miRNome microRNA Profilers QuantiMir™
Contents
1. 2 3ibrain 4 cervix S colon 6lesophagus Page 14 ver 5 072613 www systembio com miRNome microRNA Profilers Human Cat RA660A 1 Mouse Cat RA670A 1 Rat Cat RA680B 1 D Sample Data 1 Analysis of Tumor and Normal Tissue MicroRNA expression levels using the QuantiMir Kit and Real time qPCR The QuantiMir cDNAs were synthesized from both Normal and Tumor Breast Lung Ovary Colon and Lymph node RNAs MicroRNA forward primers specific for miR 9 1 miR 155 miR 125 miR 145 miR 7 miR 17 3p miR 18a miR 20a and miR 92 were using to detect the corresponding microRNA species in the tissues detailed in the expression graph below Fig 6 The signals were normalized to expression levels of the U6 snRNA transcript Fold increases and decreases in Normal vs Tumor tissues are graphed below and are consistent with published findings for the particular microRNA in the specific tumor type Lymph Node m Normal Tumor v gt 2 c 2 y w D amp x Ww gt s O a miR 125b miR 125b Fig 6 Quantitative analysis of MicroRNA expression in tumor and normal tissue samples The Bar graph data are grouped by tissue type with normal tissues in blue bars and tumor tissues in red bars The specific MicroRNAs being detected are listed below the bar graphs The expression levels are normalized to U6 snRNA transcript levels to control for RNA input The MicroRNA expression levels are de2. 888 266 5066 Toll Free 650 968 2200 outside US Page 11 System Biosciences SBI User Manual e Endogenous control assays 500 ng total RNA used for QuantiMir cDNA synthesis 0 01 pl cDNA used per 6 ul qPCR reaction 333 nM Assay 170 nM 3 Reverse ABI 7900HT Instrument MCLab HotSYBR Green Reagent RNU43 snoRNA Human U6 snRNA Amplification plots RNU1A snRNA RNUAS snoRNA Human U6 snRNA COACTOCATAATITGTOSTACTOR CTTATTIGACOGGOOGACAGAAAL CACCADG TTTATACGCOBGTS eS v v v D T S c 2 v issocia D Page 12 ver 5 072613 www systembio com miRNome microRNA Profilers Human Cat RA660A 1 Mouse Cat RA670A 1 Rat Cat RA680B 1 B Sensitivity Tests The QuantiMir cDNAs were synthesized using decreasing amounts of total starting RNA input from a pool of Human Brain Heart Kidney Placenta and Testes RNAs Real time quantitative qPCR assays were performed with Forward primers specific for Human miR 16 10 Signal 250 ng 25ng 2 5ng 250pg 25pg 25pg 250fg cDNA Input 250 nanograms z y 0 6846e2 0034x 5 R 0 9896 lt 250 picograms 250 femtograms oot gt 6 Logs range of detection aoo 0 0001 4 3 2 1 0 1 2 3 Log CDNA Input Fig 4 Real time qPCR data for Human miR 16 Real time qPCR amplification plots are shown in the upper inset Cycle threshold Ct values were determined using the software automatic baseline and Ct settings The Bar graph depicts th
3. 1 Mouse Cat RA670A 1 Rat Cat RA680B 1 Il Protocol A QuantiMir RT reaction setup for 1 RNA sample to be assayed on multiple qPCR 384 well plate It is important to start with total RNA that includes the small RNA fraction RNA input can be as low as 100 ng total For optimum signals perform the following EB Dilute your RNA to 160 ng l Sta rt In a thin walled PCR tube or PCR compatible plate well combine 5 ul Total RNA 800 ng STEP 1 i 2 ul 5X PolyA Buffer 7 1 yl 25mM MnCl PolyA Tail 1 5 pl 5mM ATP 0 5 ul PolyA Polymerase 10 ul Incubate for 30 min at 37 C Add 0 5 ul Oligo dT Adapter STE P 2 P Heat for A at 60 C Anneal Anchor Let cool to room temp for 2 min dT Adapter Add 4 ul 5X RT Buffer 2 ul dNTP mix STEP 3 1 5 ul 0 1M DTT Synthesize 1 5 ul Nuclease free H20 cDNAs 1 ul Reverse Transcriptase 20 5 pl Total in tube Incubate for 60 min at 42 C Heat for 10 min at 95 C The QuantiMir cDNAs can be stored at 20 C For more sensitive applications a single D O n e l phenol chloroform extraction with ethanol precipitation can be performed on the cDNA to g remove proteins unused dNTPs and primers typically this is not necessary 888 266 5066 Toll Free 650 968 2200 outside US Page 5 System Biosciences SBI User Manual B Real time qPCR Reaction Setup Before using the miRNome kit you will need to aliquot the stock primer plate First dissolve the stoc
