending time of the schedule Note For the exact schedule period setting please set the day and time in the setting area directly 2 Click and drag the middle of the schedule bar to move it The moved bar is in the same length but the starting and ending times are changed 4 Save Apply the changes Undo Undo the latest changes Clear All Clear all the schedule markers in the current editing area 7 Logger Click the icon to enter the Logger listing page Example 2008 05 13 13 31 33 INFO SYSTEM Login OK user admin 2008 05 13 13 34 31 INFO SYSTEM Add device 192 168 0 145 OK 2008 05 13 13 35 54 ERROR SYSTEM Network login failed Host 192 168 0 29 2008 05 13 13 36 30 INFO SYSTEM Add device 192 168 0 21 OK 2008 05 13 14 09 13 WARN LIVE_VIEW Please select a live view group node from the list 8 Alarm List Click the E MEEUSE icon to enter the Alarm listing page Example Record Recycle Bin 2008 4 25 02 06
11. t interrupt the process while the unit is updating itself Note Please make sure that the UPDATE BIN file is fit in with the model of the unit Updating with the wrong UPDATE BIN file may cause any physical damage to the device Note The Temporary Internet Files or cache folder contains Web page content that is stored on your hard disk for quick viewing We suggest deleting the Temporary Internet Files immediately after updating the firmware To delete the files in the Temporary Internet Files folder follow these steps gE 2 3 Quit Internet Explorer and quit any instances of Windows Explorer Click Start click Control Panel and then double click Internet Options On the General tab click Delete Files under Temporary Internet Files In the Delete Files dialog box click to select the Delete all offline content check box and then click OK Click OK 49 View the Event Logs Please follow the steps below to view events through the network if necessary 1 Click the Events button on the upper left above to enter the Event Log page Event Log Date and Time Item Date and Time Events l GE 1 2000 01 05 00 05 18 admin LOGIN OK FROM 192 168 0 91 2000 01 04 23 50 34 admin LOGIN OK FROM 192 168 0 91 Users 2000 01 04 23 28 10 admin LOGIN OK FROM 192 168 0 91 Digital 1 0 2000 01 04 23 11 12 admin LOGIN OK FROM 192 168 0 91 2000 01 04 23 11 10 DHCP CLIENT CONNECTION FAILED 3 4 Audio Mechanism me 6
12. 1 AUTO The JPEG compression mode comes with the STRETCH status The MPEG 4 and STRETCH This status enables images in the MJPEG MPEG4 and H264 modes to expand to the full screen 3 to remain in the aspect ratio status Sequence Settings Save Apply the changes Undo Undo the latest changes the H264 compression modes have the aspect ratio status 2 FORCE TURN ON This status enables images in the MJPEG MPEG4 and H264 modes Set the time duration 30 60 120 180 or 300 seconds from the drop down list Restore Default Recover to default setting 4 Alarm Handler Click the REEOOSESSEO icon to enter the Alarm Handler setting page Sound Settings Enable Alert Sound sound alarmring wav ke Record Settings Enable Record Duration v Seconds C Enable PreAlarm SMTP Settings Enable Send Mail Mail Server Recipients Username Password Test Mail Sound Settings 1 Tick mark the blank space to activate it 2 To vary the sound file click cil to change it Record Settings 1 Tick mark the blank space to activate it 2 Select the duration from the drop down list 3 Checkmark PreAlarm to activate the pre alarm function SMTP Settings 1 Tick mark the blank space to activate it Mail Server Enter the mail server name Recipients Enter the recipient s e mail address 2 Set the SMTP and the E mail address to mail the user when the ala
13. 235 235 252 0 255 255 252 0 235 235 252 0 255 255 252 0 235 239 292 0 255 255 252 0 4 Do you want to manually set the IP If you want to manually set the IP of the device please select the desired device from the Device Type then click the The software will provide the Free IP Address boxes on the right side of the window 86 Set IP button Internet Protocol TCP IP Settings Device Free IP Address Type IPCAM Title IPCAM MAC 00 0C 0C 00 7C 9A Internet Protocol TCP IP IP Address Subnet Mask 2 ee D Login lil Select and double click any of the addresses in the Free IP Address box on the right to enter it into an IP Address on the left iv To change any IP address type in the new address in the Free IP Address box on the right as well as the device s login Account and Password in their respective blanks at bottom left then click Submit and the new address will automatically be sent to the device V Click Exit at bottom right to shut the device 5 Link to the homepage of the selected device Si Select the desired device from the Device Type then click the Soe ae button to connect to the homepage of the device 87 APPENDIX 2 IP Camera UPnP How To The most troublesome issue when you setup an IP cance is that you have no idea what the IP address of this device is Now IP Gamera supports the UPnP Universal Plug and Play protocol whic
14. Enter the Account and the Password which are provided from your ISP 5 Click the Submit button to submit the setting NOTE Please refer to section 5 1 8 for more details lt gt Use the Sub Hostname to view the IP Camera 1 Click the URL block at the top of the PC screen 2 Type in the DDNS Host Name of the IP Camera into the URL block and press the Enter button to enter the login page 3 Enter the user name and fill in the password 4 Click the OK button and enter the home page of the IP Camera Question 4 How to set the scheduled record on from say 6 00 PM to 7 00 PM with the recording rate of 1F 8S and upload the recorded file to the FTP server Set the scheduled recording time 1 Click the Application button in the home page 2 Click the Schedule button on the left side of the page to enter the RECORD SCHEDULE page 3 Select one of the schedules and set the recording time period 4 Tick the schedule on to activate it For example if you want to set the schedule record on from 6 00 PM to 7 00 PM please choose FROM 18 00 to 19 00 on the drop down list Then tick on the schedule which you just set 5 Click the Submit button to submit the setting lt gt Upload the recorded file via the FTP 1 Click the Application button in the home page 2 Click the Enable button on the left side of the page to enter the RECORD APPLICATION ENABLE SETTING page 3 Tick on Enable RECORD
15. Paa a ae a o i Tiii mage Aceguitition PTA Aprea iTar Arek Marmer frirum Figure19 Step 7 Choose Automatic in the Startup type press the Start button and click OK to start it See Figure20 Universal Plug and Play Device Host Properties Local Comp KAN Geneval Log On Recovery Dependencies Service name ugnphost Display name Universal Plug and Play Device Host Description Provides supportto aost Universal Plug and Play devices Path to executable CAWINDOWS System32 svchost exe k _ocalService Slarlup type Silo Re Astomatic a Disabled Service status ren C san J Pause Resume You can specify the start parameters that apply when you start the service frorr here Start parameters Lag em Figure20 Step 8 Restart your system 96 4 Scan IP Cameras through My Network Place After your installation and starting services the UPnP protocol will take effect You can scan all IP Cameras in My Network Place like Figure21 and Figure22 below 2 My Documents WA amp My Network Plates My Computer Figure21 1 Figure22 Just double click the UPnP IP Camera icon and the video live stream will pop up automatically without assigning any IP address in Microsoft Internet Explorer 97 APPENDIX 3 The ARP function Setting the IP Address The Ethernet interface on the IP Camera has a default IP address 192 168 1 16
16. Password and selecting the share device function or the permissions function please click the Add button to establish the connection between the device and the computer 4 Click the device title to begin viewing images with this camera from the device list NOTE To add more connections or units to the IP Camera please repeat the above instructions Add Device Device Auto Search IP Address HTTP Port 192 168 0 98 80 Device Title IP camera Username admin Password sok Share Device To Permissions None d Test Connection ul Di a LL S i Cancel NOTE Please click the Test Connection icon to test the connecting situation and preview the video of the IP Camera 66 5 2 4 Operation 5 2 4 1 Device Management Once the connection has been established click the Si button to enter the Device Management window see the sample screen below On the left side of the window is the connected device that has been arranged when you established the connection Q A Add device Add a new device For more details please refer to section 5 2 3 Modify device E Modify the added device Please select a device then click this button to edit the device Delete device Delete the added device Device Setting left side and click the setting button to enter the setting pages of the device List of devices 2 The us
17. Peer 0 0 MB 0 0 MB 0 0 MB 0 2 MB Description Displays icons in My Network Places for UPnP devices detected on the network Also opens the required Windows Firewall ports Total disk space required 56 3 MB Space available on disk 24044 0 MB Figure 11 Step 5 When the original Network Component Wizard dialog box returns click Next See Figure12 Windows Components Wizard Windows Components You Can add orramove components of indies HF To add orremowe a component click the checkbox A shaded box means thot anky past of tz Camppppg will Du inaani To cine whats incuchod Ip e component cick Dtetle Components O SF Message Queuing OMB e CM Explorar 20 7 MB be s akupeg Sorc m a Other Network File and Fring Sernaces DOUM O fl Gutlook Exoress DOM Descnpton Corteing avarie of specialised networerelaied senices and protocols Total TEK Je E DAME Cetaila Space available on disk 4043 0 M I i lt Bock ve DL Cancel Figure 12 92 Step 6 After about one minute the UPnP installation will be done and choose Finish to close it See Figure13 Windows Components Wizard Completing the Windows Components Wizard Cou haan siais comploted thie Windas Components Wizard Tu duse Wiis anced tick First E gt Figure 13 3 Turn on Services After installation we should turn on the relative services to start the UPnP protocol The following procedures will teach you how to do
18. U 1 28 5 Click the H 264 Image button to enter the H 264 image setting page Adjust the image setting including Resolution Quality and Frame Rate if necessary H264 Image Pesca thew Allo Mah SZT Olima kbps Frane Rate 25 ma S U 6 Click the Submit button to submit the new image setting 7 Click the Fine Tune button to enter the Image Fine Tune page to set the details of the device including White Balance Flickerless Mirror High Speed Shutter BLC Mode Backlight Brightness Contrast Saturation Sharpness and videoalc Click the Default button to reset all the settings NOTE The revised image will appear immediately after any change in made Image Fine Ture W s Balance Auto m Faka GO OOF bira Oh cre Ba Pt O ON GOFF BLE Modei Diable Badk Fi e255 enghiress Ilan to 255 Contrast c Les Saturation lt jiza Eoss hur prec DIE Gho 255 akok eliza oss Reset All Image Parameters NOTE The videoalc function only activates in connecting the auto iris lens DC IRIS Please refer to the pin assignment marked on the camera when connecting the auto iris lens 29 8 Click the Privacy Mask button to enter the Privacy Mask page a Privacy Math imate 3 privacy area Glock a CkKk the night mouse button oni De vache Contin bo stew Ute popmenu
19. UPPER LEFT UPPER RIGHT BOTTOM LEFT BOTTOM RIGHT ANALOG UPPER LEFT ANALOG UPPER RIGHT ANALOG BOTTOM LEFT and ANALOG BOTTOM RIGHT Timestamp Format Click to open the list of six format modes to choose from YY MM DD MM DD YY DD MM YY YY MM DD TITLE MM DD YY TITLE and DD MM YY TITLE Submit Click to set 44 Change the System Setting Users Please follow the steps below to change add the users authority through the network if necessary i Click the Users button on the left side of the Date and Time page to enter the Users page Users Date and Time User List _ admin Admin Timestamp Es Digital 1 0 Audio Mechanism RS485 Setting Update Events Add Modify User User Name Password Confirm Authority Admin Operator Viewer Image Network System Application op Card Pan Tilt camera 2 Add modify or delete any user s data if necessary 3 Click the Submit button to submit the new user s settings 4 Click the Home button to return to the home page Description of function keys User List The list shows the registered user s and the corresponding authority Delete Deletes a selected user Name Enter the user s name which will be added or modified Password Enter the new password of the user s name above Confirm Type in the password again for verification Authorit
20. automatically Follow the on screen instructions to proceed with the rest of the installation procedure as they appear NOTE The program will update the NET Framework to version 2 0 automatically Please click Next to start and finish the setup process iy Microsoft NET Framework 2 0 Setup Welcoore to Microsodt MET Framework 2 0 Setup This witard will quake yau Hero the rrekallation process 3 Select a language of the installing process from the drop down list in the Installer Language window 4 After the installation is complete pop up the START menu from your computer and point to Programs APPRO CMS APPRO CMS to open up the program selection page as shown below Click the APPRO CMS tag to start the CMS program Install the CMS for the ZIP file 1 Save the ZIP file to your PC and extract the file to a designated directory 2 Open the extracted folder The folder contains 1 file 3 Click the setup icon to execute the installation and then follow the on screen instructions to proceed with the rest of the installation procedure 4 After the installation is complete click the START menu from your computer and point to Programs APPRO CMS to start the CMS program NOTE Please make sure the TCP IP communication software has been properly set and configured in your computer To check your TCP IP settings please refer to section 4 5 the TCP IP configuration setting 64 5 2 3 Login the IP Camera
