Home

1901-01 RC Manual

1. s USER 5 GUIDE sn 0 Idaho Technology Inc The RapidCycler Vent Capillary Tube Modules NY Display Screen Note This illustration is optimized for printing dN ONILLAS SNITIIQNVH JidWvs Contents gt IITOAUCHON T UO ITI OMIM C Setting Up the RapldGycler s sieur eet itt Ga setti eue tene ertt re trie teure eq v ER 3 Sample Hanlliri ettet rette o e eed aen date EE a eene oce e Cb ER das 4 33 zm PODIAN alo DERECHO ROOTED 21 g TTOUBIS SHOOTING iras a A A A A BAT A ATR A ARA 34 58 Zs service and Maihtengtiee u citerior evan easy D at ERES Ke di van ERRARE EE CER ir n 38 zn g Warrdnty and Upgrades iter re e tn RR ERE PIX NANEN RENNEN 46 pierde E 47 Automated polymerase chain reaction in capillary tubes WATE MOT o MER EN THEE 48 S3aviaodn ANV AINViUIVM Minimizing the time required for DNA amplification by efficient heat transfer to ssmallsatrnples 4 c iin itte o D RR ca odie 54 sJTOILAV Rapid cycle DNA amplification time and temperature optimization s sesssssrsinktt st rorarono nan memes 63 FEIERT MIN ISr1oAodlid v Introduction The RapidCycler is a rapid temperature cycling system based on heat trans fer by hot air to samples contained in thin capillary tubes For most reactions products can easily be visualized with ethidium bromide o
2. 50 mM Tris pH 8 3 2mM MgCl2 with 200 uM each dNTP 250 ug ml BSA Some primer pairs have only amplified with this no KCI buffer conventional high KCI and our original buffer were not effective Although it is probably true that no single buffer is best for all amplifications we have successfully amplified about 8096 of untested primer pairs with this buffer Most of the remainder can be amplified by varying the Mg concentration from 1 3 mM DNA amplification reactions are very resilient and many additives appear to have little or no effect on the reaction Ficoll 400 0 5 196 and tartrazine 1 mM are convenient to add to a reaction mixture before amplification if the products are going to be analyzed by gel electrophoresis This allows direct transfer of the solution into a gel well from the capillary tube after amplification without inter mediate mixing 1 If you run many reactions and are looking for quick results this is very convenient By running parallel reactions with and without Ficoll tartrazine no significant differences in specificity or yield have been observed Whether certain buffers are more amenable to rapid vs conventional cycling has not been adequately studied Reaction kinetics and equilibrium constants will change with different buffers but the effects on amplification are poorly understood Buffers other than those suggested here can be used for rapid cycle amplification but BSA must be included in the rea
3. 2 5 mg ml BSA 250 ug ml dH20 4 ul 2 z5 o 20 m lt Jo mr An E Note BSA is present in both the 10X buffer and the enzyme diluent for a final concentration in the reac tion of 500 ug ml We usually use a 5 uM 10X solution of each primer The concentration of primer stocks should be determined spectrophotometrically at 260 nm The extinction coefficient of an oligonucleotide is affected by base sequence and is best estimated by considering neighboring pairs 4 Commercially available computer programs such as Oligo 4 0 National Biosciences Hamel MN auto matically perform the calculation A summary of reactant concentrations is given in Table 1 Suggested volumes of reaction components for a master mix for 4 8 16 10 u I samples are listed for convenience in Table 2 below Kits supplying the components of this system exclusive of primers template DNA and enzyme are commercially available Idaho Technology Salt Lake City Utah Table 2 Component 10X Number of 10ul Reaction Tubes 4 8 16 Buffer 5 ul 9 ul 17 ul aNTP s 5 pl 9 ul 17 ul Left Primer 5 ul 9 ul 17 ul Right Primer 5 ul 9 ul 17 ul Template DNA 5 ul 9 ul 17 pl Taq 0 4 U ul 5 ul 9 ul 17 pl dH20 20 ul 36 ul 68 ul Total Volume 50 pl 90 ul 170 ul 2 La oe 03 az aw IZ oz References 1 Wittwer CT and DJ Garling Rapid cycle DNA amplification time and tem perature optimization BioTechniques 10 76 83 1991 2 Wittwer C
4. related the percentage GC and Figure 4 Correlation of optimum annealing tempera the Tm calculated by a commer te ee RIMEL cially available program to the final optimized annealing temperature We found that the best predictor of annealing temperature was the GC percentage of the lowest GC primer Figure 3 The Tm of the least stable primer was almost as good at predicting annealing temperatures Figure 4 Tm of Lowest Primer The amount of time spent at annealing has a direct effect on the specificity of the amplification reaction Figure 5 The longer you spend at the annealing temperature the more non specific priming you see You will notice in Figure 1 EJ zE Su 20 E m lt e mm AG z that the polymerase has significant m Ramp Time Annealing Time activity at temperatures that are 99 to 55 C sec at 55 C sec commonly used for annealing As you spend more time at the anneal ing temperature there is a greater chance of non specific priming and extension of undesirable product We recommend that when using the standard 10 ul capillary tubes you set your annealing time at O seconds to maximize specificity As with the denaturation temperature the 25 ul tubes require a hold time of 5 10 sec and the 50 ul tubes require 10 20 sec Some amplifications especially those with low Tm s may also require longer annealing times 5 to 15 sec Figure 5 Effect of annealing time on DNA amplifi cation r
5. 2 Cycle parameters as they occur on Air Thermo Cycler screen D94 A50 E72 C30 S9 dO o0 el 3 Hold 5 min at 72 Magnetic Strand Separation amp Purification of Both DNA Strands There are several methods for preparing single stranded DNA from PCR products such as asymmetric Acetate Solution Potassium acetate pH 4 8 amplification exonuclease digestion 5 M acetate 3 M K and magnetic separation prefer 294 g KCH3CO2 the last as it is fast and the magnetic LONE dede beads lend themselves to a number of other techniques It requires that HBWB high salt Binding amp Wash Buffer one and only one of the two PCR 10 mM Tris pH 7 5 primers be biotinylated Generally 3 SN M there is little additional cost for this service DynaBeads or Beads DynaBeads M 280 Dynal H20 to 1 liter no need to check pH mM Tris pH 7 4 mM Na2bDTA The protocol yields two DNA strands separated and purified in A Glycogen solution 20 mg ml manner suitable for direct sequenc Boehringer Mannheim Catalog 901 393 ing The W strand is biotinylated and the C is its complement Preparation of the W strand is a modification of the Dynal protocol which conserves beads with no apparent sacrifice in yield The method for preparing C strand is new Typically 5 uL of either strand preparation is used in a single sequencing reaction 1 Wash the beads vortex bead stock add 10 uL beads to 20 uL HBWB in tube W
6. Separate lu Combined lul m 5 zo 20 a m lt e ne o0 a Amplification Procedure 1 Prepare master mix without DNA and without primers weekly For 50 runs at a 10 ul reaction volume For gt 50 runs at a 10 ul reaction volume Dilute Enzyme to 0 4 U ul 11 5 parts Enzyme diluent 10 mM Tris pH 8 3 2 5 mg ml BSA part Enzyme 5 U ul For separate 5 uM primers For separate 5 uM primers 4 parts dH20 308 61 5 parts dH20 1 part buffer 63 ul 12 5 parts buffer 1 part 2 mM dNTPs 63 ul 12 5 parts 2 mM dNTPs 1 part 0 4U ul Enzyme 5 ul 1 part 5U ul Enzyme For combined 5 uM primers For combined 5 uM primers 5 parts dH20 370 74 parts dH20 1 part buffer 63 ul 12 5 parts buffer 1 part 2 mM dNTPs 63 ul 12 5 parts 2 mM dNTPs 1 part 0 4U ul Enzyme 5 ul 1 part 5U ul Enzyme Mix and store at 4 C for 1 week Mix and store at 4 C for 1 week 2 For each run with a specific primer pair make a primer specific mix For separate 5 uM primers For separate 5 uM primers 1 part 5 uM primer 1 1 part 5 uM primer 1 1 part 5 uM primer 2 1 part 5 uM primer 2 7 parts master mix 7 parts master mix 3 Add 1 ul of each sample DNA for genomic DNA 50 ug ml or A260 1 0 to individual wells in a microtiter plate Pipette 9 ul of the specific primer mix into each well and mix by pipetting up and down Load capillary tubes into the mod ular tops and aspirate 8 samples at a time by capillary act
7. The capillary tubes were placed verti 1 cally in a holder con I structed of 1 mm i marble thick prepunched H MACHINE perfboard Radio Shack Fort Worth TX The mixture was cycled 30 times through denatura 2 3 tion 94 C 1 min TIME IN MINUTES annealing 37 C 2 min and elongation 70 C 3 min steps Temperature moni TEMPERATURE IN C toring within the capillary tubes was done with 30 gauge J type thermocouple wire placed in 100 pl of deionized water and connected to a thermocouple meter Precision Digital PD710 Watertown MA Amplification products 5 100 ul were fractionated by electrophoresis on a 1 5 agarose gel RESULTS AND DISCUSSION The temperature profile of a sample in the cycling apparatus was compared to that obtained by manually transferring microfuge tubes between water baths Response times at each phase of the thermal cycle were roughly equivalent Fig 3 The temperature response of samples transferred between water baths is lim ited only by the heat conduction properties of the microfuge tube The response times of commercial machines is also limited by the heat capacity of their metal heating cooling blocks The air cycler has the advantage that heat transfer occurs through a low heat capacity medium air that can be warmed very rap idly The response time for sample cooling depends strongly on the heat capac ity of the system materials The current cycler was constructed fro
8. lt lt uz Ow zz uit P2 LIGHT BULB REPLACEMENT Tools amp supplies needed Flat blade screwdriver Replacement Bulb Ushio 500 W Mini Candella halogen bulb 1 Turn off the power switch on the back of the instrument Unplug instrument If the instrument has been recently in operation wait for approximately five min utes for the light bulb to cool lt lt NEVER ATTEMPT TO REMOVE A HOT BULB gt gt rigure 1 2 Completely loosen the four top corner screws Figure 1 These screws are captive style screws and do not come completely out of the instrument top but can be completely loosened in place 3 Lift the back of the top duct straight up Figure 2 The top of the instrument and the top duct should lift up approximately 7 16 1 cm If Figure 2 the instrument top does not lift up check the four corner screws to ensure they are com pletely loose If the top still does not easily lift up gently pry up the back of the instrument top near the back duct Figure 3 Figure 3 4 After the instrument top lifts straight up raise the front of the instrument top up and back to allow access to the bulb Figure 4 5 Carefully check the bulb to ensure it is cool Unscrew and remove the old bulb being careful to not break the bulb 6 Insert new bulb Do not touch the glass portion of the new light bulb with bare hands Use protective liner included with bulb 7 While the top is open