4. 2005 RNA secondary structure prediction by centroids in a Boltzmann weighted ensemble RNA 11 1157 1166 13 Griffiths Jones S Grocock R J Van Dongen S Bateman A Enright A J 2006 miRBase microRNA sequences targets and gene nomenclature Nucleic Acids Research 34 D140 D144 14 Shingara J Keiger K Shelton J Laosinchai Wolf W Powers P Conrad R Brown D Labourier E 2005 An optimized isolation and labeling platform for accurate microRNA expression profiling RNA 71 1461 1470 15 He L Thomson J M Hemann M T Hernando Monge E Mu D Goodson S Powers S Cordon Cardo C Lowe S W Hannon G J Hammond S M 2005 A microRNA polycistron as a potential human oncogene Nature 435 828 833 16 Lai E C Wiel C Rubin G M 2004 Complementary miRNA pairs suggest a regulatory role for mMiIRNA miRNA duplexes RNA 10 171 175 17 Ambros V Bartel B Bartel D P Burge C B Carrington J C Chen X Dreyfuss G Eddy S R Griffiths Jones S Marshall M Matzke M Ruvkun G Tuschl T 2003 A uniform system for microRNA annotation RNA 9 277 279 18 Obernosterer G Leuschner P J F Alenius M Martinez J 2006 Post transcriptional regulation of microRNA expression RNA 12 1 TA 19 Dostie J Mourelatos Z Yang M Sharma A Dreyfuss G 2003 Numerous microRNPs in neuronal cells containing novel microRNAs RNA 9 180 186 VI MicroRNA and Cancer References
5. 9 SBI System Biosciences miRNome microRNA Profilers QuantiMir Human Cat RA660A 1 Mouse Cat RA670A 1 Rat Cat RA680B 1 User Manual Store kit at 20 C on receipt A limited use label license covers this product By use of this product you accept the terms and conditions outlined in the Licensing and Warranty Statement ver 5 072613 contained in this user manual miRNome microRNA Profilers Contents l Introduction and Background A Overview ll Protocol A QuantiMir RT reaction set up How the microRNA specific primers are designed miRNome microRNA Array arrangements List of Components mMOOW lll Quality Control and Sample Data A miRNome Array Primer Validation Tests amp Endogenous Controls B Sensitivity Tests C Specificity Tests D Sample Data IV Troubleshooting V General References VI MicroRNA and Cancer References 888 266 5066 Toll Free 650 968 2200 outside US 15 16 17 19 20 21 Page 1 Human Cat RA660A 1 Mouse Cat RA670A 1 Rat Cat RA680B 1 System Biosciences SBI User Manual l Introduction and Background A Overview This manual provides details and information necessary to use the QuantiMir RT Kit to tag and convert small non coding RNAs into detectable and quantifiable cDNAs The system allows for the ability to quantitate fold differences of microRNAs between 20 separate experimental RNA samples The array plate also i
6. aley B 2005 Ribo gnome The big world of small RNAs Science 309 1519 1524 3 Bartel D 2004 MicroRNAs Genomics Biogenesis Mechanism and Function Cell 176 281 297 4 Kim Narry V 2005 Small RNAs Classification Biogenesis and Function Mol Cells 19 1 15 5 Valencia Sanchez MA Liu J Hannon GJ Parker R 2006 Control of translation and mRNA degradation by miRNAs and siRNAs Genes Dev 20 515 525 6 Lewis B P Burge C B Bartel D P 2005 Conserved seed pairing often flanked by adenosines indicates that thousands of human genes are microRNA targets Cell 120 15 20 7 Xie X Lu J Kulbokas E J Goulub T R Mooth V Lindblad Toh K Lander E S and Kellis M Systematic discovery of regulatory motifs in human promoters and 3 UTRs by comparison of several mammals Nature 434 