21. by a selected PC equipped with the following requirements System Requirements Intel Pentium 1 5 GHz processor or above 2 8 GHz or higher recommended 128 MB RAM at least 256 MB or higher recommended Windows 2000 XP or above 4 MB VGA card capable of 24 bit true color display 100 MB free hard disk space for software installation 10 100 Base TX network for LAN operation The Microsoft Internet Explorer 6 In the multi channel recording mode the HD data transfer rates must be 66MB or above 100MB or higher recommended 5 2 1 Introduction to the CMS The CMS allows you to access many units of the IP Camera from a remote desktop or a laptop in a TCP IP networking environment It can perform the following functions Views live images in a smooth sequential flow from an IP camera S Stores searches and reviews recorded video from a PC or an SD card quickly E Changes manual record event record and schedule record settings easily Before you are ready to view images from a desktop you need to have your IP Camera networked by obtaining a 10 100 base TX Ethernet data cable Standard RJ 45 to connect the IP Camera to your LAN WAN Now enter the main menu to set the IP address 63 5 2 2 Install the CMS in your PC Install the CMS from the supported CD R 1 Exit all applications currently running in the selected PC 2 Insert the supported CD in the CD ROM drive The program will execute the installation
22. choose 30 seconds Click the Submit button to submit the setting lt Use IE to view the recorded files de 2 3 Click the SD Card button in the home page to enter the page containing the FILELIST of MEMORY CARD Click the filename which you want to view It will ask you to enter the username and password 4 If you didn t set the other player before the AVI file will be played by the Windows Media Player Question 3 How to use the DynDNS to connect the IP Camera by using its Sub Hostname via the intranet lt gt Set the DDNS function 1 2 Click the DDNS button on the left side of the page to enter the DDNS SETTING page 3 4 Click the Network button in the home page Tick on the Enable DDNS Function to activate it Choose one of the DDNS Types from the drop down list If you didn t register for a DDNS before please choose one of the DDNS Type then press Apply button to its registering homepage and register as a member Enter the DDNS Host Name DDNS Account and DDNS Password which you created in the www dyndns com website Click the Submit button to submit the setting NOTE Please refer to the APPENDIX 4 for more details lt Set the PPPoE function 1 Click the network button in the home page 81 2 Click the PPPoE button on the left side of the page to enter the PPPoE SETTING page 3 Choose ON from the PPPoE mode list to activate it 4
23. if necessary 12 Power ON the IP Camera and it will work normally if the entire update procedure goes correctly 13 Verify the version of the system software WARNING 1 Don t use FAT32 or NTFS or other file formats in step 1 2 Steps 1 to 3 have to be done on a PC 3 Make sure the file of UPDATE BIN is a correct one in step 3 or the IP Camera will not work normally after being updated 4 Ifthe power of the IP Camera is suddenly lost in step 8 please remove the SD card first and turn on the IP Camera next to test its operation If the IP Camera remains working normally please go back to step 4 otherwise please inform your technical support 5 In step 10 if the SD card is not removed and the IP Camera does not get online as well the updating process must be repeated again after rebooting the IP Camera 6 Make sure that the SD card is inserted in a correct position in step 5 or the IP Camera will suffer permanent physical damage 7 If the message CSUM ERROR appears in step 8 it implies a problem in the file of UPDATE BIN 8 Don t interrupt the process while the unit is updating itself proceed with an SD card not including any system software of the unit or else the unit will crash 14 3 5 IP Camera SD card Troubleshooting 1 Check if the SD card position is correct or not Please refer to the manual for the related information 2 After powering the IP Camera on correctly insert the SD card and a little
24. including HTTP API ActiveX control Customized Web page tool E Power over Ethernet EEE 802 af Power DC 12V E AC 24V Miscellaneous CD x1 Quick installation manual x 1 Accessories Camera bracket x 1 Power adapter x 1 USB connection line x 1 Specifications are subject to change without notice 84 8 Functions of client PC System requirement Windows 2000 XP or above Browser IE 6 x Live Monitor Max 16 Split Real Time REC Capture Audio Live Event Full Screen Playback Viewer Playback Time live event Search Export JPEG AVI Settings Device System Camera management web page Multi camera link Max 16 camera 85 APPENDIX 1 SCANIP Follow the instructions below to use the SCANIP software to search the IP camera devices from a local location 1 Click the Feiech button to discover the connection of the all type device in the LAN The Device Type will display the connection of the all type device 2 Select the desired device from the Device Type 3 Click the desired device to show the window while the IP camera information acts to display the desired changes instantly File Tool Option Help L Set IP is Refresh Device Type BUnknown 2247 H264_IPCAM MIN Ip PIZ H264_IPCAM IPCAM 4CH SERVER IPCAM H264_IPCAM H264_IPCAM H264_IPCAM H264_IPCAM H264_IPCAM H264_IPCAM H264_IPCAM DYR 3021D H264_IPCAM Home Page ipcam ipcam ipcam ipcam yserver ipcam ipc
25. it Step 1 From the Start menu point to Settings and then click Control Panel See Figure14 amp Set Program Access and Defaults Programs 2 Documents gt E Control Panel Network Connections Printers and Faxes wil Taskbar and Start Menu Search ag Pa wy Help and Support ET Run Windows XP Profesvional Shut Down Figure 14 Step 2 When Control Panel appears double click the Administrative Tools icon The Administrative Tools dialog box appears See Figure15 93 fe ER ve Fovortes Tos Pep O amp Puh KC bier D X Ades D Contra Pane EY PES Name Comments i l A det Opare Adut your computer sengs for von Installs and troubieshoots hardeware Inehall or remove Diorama and Windows Configure administrative settings for your Set up Windows to automatically deliver L Set the date Ome and tne zone for you Dapy Change the appearance of your desktop i fokser Opus Cuttomite the tiv of fies awd folders Add change and manage fonts on your Game Comobers Add remove and configure game contrat Dwterret Options Configure your Internet display and conn Customo your keyboard settings such VW Customine your mouse rette such at Wi Hetwck Correctors Compacts to other computers networks Be Phone and Modem Options Configure your telephone daing rules and View ht portable moda devices commecte Configur
26. list box will show the recorded video which are stored in the HDD of the connected devices by channel or by time control Click to use the playback controlling panel w Click to display the volume control panel Control i Il D E Pause play stop Play Click to stop playing back l the recorded video Pause Click to freeze the image Stop Click to stop playing back the recorded video Slow reverse and forward 1x 2x 4x 8x 16x Gs ZD Speed up rewind forward Fast reverse and forward 1x 2x 4x 8x 16x Cy CT Goto previous next record Click to select the previous next recorded video Gu EZ Step back forward Click to play a recorded video step by step in the reverse forward direction 71 Export set Click to set the export function The function fits the starting and ending points of an image display when Lapon Set the user wants to transfer a file Start Time e ao Start End time Set the start and end time that you want to export ene RE backup the recorded files to the AVI files 2008 6 10 10 22 51 4 Note You also can click to select the recorded file on the recording list above E Fully Export 1 Click to add the whole selected video to the arranged exporting list __Add JL Click to add the selected part of the recorded video with time setting to the arranged exporting list Reset L Click to reset the Start End time Export Run Click to start
27. same class type NOTE The IP address of an IP Camera in a network must be unique to itself as opposed to those of the other chosen PCs but in the same class type 22 4 6 Connection Testing With the previous settings follow the instructions below to ensure whether you have established the connection successfully Click Start Programs MS DOS Prompt Accessories d s A Microsoft Access Ss Windows Update Microsoft Binder ZS Microsoft Excel New Office Document 2 Microsoft Outlook Ga DEE Microsoft PowerPoint BY Microsoft Word M MS DOS Prompt A Windows Explorer len Programs Type in ping 192 168 1 168 then enter See the sample screen below This IP is the IP Camera s IP address that is assigned for the connected IP Camera in step2 sia zi ge Alte derosoftiA windows O Cicepyr ight Micrasaft Corp 1941 1999 OWL aCe sping 192 168 1 168 23 If you receive a response as in the sample screen below the connection hasn t been successfully established Please re check all the hardware and software installations by repeating steps 1 to 5 If you still can t establish the connection after rechecking please contact your dealer icrosoftik windows 98 Cocopyright Microsoft Corp 1581 1999 ping 192 188 1189 Type Camera IP address Pinging 192 168 1 168 with 24 bytes of data C WIF D ttan ti n Bost unreachable Destination best
28. socket TX TX RX Not Connected Not Connected RX Not Connected Not Connected 12345678 Gei Ee a Sr d ee Physical specification for Ethernet Wire type Cat 5 Connector type RJ 45 Max cable length 100 m Hub wiring configuration Straight Through or Cross Over PC wiring configuration Straight Through or Cross Over 25 5 1 Microsoft Internet Explorer 5 1 1 Connecting the IP Camera 1 Start up the Microsoft Internet Explorer and then follow the steps below to connect the IP Camera 2 Click the URL block at the top of the window 3 Enter the URL address of the IP Camera into the URL block and press the Enter button to enter the home page 4 Scroll to the bottom of the page with its six icons Image Network System Application SD card and Pan Tilt Whichever you click the page headlined Enter Network Password will appear 5 Type in the User Name and Password in the appropriate spaces 6 Click the OK button to set your entries and automatically exit the page NOTE NOTE NOTE NOTE The default User Name and Password are admin and 9999 respectively The page headlined Enter Network Password is shown below Please enter the user name and password of the IP Camera when you see it If either the user name or the password is incorrect please check the input data and rectify it if necessary Once authorized successfully it will not a
29. to run the export function End Time Export Run Title Range Cameral NTE Cameral From_20080610101900 5 Cameral From_20080610102217 gt Click to run the export function of the selected work on the list i Click to delete the arranged work NOTE To change the folder of saving the exported AVI files please go to the Config setting page Config Custom Path Settings Folder for Export AVI Clips 3 The display area Provides the image capturing function Click the right key of the mouse 4 on display area to show this icon then click left to capture a jpeg file of the video Scroll bar for video searching Drag the square on the bar to search the video You can click or pull the indicator on the scroll bar to the point you want to see 12 5 2 4 4 DVR Remote Playback for DVR devices only DVR Remote Playback Press the s ei button to enter the DVR Remote Playback setting page This setting page is for connecting with the DVR devices OO 2009 2 10 i14 31 07 4 EM o nm ii j Device Management ESA Live View l DC Playback DVR Remote Playback 73 5 2 4 5 Config Press the _ button to enter the Config setting page Central Management System BCC User List User Information f ro f 2 Sr Username Description a amp admin s Use Group ser Group n Alarm List E 4 Device Management E Live View S
30. to submit the new setting of the recording 7 Click the Home button to return to the home page Description of function keys The targeted zone Click and drag the mouse across the targeted zone to draw a red rectangle on the image Detection Range The red rectangle s coordinates Save Click to save the motion detection range Motion Detection This option enables disables the motion detection function Sensitivity Level You can select any one of the given options for the setup signal level or just type in the value of Customized Threshold 58 5 1 6 Change the SD card Setting Please follow the steps below to change the SD card setting through the network if necessary Change the SD card Setting FILELIST of MEMORY CARD Please follow the steps below to change the setting via the network if necessary 1 Click the SD card button at the bottom of the home page to enter the page containing the FILELIST of MEMORY CARD The page comes in two modes the JPEG and the AVI please refer to the SD card Application Setting Page FILELIST of MEMORY CARD FILELIST of MEMORY CARD Filename Date Time Size Filename Date Time size 31VRB2E AVI 2004 02 13 15 50 38 96K SLYRCAQZ TAG DELETE 31VRB3P AVI 9004 02 13 15 51 20 96K SIVRCGRZ TAG 2004 02 13 16 15 22 266 DELETE 31VRBSH AVI 2004 02 13 15 52 16 96K EEN d 31VRB9G AVI 2004 02 13 15 54 24 96K HTIP SESE CSLL 31VRBAM AVI 2004 02 13 15 55 02 96K 31VRBF8 A
31. unreachable Destination host unreachable connection error Destination hest unreachable Ping Statistics for 192 166 1 168 Packets Sent 4 Received D Lost 4 100 loss proximate round trip times in milli seconds Minimum Ons Haxinum Ons Average Des VT NOS If you receive a response as in the sample screen below you have successfully made the connection Ha BA Cep at AUS MicrosoftR windows 98 CC copyright Microsoft Corp 1981 1999 rupp 192 168 1 168 Type Camera IP address Pinging 1927 168 1 168 with 32 bytes af data Reply from 192 168 1 168 bytes 32 time lt loms TTL 124 i j Reply from 192 168 1 168 bytes 32 time lt Lons TTL 128 connection is Realy from 192 105 1165 bytes 32 time lt lons TTL 128 Realy from 192 168 1 168 bytes 32 time lt LOns TTL 12a successful Ping 2tatistics Tor 197 165 1 168 Packets Sent 4 Received 4 Lost 0 Toss Aprox imate round trip times ain mil li seconds Hinimum Ons Haximin es Avtrage Ons NWIRD IA 24 5 Operating Instructions for Image Software and Network Two choices of software are available for linking with the IP Camera 1 the Microsoft Internet Explorer and 2 the IP Camera VIEWER a network browser in a PC which provides the functions of monitoring remote zones or watching recorded data through the TCP IP protocol The details are listed as follows RJ 45 PIN configuration for Ethernet PIN NO PIN Assignment RJ 45
