Home

GenTarget`s EcoTMPlasmid DNA Miniprep Kit User Manual

image

Contents

1. Use carbenicillin instead of ampicillin if applicable Do not incubate plates longer than 16 hours 4 Try to avoid picking the tiny satellite colonies Related Products Cat Product Name PCR cloning kit PCR cloning kit Amount kit kit Application PCR cloning kit with a built in vector T7 promoter based in provided cloning cells for E Coli expression of N term His tagged protein PCR cloning kit with a built in mammalian expression vector with neomycin selection marker in provided cloning cells The vector containing an engineered super CMV promoter for high yield mammalian expression of N term His tagged protein PCR cloning kit kit PCR cloning kit with a built in vector T7 promoter based in provided cloning cells for E Coli expression of N term GST tagged protein PCR cloning kit kit PCR cloning kit with a built in vector T7 promoter based in provided cloning cells for E Coli expression of C term His tagged protein PCR cloning kit kit PCR cloning kit with a built in mammalian expression vector with Neomycin selection marker in provided cloning cells for mammalian expression of C term His tagged protein References 1 Oliner et al 1993 Nucleic Acids Res 1 5192 97 2 Aslanidis et al 1994 Genome Res 4 172 177 3 Kaluz et al Nucl Acids Res 1992 20 4369 4370 Eco Cloning pEco BAD nHis manual Page 8 of 8 ww
2. 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com pEco BAD nHis PCR cloning Kit User Manual Patent pending Cloning PCR products for E Coli expression of N term His tagged protein Cat Contents Amounts Application pEco BAD nHis vector built in 10 tubes x 50ul ea Eco Cloning cells for 10 rxn E Coli expression of N IC 1003 Positive PCR insert 1 x 10ul ea term His tag protein 20 L arabinose 1ml best for toxic protein Sequencing primer pair Forward and reverse 15ul each 25ng ul Storage Eco Cloning Kit is shipped on dry ice Upon received stored at 80 C Once thawed must be used do not re freeze Product should be stable for 6 months Product Description 1 Introduction The revolutionary Eco Fusion in vivo cloning method is the easiest PCR cloning method available 1 Simply amplify your gene of interest with a primer pair that is flanked with short arms homologous to the expression vector 2 Add iul of purified PCR into the engineered vector build in cloning cells 3 Immediately proceed to transformation 2 How it works The engineered E Coli strain in GenTarget s Eco PCR Cloning Kit has an enhanced E Coli competent cells enabling an in vivo joining reaction for cloning with no tube reactions Let the E Coli do the job for you In Vivo GenTarget provides E Coli cloning cells
3. and then add ul water to a negative control cells vial Put tubes back on ice and proceed to heat shock at 42 C for 40 seconds Note Do not leave DNA cells mixture on ice for prolonged period less than 15min are fine Put tubes back on ice for 1 min add 250 pl of SOC medium and incubate at 37 C shaking for 1hr Plating take 250 wl aliquot spread out on pre warmed LB agar plates containing 100 wg ml ampicillin Grow colonies at 37 C overnight Note In the absence of a PCR insert cells usually form background colonies the no insert negative control also generates a few colonies In the presence of PCR insert however gt 90 colonies are positive Colony number varies depending on the quality and quantity of the PCR products The concentration of purified PCR product can be from 20 ng ul to 150 ng ul with sizes ranging from 200 bp to 10 kb For simplicity and particularly for high throughput cloning we recommend adding 1 2 ul of PCR product into the cloning cells Regardless of the PCR product s concentration and size it will generate enough colonies 5 100 colonies in general for downstream work 4 Save glycerol stocks for later expression and verification of positive clones Pick 2 5 colonies propagate in LB Amp and incubate at 37 C overnight Save an aliquot of each clone in LB Glycerol medium containing 100 ug ml ampicillin at a final concentration of 15 Glycerol Isolate the plasmid DNAs using a D