338 45 8 Lagos Quintana M Rauhut R Lendeckel W Tuschl T 2001 Identification of Novel Coding for Small Expresses RNAs Science 294 853 858 9 Basyuk E Suavet F Doglio A Bordonne R Bertrand E 2003 Human let 7 stem loop precursors harbor features of RNase III cleavage products Nucleic Acids Res 31 6593 6597 10 Chomczynski P and Mackey K One hour downward capillary blotting of RNA at neutral pH 1994 Anal Biochem 221 303 305 11 Shi R Chiang V L 2005 Facile means for quantifying microRNA expression by real time PCR BioTechniques 39 519 525 12 Ding Y Chan C Y and Lawrence C E
7. e Breast Cancer MicroRNA gene expression deregulation in human breast cancer Cancer Res 2005 Aug 15 65 16 7065 70 lorio MV Ferracin M Liu CG Veronese A Spizzo R Sabbioni S Magri E Pedriali M Fabbri M Campiglio M Menard S Palazzo JP Rosenberg A Musiani P Volinia S Nenci Calin GA Querzoli P Negrini M Croce CM MicroRNA expression profiles classify human cancers Nature 2005 Jun 9 435 7043 745 6 Lu J Getz G Miska EA Alvarez Saavedra E Lamb J Peck D Sweet Cordero A Ebert BL Mak RH Ferrando AA Downing JR Jacks T Horvitz HR Golub TR e B cell Leukemia MicroRNA profiling reveals distinct signatures in B cell chronic lymphocytic leukemias Proc Natl Acad Sci U S A 2004 Aug 10 101 32 11755 60 Epub 2004 Jul 29 Calin GA Liu CG Sevignani C Ferracin M Felli N Dumitru CD Shimizu M Cimmino A Zupo S Dono M Dell Aquila ML Alder H Rassenti L Kipps TJ Bullrich F Negrini M Croce CM A MicroRNA signature associated with prognosis and progression in chronic lymphocytic leukemia N Engl J Med 2005 Oct 27 353 17 1793 801 Calin GA Ferracin M Cimmino A Di Leva G Shimizu M Wojcik SE lorio MV Visone R Sever NI Fabbri M luliano R Palumbo T Pichiorri F Roldo C Garzon R Sevignani C Rassenti L Alder H Volinia S Liu CG Kipps TJ Negrini M Croce CM 888 266 5066 Toll Free 650 968 2200 outside US Page 17 System Biosciences SBI User Manual e Lung Cancer Unique microRNA molec
8. e relative Signal per RNA input amount for the microRNA The graph below shows the linear regression analysis with a Rf value of 0 989 for miR 16 888 266 5066 Toll Free 650 968 2200 outside US Page 13 System Biosciences SBI User Manual C Specificity Tests Petettes Eepression Less s Absolute Ct Value st z hsa miR 1 muscle i z 9 s j Relates Cxorennion Lasst bvoc M aa as mm ee PESTESEFERF SER EE ET PFET LETERPE EEE EE gitsegiee HLE RAAT CE REESE SRESE 3 3 35 3E hU6 snRNA 18 human tissue total RNAs analyzed QuantiMir cDNA Normalized to hU6 signals MicroRNA hsa miR 1 expression abundant in Heart and Muscle MicroRNA hsa miR 122 expression abundant may in Liver PRF 5 52 poi eEagPei g i l3 2 Fig 5 The QuantiMir cDNA sets were synthesized from 18 separate normal Human tissues and tested with 2 primers specific for 2 known miRNA molecules miR 1 heart and skeletal muscle specific and miR 122a abundant in liver The corresponding expression bar graphs are shown in Fig 5 above These two known miRNAs miR 1 and mir 122a have very specific tissue expression patterns Real time qPCR data confirmed that miR 1 is restricted to skeletal muscle and heart The sensitivity of the assays also reveals very low but detectable signals in additional tissues miR 122a is known to be highly abundant in liver Tissue tested skeletal muscle mall intestine 1