32. 192 168 1 200 with Subnet mask 255 255 255 0 Click OK when you finish it See Figure 6 lnlerAet Protocol TCP IP Properties General vou can gat E settings assigned suiomatcalk d you nebak suppana this capability Cthervise you need bo ask you network administrator forthe Sppropriate iP pst Obiin an iP addrett eulomatcall Wee the tolceing IF addragts IP address Gulni madk Deieuh gaisam ECH Lias the fellcenng OMS fanar acidrenees Pioiaed ONS sarvar Alte mete DWE e gra LDL N Figure 6 Step 6 Choose Close to finish the modification See Figure 7 Local Area Connection Properties General Authenfeeion Advanced Conngcg uang Ea Mivel vean Gar themed 101001 This connection uses the kiyeng Mone Se SB Cieni dor Microsok Hotworks w A Pte and Printer Shaving tor Micnoeoh Networks a Ya memel Proges TOPP Ingtall Prepeartios Descmppre Tranamifeson Crogrol Protocol fete Prateool The diie wade aiga miik pralina thal prasides COMMUN SCHER divaren inenconnecad moahencks Lal Shere vam in poltabrce aea whan conneced Gel Notty mp eben this comme chon hes Imped or no conngciwity ee Figure7 90 2 Install UPnP Packets As described before Microsoft Windows XP doesn t start the UPnP service by default however we have to install some packets before we initialize it The following steps will help you to install them Step1 From the Start menu point to Set Program A
33. 47 Disconnect Record Recycle Bin 2008 4 25 02 16 19 IOAlarm Record Recycle Bin 2008 4 25 02 16 20 Motion Camera03 2008 4 25 02 34 14 IOAlarm Camera03 2008 4 25 02 34 14 Motion 78 5 2 4 5 Tray Press the button to minimize the CMS monitor into the systray of the Windows taskbar CMe Right click the button once to select the functions on the list Ene The Microsoft Windows systray is a portion of the Windows 95 Windows 98 Windows ME Windows NT Windows 2000 and Windows XP Operating Systems that help display running programs The systray is located on the taskbar and is commonly in the bottom right hand corner of the screen next to the time display 79 6 ADVANCED OPERATION Question 1 e Ba How to view the live images of the IP Camera via the Microsoft Internet Explorer on the Desktop PCs or the laptop computers in a situation where there are no monitors or KEE EE SS The way to get the IP address of the IP Camera without a monitor There are three ways to get the IP address Scan IP UPnP and IP function Scan IP Please refer to APPENDIX 1 UPnP Please refer to APPENDIX 2 IP function Please refer to APPENDIX 3 me o wm o wm o ow o wm o wm o wm o wm o mm o mmm o mm o mm o mm o wm o wm o mm o mmm o wm o wm o mm o am o mm o mm o mm o wm o wm o mm o mm o wm o mm o wm o wm o mm o mm o mm o o mm o mmm o mm o e o mmm P e i How to set up the motion detection area and its sensitivity How to
34. 5 Click the Submit button to submit the new setting 6 Click the Home button to return to the home page NOTE Please refer to section 5 1 8 PPPoE amp DDNS for more details Description of function keys PPPoE mode Click your choices to enable the PPPoE function Account Enter it in the given space Password Enter it in the required space Submit Click to set 39 kel Change the Network Setting UPnP The Network page has on its upper left the UPnP icon Please follow the steps below to change the UPnP setting through the network if necessary 1 5 6 Click the UPnP button at upper left above to enter the Universal Plug and Play page Universal Plug and Play Network Enable UPnP ge Max Expired Age 120 Seconds 10 3600 SMTP SSDP Port 1900 ege Default 1900 DDNS UPnP Port 5678 PPPOE C Enable UPnP Memory Card Access e DS IP Filter Traffic Image 1 Network System _ Application _ SD Card _Pan Tilt ipcam Click Enable UPnP to checkmark the attached box and activate the function Type in the UPnP Max Expired Age the SSDP Port and the UPnP Port Click Enable UPnP Memory Card Access to checkmark the attached box and activate the function Click the Submit button to submit the new setting Click the Home button to return to the home page Description of function keys Max Expired Age Enter it in the given space from a rang
35. 8 that most likely needs to be changed to make it work on your local network You need to acquire a unique IP address ask your network administrator For the initial setting of the IP address the IP Camera needs to be connected to the same network segment as your client and the IP address can then be configured by using a combination of ARP and ping command Use any of the following ways to set the IP address within thirty seconds after booting the IP Camera re cycle the power Setting IP using the method below can only be done on the Ethernet interface ARP and ping from Windows or MS DOS The user can open the PC s MS DOS windows from the WINDOWS 98 operation system or open the PC s Command Prompt windows from either the WINDOWS 2000 or the WINDOWS XP operation system 1 Starta DOS prompt window 2 Type the following in 30 seconds after the booting arp s lt IP address gt lt Ethernet address gt or arp s lt IP address gt lt MAC address gt ping lt IP address gt Example arp s 192 168 1 100 00 0C 0C 00 00 01 ping 192 168 1 100 The IP address now is 192 168 1 100 98 ARP and ping from UNIX or GNU Linux 1 Start a shell 2 Type the following as superuser root arp s lt IP address gt lt Ethernet address gt or arp s lt IP address gt lt MAC address gt ping lt IP address gt Example arp s 192 168 1 100 00 0C 0C 00 00 01 ping 192 168 1 100 The device responds to the ping in the exampl
36. A e Press fekt mouse button drag and drop bo set the privacy area Bach privacy aed can be erabe of shed e After you finish af privacy mack zattin chck the night mouse be and seket tre Seve teling on the pop menu 9 Click the Day amp Night button to enter the Day amp Night page Click the drop down list to choose the Day amp Night mode of Auto Day mode Night mode and Schedule Set the values of Focus Adjust and Sensitivity Click the Submit button to submit the new Day amp Night setting 1 Day amp Night Day Might Mode Aut K Pocus Adjust 2minutes Note The Focus Adjust function To achieve ideal sharpness and the best focus every time you reboot the camera it will automatically switch from color mode to B W mode Click the drop down list to set the period of the focus adjustment from 30 seconds 1 minute 2 minutes 3 minutes 5 minutes and 10 minutes or just select disable to deactivate the function 30 10 Click the Home button to return to the home page while the new image setting acts on the images to effect the desired changes instantly If the setting has not been changed by the above steps any re entry onto the home page will find images in their earlier or original setting Description of function keys Device Title Type in the camera title in the given space Resolution
37. INSTALLATION amp OPERATION MANUAL IP CAMERA LC ES PAL A Before trying to connect or operate this product please read this manual completely Table Of Contents SAFETY PRECAUTIONS fice Kaien Ae eee Aka 3 1 PRODUCT FEATURES cccccccccccccecececscecccucucucucucucacacaeacsceaueuenennanananas 4 n W PRODUGT Eug CR Leg e A 12 PRODUCT ECHT EE tee EE Ee AE Ee EA A 2 DESCRIPTION OF THE FRONT REAR VIE NNN 8 2 1 FRONT PANEL AND REAR HANEL 8 DD EE GR EE 9 ZS e PANE RE 10 2A THE USB FUNCTION EE 11 3 INSTALLATION ae NNN 12 3 1 CONNECTING WITH AN NVR ccccececececececececececececuavauacaceees 12 3 2 CONNECTING WITHA DV 12 3 3 CONNECTING WITH A MULTIPLEXER 0 ccc cece ecececececeees 13 3 4 UPDATING SYSTEM SOETWARE aaaannannnnnnnnnnnnnnnnnnnrnnrnnrarrnnnn 13 3 5 IP CAMERA SD CARD IROUBGLESHOOTING 15 4 Network Configuration ccccccssseeeeesseeeeseeeeeeeesneeseesneeeeeneenseasneeseneaes 16 A T CABLE Ten Le EEN 16 Ae eC OMMECE O10 COMDULED EE 16 4 1 2 Connect to a LAN Hub ANTRANET WEE 17 4 2 CONFIGURE YOUR IP CAMERA NETWORK SETTINGS ececececececeeecess 18 A 2 l able DHCP Ee Te EE 18 Der RR e E SS EE 18 4 3 TCP IP COMMUNICATION DOETWARE 20 AA TGP PINS TALIATION EE 21 4 5 TCP IP CONFIGURATION SETTING onnannannannnnnnnnnnnnnnnrnnrnrnnrrnrrnrrnrenrrnrnn 22 1 4 6 CONNECTION TESHINES enee bedeelege 23 5 Operating Instructions for Image Software and Network
38. My Services to enter the service page Please click the Add Host Service item which is below the My Hosts item as shown in Figure 4 Click Add Host Service and its service items will appear The Add Dynamic DNS Host item helps to add a new DDNS Each member may have only one free account and one free account can have only five DDNS Click Add Dynamic DNS Host to enter the DDNS setting page as shown in Figure 5 101 Ke RI D By bccounl Wtkreolg lIniermest iewuree x M a Yes Pei Took Fi F vee hipnin i Dyn Ds DynDNS eis eta are tet tee sk hums Account Summary for abedevice He Sara Arcoure Sattregs ese Mi emu ett Were modify punches sl Uode yos balling Loge vas ema access sep gek daia Pour 26 ege Pirman copia A pretences swi damio pour Pty Cart Puri Ge ee Peo Eiu irea Vi Steer Cat cha La Adii bairt Ec ee hr Boers i Lade Hetory Ei i reem Bees Sere Hate b obees ele reg eege et Ek Segen E beamte Lace Ambuten Si DN g rte Figure 4 a DepnetS dreet bert barron Detling keeft Interne Lepore x he a Yee fei Took Fie Ed T iG herp ifn ere come accu jp het yee hie me Kies n T Lee Een My cc Add New Hostname matern bhy narya mi Abi Ube ski I ge Tow umens dont haw Art Loser CIT tau Garnet ue T o or Hort Sam ah PET concer ER Dsg Scott uppaa That moe Ge tem Sulton and wll Ski aera othe featured Lege More Prema Su
39. P server and set the recipient s e mail address if necessary 4 Click the Submit button to submit the new SMTP setting 5 Click the Home button to return to the home page Description of function keys Account Name amp Password Fill in the account name and password if you check marked the My Server Requires Authentication function SMTP Server Enter the SMTP server DOMAIN NAME in the given blank space Email Address The recipient s e mail address Submit Click to submit the new SMTP setting to the IP Camera 35 Change the Network Setting SNTP Please follow the steps below to change the SNTP setting through the network if necessary 1 Click the SNTP button at upper left above to enter the SNTP Server Setting page SNTP Server Setting Network SNTP Server 192 168 1 6 geg Time Zone GMT 08 Taipei Hong Kong Beijing SMTP CI Automatically Adjust for Daylight Saving DDNS PPPoE UPnP IP Filter Traffic SNTP Date and Time Image 1 Network System _ Application SD Card TU Gong ipcam 2 Enter the IP Address of the SNTP server and choose one of the time zones as and when necessary 3 Click Automatically Adjust for Daylight Saving Time Changes to checkmark the attached box and activate the function 4 Click the Submit button to submit the new SNTP setting 5 Click the Home button to return to the home page Description of function keys SNTP Server Enter the SNTP se
40. PC playback ER Remote Playback NOTE After finishing the settings of each page please click Save to save the parameters 1 User Click the EES icon to enter the User setting page User List User Information E ES ER Username Description Group User List Add User ES 1 Click to open the Add User window 2 Enter the information of the Username Password Confirm Password and Description 3 Select the User Group if necessary 4 Now press Add Modify User 1 Click to open the Add User window 2 Enter the information of the Username Password Confirm Password and Description 3 Select the User Group if necessary 4 Now press Modify ER Delete User 1 Select a user from the user list 2 Now press Yes S 74 User Information Provides the selected user s information of Username Description and Group 2 User Group Click the BEES to enter the User Group setting page User Group List Group Information L EC L Group Name Description Administrators Administrators amp Administrators P Operators A Viewers Member User Group List Add Group User EC 1 Click to open the Add Group User window 2 Enter the information of the Group Name and Description then select the Authority 3 Set the member list from the available user list 4 Now press Add Modify User Group CS 1
41. Please follow the steps below to change the date and time of the system setting through the network if necessary Set the Date and Time of the system 1 Click the System button in the home page to enter the Date And Time page default Aua J3 B52 003 Date and Time Q The Local Time Timestamp Date Time Users The Desired Time Digital 1 0 Set Manually Audio Mechanism Date YYY MM DD RS485 Setting Time HH MM SS Update O Synchronize with Computer Time Events Date Time O Synchronize with SNTP Server SNTP Server 192 165 1 6 Time Zone GMT 08 Taipei Beijing Chongquing Urumqi Hong Kong Perth Singapore Manual Frequency Every Time Format MM DD Image _Network System Application op Card Pan Tilt camera 2 Choose one of the three modes shown on the page to set the Date and Time of the system The three modes are Set Manually Synchronize With Computer Time and Synchronize With SNTP Server 3 Click the Submit button to submit the new Date and Time settings 4 Click the Home button to return to the home page Description of function keys The Local Time Shows the current date and time of the IP Camera Set Manually Manually sets the date and time of the IP Camera Synchronize With Computer Time Synchronizes with the linking computer Synchronize With SNTP Server Synchronizes with the SNTP server In this mode two choices of adjusting ar