9. 10 ul sample 10 sec holds g B S o a 5 x a E 3 o Sample Temperature Temp to Set Temp you want 7 1 22 Temp to Set Temp you want 1 8 1 10 r 10 45 50 55 Air Temperature Air Temperature Figure 4 Linear relationship between the temperature programmed into the air cycler and the actual sample temperature for thin walled capillary tubes 4A 10 ul samples 10 second holds no oil overlay 4B 50 ul samples 30 second holds no oil overlay ETTE DEYEL LsMDADdIidva Direct Sequencing of Long PCR Products Eric Kofoid Dept Biology University of Utah Introduction Vitamin B12 is an essential cofactor of many non photosynthetic eukaryotes It is synthesized by prokaryotes and archebacteria both aerobically and anaero bically In Salmonella typhimurium the anaerobic pathway is dependent on at least 30 genes Several of these genes also occur in Escherichia coli allowing syn thesis from intermediates In spite of the fact that over 1 of the Salmonella genome is dedicated to B12 synthesis cells unable to make the cofactor do well anaerobically under lab oratory conditions Only a few B12 dependent pathways are known and none seem essential For example the eut enzymes enable growth on ethanolamine as a source of carbon or nitrogen the pdu regulon allows utilization of propane diol as a carbon source and the MetH protein provides an alternate route for the final step in methi
10. The template DNA should be denatured before the cycling reaction begins We link a two minute hold at 94 to the beginning of the cycling program Alternately genomic DNA that has been denatured by boiling and then stored at 20 never reanneals E 2 pr 9 gt Q a a lt paz 3 Mg Concentrations We use 3 different reaction buffers in our amplification reac M 50 60 tions and they differ only in Mg2 concentration The low medium and high Mg2 buffers contribute reo 1 0 mM Mg2 2 0 mM Mg2 and Concentration 3 0 mM Mg2 to the final reaction respectively Increasing Annealing Temp The optimal Mg2 concentra tion is different for every template adn primer set and must be deter mined experimentally Magnesium ions stabilize DNA Figure 1 Effect of Mg2 concentration and anealing duplexes Therefore lowering temperature on stringency Mg2 concentration increases stringency while raising Mg2 concentration lowers stringency Figure 1 It has been reported that high Mg2 leads to an increased rate of nucleotide misincorporation so if you are cloning your DNA products you may wish to avoid the high Mg2 buffer 4 dNTP s Our usual final ANTP concentration is 200 uM of each dNTP Increasing this concentration does not effect the yield of the reaction If you are using low Mg2 concentrations remember that each dNTP chelates a magnesium ion so you need at least 0 8 mM Mg2 to have any free M
11. o la E o 3 0 S 1 a e o z E o 2 x lt a We use 70 C as our standard elongation temperature The extension rate vs temperature curve Figure 2 for Taq poly Figure 2 Extension rate vs temperature for Taq poly merase activity shows a broad Merase peak of about 100 nucleotides per second between 70 and 80 C The amount of time at elonga tion should be varied with product length Taq polymerase catalyzes the addition of about 100 nucleotides per second at 70 C For very small DNA products tar get lt 100 bp no elongation time at all is required These products will elongate in transit For medium length targets 100 500 bp 5 to 15 seconds elongation is sufficient A GE oh Lowest Primer Longer products must use propor Figure 3 Correlation of optimum annealing tempera tionally longer times approxi ture of GC content of lowest primer mately 15 and 30 seconds per kilo base of product Optimal Annealing Temp 20253035404550556065 The annealing temperature is the most important variable in a DNA amplification As mentioned above calculated values of Tm should not be taken too seriously but the consistent use of a single program can be helpful in pre dicting effective relative anneal ing temperatures for different primer sets a E En E ob ds s o E E x E B a o 35 40 45 50 55 60 In a group of 15 pairs of twen ty nucleotide long primers we cor
12. sequentially but the programs to be linked must fulfill all the criteria for cycle or hold programs for the link program to run to completion Segments are run in order from the upper left to lower right Empty segments are skipped Change to program 03 by pressing O and 3 The parameters should all be null or O Press the right arrow cursor key to enter the first link segment To link hold or cycle programs using a link program you must enter 3 digits for each seg ment The first digit must be either a 1 or 2 which represent a C for Cycle program or H for Hold program respectively Note that the 1 key has the word CYCLE on it and the 2 key has the word HOLD on it The next two dig its represent the program number of that cycle or hold program For example if you want to link an extended denaturation to a cycle pro gram then finish with an extended elongation enter hold program 03 cycle program 03 and hold program 04 in sequence Tab the cursor to the first seg ment right arrow cursor key and type 203 for hold program 03 Tab to the next segment and enter 103 for cycle program 03 Finally tab to the third segment and enter 204 Note that when you tab away from a link segment the first digit is changed from a 2 to an H or from a 1 toa C If you have not set up cycle program C03 and hold programs HO3 and HOA as described in the CYCLE MODE and HOLD MODE sections of this chapter you may wish to m
13. 10 ul sample Figure 6 Rapid DNA amplification Each 10 ul sample contained 0 8U of Taq polymerase and 30 cycles of ampli fication were performed Sample tem perature profiles for the 15 and 30 min amplifications are given in Figs 2 and 3 respectively Other temperature pro files are described in the text PhiX 174 RF Haelll Digest 536 bp L3 1 Amount per slot ul 10 10 Amount Amplified u 100 10 Taq Units per 100 ul PhiX 174 RF Haelll Digest 90 60 30 15 10 Total Amplification Time min around the elongation temperature is evident in the 60 s cycle from the propor tional controller Temperature profiles for the 20s cycle showed only a slight inflec tion at a sample elongation temperature of 72 C not shown The 120 s and 180 S cycles had elongation times twice their denaturation times not shown Samples of 10 ul can be amplified with a yield equivalent to 100 ul samples in the air cycler Fig 4 In capillary tubes the amplification volume can be reduced to 1 ul with the product still detected by ethidium bromide staining in agarose gels Gels from rapid amplifications are shown in Figs 5 and 6 In Fig 5 the dependence of amplification on polymerase concentration is shown for 30 s cycles Band intensity is strongly dependent on the amount of polymerase added Figure 6 shows that although amplification efficiency is reduced with extremely rapid cycling significant amplification still occurs a
14. 191 8 Williams J G K Kubelik A R Livak K J Rafalski J A and S V Tingey 1990 DNA polimorphisms amplified by arbitrary primers are useful as genetic markers Nucleic Acids Res 18 6531 6535 z Qe di JE as Ow z 9 Welsh J and M McClelland 1990 Fingerprinting genomes using PCR with arbitrary primers Nucleic Acids Res 18 7213 7218 Comparison of Different PCR Cycler Machines for Rapid and Sensitive Detection of Pathogens Rong fu Wang Wei wen Cao Carl E Cerniglia Microbiology Division National Center for Toxicological Research M G Johnson Food Science Department University of Arkansas Corresponding Author Abstract In order to find a rapid PCR method to detect bacterial pathogens we com pared different PCR cycler machines The total cycle time to complete the PCR amplifications were 5 hours in the BioOven BioTherm Co PCR cycler 1 5 hours in the MiniCycler MJ Research Inc 2 5 hours in the Perkin Elmer Cycler 480 3 hours in the PHC 2 Cycler Techne Inc but only 30 minutes in the 1605 Air Thermo Cycler Idaho Technology Using the 1605 Air Thermo Cycler with our rapid and simple sample preparation method the total detection and identifi cation time was 1 5 2 hours including 30 minutes for the PCR cycles and 40 min utes for electrophoresis Eight bacterial species have been tested with this proto col in the 1605 Air Thermo Cycler all of them gave good results
15. 3 500 ul 50 mg ml BSA 9 5 ml dH20 All solutions are made from deionized distilled water No stir bars or pH meters are to be used in the preparation of stock or working solutions Check pH by withdrawing 10 ul of solution and placing it on pH paper 2 M Tris pH 8 3 14 80 g Tris base Sigma T1503 12 28 g Tris HCI Sigma T 3253 to 100 ml with H2O Or zm me Su 20 m lt Jo mr An 2 2 p 9 gt Q a a lt c Tr E TT a Ya rf z 27 08 g TRISMA Preset pH 8 3 Sigma T5128 to 100 ml with H2O 1 M MgCI2 20 3 g MgCl2 Sigma M9272 to 100 mi dH20 Or Sigma M1028 ready made 50 mg ml BSA 0 50 g BSA Sigma A2153 to 10 ml dH20 use 15 ml tube 10 mM Cresol Red 404 mg cresol red Sigma C9877 to 100 mi dH2O 40 w v Sucrose 40 0 g sucrose Sigma 5016 to 100 ml dH2O 0 5 M EDTA pH 8 3 18 6 g disodium EDTA Sigma ED2SS 10 mI 5 N NaOH Baxter H369 1 NY to 100 ml dH2O Rapid Cycle DNA Amplification The 10 Most Common Mistakes Carl Wittwer Dept Pathology University of Utah Medical School Mistake 71 Not having bovine serum albumin in the reaction You will not get amplifica tion in capillary tubes without BSA Most buffers supplied by manufacturers of the enzyme do not include BSA BSA is necessary to prevent surface adsorption inac tivation of the DNA polymerase on the large surface area of the capillary tubes Yield increases with BSA concentra
16. 74 C elongation This reaction produced a 94 bp band as seen on a 4 Nusieve agarose gel indicating that the 100 bp fragment was the correct DNA sequence A duplicate reaction to the one directly above was done with the 100 bp fragment as tem plate and the original outside primers 1c and 1nc to amplify the 100 bp frag ment One 10 ul reaction gave approximately 30 ng of product The 100 bp product was cloned directly into the pCRII amp vector from the Invitrogen TA Cloning Kit Subsequent DNA sequencing of this vector confirmed that this product coded for the original amino acid sequence and will be used as a probe for subsequent experiments zm 5 zu 20 2 m lt Jo me An 2 x La JE au az aw 4z oz Superior Quantitation of Rare mRNA s Using Rapid Cycling Randy P Rasmussen Dept of Biology University of Utah After a long period of skepticism quantitative PCR is finally gaining accept ance in the molecular biology community No one doubted that PCR could be quantitative in theory but there was a general consensus that the efficiency of DNA amplification would be too sensitive to interference for practical quantita tion Small effects on the reaction s efficiency it was argued would destroy the quantitative value of PCR Quantitation of mRNA added the additional compli cation of the reverse transcription step Despite these initial concerns it has now been thoroughly demonstrated that the quant