9. et DL Perron MP Gobeil LA Plante P Provost P MicroRNAs as oncogenes Curr Opin Genet Dev 2006 Feb 16 1 4 9 Epub 2005 Dec 19 Hammond SM Oncomirs microRNAs with a role in cancer Nat Rev Cancer 2006 Apr 6 4 259 69 Esquela Kerscher A Slack FJ MicroRNAs as oncogenes and tumor suppressors Dev Biol 2006 Aug 16 Epub ahead of print Zhang B Pan X Cobb GP Anderson TA MicroRNAs and the hallmarks of cancer Oncogene 2006 Oct 9 25 46 6170 5 Dalmay T Edwards DR MicroRNAs exhibit high frequency genomic alterations in human cancer Proc Natl Acad Sci U S A 2006 Jun 13 103 24 9136 41 Epub 2006 Jun 5 Zhang L Huang J Yang N Greshock J Megraw MS Giannakakis A Liang S Naylor TL Barchetti A Ward MR Yao G Medina A O brien Jenkins A Katsaros D Hatzigeorgiou A Gimotty PA Weber BL Coukos G Vil Related Products e QuantiMir RT Kit Cat RA420A 1 Complete reagent kit to anchor tag small RNAs and convert them to quantifiable cDNA Kit contains enough reagents for 20 RT reactions and can generate hundreds of qPCR templates A universal reverse adaptor primer 10 uM and positive control primers for Human U6 snRNA 10 uM and Human miR 16 10 uM are also included with the kit e Lenti miR microRNA precursor clone collection Lentivector based microRNA over expression clones also available in pooled lentiviral library cat PMIRHxxxPA 1 e miRZips Anti microRNA constructs Cat MZIPxxx PA 1 Permanently
10. k primers with 22 ul water Pipette up and down a few times to dissolve the primers Then spin down the plate to collect the water at the bottom of the wells Wait about 20 30 minutes Then aliquot 1 ul per well into 20 separate plates Plates can be dried or covered and stored at 4 C These steps will ensure that the stock primer concentration does not change due to evaporation 1 Mastermix qPCR Reaction Set up for ONE entire 384 well qPCR plate To determine the expression profile for your miRNAs under study mix the following for 1 entire 384 qPCR plate For 1 entire plate 1150 ul 2X SYBR Green qPCR Mastermix buffer 39 ul Universal Reverse Primer 10M 5 ul User synthesized QuantiMir cDNA 1090 ul Nuclease free water 2284 ul Total Aliquot 5ul of Mastermix into every well in your 384 well qPCR Plate SBI has tested and recommends SYBR Green Master mix from three vendors 1 Power SYBR Master Mix Cat numbers 4368577 4367650 4367659 4368706 4368702 4368708 4367660 from Applied Biosystems 2 SYBR GreenER qPCR SuperMix for ABI PRISM instrument from Invitrogen Cat numbers 11760 100 11760 500 and 11760 02K 3 RT Real Time SYBR Green ROX PCR Cat numbers PA 012 and PA 112 from SuperArray Resuspend the MicroRNA assay Primers with 20ul water in each well before use Spin briefly to collect contents at bottom of wells Then Load 1ul per well of each of the Primers from the Primer Stock plate into your
11. knockdown endogenous micrRNAs to validate Targets and discover new phenotypes Page 18 ver 5 072613 www systembio com miRNome microRNA Profilers Human Cat RA660A 1 Mouse Cat RA670A 1 Rat Cat RA680B 1 e Small RNA Amplification and Cloning Kit Cat RA400A 1 Simple amplification kit allows cDNA amplification for RT PCR and microarray studies from as little as 50 ng of starting total RNA e Full Spectrum Global mRNA Amplification Kit Cat RA101A 1 The Full Spectrum RNA Amplification Kit provides an inexpensive method to amplify reverse transcribed RNA in a sequence independent unbiased and uniform manner with better representation of 5 end of MRNA sequences This approach maintains the relative levels of each transcript in the starting mRNA samples even when using starting amounts of RNA as low as 5ng or when using heavily degraded RNA e Full Spectrum MultiStart Primers for T7 IVT Cat RA300A 2 Extract more data from your RNA than currently available primers in nearly all commercially available T7 IVT kits using Full Spectrum technology Just replace the existing T7 primer with the Full Spectrum primers Compatible with Affymetrix GeneChip hybridization 888 266 5066 Toll Free 650 968 2200 outside US Page 19 System Biosciences SBI User Manual Vill Technical Support For more information about SBI products and to download manuals in PDF format please visit our web site http jwww systembio co