42. SD card 52 Change the Application Setting SMTP Application Setting Please follow the steps below to change the SMTP setting via the network if necessary 1 Click the SMTP button on the left side to enter the SMTP Application Setting page SMTP Application Setting Setting SMTP Networking FTP SMTP Server 192 168 1 1 SD Card e Email Address guest localhost Language Record Storage Setting Serena Attatched File 1 1 Schedule Numbers Alarm Enable Alarm Motion Detection n Image __Network 1 System Application sb Card TI Gan NetworkCam 2 Enter the attached file number as and when necessary The maximum number which can be used is 8 3 Click the Submit button to submit the new SMTP setting of the recording 4 Click the Home button to return to the home page Description of function keys File numbers Sets the quantity of images per Email 53 Change the Application Setting Language Setting Please follow the steps below to change the Language setting via the network if necessary 1 Click the Language button on the left side to enter the Language Setting page Language Setting Setting Language English English FTP SD Card SMTP Record Enable Record Schedule Alarm Enable Alarm Motion Detection n Image __Network sten Application op Card 1 Pan Titt NetworkCam 2 You have an option as to which language to use The default is E
43. UPLOAD via FTP 4 Click the Submit button to submit the setting 82 Bet the upload rate 1 Click the Application button 2 Click the FTP button on the left side of the page to enter the FTP APPLICATION SETTING page 3 Set the last item Upload Rate at the bottom of the page to the rate you want If you want to record at the rate of 1F 8S please choose 1F 8S in the drop down list Question 5 How to add or modify the users and their authorities of using the IP Camera Entering the setting page 1 Click the System button in the home page 2 Click the Users button on the left side of the page to enter the SYSTEM USERS page lt Add a new user 1 Please enter the user name the password the confirmed password and choose the authority There are three different levels of authorities namely Admin Operator and Viewer Admin The user who accesses with the admin name and password has the full power to even change the settings of the IP Camera Operator The suggested choice for normal use Viewer The user who accesses with just the viewer name and password has only a limited power to view 2 Click the Submit button to submit the new user s setting Modify the user 1 Click the user name you want to modify on the User List 2 Enter the password the confirmed password and choose the authority 3 Click the Submit button to submit the new setting Delete a user 1 Click the user name you want t
44. VI 2004 02 13 15 57 28 96K 31VRBH6 AVI 2004 02 13 15 58 30 96K 31 RBQ7 AVI 2004 02 13 16 03 18 96K 31VRC7S AVI 2004 02 13 16 10 36 93K 9 file s and 895 KBytes free HITP SERVER AT caml 2 Click the desired file to display the images therein 3 Each file can be deleted by clicking the attached DELETE hyperlink NOTE You can t directly click the hyperlink of the file in the FILELIST of MEMORY CARD page with the right button of the mouse focus then click SAVE to save the file CAUTION If you wish to save the SD CARD files from a camera to your computer you can enter the JPEG column in the FILELIST of MEMORY CARD page to click in and enter the particular files in the column When you click in the images concerned will appear Move your mouse focus within the image area and click the right button of the mouse A table of item entries will show up Click Save and select the path by which to save your files 59 5 1 7 Change the Pan Tilt setting Click the Pan Tilt button on the home page to open the Speed Dome Controller 1 2 a 5 78 a http 192 168_ 0_92 ptz_htm Microsoft Internet E PEET 232 485 Ti ES 1 Click Configure to enter to the RS485 setting page please refer to Change the System Setting RS485 Setting Select a Speed Dome device ID from the drop down list on the Speed Dome Controller The Controller will display the corresponding ID 2 Each of the ten buttons unde
45. am ipcam ipcam ipcam ipcam ipcam ipcam ipcam ipcam ipcam ipcam DYR ipcam ipcam ipcam CAMS 00 0C 0C 00 98 98 00 0C 0C 01 7B 34 00 0C 0C 00 54 DE 00 0C 0C 01 74 5C 00 0C 0C 00 7C 94 00 00 0C 01 54 42 00 0C 0C 00 7C 44 00 0C 0C 01 74 64 00 0C 0C 01 74 44 00 0C 0C 01 7B 4C 00 0C 0C 01 74 66 00 0C 0C 01 7B 5E 00 0C 0C 01 74 76 00 0C 0C 01 7B 57 00 00 00 01 74 52 00 0C 0C 01 7B 44 00 0C 0C 01 74 80 00 0C 0C 01 7B 38 00 0C 0C 00 00 15 00 0C 0C 01 7B 4B 00 0C 0C 01 7B 3F 00 0C 0C 01 74 59 00 0C 0C 00 54 E5 192 168 3 201 192 168 0 96 192 168 0186 192 168 0 52 192 168 1 180 192 168 0 226 192 168 1 181 192 168 0 64 192 168 0 44 192 168 0 24 192 168 0 40 192 168 0 86 192 168 0 60 192 168 0 87 192 168 0 46 192 168 0 92 192 168 0 54 192 168 0 83 192 168 0 95 192 168 0 93 192 168 0 90 192 168 0 57 192 168 0 148 HEERE Gateway 0 0 0 0 255 2 192 168 1 254 192 168 1 161 192 168 1 254 192 168 1 254 192 168 1 254 192 168 1 254 192 168 1 254 172 16 1 1 192 168 1 254 192 168 1 254 192 168 1 254 192 168 1 254 192 168 1 254 192 168 1 254 192 168 1 254 172 16 1 1 192 168 1 254 192 168 1 254 192 168 1 254 192 168 1 254 192 168 1 254 192 168 1 1 239 239 252 0 255 255 252 0 235 235 252 0 255 255 255 0 235 295 292 0 235 255 252 0 255 255 252 0 235 255 252 0 255 255 252 0 2535 235 252 0 235 235 252 0 235 235 252 0 255 255 252 0 255 255 252 0 259 255 232 0 255 255 252 0
46. button on the left side of the record to enter the Alarm Application Enable Setting page HOMe mene pm os lout Alarm Application Enable Setting Setting CO Enable Alarm Trigger an Alarm When Ethernet Is Lost D CI Enable Alarm Upload via FTP SD Card SMTP C Enable Alarm Save Into SD Card Language CI Enable Alarm Upload Via SMTP Record Enable Record Alarm Duration 30 seconds Schedule Alarm Submit Motion Detection Image Network sten 1 Application op Card 1 Game NetworkCam 2 Click Enable Alarm Trigger an Alarm When Ethernet Is Lost to checkmark the attached box and activate the function 3 Click Enable Alarm Upload Via FTP to checkmark the attached box and activate the function 4 Click Enable Alarm Save Into SD card to checkmark the attached box and activate the function 5 Click Enable Alarm Upload Via SMTP to checkmark the attached box and activate the function 6 Enter the Alarm Duration you have chosen 7 Click the Submit button to submit the new setting of the recording 8 Click the Home button to return to the home page Description of function keys Enable ALARM Trigger an Alarm When Ethernet Is Lost Activates or deactivates the alarm triggering while the Ethernet lost Enable Alarm Upload Via FTP Activates or deactivates the alarm recording upload to the FTP Enable Alarm Save Into SD card Activates or deactivates the alar
47. ccess and Default and then click it See Figure 8 Sel Program Access anid Defaulls sill Programs gt Docurner ils Settings D Search Help and Support RUN Windows XP Professional Shut Down Figure 8 Step 2 When the Add or Remove Programs dialog box appears click the Add Remove Windows Components button See Figure 9 Figure 9 Step 3 Check the Network Services in the Windows Component Wizard dialog box and then click Details See Figure10 91 Windows Components Wizard Windows Components ou con edd or ramowa components od Windows Ni ge To add or zempue component dick the checkbox A shaded boo means fet only pat of lho pamponin wall Des maod Jo ost whats included ine component Geck Wintel Components S Messagi Dean iiA S 20 7 Me EU MA D 2 tCruluuk Emirs s ia Descnpin Conlon ovonety o specoliced reteok zelofed senice and protocols Total disk space required BB Me Spars available on dak 24044 fh ae d Heck Hoi 3 Lang Figure 10 Step 4 Check UPnP User Interface and choose OK See Figure 11 Networking Services To add or remove a component click the check box A shaded box means that only part of the component will be installed To see what s included in a component click Details Subcomponents of Networking Services REES BESSE M S Internet Gateway Device Discovery and Control Client 0 0 MB O E Peer to
48. duct Features Camera Image sensor Image co processor Minimum Illumination Lens type Shutter time Sensor resolution Horizontal resolution Auto iris type Exposure S N Ratio Day amp Night Day amp Night mode Video Signal Video output type Video output level Video output frequency Video output burst level Synchronization Sony 1 3 inch interlaced CCD Sony HQ1 DSP Color 0 5 lux F1 2 B W 0 03 lux F1 2 CS C mount adaptor can be used 1 50 1 100 000sec PAL 440K pixels PAL 520 TV lines DC drive AES Auto iris 50db with AGC off Mechanical IR filter Auto Day Night Schedule BNC 1 0 Vpp 10 75Q composite Negative BNC unbalanced 3dB 1dB at 3 MHz 25 fps best recording 300mv PAL 10 Internal Video Codec Video compression Resolutions Video streaming Video Codec MJPEG Motion JPEG frame rate Motion JPEG rate control Motion JPEG quality level Video Codec H 264 H 264 Frame rate H 264 frame rate control Customized H 264 bit rate H 264 bit rate control H 264 quality level Image AWB ALC adjustable Flickless Mirror High speed shutter Back light compensation Saturation Sharpness Contrast Brightness Privacy Area Motion Detection Motion Detection Sensitivity Customized motion detection sensitivity Digital PTZ OSD Timestamp Software Platform Operation System System Integration System Requireme
49. e 6 103 APPENDIX 5 FAQ 1 How to disable the DHCP function and use a static IP instead A Turn up the DIP SWITCH from 3 to 4 and change the relative network settings the IP Address NetMask and Gateway on the image web page 2 Can the SD card be removed during recording A No it cannot be removed until the recording comes to a single point The POWER LED flashing light signals the SD card is operating The green light indicates the unit is activating The red light warns the SD card cannot be removed If the SD card is withdrawn in this mode the card will break 3 I ve set the function of Motion Detection but it doesn t seem to work A Check if Motion range and Sensitivity have been set before activating the function 4 My AVI files recorded in the SD card cannot be displayed What can do to display the files A Please visit http www morgan multimedia com to download Morgan M JPEG codec and install it and then check the selection of the IJP Core 5 How to turn on off the OSD on screen display on off on the IP Camera A Visit the homepage tailpage htm of the device and select ON or OFF in the OSD column Example suppose the IP address of the device is 192 168 1 168 Type in http 192 168 1 168 tailpage htm a registration is needed and select ON or OFF in the OSD column WARNING Please write down the IP address of the device before you
50. e device can t obtain an IP address from the DHCP server This option is needed to configure the network communication settings 10 2 4 The USB function By connecting the IP Camera with a PC via the USB connector the IP Camera can provide two different functions 1 Insert an SD card As a card reader Insert an SD card into the IP Camera then connect to the PC You might transfer files between the SD card and the PC Once you ve connected your IP Camera to your computer the Windows system will detect the connection and ask you what you want to do with your SD card In another words if the user connects the IP Camera with an SD card and the PC via the USB connector the IP Camera can be used as a normal card reader 2 Remove an SD card As a configuring tool Before using the USB configuration setting page please remember to remove the SD card or your PC will read the SD card and won t show this window USB Configuration 1_01 USB Configuration v1 01 k DHCP DHCP Network IP Address IP Address Netmask Netmask Sett de H Gateway i Gateway DNS Server DNS Server HTTP Port co HTTP Port PPPoE Enable PPPoE Enable Account Account Password Password P D P Oo E Mode Setting Mode Setting Setti n g ESSID ESSID Channel Channel WEP Key WEP Key Default Key Cc Default Key Keyl Keyl Key2 Key2 Key3 Key3 Key4 Key4 Ew Ew DHCP ON DHCP OFF WARNING After changing the settings please click the Apply bu
51. e energy saving settings for your Show installed rer ez avd fax printers a Customine settings for the display of bng Add remove and configure scanners and Schede computer LRS fo run automat View your current security status aud aoc ACS Auto Control Pane O e ce rt Ai ot Pew Fianna the ors ow erama Ge we rm H 3 Figure15 Step 3 Click the Services icon in the Administrative Tools dialog box See Figure16 ri ES Adminiaieative Tools Pic Edt wew Favortes Took Hep Goa EN bt Search gt Foire Die De ae Type Fle and Felder Taska Services ZER Shortcut 2kB Shortcut WW Rename thes fin Su Julai Dh Mowe thes De LKB Coniguraton Sept D Copy tua fe 38 Shortcut gd tier E ine Er fa Wetz Internet informanon ear ZEE shortcut CN eral ta the Local Gacunity Pokey Je Sheeteut W rom thet Ee Figure16 Step 4 When the Services dialog box shows up double click the SSDP Discovery Service icon See Figure17 94 b Serviced ER ACT We He deica on your home meteor Takema Desk fog Hap Dessy lemon Procedure Cal MPC Remote Procedure Cal PC hemo epp B bee Storage Bpo ri aed Remote access iy Secondary Logon Security Acces auer eSecurity Center teaver Sat Hardware Detection Seem estore Service Bp Task Sech be Zara Her Hepar TaT Batoket ie Terminal Serine i Manager and coniro Provade the evkten Manages the RPC ma Erebia remote pe Offers ro Pre serv
52. e network hardware you need to activate the network function and configure the proper network settings of the IP Camera 4 2 1 Enable DHCP Function This function can only work if the LAN which the unit is connected to has a DHCP server If the DHCP server is working please move the dip switch points up to 3 on the flank panel now the IP Camera will obtain an IP address automatically from the DHCP server In that case please skip section 4 2 2 Set IP address and follow section 4 3 TCP IP Communication Software 4 2 2 Set IP Address You need to set an IP address for the unit if the LAN unit isn t connected to a DHCP server Otherwise please follow the instructions given below Set the IP MASK and GATEWAY The following is a sample setting IP 192 168 1 X MASK 255 255 255 0 GATEWAY 0 0 0 0 NOTE When only one unit of the IP Camera is connected to a computer or LAN you can freely assign an IP address for the IP Camera For example there is a range of IP Camera IP addresses from 192 168 1 1 to 192 168 1 255 You can pick one for use from the range of the IP It s not necessary to set MASK and GATEWAY leave the settings as default When an IP Camera is connected to a WAN you must acquire a unique permanent IP address and correctly configure the MASK and GATEWAY settings according to your network architecture If you have any questions regarding those settings please consult a qualified MIS professional or your ISP