4. of final concentrations from 0 2 to 0 00005 to find the concentration for optimal expression Remove a 1 mi aliquot of cells from each tube for analysis of protein expression Be sure to save aliquots of uninduced control samples Analyze protein expression by SDS PAGE or other methods Harvest cells by centrifugation Lyse the cell pellet using lysis reagent Following lysis run a gel protein analysis Purification use your favorite protocol and reagent to purify the expressed His tagged protein by affinity chromatography 6 Vector maps The figure below summarizes the vector map of pEco BAD nHis The complete nucleotide sequence is available for download from our Support page http www gentarget com support vector sequences To make your clone map simply paste your gene sequence not included the flanking sequences of both ends in the Red highlighted position replacing the NNNN NN In most case the pasted sequence is ATG to last codon Eco Cloning pEco BAD nHis manual Page 6 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com CTAGAAATAA TTTTGTTTAA CTTTAAGAAG GAGAATTCAC CATGccc caT GATCTTTATT AAAACAAATT GAAATTCTTC CTCTTAAGTG GTACccc cTA His tag PCR insert CAC CAT CAT CAT CATNNNNN NNNNTAGacG CGTGTTAACC TGCTAACAAG GTG GTA GTA GTA GTANNNNN NNNNATCtTGc
5. with a selection of built in vectors for mammalian or E Coli expression systems A proprietary process for making ready to use E Coli cells with built in vectors ensures low background and a positive cloning rate of greater than 90 Eco Cloning pEco BAD nHis manual Page 1 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com gt z Target PCR Add PCR to cells x m Transformation i I wo e in vivo cloning O O S e pEco BAD nHis cloning cells has a built in non T7 based expression vector with an E Coli araBAD promoter The promoter is tightly inhibited by an AraC regulatory protein expressed from the vector backbone This basal level self control mechanism is ideal for the expression of toxic proteins avoiding the difficulties associated with direct cloning and expression Target expression is induced by L arabinose which releases the AraC regulatory protein and the expression level can be optimized and protein solubility enhanced by varying the concentration of L arabinose The PCR insert is cloned in frame with an N terminal His tag 3 Key Features e The easiest and most cost effective PCR cloning method available Simply add iul of PCR insert into provided cells for transformation regardless of the insert s size and concentration e No need to buy vecto
6. GCACAATTGG ACGATTGTTC Map of pEco BAD nHis vector 02 operator arabinose promoter m EcoRI CAP binding 2 ee cloning ends O2 operator 4 19 CAP binding with 11 12 161 251 Arabinose promoter 248 276 RBS 329 334 GOI cloning ends 365 366 Amp 901 1761 pUC19 pro 1906 2579 araC gene 3988 3110 7 Troubleshooting Problems Solution No colony Be sure to set up a positive control transformation using the provided positive PCR insert1 which should give you 10 100 colonies Spread all of the transformation mixture onto the plate Eco Cloning pEco BAD nHis manual Page 7 of 8 www gentarget com GenTarget Inc Copyrights 2015 GeniTarset ine 7930 Arjons Drive Suite B San Diego CA 92126 Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Background Be sure to set up a background control plate in which no colonies PCR product was added to the cells It should generate 0 5 colonies or less than 10 compared to plates with the insert Note in the absence of a PCR insert cells force vector self ligation resulting in a few background colonies Make sure that the PCR s template does not cause background colonies If it does clean PCR products by gel isolation or treatment with DPNI Plate less transformation mixture onto the plate Satellite Be sure to use the right amount of antibiotics in the LB colonies plate and make fresh LB plates if necessary
7. NA miniprep kit Confirm the positives by restriction digestion i The PCR insert can be cut out at two unique sites EcoRI Hpal ii Run a 1 2 agarose gel You should see two bands 4 kb backbone the PCR insert or multiple bands when the cuts exist within the PCR insert Final sequencing verification Use the provided sequencing primer pair The sequencing primer comes in a ready to use dilution use 1ul for each sequencing reaction with 500ng plasmid in 20ul volume Eco Cloning pEco BAD nHis manual Page 5 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com Cat Vector Forward primer Reverse primer IC 1003 pEco BAD IC 1003 fwd IC 1003 rev nHis 5 gaaataattttgtttaactt 5 gatttaatctgtatcagg 5 Protein expression Once positive clones are confirmed they can be used directly for protein expression without re transformation into another strain Add 10 ul of your positive clones in 4ml of LB medium with 100ug ml ampicillin grow at 37 C overnight shaking 225 250 rpm The next day measured OD should be approximately 1 2 Inoculate a large volume by making a 1 100 dilution of overnight culture in LB or SOB medium containing 100 ug ml ampicillin Grow the cultures at 37 C with shaking to an OD600 0 5 Induce expression by adding L arabinose in a range