17. air cycler and the actual sample temperature for thin walled capillary tubes 4A 10 ul samples 10 second holds no oil overlay 4B 50 ul samples 30 second holds no oil overlay CAPILLARY TUBE HANDLING e with the RepidCucler One of the biggest concerns for new users of air cyclers is the handling and sealing of glass capillary tubes While they are a bit more difficult to use than the traditional microcentrifuge tube the rapid cycle times and temperature homo geneity made possible by the capillaries makes them more than worth the extra trouble After a little practice you may wonder why you ever worried JIdNVS TI gt z s Z z o 1 SINGLE TUBE HANDLING Mixing the Sample You can mix your reaction in any sort of container use low protein absorb ing microtiter dishes IT22590 Take care at the mixing step as one of the most common causes of reaction failure is forgetting a component of the reaction see The 10 most common mistakes Rapid Cyclist 2 11 12 The chances of leaving something out can be reduced by making up master mixes that con tain everything but primer and template The mix can be stored at 4 C for up to 3 months see Reaction mixes and buffer recipes Rapid Cyclist 2 9 Figure 2 Directly injecting sample into the tube using a pipetman Figure 1 Tipping the capillary tube sideways to increase the rate of liquid uptake Figure 3 Sealing capillary with a Blazer mini butane tor
18. air temperature cycling of 1 to lO ul samples in glass capillary tubes can amplify DNA by the polymerase chain reaction in 15 min or less A rapid temper ature cycler of low thermal mass was constructed to change sample tempera tures among denaturation annealing and elongation segments in a few sec onds After 30 cycles of 30 s each a 536 bp B globin fragment of human genom ic DNA was easily visualized with ethidium bromide on agarose gels With rapid cycling amplification yield depended on polymerase concentration The time required for DNA amplification can be markedly reduced from prevailing proto cols if appropriate equipment and sample containers are used for rapid heat transfer to the sample 1990 Academic Press Inc The minimum time required for DNA amplification by the polymerase chain reaction 1 2 has not been rigorously investigated No systematic study of opti mal times for annealing elongation and denaturation is available because no device has been able to change the sample temperature quickly enough to make such study meaningful Commercial instruments spend a significant amount of time changing the sample temperature 3 A number of commercial cyclers use aluminum blocks and microfuge tubes to cycle temperature for the polymerase chain reaction Standard protocols for a 30 cycle amplification are usually 2 6 h in length and a large fraction of this time is spent heating and cooling the sample Time is required both to
19. and sample temperature profiles determined with a miniature thermocouple probe Profile A resulted when the instrument was programmed to denature at 93 C for 1 min anneal at 55 C for 2 min and elongate at 74 C for 3 min Profile B was obtained by modifying the program to mini mize sample times at each tem perature 35 sec at 55 C 45 sec at 77 C and 35 sec at 93 C The rapid air cycler was used for pro files C and D In profile C a 1 min elongation time at 77 C was used Profile D uses a 10 sec elon gation time at 77 C and is the 30 sec base profile described in Materials and Methods neous Homogeneity of sample temperature is better with small samples and with symmetric high surface area to volume containers Small thin capillary tubes are SAMPLE TEMPERATURE C Temperature Profile TIME min Time for 30 Cycles hr 4 2 0 67 0 25 PhiX174 RF Hae III Digest SJIONIV ideal microcentrifuge tubes are not Capillary tubes can be sealed with a Bunsen burner in less time than it takes to overlay the sample with mineral oil and close a microcentrifuge tube After amplification the ends of the glass capillaries can be quickly scored with a file and snapped off easily with less risk of aerosolization and contamination than microcentrifuge tubes The capillary tubes serve both as a wn wi a Q E lt transfer pipette and a container for temperature cycling The am
20. and MgCI2 solution is prepared in distilled H20 5X reaction buffer contains 250 mM Tris pHz8 5 5mM MgCl2 100 mM KCL 2 5 mg ml BSA 12 5 Ficoll 400 and 1 xylene cyanole For a set of 100 reactions a master mix containing dNTP s MgCL2 Taq DNA poly merase Promega Corp and reaction buffer is prepared by mixing 200 ul 5X zm zs Su 20 m lt Jo mr An E buffer 40 ul 25X MgCI2 aNTP s 12 ul Taq polymerase 5 units ul and 348 ul dis tiled H20 Reactions are then prepared in 10 ul volumes by combining master mix 5X template and 5X primer in the ratio 3 1 1 The final concentrations in vol umes of 10 ul should be 2 ng ul template DNA 4 uM primer 100 uM each dNTP 2 mM MgCl2 06 U ul polymerase and 1X reaction buffer Amplification is divided into two steps For the first two cycles the thermal pro file is 1 minute at 92 C 7 seconds at 42 C and 70 seconds at 72 C Subsequently an additional 38 cycles are performed with denaturation for 1 second at 92 C annealing at 42 C for 7 seconds and elongation at 72 C for 70 seconds Following these forty cycles the temperature should be held constant at 72 C for 4 minutes Some Comments on Reaction Optimization A particular RAPD product generated from a unique primer and template combination will require a specific set of optimum conditions Our goal was to get good bands for a large number of primers making our protocol as general as possible Also we wanted to b
21. as per the instructions found in the Programming section of this manual If the desired pro tocol is being displayed press the RUN STOP button several times and watch the display The display should change with each press of the RUN STOP button shift ing from a SET PROTOCOL screen to a RUN screen as shown in the Programming section of this manual When the RUN screen is showing the internal fan should be running and the quartz halogen bulb will go on as need ed to heat the sample to the desired temperatures If the screen does not change back and forth between the two screens when the RUN STOP key is pressed shut the instrument off and unplug the power cord for 30 seconds to 1 minute Then plug the cord back in and turn the instru ment back on Remember the protocols set at CYCLE 1 HOLD 1 and LINK 1 will reset to factory preset values if the power is turned off The remainder of the pro tocols will remain at their last set values even after power loss If the problem persists please call our service department at the appropriate number listed at the beginning of this section Q When RUN is pressed the fan runs but the temperature does not increase A If the RUN STOP key has been pressed and the display shows the RUN screen but the instrument is not heating up first check the values of the protocol entered to ensure the proper temperature shows on the running protocol If the proper values are displayed it is possible tha
22. aureus the primer set is GCGATIGATGGTGATACGGIT with CAAGC CITGACGAACTAAAGOC the product is 276 bp References 1 Sambrook J E F Fritch and T Maniatis 1989 In vitro amplification of DNA by the polymerase chain reaction p 14 1 35 In Molecular Cloning A Laboratory Manual 2nd Ed Cold Spring Harbor Laboratory Cold Spring Harbor NY 2 Wang RF W W Cao H Wang and M G Johnson 1993 A 168 rRNA based DNA probe and PCR method specific for Listeria ivanovii FEMS Microbiol Letters 106 85 92 3 Wang RF W W Cao and M G Johnson 1992 16S rRNA based PCR method to detect L monocytogenes cells added to foods Appl Environ Microbiol 58 2827 2831 4 Wang RF W W Cao and M G Johnson 1992 Development of cell surface protein associated gene probe specific for Listeria monocytogenes and detec tion of bacteria in food by PCR Mol Cel Probes 6 119 129 5 Wang R F M F Slavik and Wei Wen Cao 1992 A rapid PCR method for direct detection of low numbers of Campylobacter jejuni J Rap Met amp Auto Microbiol 1 101 108 6 Wittwer C T and D J Garling 1991 Rapid cycle DNA amplification time and temperature optimization BioTechniques 10 76 83 m Z zo 20 e m lt e mE An a New From Idaho Technology Kirk Ririe Idaho Technology Inc Introducing the 1002 Rapidcycler In March of 1995 we began shipping a new version of our capillary based temperature cycling system the Rapidcycler This s
23. bring the Abbreviations used DMSo dimethyl sulfoxide aNTP deoxynucleoside triphosphate Figure 1 Diagram of the rapid DNA amplifier A hori zontal section through the air cycler is shown Recirculating air is heated by a 1000W coil and mixed by fan blades while a ther mocouple monitors the airstream temperature in the sample area and provides input to the proportional controller The fan motor is mounted outside of the airstream to decrease the thermal mass of the system A solenoid activated door opens for rapid cooling between denaturation and 1000W annealing stages The air HEATING chamber is 10 cm in height 10 cm in width and 20 cm in COIL depth Samples are con UJ tained in glass capillary tubes that are placed verti cally in the sample area of the cycler RS SOLENOID ACTIVATED DOOR sample block to temperature and to transfer heat to the sample through a microfuge tube 3 These systems have limited response times because of high heat capacity of the metal blocks and low heat transfer through thick plastic microfuge tubes gt a 2 HR m m An alternative approach for thermal cycling uses air for heat transfer 4 6 and contains samples in thin glass capillary tubes 5 6 With forced air heating and 100 ul samples temperature profiles similar to those obtained by transfer ring microfuge tubes between water baths can be obtained 6 None of the air cycling sys