12. m For additional information or technical assistance please call or email us at System Biosciences SBI 1616 North Shoreline Blvd Mountain View CA 94043 Phone 650 968 2200 888 266 5066 Toll Free Fax 650 968 2277 E mail General Information info systembio com Technical Support tech systembio com Ordering Information orders systembio com Page 20 ver 5 072613 www systembio com miRNome microRNA Profilers Human Cat RA660A 1 Mouse Cat RA670A 1 Rat Cat RA680B 1 IX Licensing and Warranty Statement Limited Use License Use of the miRNome microRNA Profilers with QuantiMir e the Product is subject to the following terms and conditions If the terms and conditions are not acceptable return all components of the Product to System Biosciences SBI within 7 calendar days Purchase and use of any part of the Product constitutes acceptance of the above terms Purchase of the product does not grant any rights or license for use other than those explicitly listed in this Licensing and Warranty Statement Use of the Product for any use other than described expressly herein may be covered by patents or subject to rights other than those mentioned SBI disclaims any and all responsibility for injury or damage which may be caused by the failure of the buyer or any other person to use the Product in accordance with the terms and conditions outlined herein SBI has pending patent applications related to the Prod
13. n below Hsa miR 16 0000065 Simple Directly use sequence PIERE iima To000059 of mature miRNA as forward ee hseamiR 16 primer in oligo design 14 uagcagcacguasauauuggcg 35 SICER experimental cloned 1 5 7 Northern 1 6 Sequence The mature miRNA sequence 5 uagcagcacguaaauauuggcg 3 can be simply converted to a DNA sequence and used directly as the forward primer for end point and qPCR analysis Forward primer for hsa miR 16 included in kit 5 TAGCAGCACGTAAATATTGGCG 3 Tm 58 9 C 45 GC and length 22 bases All of the Micro RNA specific primers for the HT 384 microRNA Profiler were designed in this fashion D miRNome MicroRNA Profiler Array arrangement The array plate contains assays for microRNAs and also includes three endogenous reference RNAs as normalization signals Please see the SBI website to download the qPCR array arrangement and AACT analysis software www systembio com mirnome Page 8 ver 5 072613 www systembio com miRNome microRNA Profilers miRNome Profilers Expression profiling across all Human Mouse or Rat microRNAs Human Cat RA660A 1 Mouse Cat RA670A 1 Rat Cat RA680B 1 updated e Simple to use qPCR Sensitive and accurate microRNA profiling 888 266 5066 Toll Free EES ow Online Resources miRNome Profilers User Manual PDF Free Analysis Software for Rat miRNome Ver 19 xls 650 968 2200 outside US Free Analy
14. ncludes three endogenous RNA assays as normalization signals To ensure optimal results please read the entire manual before using the reagents and material supplied with this kit These MicroRNA qPCR Array Panels come with all the reagents necessary to tag and convert small RNAs from 20 different total RNA samples into quantifiable cDNA using the sensitive QuantiMir technology The kits include assays in pre formatted plates for either all human mouse or rat microRNAs with three endogenous reference RNA controls on each plate All microRNA assays based on the Sanger miRBase microRNA database registered entries Human complete set Mouse complete set Rat complete set All microRNAs All microRNAs All microRNAs cat RA670A cat RA680B 1 cat RA660A 1 All miR major and minor miR forms Page 2 ver 5 072613 www systembio com miRNome microRNA Profilers B miRNome microRNA qPCR profiler workflow miRNome microRNA Profiler Workflow Control Sample Test Sample l QuantiMir cDNA synthesis Combine QuantiMir cDNA Universal 3 Primer 2X SYBR Green Pipet mastermix into 384 well qPCR optical plates Add 1 ul of each Perform Real time qPCR runs Cross compare AACt measurements between Control and Test Samples What this Profiling Array Kit does The miRNome microRNA Profilers enable the quantitation of all registered microRNAs along with 3 endogenous RNA controls for normaliza