8. ain a 20 25bp homologous sequence corresponding to the built in vector Design your primer pair as follows Fwd 5 catggcgcatcaccatcatcatcat 20bp of 5 end gene specific forward sequence Rev 5 ttgttagcaggttaacacgcgtcta 20bp of 3 end gene specific reverse sequence A protein cleavage site may be included in the forward primer to allow excision of the N term tag if desired Its codon sequences must be in frame and set between the homologous leader and the 20bp gene specific sequence An example of PCR primer design Eco Cloning pEco BAD nHis manual Page 3 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com To design the primer pair for the following gene sequence atggcctctgtgaaggaaaatccactctagtccctacctgcatttctcagccttgct tacctgttgccaacattgggccaacccgaattcttcccaatctttatcttggctgcca gcgagatgtcctcaacaaggagctgatgcagcagaatgggattggttatgtgtta aatgccagcaatacctgtccaaagcctgacttttta The PCR primer for vector pEco BAD nHis will be Fwd 5 catggcgcatcaccatcatcatcatatggcctctgtgaaggaaaa Rev 5 ttgttagcaggttaacacgcgtctaaaagtcaggctttggacagg If inserting a protein cleavage site the Forward primer will be Fwd 5 catgcatcatcaccatcatcatcatNNNNNNgcctctgtgaaggaaaatcc Where the NNNNNN is the in frame codon sequence of the cleavage site Notes 1 GenTarget s cloning k
9. its with the same terminal tags share PCR insert sites The three Eco cloning kits with N terminal tags Cat IC 1001 IC 1002 and IC 1003 can share the same PCR insert and the two cloning kits with C terminal tags Cat IC 1006 and IC 1007 can share the same PCR insert 2 A stop codon does not need to be included in the PCR reverse primer since a stop codon is already built in immediately after the PCR insert 2 Target amplification by PCR Amplify your target using any PCR amplification protocol that works for you To minimize PCR errors we recommend using high fidelity DNA polymerase Use any PCR purification column to clean your PCR products If you do not obtain a single discrete band from PCR gel purify your fragment Important if your PCR template can generate background clones having Amp resistance treat the PCR product with DPNI or perform gel purification Eco Cloning pEco BAD nHis manual Page 4 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com 3 Transformation Thaw Eco Cloning cells in ice water After they are completely thawed add 1 2 ul purified PCR product from 20ng to 150ng into each vial of cells and mix briefly by tapping the tube with your finger For control vials add 1ul positive PCR insert provided as a positive control
10. rs and no tedious bench work preparing a vector backbone e No need to buy cloning competent cells e No need for any enzymes or any tube reactions e Precise directional cloning of PCR products without any extra amino acids except the affinity tag N His e Flexibility to allow addition of any cleavage site for removal of N terminal His tag if desired e Compatibility with any PCR product with or without a 3 A overhang the extra A overhang if it exists will be removed in the cloning step Eco Cloning pEco BAD nHis manual Page 2 of 8 www gentarget com GenTarget Inc Copyrights 2015 7930 Arjons Drive Suite B San Diego CA 92126 el arue ne Phone 858 6788683 Fax 800 3804198 Email Orders gentarget com e Can be used with PCR products of varying sizes from 200 bp to 10 kb The same PCR product can be used to construct multiple different expression vectors e Engineered E Coli and mammalian expression vectors for high protein yields e Great for high throughput cloning 4 Protocol Outline Produce and clean PCR products v Add 1 2 ul of PCR product into the cloning cells provided briefly mix and immediately proceed to transformation v Pick colonies save glycerol stocks and isolate plasmids by miniprep to verify the positive clones v Express protein from the saved glycerol stock 5 Detailed Protocol 1 PCR primer design PCR primers used for generating inserts for Eco Cloning must cont
11. w gentarget com GenTarget Inc Copyrights 2015

Download Pdf Manuals

image

Related Search

Related Contents

Aphex Systems 320A Stereo System User Manual  HD Guide  Quel système bancaire pour l`après-crise ?  Vol.6 「技工フリーダイヤル」  JUS DE CANARD NOUVELLE GENERATION  Recommendations for Minimal Wi-Fi Capabilities of  etherma 110 c  Guide de dépannage de Java Desktop System Version 2  図面(PDF:1759KB)  DEFY DHG 116 User's Manual  

Copyright © All rights reserved.
Failed to retrieve file