24. classical Mendelian inheri tance If siblings are matched at HLA loci for transplantation they have a one in four chance of receiving the same parental VNTR alleles at any particular locus If they do receive the same VNTR alleles at one locus that particular locus is not useful for distinguishing donor vs recipient type However most of the time VNTR Amplification in Bone Marrow Transplantation siblings will differ by either one allele 50 of the time or two alleles 25 of the time DNA from peripheral blood leukocytes Figure 2 Bone marrow transplant engraftment by 1 month The VNTR locus HGM D178301 was used Lane 1 Recipient before transplantation Lane 2 Donor Lane 3 Recipient 2 weeks after transplantation Lane 4 Recipient 4 weeks after transplantation In lane 3 the patient shows bands from both the recipient and the donor In lane 4 the patient shows only donor bands suggesting successful engraftment needs to be isolated from donor and recipient before bone mar row transplantation so that informative VNTR loci can be identified Since there are many VNTR loci finding differences between recipient and donor is not difficult even for siblings In the case of syngeneic or autologous transplantation genotyping studies are not informative The VNTR loci used here are HGM locus D17 301 and D15S802 All PCR reactions were run with standard rapid cycling techniques3 5 in an Idaho Technology 1605 air cycler
25. dideoxy technology This protocol will yield sufficient material for fully redundant loading of 1 5 uL samples on two gels Mix quantities are given for a single primer template pair Multiply amounts by the number of such sequences plus one Wherever temper ature blocks are called for each cavity used is filled with water 1 Annealing combine in a small Eppendorf vial 7uL DNA at0 1 1 ug mL luL primer at 5 uM luL 10X MOPS included in kit luL 10X Mn Solution included in kit Total 10 uL 2 min at 65 temp block 30 min at 42 small oven or temp block Qe oe 53 as aw z 2 Extension add 55 uL EMix Total2 15 5 uL O 5 min at room temperature Shorter times allow reads closer to template 5 min is the norm During this time add 2 5 uL ter mination mixes to a preheated 37 C mini tray Distribute each mix to its own column fill ing as many wells as there are reactions Each row corre sponds to one primer template pair and can be color coded on the reverse side of the tray 3 Termination add to each well of appropriate row 3 5 uL extension reaction Total in each well 6 uL 10 min at 42 small oven or temp block 4 TdT Extension optional used to resolve premature stops Add to each well 1 uL TdT Mix Total in each well 7 uL Manganese Reagent Kit USB Mn2 Reagent Kit for DNA Sequencing catalog 0130 Enzymes USB Sequenase Version 2 Pyro
26. door does not open roughly 2 cm or if very little hot air is being vented from the duct please call our service department at the appropriate number listed at the beginning of this section m I o o z 7 31INOAL Q The machine cycle normally but reactions are not working A There are numerous factors influencing the outcome of reactions including reagents reaction kinetics and secondary DNA or RNA structure The most com mon mistakes affecting the outcome of a reaction have been outlined in the Rapid Cyclist Vol 2 located in the back of this manual While Idaho Technology does not warrant the RapidCycler for any specific biochemical reaction technical assistance for the instrument is available For assistance call our service department at the appropriate number listed at the beginning of this section Keep in mind that of the many factors influencing the outcome of a reaction the RapidCycler affects only one namely the temperature profile If the tem perature on the display seems to indicate the sample is being cycled as expect ed you can be confident that the reading accurately reflects the sample tem perature Service and Maintenance Phone numbers to call for service problems US and Canada 1 800 735 6544 Outside the US 1 801 736 6354 Fax 1 801 588 0507 E mail addresses Web address Idaho Technology it idahotech com www idahotech com User s Group lightcycler idahotech com 00 zz
27. ensure complete mixing It is helpful to use a set of colored markers to keep track of your samples A color code can be used both on the rim of the microtiter plate wells and on the upper portion of the capillary tube as colored bands Rapid air cycling is optimized for 10 ul samples Larger samples 25 and 50 ul can be used but require 10 15 second hold times which compromise cycling and reaction time Larger volumes can be prepared and cycled with no loss of cycling speed by simply loading the solution into several 10 ul capillary tubes at once As the liq uid wicks up into multiple tubes it distributes itself evenly between the tubes LOADING AND SEALING SAMPLES INTO CAPILLARY TUBES After the samples have been mixed in individual wells of a microtiter plate they can be loaded into capillary tubes either singly or using the capillary rack module To load a single sample simply insert a capillary tube into the microtiter well containing the sample Capillary action will draw the sample into the tube Run the capillary tip along the bottom of the microtiter well to ensure the entire volume is drawn up into the tube It is helpful to hold the microtiter plate in one hand and the capillary tube in the other Tilting the microtiter plate will ensure complete transfer into the capil lary tube Once loaded the position of the sample in the tube can be shifted by tilting the tube Adjust the sample so that it is roughly centered in the ca
28. instru ment frame If the top does not fit in place easily do not force Lift up on the cover realign and press 10 Once proper fit is established the four corner screws should be retight ened Do not over tighten the screws 11 Plug instrument back in Turn switch back on Check for proper operation of instrument If problems persist call our service department at 800 524 6354 CA PERIODIC MAINTENANCE LIST DAILY 1 Make sure power switch is off after use not required but recommended 2 Make sure nothing is underneath the machine blocking the air intake Look under the instrument to inspect the fan guard on the bottom of the instrument to ensure there is nothing blocking the air flow fafa zZ Ia uz ou zZ w lt E MONTHLY 1 Inspect chamber for debris Remove the four screws that hold the top down Lift the top straight up about one inch then swing towards the back of the machine being careful not to touch the halogen bulb Make sure there are no broken tubes or debris on the foam 2 Inspect the thermocouple for damage The thermocouple protrudes horizontally from the chamber wall halfway between the top and bottom of the chamber at the 5 o clock position 3 Inspect halogen bulb for debris and darkening around the mount Slight discoloration around the base of the halogen bulb is normal Using a dust free cloth remove any dust or lint that may have collected around the bulb mount Do not touch the b
29. mg ml In addition always block the well surface with BSA by adding the BSA containing buffer before the polymerase Microtiter plates that do not absorb protein can also be used and are available from Idaho Technology microtiter plate part 2 53 o 20 m lt Jo mr Aa a La oe 03 az aw 4z oz number 2590 lid part number 2591 but BSA is still necessary for the capillary tubes whether glass or plastic Mistake 5 Pulling tubes out near the denaturation temperature If double stranded product is cooled rapidly by pulling a tube out of an air cycler that is near denaturation temperatures not all the product will reanneal and multiple apparent products may appear on gels Mistake 6 Using excessive denaturation times There is no reason for denaturation times longer than 0 sec at 94 C The Tm of products in amplification buffer is around 85 90 C and complete denaturation of product at 94 C occurs faster than can be measured lt 1 sec See Wittwer and Garling 1991 BioTechniques 10 76 83 or Wittwer et al 1994 in The Polymerase Chain Reaction Mullis Ferre and Gibbs eds pp 174 181 The only possible exception is on the first cycle when high quality complex genomic DNA is used as template An initial denaturation of 5 15 sec at 94 C on the first cycle may allow more complete initial denatura tion However extended times at high temperatures degrade DNA and are par ticularly harmful
30. small amount of condensation occurs on the leeward side of the tubes but have not found this to be a prac tical problem even for 10 ul reactions While a little mineral oil does stop this con densation in general oil is not needed for 10 ul reactions 50 ul reactions show minimal condensation but will occasionally pop open during reactions if no oil is used The frequency with which this occurs seems to vary with reaction buffer and with tube manufacturer so you may wish to exper iment with your particular combination 5 REAL VERSUS SET TEMPERATURES The fast protocols given above both give a sample temperature of 94 denaturation and 72 to 74 extension The actual sample annealing tempera ture may not be important to you if you optimize the reaction experimentally as recommended above If you do need a particular annealing temperature the value you should set can be calculated using the equations in figure 4 have provided graphs for 10 ul reactions with a 10 second hold figure 4A and for 50 ul reactions with a 30 second hold figure 4B 10 ul sample 10 sec holds SAMPLE HANDLING Sample Temperature Temp to Set Temp you want 7 1 22 r 99 45 50 55 Air Temperature 50 ul sample 30 sec holds o gL 3 S g o a 5 Lr o o E i o Temp to Set Temp you want 1 8 1 10 r 10 j T 50 55 Air Temperature Figure 4 Linear relationship between the temperature programmed into the
31. tris pH 8 3 2 5 mg ml BSA 1 ul enzyme 1 ul Tag polymerase diluted 1 12 5 in enzyme dilution buffer 10 mM tris pH 8 3 2 5 mg ml BSA water to 10 ul total volume Thermal Cycling Conditions These conditions produced the expected 100 bp fragment in small amounts as visualized on a 4 Nusieve low melting temperature agarose gel The band was cut from the gel approximately 2X2X4 mm chunk and used as a template in subsequent thermocycling reactions Each 10 ul reaction was done in heat sealed glass capillaries Initial hold 2 minutes 94 C 2 cycles D 94 C 0 sec A 40 C 7 sec E 74 C 5 sec 5 cycles D 94 C 0 sec A 42 C 7 sec E 74 C 5 sec RAPIDCYCLIST NEWSLETTER 23 cycles D 94 C 0 sec A 45 C 7 sec E 74 C 5 sec Confirmation of the 100 bp product To confirm the accuracy of our 100 bp product we attempted to amplify a smaller fragment using the 100 bp cycling product as a template with the inter nal non coding primer 2nc and the original coding primer 1c The 100 bp product isolated in agarose was heated at 100 C until melted and 500 ul TE was added Two ul of this mixture were used as the template in a 10 ul reaction One pl each of the lc and 2nc primers was used and the other parameters were as described above The thermal cycling reaction was run with an initial 2 minute denaturation at 94 C followed by 30 cycles O sec at 94 C denaturation 12 sec at 50 C annealing 5 sec at