15. oll Free 650 968 2200 outside US Page 7 System Biosciences SBI User Manual Instrument setup qPCR cycling and cane henman data accumulation Mercy res conditions T Suwa C 9900 Ematen see vamo fi Travmas Protie Auto incremert Ramp Rate Duta Cotecton Stage 1 Stage 2 Stage 3 af Standard Protocol Repeats 5 1 50 C 2 min 2 95 C 10 min 3 95 C 15 sec 4 60 C 1 min 40 cycles of Stage 3 data read at 60 C 1 min Step An additional recommendation is to include a Dissociation Stage after the qPCR run to assess the Tm of the PCR amplicon to verify the specificity of the amplification reaction Refer to the User Manual for your specific instrument to conduct the melt analysis and the data analyses of the amplification plots and Cycle Threshold Ct calculations In general Cycle thresholds should be set within the exponential phase of the amplification plots with software automatic baseline settings C How the miRNA specific primers are designed for Detection and Quantitation in the Array MicroRNAs typically range in size from 19 24 nt We recommend using the exact sequence of the miRNA or siRNA being studied when designing the forward primer If the miRNA under study is known and documented using the miRBase database can be an easy starting point http microrna sanger ac uk sequences search shtml An example of the known and documented miRNA Human miR 16 is show
16. ons PCR Mastermix including Taq polymerase for PCR 3 0 3 5 Agarose Gel in Tris Borate EDTA TBE or Tris Acetate EDTA TAE Buffer DNA Size Ladder with markers from 50 to 2 000 bp Bio Rad AmpliSize DNA Ladder Cat 170 8200 IMPORTANT Recommended 2X SYBR Green qPCR Mastermixes SBI has tested and recommends SYBR Green Master mix from three venfors Power SYBR Master Mix Cat numbers 4368577 4367650 4367659 4368706 4368702 4368708 4367660 from Applied Biosystems SYBR GreenER qPCR SuperMix for ABI PRISM instrument from Invitrogen Cat numbers 11760 100 11760 500 ahd 11760 02K and RT Real Time SYBR Green ROX PCR Cat numbers PA 012 and PA 112 from SuperArray Page 10 ver 5 072613 www systembio com miRNome microRNA Profilers Human Cat RA660A 1 Mouse Cat RA670A 1 Rat Cat RA680B 1 lll Quality Control and Sample Data A miRNome Array Primer Validation Tests amp endogenous Controls e Real time qPCR validation fm pa Yew Toot meet ie ne ie Os BBS ee rrRae gAs S s ae The miRNome microRNA Profiler qPCR Array plates were tested using a 500 ng RNA sample converted to cDNA using the QuantiMir RT Kit The resulting cDNA was tested using about 1 ng cDNA per well Shown above is the resulting Real time amplification plot for the entire plate The Cts ranged from 16 15 to 37 8 and the Ct value for the Human U6 assay was 26 2 in this experiment
17. picted as ACt vales Y axis Real time assays were performed as described in Section Il D of this manual Fold changes for these specific microRNAs and the particular tumor type are documented in the literature and verified using the QuantiMir RT kit and the selected miRNA primers from the Cancer Array shown above See MicroRNA and Cancer References in Section VI 888 266 5066 Toll Free 650 968 2200 outside US Page 15 System Biosciences SBI IV Troubleshooting User Manual Problem Possible Solution Too much background in qPCR Use much less cDNA in the SYBR signals Green Mastermix No qPCR signals Did you