53. e of 10 3600 SSDP Port SSDP stands for Simple Service Discovery Protocol SSDP searches for upstream Internet gateways using UDP port 1900 UPnP Port Type in the UPnP Port in the attached space Submit Click to set 40 kel Change the Network Setting IP Filter The Network page has on its upper left the IP Filter icon Please follow the steps below to change the IP Filter setting through the network if necessary 1 Click the IP Filter button at upper left above to enter the Network Setting page Network FTP SMTP SNTP DDNS PPPoE UPnP o parity Traffic IP Filter Enable IP Filter Default Policy Allow O Deny Policy List a Get Add Modify Policy Deny 0 H 0 0 How to Set IP Filter Image Network System T Application Top Card Gong ipcam 2 Click Enable IP Filter to checkmark the attached box and activate the function 3 Select the Default policy 4 Set the Allow Deny IP Filter policy and enter its IP address 5 After setting the policies they will be shown on the Policy List The user can use the Up or Down to select a policy and use the Delete button to erase it 6 Click the Submit button to submit the new setting 7 Click the Home button to return to the home page Note The settings of the IP Filter must be correct or you may not able to operate the device regularly In case of the wrong set
54. e of the IP Camera needs to be upgraded please take the following steps to safely process it Important Before carrying out the following procedures please ensure the SD card is working and the file of the system firmware is intact 1 Format an SD card using the FAT16 format if it is unformatted there are no limitations to an SD card s capacity 2 Create a directory named LANCAM in the SD card if it does not exist 3 Copy the file of UPDATE BIN to the LANCAM directory 4 Ifthe IP Camera is running please power it off first 5 Insert the SD CARD into the IP Camera 6 Remove the Ethernet cable from the RJ 45 port and then power on the IP Camera 7 In 5to 10 seconds a message reading UPDATE PROCESSING will show up on the screen on a blue background if not please check out steps 1 to 6 carefully or else inform your technical support while ignoring the following steps 8 DO NOT power off the IP Camera while this update process is running until the message UPDATE OK RESET PLEASE appears on the screen it might take 15 to 30 seconds to appear 13 9 If the message UPDATE NG RESET PLEASE appears rather than UPDATE OK RESET PLEASE please write down the error messages shown on the screen and inform your technical support while ignoring the following steps 10 Power off the IP Camera when this update process is finished then remove the SD card from the IP Camera 11 Reconnect the Ethernet cable to the RJ 45 port
55. e provided doing it manually or setting the frequency to enable the system to do it automatically Submit Click to submit the new setting to the IP Camera 43 Change the System Setting Timestamp Please follow the steps below to change add the timestamp through the network if necessary 1 Click the Timestamp button on the left side of the System Date and Time page to enter the Timestamp page Aua J3 B52 003 Timestamp Date and Time Enable Timestamp ji Timestamp Color BLACK Users e Timestamp Location UPPER LEFT v Digital 1 0 RS485 Setting Submit et Submit Events Image __Network System Application op God 1 pa camera Click Enable Timestamp to checkmark the attached box and activate the function Add or modify any timestamp s data if necessary Enter the Timestamp Color you have chosen Enter the Timestamp Location you have chosen Enter the Timestamp Format you have chosen Click the Submit button to submit the new user s setting SS Gh SS Ee oe Je Click the Home button to return to the home page Description of function keys Enable Timestamp Checkmark to activate the function Timestamp Color Click to open the list of eight color modes to choose from BLACK WHITE RED ORANGE YELLOW GREEN BLUE and PURPLE Timestamp Location Click to open the list of four location modes to choose from
56. ease refer to section 5 1 8 PPPoE amp DDNS for more details 37 Description of function keys Enable DDNS Function Checkmark to activate the function DDNS Type Click to open the list of two DDNS modes to choose from DynDNS and hn Click the Apply button and connect this website automatically and enter it Type in your dynamic IP Address and Email Address If they are accepted by the website you will get an Email containing your DDNS Account and DDNS Password in your Email box DDNS Host Name Type in your host name in the attached space DDNS Account Enter it in the given space DDNS Password Enter it in the required space Submit Click to set 38 kel Change the Network Setting PPPoE The Network page has on its upper left the PPPoE icon Please follow the steps below to change the PPPoE setting through the network if necessary 1 Click the PPPoE button at upper left above to enter the PPPoE Setting page PPPoE Setting Network PPPOE is inactive FTP SMTP di PPPoE Mode OFF DDNS Account A Password UPnP IP Filter Traffic All PPPoE setting takes effect after rebooting Image Network System Application _ SD Card _Pan Tilt ipcam 2 Please read the PPPoE Troubleshooting document first then press Close button 3 Click the PPPoE mode to activate the function 4 Type in the PPPoE Account and the PPPoE Password
57. ening or removing covers may expose you to dangerous voltage or other hazards Please refer all servicing to your distributor retailer Do not use liquid cleaners or aerosols for cleaning To prevent fire or electric shock do not overload wall outlets or extension cord This unit must be grounded to reduce the risk of electric shocks 1 PRODUCT FEATURES 1 1 Product Instructions The newly designed H 264 MJPEG stream IP camera provides simultaneous video codec streams of H 264 and MJPEG in 520 TV lines This IP camera not only supports the 25 fps frame rate motion detection and built in microphone but also the day and night and pre and post alarm functions In addition it hosts the powerful Multi Profile function which enables the simultaneous use of different rates of resolution while allowing two video codecs to connect with computers at the same time Apart from this the camera brings you four comprehensive and advanced user friendly PnP operations and captures alarm and scheduled recordings by using an SD card Besides when this IP camera connecting the auto iris lens and the IP camera makes available the Auto Iris mode which can easily be turned on or off with the help of the switch on the camera s side panel In this mode the ALC function can also be activated This new generation H 264 network camera offers a more progressive digitalized image technology to thoroughly update your surveillance capabilities 1 2 Pro
58. ers can click the title of the device and use the icons above the list to change the device settings Display area Click the title of the device and you will see the live image in this area 67 NOTE The Device Setting page Central Management System a Image Network System Application Image Multi Profile H 264 Image Fine Tune Privacy Mask Day amp Night Device Tite Camera O Activex Viewer Type SA For the further settings of each channel please select the device title on the left side and click the setting button to enter the setting pages of the device Click the Setting button to bring up the device setting pages You can interchange between 7 Di 7 DI four buttons the Image Network System and Application The method of operation is the same as the Microsoft Internet Explorer setting pages please refer to section 5 1 for more details 68 5 2 4 2 Live View Giger Jag 0 14g 100g Tr 20 18 w Fo EEMCS 0 127 D ieee 28 54 e 31 fps MSG EBA f um Add Live View Group 1 Press to add a new group of the live view To change the group name please left click twice on the title of the group and then enter the new title Group Sequence This button enables you to see the sequential display of the group Please select the group and then click this button to start the display Delete Live V
59. es above if the new address was configured Note this method will set the IP address permanently Note The default account and password after the reset are admin and 9999 99 APPENDIX 4 Register as a DDNS member The DDNS dynamic domain name system is a function which is provided by an American company Please refer to www dyndns com This chapter provides the user with the basic instructions on how to register a free DDNS service Registering fora DDNS Enter the URL www dyndns com In the upper right hand corner of the main page where there is an item Create Account as shown in Figure 1 ln Loge rra d kd AE L aaa ROKKA Geng s Deen TL A Capen C DynDNS Ge Suppor TEAM SPORT FOR THE BRAIN an bo CA me sbar ore res et een oo i We tupport the US HA DAS Sm DD Foe ge pl aae P acide k Servies fr rar feats mal boy auc Beaangd pa Sorc Support Abpout Us what u DAG Tugba DE Lee Chi The Compan DAG Too Drame Ce Bin Brora pout DnD Oromi Drgeir irii E Hal Fais Dai 1 bz erie LR re m Lee EE Ze ei ks Lead Peers Core pet Si here Create an account After clicking Create Account you will enter the Create Account page Please complete the form at the bottom of the page to create your account You will receive an e mail containing instructions to activate your account If you do not follow the directions within 48 hours you will need to recreate you
60. gs Control Panel Network Select TCP IP and then click Properties Before processing the IP Camera installation in a WAN please make sure the Internet connection works properly If not please contact your ISP provider Network 21x TCP IP Properties Ei E3 Configuration Identification Access Control Bindings Advanced NetBIOS DNS Configuration Gateway WINS Configuration IP Address The following network components are installed Client for Microsoft Networks NE2000 Compatible 3 IPX SPX compatible Protocol An IP address can be automatically assigned to this computer If your network does not automatically assign IP addresses ask your network administrator for an address and then type it in the space below Obtain an IP address automatically Specify an IP address Add Remove d Primary Network Logon Client for Microsoft Networks Subnet Mask File and Print Sharing Description TCP IF is the protocol you use to connect to the Internet and wide area networks IP Address 192 166 1 2 Cal ss If you are using a DHCP server please select Obtain an IP address automatically Any assigned IP address for the connected IP Cameras must be in the same class type as the server If there is no DHCP server please select specify an IP address and type in the IP address of your PC This IP address must be different from other network IP devices but in the
61. h makes it easier for you to examine it however it is a pity that Microsoft Windows XP doesn t start this service by default Therefore the following procedures will help you to turn it on and discover your IP Camera step by step as shown in Figure1 below g START D CHECK IP CLASS l 1 o Sooo YES lt a SAME CLASS 7 NO SET IP ADDRESS INSTALL UPnP PACKETS TURN ON SERVICES RESTART SYSTEM CHECK MY NETWORK PLACES DONE Figure 1 UPnP Setup Flow Chart 1 Check the IP class of your PC In most case Microsoft Windows XP will assign an IP address 169 254 automatically with a subnet mask 255 255 0 0 if the DHCP server is absent while the default IP address of an IP Camera is 192 168 1 168 with a subnet mask of 255 255 255 0 There won t be any communication due to different IP class domains and you have to modify the relative settings or the UPnP protocol won t work however checking your own IP address is necessary Here are the procedures to check and modify them Step 1 From the Start menu point to Settings and then click Control Panel See Figure 2 88 QS Set Program Access and Defaults GA Programs gt Documents Control Panel gt Network Connections 6 Printers and Faxes el Taskbar and Start Menu Search Help and Support Run Windows XP Professional Step 2 When Control Panel appears d
62. hange the FTP setting via the network if necessary to upload recording data live 1 Click the Application button on the home page to enter the FTP Application Setting page default Aua p hoy 983 FTP Application Setting Setting FTP Networking o FTP Server 192 168 1 1 Port 21 SD Card SMTP User Name guest Language File Upload Path f tmp Record Enable Record e Storage Setting Schedule Alarm Upload Rate 25F 1S Enable Alarm Motion Detection Image _Network System Application 1 op Card Pan Tilt NetworkCam 2 For the storage setting type in the required number of images you wish to set in Pre Alarm Memory Buffer and Alarm Memory Buffer respectively in their corresponding blank spaces 3 Enter the Upload Rate you have chosen 4 Click Submit after each of the above entries for their settings 5 Click the Home button to return to the home page Description of function keys Pre Alarm Memory Buffer Fixes the desired number of images to prelude an alarm Alarm Memory Buffer Determines the selected length of the image buffer after an alarm Upload Rates Sets the upload speed rate 51 Change the Application Setting SD Card Application Setting Please follow the steps below to change the SD CARD setting via the network if necessary to upload recording data live 1 Click the SD Card button on the top left to enter the SD Card Application Setting page
63. ic Eras starting pro Supports fie prt a Tracks syshem ever Perfo system res Erv gdez age TC Lie support for Provide Teen Eraik aremcte u Aip mpi LTs Figure17 Step 5 Choose Automatic in the Startup type and click OK to start it See Figure18 SSDP Discovery Service Properties Local Computer Heneral Log On Recovery Dependencies Servic name ssorsrv Display nara Descuripliur righwurk Path lt cxvculatle Pobre Cliscovery Service ICAWINDOW hien lermns2 sveiuslexd k Luca Servici Enables discovery of IPn devices on your home Startup type AUTOM AT A ee ee MAMA Lisalslect GVervics status Smet You can specify the start porometers thot apply wher you start the service from hera Resume tart parameters IK p Concel Asply Figure18 Step 6 When the Services dialog box appears again double click the Universal Plug and Play Device Host icon See Figure19 95 Mem L eemegeen tt Zare puree ge ee Een K Somat cad Manager anos Enn Sat Decovery Bavia Brabies dacovery of Star EEDI pe serie psyctem event Monican In TEM g r Sg iim Dez Gore Pariona rem rc ae Ae Eecher Enaks A uer bode Sar DEE DLHE biet fa Peer irruti gt Ee Frowides Steet bp host Tehon Gegen EN Ier PRO RI Ep E a Taret Erde a remote us Sienna Pa Aber Tepe ATE KC Bn Thame Pros ge gt GEN D p ana Fp veri Ai rin G a a