32. tubes and have the tubes and the sealers available in June of 94 barring major catas trophe 10 ul tubes part number 1714 tube sealer part number 1740 ze 55 Su 20 2 m lt Efe me An 2 Modular Tops In other hardware news some of our earlier customers may be interested in a change made in the design of the 1605 cycler The plastic top now has remov able modules for loading and unloading tubes The entire module is removable from the rest of the top to allow easier loading and unloading Each module holds 16 tubes To help ensure a good fit of all sizes of tube modules are avail able in two sizes 10 ul and 50 ul An upgrade kit to a modular top is available from Idaho Technology part number 1869 Module Racks A rack for holding the capillary tube modules is also now available Each rack will hold three filled capillary tube modules These module racks should help elim inate damage to capillary tubes when filled modules are set down prior to re insertion into the instrument top The part number is 1735 Improved Buffer System We have made several improvements to the buffers optimized for rapid cycling Traditionally we have used Ficoll and tartrazine to increase the density of our buffer and make it visible for direct loading of product onto gels We now rec ommend substituting sucrose for Ficoll and cresol red for tartrazine For optimizations we have traditionally recommended using a three by three matrix of
33. type converts to the donor type successful engraftment has occurred Variable number of tandem repeat VNTR loci are regions in the human genome where a short nucleotide sequence is repeated in tandem for a vari able number of times If flanking primers are placed outside of the repeats the number of tandem sequences in any particular allele determine the length of the amplified prod uct Some VNTR loci are highly polymorphic with over 10 different alleles and are very use ful for establishing individuality by genotype For highly polymorphic loci homozygosity is uncommon and two bands are expected at each locus because of the diploid nature of human cells VNTR loci are commonly used in forensics to establish identity and can also be used to establish donor vs recipient type in peripheral blood leukocytes after bone mar row transplantation Since peripheral blood leukocytes originate in the bone marrow the Figure 1 DNA samples from five unrelat type of circulating leukocytes establishes the ed individuals amplified with primers for type of hematopoietic cells populating the the D1580 locus2 bone marrow An example of DNA amplification of a VNTR locus in 5 unrelated individuals is shown in Figure 1 Siblings are often used as donor recipient pairs in bone marrow transplantation because they may match at HLA loci and have fewer problems with graft host acceptance HLA and VNTR loci are not linked and fol low
34. 10 ul samples require 40 second holds at denatura tion and annealing 50 ul sam ples 60 second holds at denatu ration and annealing Elongation requires 25 nucleotides per second plus about 15 seconds 10 ul Reactions Predenature 98 C for 10 seconds Cycle Denature 98 C for 10 seconds Anneal 40 C to 60 C for 10 seconds as appropriate for your primers Extend 74 C for 25 nucleotides per seconds 50 ul Reactions Predenature 96 C for 30 seconds Cycle Denature 96 C for 30 seconds Anneal 40 C to 60 C for 30 seconds as appropriate for your primers Extend 74 C for 25 nucleotides per seconds m 5 zo 20 s m lt e ne An a Optimization of Reactions in Thin Walled Microcentrifuge Tubes The same optimization protocol that has been recommended in capillaries Optimizing Rapid Cycle DNA Amplification Reactions Rapid Cyclist 1 1 5 1992 has provided excellent results in thin walled microcentrifuge tubes Optimal reaction conditions are found by running amplifications at 40 C 50 C and 60 C with 2 mM 3 mM and 4 mM MgCI2 at each temperature This allows you to test 9 different stringencies while only requiring you make up three different reaction mixes have used this optimization protocol successfully with Idaho Technology buffers low medium and high MgCl buffers Promega 10X Taq buffer and Stratagene 10X Pfu buffer Are Mineral Oil Overlays Required The thin walled microcentrifuge tube hol
35. 3 mM 2 mM and 1 mM Mg2 run at three annealing temperatures 40 C 50 C and 60 C However our experience is that most reactions optimize at the higher end of the Mg2 concentration therefore we now recommend using 2 mM 3 mM and 4 mM Mg 2 in the high medium and low buffers We will include the new buffers free with all reagent orders for the next few months and if the reaction is positive we will switch to the new system for indi vidual buffer orders and the Optimizer Kit As usual we are also publishing the reagent constituents in case you choose to make your own buffers On the fol lowing pages are procedures for running individual reactions making master mixes and making the reaction constituents themselves s Qe JE 54 as aw z oz Reaction Mixes and Buffer Recipes from Car Wittwer s laboratory Reaction Constituents for One 10 ul Reaction Component DNA human genomic Primers Separate Primer 1 Primer 2 or Combined Primer 1 2 Nucleotides Buffer Low Mg2 Medium Mg2 High Mg2 Enzyme dH20 other 10X 50 ng uL or A 260 1 0 5 uM 5 uM 5 uM each 2 mM each dNTP 500 mM Tris DH 8 3 2 5 mg ml BSA 20 w v Sucrose 1mM Cresol Red 20 mM MgCl2 30 mM MgCI2 40 mM MgCl2 0 4 U uL Reaction 50 ng 10ul 0 5 uM 0 5 uM 0 5 uM each 200 uM each dNTP 50 mM Tris pH 8 3 250 ug ml BSA 2 w v Sucrose 0 1 mM Cresol Red 2 mM MgCl2 3 mM MgCl2 4 mM MgCl2 0 4U 10ul
36. 4 ph 801 736 6354 fax 801 588 0507 it idahotech com www idahotech com Revised March 2000
37. 48 micro test tubes Figure 1 shows that all 48 positions give a Clean bright 500 bp product in a DNA amplification from Human genomic DNA Thin walled micro test tubes have many advantages over capillary tubes First handling of the sample tube is much simpler reactions can be made up in the micro test tube no heat sealing is required concern about breaking the tubes is eliminated Second there is no need to adjust buffers or protocols The buffers that manufacturers provide with their thermostable polymerases work in these tubes without modification Published protocols developed in heat block instruments seem to transfer more readily to the Rapidcycler when micro test tubes are used The thermal properties of thin walled microcentrifuge tubes are much better than their thick walled ancestors but they are still no match for a capillary tube Using thin walled microcentrifuge tubes requires a sacrifice in speed and Figure 1 Amplification of a 500 bp target Qe JE ou as aw z oz in sample temperature uniformity A 10 ul reaction that would take 15 minutes in a capillary tube takes 35 minutes in a thin walled microcentrifuge tube a 50 ul reaction that would take 20 minutes in a capillary takes 50 minutes in a microcentrifuge tube from human genomic DNA in all 48 sample positions of the Air Thermo Cycler Reactions volume was 50 ul no oil overlay Reactions contained Idaho Technology medium buffer 200 uM each d
38. 5 DMSO 0 5 uM each of the human B globin genomic primers KM29 and RS42 7 0 5 mM of each dNTP 50 ng of placental human genomic DNA and 0 1 0 8 U of Taq polymerase 10 ul One unit U of polymerase activity was the amount of enzyme required to incor porate 10 nmol of 3H dTTP in 30 min at 80 C as defined by the manufacturer Stratagene La Jolla CA All other reagents were from Sigma St Louis MO The DMSO KCI albumin and MgC12 concentrations were optimized by individual titrations for amplifying the KM29 RS42 primer pair region of genomic DNA Samples 10 ul were placed in 8 cm capillary tubes KIMAX 46485 1 and the ends fused with an oxygen propane torch Samples of 100 ul were placed in larg er diameter 0 cm tubes KIMAX 34500 The capillary tubes were placed verti cally in the sample area of the rapid air cycler The temperature of the samples was cycled 30 or 40 times through denaturation annealing and elongation steps of 90 92 C 50 55 C and 71 73 C respectively for the times indicated in individ ual experiments Amplification products 9 ul unless indicated otherwise were fractionated by electrophoresis on a 1 5 agarose gel and visualized with ethid ium bromide and uv transillumination wn wi a Q E lt RESULTS The temperature response of 10 ul samples during 30 and 60 s cycles of the rapid air cycler is shown in Fig 2 and Fig 3 respectively The annealing segment of each temperature profil
39. 721 8 Ferre F 1992 Quantitative or semi quantitative PCR reality versus myth PCR Methods and Applications 2 1 9 E 5 5 20 E m lt Jo me BG E 9 Chirgwin J M A E Przybyla R J MacDonald and W J Rutter 1979 Isolation of biologically active ribonucleic acid from sources enriched in ribonu clease Biochemistry 18 5294 5299 Qe oe Ji as aw z Rapid Cycle Amplification of VNTR Loci for Engraftment in Bone Marrow Transplantation Gudrun Reed Dept of Pathology University of Utah Medical School Bone marrow transplantation is now standard therapy for a range of diseases including many hematologic malignancies some solid tumors and some acquired or inherited hematologic and immunologic diseases Many of these dis orders result from a malfunctioning bone marrow and the only cure is to inacti vate the diseased bone marrow and replace it with healthy marrow After the original marrow is destroyed healthy marrow from a donor is infused into the recipient Bone marrow transplantation may be 1 autologous where healthy stem cells have been previously harvested from the same individual 2 syn geneic where the donor is an identical twin and 3 allogeneic where the donor is different genetically from the recipient In allogeneic transplantation it is possible to determine the success of transplantation by monitoring the geno type of cells appearing in the peripheral blood If the recipient
40. Introduction Rapid and specific methods for detection and identification of pathogens are essential for food safety and clinical diagnosis of human and animal diseases Antibody based test methods are the most often used technique However PCR based methods should be faster and more specific A traditional PCR protocol takes about 5 hours in Perkin Elmer Cycler 480 Previously we reported a protocol for the PHC 2 cycler machine Techne Inc Princeton NJ which shortened detection time to 3 hours 2 3 4 5 In this article we report the results of compar ison of different PCR cycler machines for the rapid and sensitive detection of pathogens E LE z5 20 m lt e mr An 2 Materials and Methods The bacterial cells were collected from liquid cultures by centrifugation The cells were washed twice with phosphate buffered saline PBS dis tiled water dH2O and resuspended in dH2O at 107 cells per ul Just before the PCR assay the samples were diluted to the desired cell concentra tion of 105 CFU in 50 to 100 ul of 1 Triton X 100 The cells were then heat ed at 100 C for 5 minutes immedi ately cooled in ice water and tested by PCR without isolation of the DNA Two ul of above sample were added to 23 ul of a PCR mixture For the BioOven MiniCycler Perkin Elmer Cycle 480 and PHC 2 ihe PCR mixture contained 50 mM Tris HCI pH 8 5 50 mM NaCl 1 mM MgCl2 and 2 mM dithiothreitol 0 1 Triton X 100 0 22 m