select SYBR Green as the Detectors Reporter Dye Did the controls work Use more cDNA in Mastermix Check Mastermix contents and try a subset with the controls as a positive control Also try lowering the Annealing Temperature to 50 C How do select the Threshold level Typically place the threshold setting in for Ct analysis the upper third of the exponential phase of the amplification curve Also see the User Manual for your specific instrument or phone their technical support team for guidance Page 16 ver 5 072613 www systembio com miRNome microRNA Profilers Human Cat RA660A 1 Mouse Cat RA670A 1 Rat Cat RA680B 1 V General References 1 Sonthelmer E J Carthew R W 2005 Silence from within Endogenous siRNAs and miRNAs Cell 122 9 12 2 Zamore P D H
18. qPCR plate well A1 into qPCR plate A1 etc Once reagents are loaded into the wells cover the plate with an optical adhesive cover and spin briefly in a centrifuge to bring contents to bottom of wells Place plate in the correct orientation well A1 upper left into the Real time qPCR instrument and perform analysis run Page 6 ver 5 072613 www systembio com miRNome microRNA Profilers e Use a Multichannel pipette to load the qPCR plate with MasterMix and Primers Pour the Mastermix into a reservoir trough and use a 8 or 12 channel pipette to load the entire 384 well qPCR plate with the Mastermix Then load the primers from the primer plate to the qPCR plate using a separate multichannel pipette 2 Real time qPCR Instrument Parameters Human Cat RA660A 1 Mouse Cat RA670A 1 Rat Cat RA680B 1 Follow the guidelines as detailed for your specific Real time instrumentation The following parameters tested by SBI were performed on an Applied Biosystems 7900HT Real time PCR System but can also apply to any other 384 well system The details of the thermal cycling conditions used in testing at SBI are below A screenshot from SBI s 7900HT Real time instrument setup is shown below also Default conditions are used throughout Create a detector 1 Create a new Detector 2 Name the Detector any name will do 3 Select Reporter Dye as SYBR Green 4 Select Quencher Dye as none 888 266 5066 T
19. sis Software for Human miRNome Ver 15 xls Eror SBI Keystone 2008 poster identification and Stratification of Clear Cell Renal Carcinoma using microRNA Preliminary linkage of microRNA and mRNA in Human Kidney Cancer PDF Free Analysis Software for Mouse miRNome Ver 14 xis Page 9 System Biosciences SBI User Manual E List of Components Each miRNome microRNA Profiler Kit contains the following components with enough material to perform 20 QuantiMir cDNA synthesis reactions and enough Primers in the microRNA assay array plate to perform 20 384 well qPCR plate sets as outlined in this manual 40 ul Optimized for 6 ul qPCR reactions 20 ul 30 pl 5 mM ATP 10 pl 3 Oligo dT Adaptor 80 ul 5X Reverse Transcriptase Buffer 20 ul Reverse Transcriptase 30 ul 0 1 M Dithiothreitol DTT 50 wl dNTP Mix 2400 ul 3 Universal Reverse PCR Primer 20 ul Each of microRNA assays three controls 1 2 mli RNase free Water The kit is shipped on blue ice and should be stored at 20 C upon arrival Properly stored kits are stable for 1 year from the date received Resuspend each primer assay well with 20u water before use F Additional Required Materials Nuclease free water for qPCR reactions Real time qPCR Instrument Instrument specific optical qPCR plates Thermocycler with heated lid Thermocycler PCR tubes or plates for end point reacti