64. icon of SD will show up in the upper right corner of the monitor screen If not it means the device detection has failed Please contact your technical support and ignore the following steps 3 If no cross sign appears beside the SD icon please go on to the next step If a cross sign appears please check the following a Is it really an SD Memory Card b Is this SD card formatted in the FAT16 format c Connect the SD card with a PC and test to see whether the PC can read the data or not d Does this SD card still have the capacity for storing data e Is the SD card set to write If all the answers are yes but the cross sign still persists please contact your technical support and ignore the following steps 4 Please make sure the function of SD CARD ENABLE is activated in the ALARM and SCHEDULE pages if no cross sign appears beside the SD icon on the screen 5 After recording read the data on the web page of sdget htm If the data cannot be read through the network please read it instead in a PC check the data stored in the LANCAM directory and contact your technical support regardless of whether there is data or not WARNING 1 Performing this troubleshooting process may need a monitor a PC a card reader and some cables 2 If the SD card is removed while storing or accessing data the data will be lost 3 If there is a cross sign beside the SD icon it means the SD card has been inserted into the IP Camera b
65. iew Group 1 Select the Live View Group you want to delete from the list 2 Press Yes Add Sub Group 1 Click the button to open the Add Sub Group window 2 Select the Square Division from the drop down list Division 1 L_Isingle window Division 4 Ch 4 windows Division 9 H49 window and Division 16 HIE windowt 3 Now press the Add button Modify Sub Group 1 Click the button to open the Modify Sub Group window 2 Select the Square Division from the drop down list Division 1 L_Isingle channel Division A EH 4 windows Division 9 E H9 window and Division 16 Z 116 window 3 Check mark the Cover Original Name or don t 4 Press Modify button Delete Sub Group 1 Select the division mode you want to delete from the list 2 Now press Yes 2 List of divisions and its groups The users can left click twice on the title of the list to change the groups names or the divisions names Display area Click the title of the division and you will see the live image in this area Audio function GEI The audio function is not available 69 The audio function is available Press to activate the function ER and the icon will turn purple CP Press again to deactivate the function Recording function Gi The recording function is not available The recording function is available Press to activate the function and the ico
66. m recording to be saved to the SD card Enable Alarm Upload Via SMTP Activates or deactivates the alarm recording upload to the SMTP Alarm Duration Predetermines the length of the alarm 57 Change the Application Setting Motion Detection Please follow the steps below to enable changes in the motion detection function of the alarm through the network if necessary Set the motion detection 1 Click the Motion Detection button on the left side of the Alarm to enter the Motion Detection page Motion Detection Setting FTP SD Card SMTP Language Record Enable Record Select all Schedule e E Clear all Alarm TEEN FX Restore Enable Alarm es h Save setting zaj Ti aaa D f Click the right mouse button to show the popmenu Save the setting after you finish editing Motion Detection Enable Disable High v Sensitivity gees a Re K 128 _ Customized Threshold Image Network System _ Application _ SD Card Pan Tilt CAMERA 2 Click and drag the left mouse button across a targeted zone to draw a red rectangle on the image coordinates provided below NOTE You can set more than one targeted zone depending on your requirement 3 Click the right mouse button to see the popup menu After setting the target zone please click Save setting 4 Enables disables the motion detection function 5 Set up the sensitivity 6 Click the Submit button
67. n will turn red Press again to deactivate the function Press the button to expand the PTZ Control Panel PTZ Control Panel press the button to minimize the PTZ Control Panel bi D E KH The direction keys Speed Here you have a drop down list of speed dome rates from 1 to 63 1 is the lowest rate and 63 the highest You can set any one of these to control your speed dome rate E len Click this button to save the preset position B Preset Goto Click this button to automatically view the preset position number you have selected Preset Clear Choose any one preset position and click this button to delete your choice H a del Preset Position number There s a drop down list here from which you can choose the preset position you want Auto Scan Click this button to view preset positions 1 to 8 automatically Stop Auto Scan Click this button to stop auto scan F in fe EA EA al and Lal The Tour function keys and A The Zoom function keys le ie g gt p and fa The Aperture function keys and Lal The Focus function keys a Flip Click this button to turn the camera180 degrees horizontally w Zero pan This button enables you to return the camera to the original direction it was facing 6 OSD Click this button to activate the OSD in the dome device menu the OSD enables you to select or change your remote settings NOTE Add a camera video onto the Live View area
68. nci High performance 32 bit RISC CPU DDRII 1Gbit 256Mb Built in Built in Built in SD Card FTP HTTP Yes Yes Yes Yes Max TBD Watt Yes Power over Ethernet IEEE 802 3af 50mm 62mm 95mm 360 g 1350000Hours OTC to 50 C 32 F to 122 F 30 to 80 20C to 60 C 4 F to 140 F Mono 1 channel 16 KHz sampling ulaw 1K ohms Built in Microphone or LINE in10k ohms 1 0Vpp Available 2 0 1 24Mbit Network settings configurable Yes Network Ethernet MDIX Security Protocol Management console Throughput Bandwidth control Simultaneous users DDNS IE recording support Storage SD Card Support Pre alarm Ethernet 10 100 Base T RJ 45 connector Yes 3 Level password protection IP address filtering User access log TCP IP UDP ARP ICMP DNS DHCP HTTP SNTP PPPoE DDNS UpnP FTP SMTP Full function 19M bit second Yes 8 Dyndns Yes MMC SD SDHC 2 0 32MB 32GB Yes File system Recording format Network play back SD card brand verified Device Indicator Ethernet Link Ethernet Active System Operation System Warning Accessories Accessories PTZ Support Protocol UO Ports USB DHCP Static IP switch DC IRIS AES switch Factory Reset RS 485 Alarm input Alarm output Alarm reset Audio I O DC OUT FAT32 16 12 JPG AVI Yes A Data PQI Toshiba Transcend APacer Photo Fast Yes Yes Yes Yes USB cable CD Rom C Mo
69. ncluded please process section 4 5 If it is not included please follow section 4 4 to install the TCP IP Network 21x Configuration Identification Access Control The following network components are installed E Client for Microsoft Networks NE2000 Compatible IPX SPX compatible Protocol 23 NetBEUI Remove Properties Primary Network Logon Client for Microsoft Networks File and Print Sharing Description TCP IP is the protocol you use to connect to the Internet and wide area networks OK Cancel 4 4 TCP IP Installation Network 21x Configuration Identification Access Control The following network components are installed Client for Microsoft Networks NE2000 Compatible IPX SPX compatible Protocol NetBEUI Ca reese Primary Network Logon Client for Microsoft Networ File and Print Sharing m Descriptio Select Network Protocol X Click the Network Protocol that you want to install then click OK If you have an installation disk for this device click Have Disk Manufacturers Network Protocols 3 Fast Infrared Protocol F PX SPX compatible Protocol Microsoft 32 bit DLC Microsoft DLC 5 Have Disk C D e During the installation you will be requested to insert the Windows CD ROM After installation the PC may be restarted 21 4 5 TCP IP configuration setting Click Start gt Settin
70. nglish 3 Click your selected language and click Submit to set it 54 Change the Application Setting Record Application Enable Setting Please follow the steps below to change the setting via the network if necessary 1 Click the Enable Record button on the left side of the record to enter the Record Application Enable Setting page Record Application Enable Setting Setting C Enable Record Upload Via FTP FTP SD Card SMTP Language Record Schedule Alarm Enable Record Save Into SD Card Enable Alarm Motion Detection __Image__ _Network 1 System Application _SD God 1 Pan Tilt NetworkCam 2 Click Enable Record UPLOAD Via FTP to checkmark the attached box and activate the function 3 Click Enable Record Save Into SD card to checkmark the attached box and activate the function 4 Click the Submit button to submit the new setting of the recording 5 Click the Home button to return to the home page Description of function keys Enable Record Upload Via FTP Activates or deactivates the recording to the FTP server Enable Record Save Into SD Card Activates or deactivates the recording to the SD card 55 Change the Application Setting Record Schedule 1 Click the Application button on the home page to enter the Schedule page Schedule Setting o wednesday iif From E S a Bil 00 LR o0 v FTP O day From Toi 00
71. nism Setting Date and Time Audio Mechanism COON OFF Timestamp Audio Source O Audio In Mic Users Digital 1 0 a Audio Mechanism RS485 Setting Update Events __Image__ _Network _System Application op Card 1 Pan Tilt camera Mark the Audio Mechanism ON or OFF Choose one of the audio sources The two sources are Audio In and Mic microphone Click the Submit button to submit the new user s settings SH oP eS Je Click the Home button to return to the home page NOTE This setting is for turning the audio mechanism of the Camera on off automatically The Live audio service is only provided in the H 264 mode via the Web browser Description of function keys Audio Mechanism Select ON or OFF to activate or deactivate the function Audio Source Select Audio In or Mic microphone from the audio sources 47 Change the System Setting RS485 Setting Click the RS485 Setting button on the left side of the Date and Time page to enter the RS485 Setting page Aua J3 ESI RS485 Setting Date and Time Baud Rate 9600 bps Timestamp Type 8 N 1 Users geg Device ID 1 Digital 1 0 Audio Mechanism gt Update Transmit Data Yia R5465 Events O Raw Format Canonical Format Image Network System Application op Card Pan Tilt camera Description of function keys Baud rate Eight different s
72. nt Remote Access Software Network API Recording Software Alarm Alarm triggers Alarm application Alarm duration Schedule counts H 264 Motion JPEG 720 x 576 PAL 352 x 288 PAL Simultaneous H 264 720 x 480 and 352 x240 Up to 25 fps at 720 x 576 PAL Yes 5 Up to 25 fps at 720 x 576 PAL Yes Yes Yes 5 Auto Indoor Outdoor Push Hold Yes Yes Yes 1 1000 second Switchable Adjustable Adjustable Adjustable Adjustable Programmable 3 independent zones Programmable 96 independent zones 5 levels Yes Yes IP Address Date Time ICON Title Date Time Proprietary OS Microsoft Windows 2000 Microsoft Windows XP Microsoft Windows Vista Microsoft Internet Explorer 6 0 or above SDK CGI DLL 16 channel free bundled CMS Motion Detection Schedule Alarm input Ethernet loss Network Remote digital alarm input SD recording SMTP FTP CMS recording Programmable 7 Network active alarm notification Yes ANNP Hardware Processors DDRII memory Flash memory Real time clock Real time clock battery Watchdog Firmware upgrade Approvals FCC CE RoHS Power DC 12V AC 24V PoE Physical Property Height Width Length Weight MTBF Operating Temperature Operations Humidity Storage temperature Audio Signal Number of tracks Audio sample rate Audio output Audio input Network Audio Stream USB Type Capacity Texas Instruments DaVi
73. o modify on the User List 2 Click the Delete button 83 7 SPECIFICATIONS LC 7314 H 264 CCD Box I P Camera PAL 1 3 Sony Super HAD CCD with HQ1 DSP 520 TV Lines C CS mount Video system DC drive 1 50 1 100000 sec Min illumination 0 5 Lux F1 2 Day amp Night Yes Mechanical IR Cut filter Simultaneous H 264 amp MJEPG video streaming Video compression Simultaneous multi profile video stream Controllable frame rate and bandwidth Full D1 Half D1 CIF QCIF Image system Up to 25 in all resolutions Image quality 5 levels Image AGC Gain Contrast Brightness AWB BLC Sharpness configurations Saturation Fluorescent Private mask 3 areas l Built in Microphone external audio input x 1 Audio l l Audio compression u law HTTP HTTPS TCP SNMP RTSP RTP RTCP DHCP support protocols UPnP ARP DNS DynDNS SNTP PPPoE 3GPP Network system T Multiple authorities levels IP filtering Ethernet 10BaseT 100BasetX SD card slot RJ 45 USB connector Connectors 12 pin push in block for BNC output for analog signal alarm input alarm out output RS 485 DC Out audio input DC AC jack connector audio output Alarm triggered by build in motion detection external alarm in Video loss Reboot Manual Alarm management Alarm can be managed by schedule Alarm notify to ANNP email FTP SD card Aegle alarm out software APPRO CMS Lite Comprehensive development SDK kit