41. M of each dATP dTTP dCTP dGTP 0 28 uM of each primer and 0 9 U of Taq polymerase Promega Madison Wl The pro gram consisted of one cycle of 3 min utes at 94 C then 40 cycles of 20 sec onds at 94 C 20 seconds at 55 C 40 seconds at 72 C and finally one cycle of 3 minutes at 72 C For the 1605 Air Thermo Cycler Idaho Technology the PCR mixture con tained 50 mM Tris HCI pH 8 5 20 mM KCI 3 mM MgCl2 0 05 bovine serum albumin BSA No A 4378 SIGMA Chemical Co St Louis MO 0 25 mM Figure 1 PCR results in different thermal cycler machines PCR primers are specific for Mycoplasma gallisepticum unpublished data The PCR product is 138 base pair DNA fragment 3 agarose gel was used for the electrophoresis Lane m molecular size marker Lane 1 Mycoplasma gallisepticum strain K23 Lane 2 M gallisepticum strain K730 Lane 3 Mycoplasma synoviae strain FMT Lane 4 H2O for control Panel a The MiniCycler was used with a total cycle time of 1 5 hours Panel b The BioOven was used with a total cycle time of 5 hours Panel c The PHC 2 Cycler was used with a total cycle time of 2 8 hours Panel d The 1605 Air Thermo Cycler was used with a total cycle time of 30 minutes of each dATP dTTP dCTP dGTP 0 25 uM of each primer and 0 9 U of Taq poly merase The program consisted of one cycle of 15 seconds at 94 C then 30 cycles of 5 seconds at 94 C 5 seconds at 55 C 15 seconds at 74 C and final
42. NTP 5 uM each primer RS KM 50 ng human genomic DNA Cycling param eters were 96 for 30 seconds then 30 cycles of 96 for 30 seconas 55 for 30 seconas 75 for 20 seconds Because the Rapidcycler was developed for capillary tubes the temperature values that you program into the machine and the temperatures displayed dur ing cycling reflect what the temperature would be in a 10 ul capillary When using microcentrifuge tubes you must modify the program parameters to com pensate for the thermal differences between capillaries and microcentrifuge tubes Thin Walled Microcentrifuge Tube Cycling protocols for the Rapidcycler There are two possible approaches when using microcentrifuge tubes You can set the machine to the temperature you want and wait for the microcen trifuge tube to get to that temperature Figure 2B This is what the slower heat block cyclers do This method is slow but it assures you that no part of your sam ple is ever over the target temperature A faster approach is to overheat and under heat the air This brings the sample to temperature more quickly Figure 2A The faster heat block instruments do this but some parts of your sample may be slightly above or below the target tempera tures have had good success with the faster overheat and under heat approach The fol lowing protocols have been successful with a variety of primers and DNA sources If you prefer the sit and wait approach
43. RAPIDCYCLING WITH GLASS CAPILLARY TUBES Using a capillary based air cycler is different from using a heat block instrument Samples must be prepared loaded into the capillary tubes sealed and after the reaction is complete analyzed Following are instructions for sam ple preparation loading and sealing samples into capillary tubes cycling and after cycling sample handling NOTE Detailed instructions for the preparation of buffers and optimizing protocols can be found in the Rapidcyclist Newsletters section of this manual 1 SAMPLE PREPARATION All reactions in glass capillary tubes must contain 250 500 ug ml bovine serum albumin to prevent surface denaturation of the enzyme The same high surface area to volume ratio that allows rapid temperature cycling also provides many sites for enzyme inactivation We recommend three alternatives for adding adequate BSA to your reaction JIdNVS TI gt z o z o 1 Add 10X BSA 2 5 mg ml to your master mix You can either make the solu tion yourself or it is included in the Optimizer Kit from Idaho Technology 2 Dilute your concentrated enzyme stock to a 10X enzyme solution with an enzyme diluent containing BSA 10 mM Tris pH 8 0 2 5 mg ml BSA You can make the diluent yourself or it is included in the Optimizer kit from Idaho Technology 3 Use one of the 10X buffers included in the Optimizer kit from Idaho Technology that already contains BSA These buffers are optimiz
44. ROGRAMMED RAPIDCY CLER CYCLE PROTOCOLS 51 99 cycles 51 61 5 After Cycling After cycling is complete remove the modules from the instrument and remove tubes If desired the modules may be left in place and the tubes removed directly Verify that no fluid has evaporated from the tubes If sample has evaporated the tubes were not completely sealed Score the tubes approximately 1 cm from each end using the sapphire cut ter supplied One small stroke with the cutter is sufficient to score the glass Holding the tube horizontally gently snap off scored ends Next insert the capillary tube into the white silicone tip of the microaspira tor dispenser approximately 2 cm While inserting capillary tube into microaspi rator dispenser you will notice the sample tends to be pushed out of the tube because of back pressure This requires the user to turn the black knob on the dis penser counterclockwise to prevent the sample from being pushed out of the capillary tube as it is being inserted into the silicon tip The user may now dispense the amplified sample from the capillary tube by inserting the capillary tip directly into a gel well and slowly turning the microaspi rator dispenser knob clockwise to dispense the sample NOTE With extensive use the silicon tip of the microaspirator dispenser will lose its seat and need to be replaced Use of Thin Walled Microcentrifuge CED Tubes with the Rapi tycler 1 Introduction JIdNVS
45. T and JL Cherry Momentary denaturation and annealing for DNA amplification submitted 3 Innis MA KB Myambo DH Gelfand and MAD Brow DNA sequencing with Thermus aquaticus DNA polymerase and direct sequencing of polymerase chain reaction amplified DNA PNAS 85 9436 9440 1988 4 Fasman GD ed Handbook of Biochemistry and Molecular Biology 3rd ed Nucleic Acids Vol 1 pp 589 CRC Press Cleveland OH 1975 A RAPD Protocol for the Air Thermo Cycler Paul W Skroch Jim Nienhuis Department of Horticulture University of Wisconsin Madison Idaho Technology s Air Thermo Cycler is unique among commercial thermal cyclers in the speed with which PCR reactions can be performed The RAPD reaction a PCR technique for generating useful genetic markers Williams et al 1990 Nucleic Acids Research 18 6531 6535 also runs much faster in the ATC Published RAPD protocols are based on the use of metal block machines and require relatively long total cycling times The RAPD reaction can be economi cally performed in the Idaho Technology ATC with a total cycling time of less than 90 minutes Template DNA should be clean and relatively free of RNA Treatment with RNase followed by an alcohol precipitation is sufficient to remove most of the RNA Clean DNA may give good RAPD products even when it is significantly degraded 5X solutions of template and primer are prepared in a TE buffer that is IMM Tris OH 7 5 and 1mM EDTA pHz8 0 A 25X dNTP
46. TI gt z s z o The development of thin walled micro test tubes makes it possible to com bine the speed of the air cycling with the convenience of that universal vessel of molecular biology the microcentrifuge tube While the RapidCycler was developed for use with glass capillaries it provides excellent results with thin walled microcentrifuge tubes Using modified sample modules the RapidCycler can hold up to 48 micro test tubes Figure 1 shows that all 48 positions give a Clean bright 500 bp product in a DNA amplification from Human genomic DNA Figure 1 Amplification of a 500 bp target from human genomic DNA in all 48 sample positions of the Air Thermo Cycler Reactions volume was 50 ul no oil over lay Reactions con tained Idaho Technology medium buffer 200 uM each dNTP 5 uM each y primer RS KM 50 ng x z za human genomic DNA L d A TW Lg Cycling parameters 1 were 96 for 30 sec onds then 30 cycles of 96 for 30 seconds 55 for 30 seconds 75 for 20 seconds EE FIDA Thin walled micro test tubes have many advantages over capillary tubes First handling of the sample tube is much simpler reactions can be made up in the micro test tube no heat sealing is required concern about breaking the tubes is eliminated Second there is no need to adjust buffers or protocols The buffers that manufacturers provide with their thermostable polymerases work in these tubes withou
47. Up to sixteen capillary tubes may be inserted into the modules After the capillary tubes are in place align the tubes by pressing against a clean flat surface Prepare samples in two rows of a microtiter plate Then lower the capillary tips into the wells and run them around the bottom of the wells to ensure that all the liquid has been drawn up into the tubes Seal the tubes individually tipping the module to adjust the liquid level We suggest starting with 8 tubes at a time to gain experience handling and sealing the capillary tubes The modules can then be placed back into the machine and cycled Care must be taken with the capillary tubes when reinserting the module into the machine Before running make certain that all three modules are completely seated into the instrument top JIdNVS TI gt z s z o 4 Cycling For information on how to enter and run a program see Section 4 Programming The choice of cycling protocols depends on many factors Use the tables to adjust temperatures and times when using 25 or 50 ul capillary tubes Keep in mind that the RapidCycler is optimized for use with 10 ul capillary tubes The larger 25 or 50 ul tubes require hold times of 10 and 15 seconds at each tem perature to allow the sample enough time to come to temperature az sa z zi A listing of common cycling protocols for 10 25 and 50 ul tubes can be found in the Programming section of this manual See PREP