20. tion 1 QuantiMir cDNA technology tags and converts all small RNAs into cDNAs ready to use as template for real time qPCR 2 Create mastermix with QuantiMir cDNA 3 universal reverse primer and 2X SYBR Green pipet intoqPCR optimcal 384 well plate 3 Pipet 11 of each of the microRNA assays from the miRNome assay stock plate into each well separately 4 Perform Real time qPCR runs using standard run conditions 40 cycles 60 C anneal extension 888 266 5066 Toll Free 650 968 2200 outside US Page 3 Human Cat RA660A 1 Mouse Cat RA670A 1 Rat Cat RA680B 1 System Biosciences SBI User Manual C How QuantiMir cDNA synthesis works How QuantiMir Works P Single Tube 10pg 10 g 7 microRNA total RNA hor tailed 3 Step Assay z PENOS microRNA 5 3 poly A polymerase AAAAAAZ Q Tag small RNA polyA tailed 5 microRNA TA T Incubate at 37 C 30 min w ti A3 NVTTTTTTT IT 5 Anneal adaptor Anneal oligo dT adaptor 60 C 5 min 5 f AAAAD 7 TITT TTT RT to create first strand Convert to cDNA cDNAs 42 C 60 min cDNA pool of anchor tailed microRNAs 3 a I T TITT ee 6 Single cDNA synthesis 5 Profile all microRNAs a irn cDNA templates ready for qPCR primer provided p 3 TTTTTTTTT 5 microRNA specific Forward Primer Assay Page 4 ver 5 072613 www systembio com miRNome microRNA Profilers Human Cat RA660A
21. uct For information concerning licenses for commercial use contact SBI Limited Warranty SBI warrants that the Product meets the specifications described in the accompanying Product Analysis Certificate If it is proven to the satisfaction of SBI that the Product fails to meet these specifications SBI will replace the Product or provide the purchaser with a refund This limited warranty shall not extend to anyone other than the original purchaser of the Product Notice of nonconforming products must be made to SBI within 30 days of receipt of the Product SBI s liability is expressly limited to replacement of Product or a refund limited to the actual purchase price SBI s liability does not extend to any damages arising from use or improper use of the Product or losses associated with the use of additional materials or reagents This limited warranty is the sole and exclusive warranty SBI does not provide any other warranties of any kind expressed or implied including the merchantability or fitness of the Product for a particular purpose SBI is committed to providing our customers with high quality products If you should have any questions or concerns about any SBI products please contact us at 888 266 5066 2009 System Biosciences SBI 888 266 5066 Toll Free 650 968 2200 outside US Page 21
22. ular profiles in lung cancer diagnosis and prognosis Cancer Cell 2006 Mar 9 3 189 98 Yanaihara N Caplen N Bowman E Seike M Kumamoto K Yi M Stephens RM Okamoto A Yokota J Tanaka T Calin GA Liu CG Croce CM Harris CC A polycistronic microRNA cluster miR 17 92 is overexpressed in human lung cancers and enhances cell proliferation Cancer Res 2005 Nov 1 65 21 9628 32 Hayashita Y Osada H Tatematsu Y Yamada H Yanagisawa K Tomida S Yatabe Y Kawahara K Sekido Y Takahashi T MicroRNA and lung cancer N Engl J Med 2005 Jun 9 352 23 2446 8 Eder M Scherr M e Pancreatic Cancer Expression profiling identifies microRNA signature in pancreatic cancer Int J Cancer 2006 Dec 5 Epub ahead of print Lee EJ Gusev Y Jiang J Nuovo GJ Lerner MR Frankel WL Morgan DL Postier RG Brackett DJ Schmittgen TD e Solid Tumors A microRNA expression signature of human solid tumors defines cancer gene targets Proc Natl Acad Sci U S A 2006 Feb 14 103 7 2257 61 Epub 2006 Feb 3 Volinia S Calin GA Liu CG Ambs S Cimmino A Petrocca F Visone R lorio M Roldo C Ferracin M Prueitt RL Yanaihara N Lanza G Scarpa A Vecchione A Negrini M Harris CC Croce CM e MicroRNA and Cancer Reviews Other Publications Cancer genomics small RNAs with big impacts Nature 2005 Jun 9 435 7043 745 6 Meltzer PS MicroRNAs in Gene Regulation When the Smallest Governs It All J Biomed Biotechnol 2006 2006 4 69616 Ouell
Download Pdf Manuals
Related Search