74. oeeds can be used 2400 baud per second 4800 baud 9600 baud 19200 baud 28800 baud 38400 baud 57600 baud and 115200 baud Type Choose one of the types Device ID You have the option of using an ID code any number between 1 and 255 Raw Format Set to transmit the ASCII codes Canonical Format Set to transmit the character string 48 kel Change the System Setting Update Firmware Please follow the steps below to change the Audio Mechanism through the network if necessary 1 Click the Update Firmware button on the left side of the Date and Time page to enter the Update Firmware page Aas Tata Lou Our Update Firmware Date and Time Current Version Description Timestamp Kernel version 1 00 Users der BIOS Version 1 16 Digital 1 0 RS485 Setting Compile Date amp Time Sep 21 2007 14 07 30 8 HTML Version 1 1 50 Events Activex Version 1 0 2 6 Update the device with the latest firmware Specify the firmware to update and click Update Note Do not disconnect the power of the device during the update The device restarts automatically after the update has completed 30 60 seconds U Image Network System Application SD Card TU _ Pan Tilt camera 2 Click the Browse button to select the UPDATE BIN file which was copied into your computer 3 Click the Update button 4 DO NOT power off the IP Camera while this update process is running Note Don
75. onitor The monitor screen will show the IP address on its right side Change the switch on the IP Camera s side panel to position 4 Installing an IP address in your PC or notebook Desktop Move the mouse focus to the Network neighborhood and click the right key of the mouse Choose the properties gt Choose your local connection gt Choose the properties and select the configuration gt Select the TCP IP Choose the properties gt Type in the IP address in a four part formula for example 192 168 1 101 the first three parts must be identical to the above numbers only the last part can be changed to your own number which must never exceed 255 Click the mask and the mask input namely 255 255 255 0 a fixed formula Click OK Click OK Desktop Choose IE browser gt Type in the IP Camera s IP address in the URL check step 2 above gt Enter gt IP Camera images will appear PPPoE Settings 1 Enter the IP Camera home page Choose the network Type in User Name admin and Password 9999 Click OK Choose PPPoE PPPoE mode Select ON Type in Account Type in Password Submit gt Unplug the power connection Plug in the IP Camera and it will receive an IP address from the ISP dealer this IP address is dynamic every time you unplug and plug in again you ll get a new IP address 61 Te
76. ouble click the Network Connections icon The Shut Down amp untitled Paint Network Connections dialog box appears See Figure 3 Cenieei Panel Fie Edt View Faron Took Heb DN O E search A Foie Ley Ge Pare Wrens up Hp and Suppor BE Pee taie meda Deen ham A Roney opari SE Gkiigt ege Dhidi of Ramine Pranimi Timne Tons automa Lae a Dae and Zoe L Cepige Toves Opia nett ed Farce S egonal and Language Opiom Sarre St vm se Ea Commegr ket et pompte S it for viori heart ketik ond Inoue hardware Feta ar remot Dig arnt id Winker OOM Configure achunstraties setiings for your com Sat up Windows E atomically Ce ugg import Set the date tie and De cone for wg Co Change the appearance of emt desktop auch Tuia the dapi of Bez vi folders chan Add change and manage Gone on your pomp kid remows and oondgure game controler han Doniane pour Internet dapley ad corrector Cuntomine your bevboand settings such as the CLADE wf maur Sete nach a e Bs Comec hotter comperi meio s t Configure your iphone Age and moc Ve fe por tibe mad dkaen Gores hess fo Configure enengyeuivang ting for sour Com Shc reud pnia Si fas portent evi het CL top e settings for echt of languages _ Ak pero Ssidcceb rersret sic oa Figure 2 Schedule computer tasks fo num momia View VOLE GUTS IeLttv ENEE ard acces i RTII AEO Conia Pira Change the sund shema far your compu
77. ppear again until you close the window and reconnect it The initial sequence of proceeding is to type in your IP address and click the Enter button to access the home page If and when you revise or change data in the SYSTEM USERS page the sequence will alter to initially show the Enter Network Password page Connect to 192 168 0 92 NETWORK User name Password Remember my password 26 Browsing images from the IP Camera The images from the IP Camera will be displayed on the home page while going online with the IP Camera Some buttons of the home page are provided for further setting In MJPEG mode or in H 264 mode there are different display formats of its home page Scroll to choose the image mode from H 264 or MJPEG Homepage of H 264 mode Homepage of MJPEG mode Click the Image button to enter the image setting page Click the Network button to enter the network setting page Click the System button to enter the system setting page Click the Application button to enter the application setting page Click the SD card button to open the SD card FILELIST of the MEMORY CARD window if the SD card is inserted Click the Pan Tilt button to change the Pan Tilt Zoom settings Click the MPEG w i ito change the six pairs of resolution and quality which you already arranged in the Multi Profile setting page MJPEG mode only NOTE The maximum video capture resolution of CIF for PAL i
78. pper N himin dnih omg D Feet See gg Metteg Cutbound Wian re ge rzreotmwe mu came met niarra DAE Cerne Terme D test w n P pci Faster Horsbonng A Veetzeg Becke D Comsat CH Glires Hotere Fees eves o di Bees Seti re Copies Spe Syiir IP Gekkee nt oe F bbe RA B rg TTL maias in U e DE TTL bie Cep Lie tal Boating C feet Seeercr ore Dual ues Search Theth Ce mr ee o a iG tore EE renee Figure 5 All we have to set in this page is the Hostname item The user can choose a Sub Hostname as s he likes from the right hand side of the Hostname s drop down list NOTE You don t have to set the IP Address in the same format as the camera s IP Address It will renew the IP Address automatically After finishing the setting please press the Create Host button as shown in Figure 5 102 J DDS Arepurg Fil Services tierce Interred Lrsiore P bE W T opten Ion re ZS Schi Biren een ere me un jer ee ies iia P k DAOU Ser TTL Cegergie Min Ba Pre L ete O DynDNS er Bett Ua da S O e Mr Auccunt Host Services Sal nee Eegen el Listen ien Hyr Zeg ei irri Upp siet timum emie Orla Let Urabe oth Pom atl cat era D I eee ae fe Di 2000 112 ANE Pr Star fore Leo ee Fret Sereeeg Hexe Cotten Becomes DAE Fasten Morano TiL Cezfeeeg Ee lene dup hers Zentre Dee Expr aor Accour Settings hairy miy Carl L Search Figur
79. r Set is connected with a specific position and angle of either panning or tilting of the camera Click each button to activate its particular position and angle Press the button under Preset to turn the camera angle by angle in the set positions Each of the ten buttons designated Go to can be clicked to view the particular corresponding angle of the position in which it is set 3 Select the connecting port The RS 485 communication ports function as connectors when two or more units are serially connected to an external control device 4 Upon the buttons being clicked a camera will move one short step only in any of the four designated directions 5 Click the buttons to control the Focus setting on the Speed Dome Controller Click button to focus far and click the button to focus near 6 Click the buttons to control the Zoom setting on the Speed Dome Controller Click button to zoom in and click the button to zoom out 7 Upon the buttons being clicked a camera will turn all the way without stopping in one of the four designated directions 8 Click the buttons to control the Aperture setting on the Speed Dome Controller 60 5 1 8 PPPoE amp DDNS Using the PPPoE ie 2 Install the XDSL software obtained from your ISP dealer in your PC Search your IP Camera s IP address you can use your Network Viewer s Scan IP program or just connect the IP Camera and the Video m
80. r account Set up the DDNS After creating the account successfully please enter your user name and password in the upper right hand corner of the main page to login as shown in Figure 2 After you login successfully a text will appear saying My Services as shown in Figure 3 100 A Ierd n name ES Ekel Delivery a n Ulbe ereken Micoscil babere Eaplever P fi gen fwi Took Hel F Ejip a ra pd EI ec n P f E EE Deere r BAIE Cegeege ae O DynDNS iba Soca ze e TEAM SPORT FOR THE EB E OC ip fet ths DAS Sarva DAD for shane oral pacer E S iteen L ku Sendces freee tekst mal Glory Lee ee Dynami Here Saraca Dorop gel supports 2008 FIRST Compenson Deaangd pa Sorin Suppo Adsout Us What u DAG ciho DE Uiju Chi Than Compa DAG Toni rame OS BaT ror Sumoort Der Cep Drgeir Geo E Haten Sr b s erie LR Si Bere Figure 2 Pe DE W fai To Pie E ij hipnin raro Kies P WII Accmgg Datt TEAM SPORT FOR THE BRAIN Peno Dara Tait bP ir iee r ve hi Wed Ao We tippar the US FR DNS Eegen DAD Aon ba ad eer F aces Pela Serios Enrere reksie mam r Geng EEJ Geer Meteors Seraces Incorporated Strutz 2008 FIRST Competition hai e DAS Centres Re Upri Chart Die Corp DAG Toon Drees CR RAJT Fan Gano Denne Career Buses SE Ebla Fmi Desen 2 bes Contact Lg G re tes See i Legd likes keint jiss E ie Figure 3 Click
81. record into the SD card l i for 30 seconds when the motion has been activated and use the Microsoft Internet Explorer l to view the recorded files Set up the motion detection 1 Click the Application button in the home page 2 Click the Motion detection button on the left side of the page to enter the ALARM MOTION DETECTION page 3 Click and drag the mouse left button across a targeted zone to draw a red rectangle on the image You can also draw the other targeted zones as you wish 4 Please Enable the motion detection function 5 Set up the sensitivity level from Lowest Low Medium and High to Highest 6 Click the Submit button to submit the setting lt Recording the images into an SD card while the motion detection function is working 1 Click the Application button in the home page 2 Click the Enable button below the ALARM item on the left side of the page to enter the ALARM APPLICATION ENABLE SETTING page 3 Tick on Enable ALARM SAVE into SD Card to activate it 80 4 Click the Submit button to submit the setting NOTE Please remember to insert the SD card into the built in SD slot of the unit first Set the recording time the AVI duration of the SD card 1 2 3 Click the Application button in the home page into the SD Card APPLICATION SETTING page Choose the AVI Duration from the drop down list If you want to record the file into the SD card for 30 seconds please
82. rms occur Save Apply the changes 76 Undo Undo the latest changes Restore Defaults Recover the default setting 5 Record Settings R ecord Se Click the GER icon to enter the Record setting page Record Path Current Usage Max Usage Overwrite c CcMSRecord 83 90 E Click to add a new record saving path Click to delete a selected recording path Max Usage Set the maximum recording quota from the drop down list Overwrite Checkmark to activate the function Save Apply the changes Undo Undo the latest changes 6 Schedule Click the E BERIEME icon to enter the Schedule setting page Day Of Week Wednesday Wednesday v Start Time os BW S4 End Time 18 25 SS BP Tuesday _ Wednesday D a Thursday S O mie o 1 The setting area Sets the recording day from the drop down list Day OF Week Daly Note After the setting of the starting and ending time is done select Daily to add the same time schedule from Sunday to Saturday T1 Sets the starting time of recording from the drop down list Sets the ending time of recording from the drop down list Clicks the icon to enable the just added schedule Clicks the icon to disable the selected schedule The working area 1 Click the working area directly to add a new schedule as you wish 2 The functioning schedule bar is colored orange and the non functioning schedule bar s is colored pink
83. rver DOMAIN NAME in the blank space provided Time Zone As we know the globe is divided into various time zones The user must enter his her time zone If this is not done the time given by the unit may be incorrect Submit Click to submit the new SNTP setting to the IP camera 36 kel Change the Network Setting DDNS The Network page has on its upper left the DDNS icon Please follow the steps below to change the DDNS setting through the network if necessary 1 Click the DDNS button at upper left above to enter the DDNS Setting page DDNS Setting Network V Enable DONS Function eg DONS Type DynDNS SMTP DDNS Host Name SNTP PPPoE DDNS Password UPnP IP Filter Traffic Image Network System Application _ SD Card _Pan Tilt ipcam 2 Click Enable DDNS Function to checkmark the attached box and activate the function 3 Click DDNS Type to open the list of two DDNS modes to choose from DynDNS and hn Click the Apply button and connect their website automatically and visit it Type in your dynamic IP Address and Email Address If they are accepted by the website you will get an Email containing your DDNS Account and DDNS Password in your Email box 4 Type in the DDNS Host Name the DDNS Account and the DDNS Password 5 Click the Submit button to submit the new setting 6 Click the Home button to return to the home page NOTE Pl
84. s 352x288 pixels The maximum video capture resolution of HALF D1 is 720 x 288 pixels The maximum video capture resolution of D1 is 720 x 576 pixels Click the Jt button to change the time date display mode Click the Ki button to play the live audio Click once again to deactivate Digital zoom function Click the left mouse button on the video display area and it will show the zoom in images Double click the left mouse button to see the maximum size Click the right mouse button on the video display area and it will show the zoom out images Double click the right mouse button to come back to the normal size 21 5 1 2 Change Image Setting Please follow the steps below to change the image setting through the network if necessary 1 Click the Image button on the home page to enter the image setting page Device Tle Camera Oachwex Teo TEE sy stay agent mae network System Log an o Card 1 rem Adjust the image setting including Device Title and Viewer Type if necessary Click the Submit button to submit the new image setting Click the Multi Profile button to enter the MultiProfile image setting page Select an ID 1 6 from the drop down list then set its resolution and quality Click the Submit button Then you can exchange the pairs of resolution and quality directly in the Home page MultiProfile Profle ID i w Bechen FatlTnfp ze uay Hechmm i dent