48. WVA9DOdd z z z lt e o e a HOLD MODE PROGHHO4 TEMPERATURE 72 TIME 00HR OOMN 15SEC The only requirement for a hold program to run is that the temperature can not be O or greater than 99 however if a temperature below room temperature is entered the machine will be unable to reach it RUNNING A HOLD PROGRAM Press the RUN STOP key to start the program If you wish you may also press the RUN STOP to halt the program While running a HOLD MODE program the RapidCycler displays the current temperature and begins a count down once the desired temperature has been reached After completion of a program the RapidCycler will display PROGRAM COMPLETED and prompt you to PRESS ANY KEY to continue While waiting for you to press a key the RapidCycler will beep every thirty seconds to remind you that it is finished Once a key is pressed the RapidCycler will return to the HOLD MODE screen for the program you have just completed qu LINK MODE When you enter LINK MODE the screen should appear as follows LINK MODE PROG 01 HO1 CO1 XXX XXX XXX XXX XXX XXX XXX XXX 8 3 Description of LINK MODE parameters gt PROG Program number 01 through 99 g 10 LINK SEG MENTS Up to 10 cycle or hold programs to be run sequentially Cycle programs are designated CXX and hold programs are HXX 1 CHANGING BETWEEN AND EDITING PROGRAMS Link mode can be programmed to run up to ten cycle or hold programs
49. aNTPs rather than 200 uM dNTPs which may decrease expected specificity Nevertheless using identical reactant concentrations the same master mix the relative specificity of rapid cycling was surprisingly superior to slower cycling Other modification in the buffer used deserve brief comment Bovine serum albumin was required for amplification in capillary tubes No amplification was obtained with gelatin perhaps because of surface denaturation of the poly merase on the large surface area of the tube Inclusion of Ficoll and an indica tor dye in the amplification mixture is convenient and to our knowledge has not been previously reported Xylene cyanole or tartrazine can be used as dyes but bromphenol blue strongly inhibits the amplification reaction Increased specificity of DNA amplification by rapid cycling should be useful in sequencing mutation detection and infectious disease diagnosis With improved specificity simple agarose gel electrophoresis may be sufficient for diagnosis in many cases without use of a probe internal to the primers However high specificity is not always desirable Relatively low specificity is required when consensus primers are used to detect a group of related or rapidly mutating sequences or when the sequence to be amplified is not precisely known Therefore rapid cycling may be less suitable than slower conventional cycling when primers have one or more mismatches with the template and equal ampli ficatio
50. activity was the amount of enzyme required to incorporate 10 nmol of dNTPs in 30 min at 74 C as defined by the manufacturer Promega Madison WI All other reagents were from Sigma Chemical St Louis MO A single amplification mixture was used for all samples viewed on one gel Taq polymerase was accurately measured with a 1 ul microcapillary pipet Microcaps Drummond Scientific Broomall PA and diluted in 10 mM Tris pH 8 5 100 ug ml bovine serum albumin if necessary Samples 10 ul were placed in 8 cm lengths of microcapillary tubing KIMAX 46485 1 Kimble Vineland NJ and the ends were sealed with a Bunsen burner A 1 2 cm column of air on each side of the sample allowed easy sealing and opening of the tubes Thirty cycles of DNA amplification performed in a custom made hot air thermal cycler Inclusion of Ficoll 400 and a dye tartrazine or xylene cyanole into the amplification mix ture allowed samples to be directly emptied into wells of a 1 5 agarose gel using wn wi a Q E lt Denaturation Temperature C 103 100 97 94 91 88 85 PhiX 174 RF Hae Ill Digest Figure 1 Effect of denaturation tem perature on DNA amplification yield DNA amplification was performed for 30 cycles as described in Materials and Methods except that the denatu ration temperature was varied from 85 103 C Temperatures greater than boiling could be attained because sealed capillary tubes were used for sample containme
51. and elongation were studied Figure 1 shows that momentary denaturation lt 1 s at 91 97 C was adequate for DNA amplification Little amplification occurred with a denaturation temperature below 91 C presumably because of inadequate strand separation Above 97 C product amplifica tion was also minimal Figure 2 shows equiva 64 lent amplification with denaturation times from 1 16 s when the denaturation tempera PhiX 174 RF ture was 92 94 C Decreased yield with long Hae Ill Digest denaturation time gt 30 s or high denaturation temperatures may be secondary to poly merase inactivation or to compromise of other reaction components ANTP break Figure 2 Effect of denaturation time down albumin coagulation etc on DNA amplification yield The denaturation time at 92 94 C was var ied from 1 64 sec Other conditions were as given in Figure 1 The optimal annealing temperature was about 55 C Figure 3 Lower annealing tem peratures resulted in decreased yield of the desired product and an increase in nonspecific amplification Little specific amplification occurred at an annealing temperature of 40 C Although nonspecific amplification was minimized at tem peratures gt 55 C desired product yield also decreased presumably because of incomplete annealing Figure 4 shows that the shortest possible annealing time l s and the fastest denaturation to annealing transition 9 s gave the highest yield and t
52. anging between and editing pro grams section earlier in this chapter for a list of the cycling criteria When running a cycle program the RapidCycler displays the current temper ature as well as the cycle count Line 3 of the display CYCLE 1 D OF 30 describes the cycling status as being on cycle 1 of 30 cycles After completion of a program the RapidCycler will display PROGRAM COMPLETED and prompt you to PRESS ANY KEY to continue While waiting for you to press a key the RapidCycler will beep every thirty seconds to remind you that it is finished Once a key is pressed the RapidCycler will return to the CYCLE MODE screen for the program you have just completed CED HOLD MODE When you enter HOLD MODE the screen should appear as follows HOLD MODE PROG HO1 TEMPERATURE 94 TIME 00HR OOMN 15SEC Description of HOLD MODE parameters PROG H Program number H 01 THROUGH 99 TEMPERATURE Temperature in C 30 C 99 C TIME Hold time in hours minutes and seconds 1 CHANGING BETWEEN AND EDITING PROGRAMS Change to program H03 by pressing O and 3 The parameters should all be null Use the cursor keys and numeric keys to enter a temperature of 94 and hold time of 15 seconds The screen should appear as follows HOLD MODE PROG H03 TEMPERATURE 94 TIME 00HR OOMN 15SEC Now create another hold program for an extended elongation period after cycling Select program 04 and enter 72 for 15 seconds ONIN
53. bulb and set it aside being careful to not break the bulb Do not touch the glass por tion of the light bulb with bare hands 6 The thermal fuse is inside the top duct Fig 5 Unplug the two wires connected to the thermal fuse These are regular slip spade connections and should be relatively easy to remove Zo 25 Z lt mO So zz QU The thermal fuse is connected to the duct with a hex head screw A 5 64 hex wrench is needed to remove the screw Remove the screw and remove the tripped thermal fuse Insert the new fuse in the same location as the old fuse and replace and tighten the screw Reconnect the wires to the thermal fuse and ensure that all wiring is placed correctly 7 While the top is open check the chamber for for eign materials If you clean the chamber for any reason only water or water based cleaners should be used Figure 5 Care must be taken not to bend or harm the thermo couple probe which looks like a small wire sticking about Lamp 1 2 1 25 cm into the chamber from the side wall It should be sticking straight into the chamber and should not be disturbed Thermal Fuse 8 Replace the bulb Do not touch the glass portion of the light bulb with bare hands 9 Lift and tip the instrument cover back to a horizontal position Then hold ing the top level carefully align the top in place and press down There is an electrical plug inside the top cover which must mate into contacts in the
54. ch 5 uz od EL aa Loading the capillary Glass capillary tubes are easily loaded by capillary action You can increase the rate of liquid uptake by tipping the capillary tube sideways Figure 1 You can also load the capillaries using a Drummond microaspirator IT 1690 to draw the reaction mix up into the tube or you can use a pipetman to directly inject sample into the tube Figure 2 The 10 ul size tubes hold 2 2 ul cm and can be used for reaction volumes from 5to 15 ul The 10 ul capillaries come to temperature so quickly that they require no holds at denaturation or annealing The 50 ul tubes hold 9 ul cm and are use ful for reaction volumes from 15 to 70 ul These tubes require a 15 second hold at the denaturation and annealing temperature Sealing the capillary The glass capillaries sold by Idaho Technology are made out of a high sodi um low melting temperature glass This makes them very easy to flame seal with just about any flame They can be sealed with a Bic lighter a Bunsen burner a candle or a Blazer mini propane torch Figure 3 IT 2721 After the capillary is loaded tip the tube to center the liquid Hold the tube in the center and place the end just into the flame Rotate the tube in the flame by rolling it between your thumb and index finger You should be able to see the glass slowly close in on itself Try to avoid leaving the tube in the flame too long as you can end up with a big glob of glass whi
55. ch will not fit into the holder This is more likely in very hot flames Cutting down the air to the flame will cool these burners down and make the capillaries easier to seal You can confirm that the end is sealed by looking carefully at the end for a continuous wall of glass around the end You can also confirm sealing by blow ing on the hot end of the capillary and watching to see if the liquid moves toward the end of the capillary as the glass cools This is more dramatic for the first seal than the second Repeat the sealing process on the other end and then insert the tube into the capillary holding module A module rack IT 1735 makes these manipulations easier Figure 4 Scoring capillary ends with sapphire cutter Figure 5 Using capillary tube as a pipet tip and directly loading sam ue ple into gel JIdNVS TI gt z s z o ul m a z o F4 E fay z lt E Sample Recovery After your reaction is done you pull the tube from the module lightly score the two ends with a sapphire cutter Figure 4 IT 1691 and break off the ends The capillary tube then becomes a pipet tip for the Drummond microaspirator IT 1690 and can be used to directly load your sample into a gel Figure 5 or into a storage tube Beware the pressure caused by sliding the capillary into the microaspirator can cause your sample to be blown out of the tube This is easily prevented by dialing the microas