85. software Once the CMS is executed a Login prompter will appear You must enter the default user name admin and the password 9999 in the respective spaces and confirm the password again the first time you log in Click the OK button and enter the console page of the CMS both the user name and password must be entered correctly Click the Cancel button and exit the login of the CMS CMS Lozin Ix Lsername Sch dh 2 Login Cancel Gage View the IP Camera video from a remote PC Follow the instructions below to use the CMS to browse an IP Camera video from a remote location Upon entering the CMS a connection box will appear as follows ee a wan emm DC Gasbach Duk VT j a i 1 Press the di Add Device button on the Device Management page 65 2 Add a channel from the Add Device page TE Add Device Devics iAddress HTTP Port Device Title Username admin Password Share Device To None Permissions a 3 1 Click the Auto Search button at the bottom of the Add Device page to discover the connection of the IP Camera type device in the LAN Instantly the Search Device page will appear Click the device of your choice and click Add at the bottom of the page to access the Add Device page again 2 This page provides the IP Address and the HTTP Port After typing the Device Tile Username
86. st Go to the Internet 1 Set your PC to enter the Internet 2 Desktop gt IE browser Type in the IP Camera s IP address the same address as in the PPPoE settings and step 3 above You can see the IP Camera images DDNS settings 1 Check your IP Camera s IP address Scan IP software or monitor open your IE browser Use the address to connect to the IP Camera or view the images Choose the network Type in User name admin and Password 9999 Click OK 2 Choose the DDNS gt Click Enable DDNS gt Enter the DDNS host name for example abc123 homeip net Type in DDNS Account for example abc123 Enter the DNS Password for example 7777 Submit gt The settings are now complete Close the IE browser 3 Open the IE browser again Type in the Website address you just applied for such as abc123 homeip net gt You can look at your IP Camera images right away The procedure is complete Note These settings are only for your ADSL Dynamic IP configuration If your configuration is fixed true IP you don t need to proceed with the PPPoE and DDNS settings The DDNS is just for your convenience 62 5 2 The IP Camera CMS Central Management System This section provides instructions for installing and using the Central Management System CMS which is included with the IP Camera The programs can be operated
87. ter SE e Figure 3 Sounds and Audio De aces Step 3 Click the Protocols tab in the Network Connections dialog box See Figure 4 Network Connections Fe Eat Vew Favortes Took Advawed Hep Gea A Parn rw Hy X Network Connecpore LAN of Hig Speed Internet LAN of MgrSpesd interet Corrects sabie Status He Bridge Connectors Create Pott Renae Si My Parte Paces Sal My Doent My Conger Figure 4 Step 4 When the Local Area Connection Properties dialog box shows up choose Internet Protocol TCP IP and click Properties See Figure 5 89 4 Local Area Connection Properties General Authentication Advanced Connect using Configure SB Marvell Yukon Gigabit Ethernet 10710071 This connection uses the following items K 4 Client for Microsoft Networks i Erinte ing for Microsoft Networks A File anc n b D col CT CPA Properties D gt Description Transmission Control Protocol Internet Protocol The default wide area network protocol that provides communication across diverse interconnected networks Install Show icon in notification area when connected Notify me when this connection has limited or no connectivity JL zt 21 Figure 5 Step 5 In the Internet Protocol TCP IP Properties dialog box choose Use the following IP Address to indicate that you do not wish to use DHCP and assign IP Address
88. the User Name and the Password of the FTP Server and set the File Upload Path of the image files when necessary 3 Click the Submit button to submit the new FTP setting of the recording 4 Click the Home button to return to the home page Description of function keys FTP IP Address Enter the FTP server DOMAIN NAME in the appropriate blank space User Name Fill in the FTP login user name in the attached blank space if the data is not provided warning messages will show up Password Type in the FTP login password in the attached blank space if the space is blank warning messages will show up File Upload Path Enter the file upload path while setting the FTP Submit Click to submit the new FTP setting to the IP Camera 34 Change the Network Setting SMTP Please follow the steps below to change the SMTP setting through the network if necessary 1 Click the SMTP button at upper left above to enter the SMTP Server Setting page SMTP Server Setting Network O My Server Requires Authentication FTP Account Name Password SNTP DDNS Sender PPPoE SMTP Server 192 168 1 1 veer Email Address guest localhost IP Filter Traffic SMTP Application Setting SMTP Alarm Image Network System Application op Card Pan Tilt ipcam 2 Click My Server Requires Authentication to checkmark the attached box and activate the function 3 Fillin the Sender name DOMAIN NAME of the SMT
89. ting of the IP Filter and you can t access the device normally please press the Default button on the rear panel of the camera for back to the factory default setting 4 kel Change the Network Setting Network Traffic The Network page has on its upper left the Traffic icon Please follow the steps below to change the UPnP setting through the network if necessary il Click the Traffic button at upper left above to enter the Network Traffic page Network FTP SMTP SNTP DDNS PPPoE UPnP IP Filter Network Traffic Specify the maximum donwload upload bandwidth per each socket is a useful function when connecting your device to busy or heavily loaded networks Maximum Upload 0 Kilo Bytes Per Second Bandwidth 0 102400 Maximum Download 0 Kilo Bytes Per Second Bandwidth 0 102400 The value O means it will not monitor any traffic U Image Network System Application SD Card 1 Pan Tilt ipcam 2 Type in the Maximum Upload Bandwidth and the Maximum Download Bandwidth 3 Click the Submit button to submit the new setting 4 Click the Home button to return to the home page Description of function keys Maximum Upload Bandwidth Enter it in the given space from a range of 0 to 102400 Maximum Download Bandwidth Enter it in the required space from a range of 0 to 102400 Submit Click to set 42 5 1 4 Change the System Setting
90. tton All of the options will be effective after removing the USB connector 11 3 INSTALLATION Please follow the instructions and the diagram below to set up the system NOTE The IP Camera is linked by its Video Out connection via a BNC connector to a monitor s Video In connection If this connection is there you can see some information on the monitor screen such as the IP Camera factory default Static IP address 192 168 1 168 But the IP Camera Static IP address can only appear if there is a connection between the IP Camera and another device If there is no such connection the IP Camera factory default Static IP address will not appear on the monitor screen 3 1 CONNECTING WITH AN NVR Use a straight LAN cable to connect directly to an NVR CAMERA CONNECT TO ETHERNET RJ45 CONNECTOR CONNECT TO NVR ETHERNET PORT VIDEO AUDIO ETHERNET 10100 Lu d our O0000 N OUT ALARM I O 3 2 CONNECTING WITH A DVR CONNECT TO VIDEO OUT CAMERA BNC CONNECTOR Th CONNECT TO DVR SD Card RS 485 o 990000 o oo00 ETHERNET RS 232 10 100 AP g TO To MUX SVCRIN MONITOR ALARM Wo VIDEO MAIN MONITOR DC12V 12 3 3 CONNECTING WITH A MULTIPLEXER CAMERA 1 CAMERA 2 CAMERA VIDEO OUT BNC CONNECTOR auaaaaaasaasassssssssssssssssss CAMERA 16 ZC Geet Eer 00O CD MOOOOMNOOOOMOOOOTOOOO 3 4 UPDATING SYSTEM SOFTWARE If the system softwar
91. turn off the OSD RMN0100242v1 1 104
92. unt ring Power Adapter Quick installation guide Pelco D 2 0 x1 1 1 Yes Yes zech sech 2 DESCRIPTION OF THE FRONT REAR VIEW oP er Ze 2 1 Front Panel and Rear Panel Front Panel Rear Panel AC 24V 2 ETHERNET Se Po E RESET O DED P P Pepe MICROPHONE The IP Camera has an additional audio function The device has a microphone built into its front panel which records sound POWER indicator Indicates the power status of the unit Plug Inlet ADC 12V inlet that connects to an external power supply Plug Inlet An AC 24V inlet that connects to an external power supply ETHERNET 10 100 Connector This is a standard RJ 45 connector for 10 100 Mbps Ethernet networks PoE Power over Ethernet function Provides power to the device via the same cable as used for the network connection VIDEO OUT Connector The connector provides the unit s composite video signals to a monitor USB port The user can use a USB device cable to connect the IP camera to the USB port on the PC RESET Recover to factory default LED indicator The green light indicates the unit is activating and the SD card cannot be removed 10 SD CARD slot This is used for system software updating and archiving accessing critical images 11 ALARM I O This is a 12 PIN connector including the ALARM IN OUT ALARM RESET GROUND and AUDIO items for connecting with external devices
93. ut cannot perform its writing function Possible reasons are a It is not an SD memory card b The SD card is unformatted or formatted in a non FAT16 or non FAT12 format c The file system is damaged d The capacity of the SD card is full e The SD card is set to be read only 4 Turn off the power before inserting the SD card Otherwise the unit may shut down 15 4 Network Configuration 4 1 Cable Connections Please follow the instructions below to connect your IP Camera to a computer or a network and to choose a proper RJ 45 cable configuration for connections Physical specifications of the RJ 45 cable for Ethernet Wire Type Cat 5 Connector Type RJ 45 Max Cable Length 100 m Hub Wiring Configuration Straight Through or Cross Over PC Wiring Configuration Straight Through or Cross Over 4 1 1 Connect to a computer Use a straight LAN cable to connect directly to a computer CAMERA CROSSOVER CABLE RJ 45 ee een enen eneen sch CROSSOVER CABLE PIN CONFIGURATION 16 4 1 2 Connect to a LAN Hub INTRANET The RJ 45 PIN configuration for connecting with a LAN Hub is shown below TO PC NETWORK CARD CAMERA o ess OB TO NETWORK RJ 45 EA est mm m1 m1 III UUL II III II 1 3 4 uplink HUB 17 4 2 Configure Your IP Camera Network Settings Upon connecting with th
94. y Choose an authority option of the user s name from Admin Operator and Viewer Submit Click to submit the new setting to the IP Camera 45 Change the System Setting Digital I O Please follow the steps below to change the Digital I O through the network if necessary 1 Click the Digital LO button on the left side of the Date and Time page to enter the Digital I O Setting page Digital I O Setting Date and Time Digital Input ON OOFF Active Type LOW sani tai Digital Output ON OOFF Active Type LOW Users Audio Mechanism RS485 Setting Update Events Image Network System _ Application SD Card _Pan Tilt camera 2 Mark the Digital Input ON or OFF and the Digital Output ON or OFF Click your choices to enable 3 Click the Submit button to submit the new user s settings 4 Click the Home button to return to the home page Description of function keys Digital Input Select ON or OFF to use the GPIO connector or shut it down Digital Output Select ON or OFF to use the GPIO connector or deactivate it 46 kel Change the System Setting Audio Mechanism Please follow the steps below to change the Audio Mechanism through the network if necessary 1 Click the Audio Mechanism button on the left side of the Date and Time page to enter the Audio Mechanism Setting page Audio Mecha
95. y of image brightness from a spectrum of 0 to 255 Contrast Select the contrast level in the blank 0 to 255 Saturation Select the saturation level in the blank 0 to 255 Sharpness Select the sharpness level in the blank 0 to 255 Videoalc Select in the blank 0 to 255 to adjust the iris for different lighting environments Default Click this button to install the default settings in all the entries for image parameters on this page 31 5 1 3 Change the Network Setting Please follow the steps below to change the network setting through the network if necessary kel Set the network options and IP address 1 Click the Network button in the home page to enter the Network page Network a Use of Dynamic IP Configuration BOOTP DHCP Allowed FTP om IP Address Diese SNTP Netmask 255 255 252 0 DDNS Default Gateway 192 168 1 1 PPPoE l Primary Nameserver 192 168 1 11i UPnP IP Filter HTTP Port 80 Traffic Image Network System Application 1 SD Cord 1 Pan Tilt ipcam 2 The accessible networks here are the FTP SMTP SNTP DDNS PPPoE UPnP IP Filter and the Traffic 3 Fill in the IP Address Netmask Default Gateway Primary Nameserver and HTTP Port if necessary 4 Click the Submit button to submit the new network setting 5 Click the Home button to return to the home page 32 Description of function ke
96. ys IP Address Enter the 4 byte IP Address in the appropriate blank space the value in each box may be anywhere between 0 and 255 Every IP camera has to own an IP address to be identified on the network Netmask Fill in the 4 byte Subnet Mask in the required blank spaces usually any numbers between 0 and 255 It is used to identify the subnet where the IP camera is sited Default Gateway Type in the 4 byte Gateway in the relevant blank spaces each unit value must be between 0 and 255 Primary Nameserver Enter the 4 byte DNS Server Address in the blank spaces provided each value unit must be between 0 and 255 The DNS Server is in charge of translating the Domain Name into the IP Address HTTP Port Indicates the specific HTTP Port Number The default is 80 Submit Click to submit the new network setting to the IP camera 33 kel Change the Network Setting FTP Please follow the steps below to change the FTP setting via the network if necessary to upload recording data live 1 Click the FTP button at top left to enter the FTP Server Setting page FTP Server Setting Network FTP Server 192 168 1 1 Fort 21 Q User Name guest SMTP Password SNTP File Upload Path tmp DDNS i ti UPnP IP Filter Traffic FTP Application Setting FTP Schedule FTP Record FTP Alarm FTP Server Login Image JL Network 1 System 1 Application 1 op Card 1 Gen ipcam 2 Type in the FTP Server address

Sony DCR-PC5 Camcorder User Manual

Contents

Download Pdf Manuals

Related Search

Related Contents