56. chase If problems occur with your machine a replacement machine will be shipped immediately via next day air In the event of a failure please call us at 800 735 6544 to arrange for the return repair and temporary replacement of your machine GED Upgrades Because of the modular nature of the ldaho Technology RapidCycler it will be possible to upgrade the performance of both the hardware and software in the future Any such upgrades will be offered at low cost and zero downtime n Lu Ea zz o FE a 2 lt Articles Automated polymerase chain reaction in capillary tubes with hot air Pg 48 Nucleic Acids Research Vol 17 No 11 4353 4357 1989 C T Wittwer G C Fillmore and D R Hillyard University of Utah Medical School Minimizing the time required for DNA amplification by efficient heat transfer to small samples Pg 54 Analytical Biochemistry Vol 186 328 331 1990 Carl T Wittwer G Chris Fillmore and David J Garling Department of Pathology University of Utah Medical School and Associated Regional and University Pathologists GERONEN Rapid cycle DNA amplification time and temperature optimization Pg 63 BioTechniques Vol 10 No 1 76 83 1991 Carl T Wittwer and David J Garling University of Utah Medical School Automated polymerase chain reaction in capillary tubes with hot air Nucleic Acids Research Vol 17 No 11 4353 4357 1989 C T Wittwer G C Fillmore and D R H
57. check the chamber for for eign materials If you clean the chamber for any reason only water or water based cleaners should be used Care must be taken not to bend or harm the thermocouple probe which looks like a small wire sticking about 1 2 1 25 cm into the chamber from the side wall It should be sticking straight into the chamber and should not be disturbed So 22 zz mO zm zz QU 8 Lift and tip the instrument cover back to a horizontal position Then hold ing the top level carefully align the top in place and press down There is an electrical plug inside the top cover which must mate into contacts in the instru ment frame If the top does not fit in place easily do not force Lift up on the cover realign and press 9 Once proper fit is established the four corner screws should be retight ened Do not over tighten the screws 10 Plug instrument back in Turn switch back on Check for proper operation of instrument If problerns persist call our service department ELECTRIC FUSE REPLACEMENT Tools amp supplies needed Flat blade screwariver Replacement fuses 1 Turn off the power switch Figure 1 on the back of the instrument Unplug instrument Locate fused switch on back of instru ment Figure 1 2 Insert a small flat bladed screwdriver in fuse tray release slot Figure 2 and gently lift up This will allow the fuse tray to be removed 3 Replace fuses with appropriately sized new fus
58. ction It is convenient to add the BSA with the enzyme A 10X enzyme solution of 0 4U ul can be obtained from a 5U ul enzyme stock by diluting in an enzyme diluent as follows 11 5 ul enzyme diluent 10 mM Tris pH 8 3 2 5 mg ml BSA 1 0 ul enzyme This is enough to run about 12 reactions When the 10X enzyme solution is diluted enough BSA is included for efficient amplification even if no additional BSA is added with the buffer The 50 glycerol storage media of most enzyme preparations makes pipetting 1 ul very difficult If accurate volumes are desired microcapillary pipets 1 ul Microcaps available from Sigma can be used The other components of a master mix can also be stored as 10X stocks A 10X solu tion of human genomic DNA 50 ug ml conveniently has an absorbance of 1 0 at 260 nm One ul of this 10X solution provides about 15 000 template copies per 10 ul reaction Table 1 Rapid Cycle Reactant Concentrations Component 10X Stock 1X Reaction Volume 10yul Buffer 500 mM Tris pH 8 3 50 mM Tris 1 ul 2 5 mg mL BSA 250 ug mL BSA 5 10 Ficoll 0 5 1 0 Ficoll 10 mM Tartrazine 1 mM Tartrazine Low Mg 10 mM MgCl2 1 mM MgCI2 Med Mg 20 mM MgCl2 2 mM MgCl2 High Mg 30 mM MgCl2 mM MgCl2 dNTPs 2mM each dNTP 200 uM dNTP lu DNA Genomic DNA 50 ng uL 5ng uL mammalian or A 260 1 0 Bacterial DNA 5 50 pg pl 0 5 5 pg ul Plasmid DNA O 1 1 0 pg ul 10 100 fg pl Diluted Enzyme 0 4 U uL 0 4 U TOuL
59. cursor will be displayed E gt CYCLE MODE When you enter CYCLE MODE the screen should appear as follows CYCLE MODE PROG CO1 TEMP D94 A55 E72 TIME 0 00 0 00 00 15 SLOPE 9 9 CYCLES 30 1 DESCRIPTION OF CYCLE MODE PARAMETERS PROG COI Program number C 01 THROUGH 99 TEMP Temperatures in C 30 C 99 C Typically 90 96 Typ 40 68 Typ 70 74 TIME Corresponding hold times in minutes and seconds O sec for 1Oul sample in capillary tube O sec for 1Oul sample in capillary tube and highest stringency 1 sec 50 bp for products 500 bp 1 sec 25 bp for products 2 kbp 1 sec 15 bp for products lt 5 kbp SLOPE Ramp rate between A and E in C sec Typically 9 9 for highest stringency 2 6 for low stringency CYCLES Number of cycles mp Uy gt U SNINWIN V3oOdd m 2 CHANGING BETWEEN AND EDITING PROGRAMS Change to program CO3 by pressing O and 3 The parameters should all be null Use the cursor keys and numeric keys to enter the following temperatures hold times slope and cycle count CYCLE MODE PROG C03 TEMP D94 A65 E72 TIME 0 00 0 00 00 15 SLOPE 9 9 CYCLES 3 3 A CYCLE PROGRAM MUST MEET THE FOLLOWING CRITERIA TO RUN D must be greater than E E must be greater than or equal to A For two temperature cycling set A E with a O second hold at A Slope must be greater than O Cycles must be greater than O o z z z lt ce 0 6 L a Since there are ma
60. ders for the Rapidcycler put the entire tube inside the reaction chamber This keeps the whole tube at the same temperature and thus reduces condensation A small amount of condensation occurs on the leeward side of the tubes but have not found this to be a prac tical problem even for 10 ul reactions While a little mineral oil does stop this con densation in general oil is not needed for 10 ul reactions 50 ul reactions show minimal condensation but will occasionally pop open during reactions if no oil is used The frequency with which this occurs seems to vary with reaction buffer and with tube manufacturer so you may wish to exper iment with your particular combination Real Versus Set Temperatures The actual sample annealing temperature may not be important to you if you optimize the reaction experimentally as recommended above If you do need a particular annealing temperature the value you should set can be cal culated using the equations in figure 4 have provided graphs for 10 ul reactions with a 10 second hold Figure 4A and for 50 ul reactions with a 30 second hold Figure 4B z La JE 5 az aw 4z oz Figure 3 Optimization of RS KM primer pair in microfuge tubes Lanes 1 3 60 C annealing 4 3 and 2 mM MgCl Lanes 4 6 50 C annealing 4 3 and 2 mM MgCl Lanes 7 9 40 C annealing 4 3 and 2 mM MgCl 10 ul reaction volume no oil 10 sec holds at annealing and denaturation 50 ul sample 30 sec holds
61. e hold and link programs Each table also includes space for you to add your own programs We recommend making copies of these tables and posting them near the RapidCycler PREPROGRAMMED RAPIDCYCLER HOLD PROGRAMS PROGRAMMING T z E o 2 m Lo m I jeu n j ka a E c4 r ko c o T n re po or E c r po c r ko Lr Lr Li Lr Ley Li po nm Puc D D M i ro rm r r rm ko Bo ko En vo Eo Ej c n Ej c n LI LI LI LI LI LI LI LI LI LI LI LI LI LI LI LI LI LI LI c m r od T B Eo fo I2 me 24 T so j o fo I2 e 24 T D ro zr Kk e c4 T B j Eo ar E e I B ji po fo I aeB rme j ejrJj rm j E e c4 E e Laie ia es ue ia es E33 EI a EI er Er ere Ee 50 PREPROGRAMMED RAPIDCYCLER CYCLE PROTOCOLS 1 D EEE BEEREEEEEREEEERERREEREE aa y Bm fe 5 teclea Ee eee ERE EER El E el EL el El El el El Bl l kl Bl EL EL EL FL EL BIBI EL SNINWINV39O ld 99 PREPROGRAMMED RAPIDCYCLER CYCLE PROTOCOLS 51 J0 Ex product lengt iens up To LU pd neci PROGRAMMING c4 Jope au Cycles 50 rs TT 9 7 W ewhm Standard Cyele LLL O T5s69 8t8 Cycle 305872 PREPROGRAMMED RAPIDCYCLER CYCLE LINK PROTOCOLS 1 SNINNWV39O ld 99 PREPROGRAMMED RAPIDCYCLER CYCLE LINK PROTOCOLS 51 PROGRAMMING ze ANECA a d d a E d y PP A Barisienatur
62. e able to run the reactions in a short amount of time to maximize throughput Interactions between concentrations times and temperatures are important Changing the value of any parameter may change some reaction results However reaction parameters near those given here will give good results For example annealing for 7 instead of 8 seconds is somewhat arbitrary Attempts to improve the efficiency of the reaction by significantly low ering or raising the polymerase concentration has not worked in general Using the protocol described above we have obtained satisfactory reaction products from thousands of RAPD reactions Results The following figures show some results from our lab using the above protocol 2 Qe JE 5 as aw ET oz Figure 1 The gel shows RAPD amplification prod ucts from 10 different primers with a single Phaseolus vulgaris Dean DNA preparation The number of bands amplified for a given primer Figure 2 The gel compares 10 different P vul can vary from 1 to about 16 garis genotypes amplified with a single primer Research In Progress at Idaho Technology Kirk M Ririe Idaho Technology Idaho Technology is committed to improve the state of the art in rapid cycling instrumentation and accessories Several recent developments are worth noting Linear Actuator Tests We recently tested a prototype instrument outfitted with a linear actuator in place of the solenoid on the 1605 ATC Our primar
63. e is a spike corresponding to cooling of the sample with ambient air The denaturation segment of the 30 s cycle is also a spike with very little time spent at the high temperature The major difference between the 30 and the 60 s cycles is the length of the elongation segment Some oscillation TEMPERATURE C TEMPERATURE C 15 30 45 60 TIME SECONDS Sa1SILaV TIME SECONDS Figure 2 Sample temperature during a 30 s cycle Chart recording of the analog output of a BAT 12 tempera ture monitor with an IT 23 thermocou ple probe time constant 0 005 s Figure 3 Sample temperature during a Sensortek Clifton NJ The thermocou 60 s cycle Conditions of measurement ple was placed in 10 ul of water within were as described in Fig 2 a microcapillary tube ARTICLES Figure 4 Micro DNA amplification Ethidium bromide stained amplification products of human genomic DNA delimited by the B globin primers KM29 and RS42 7 From 1 to I00 ul samples were amplified in capillary tubes using 40 cycles of amplification 1 min at 90 C 1 min at 55 C 1 min at 72 C and the air cycler previously described 6 The resulting product 1 to 10 ul was applied to a 1 5 agarose gel Figure 5 Rapid DNA amplification is dependent on polymerase concentra tion The total amplification time was 20 min and consisted of 40 30 s cycles as shown in Fig 2 The amount of Taq poly merase varied from 0 1 to 0 8 U in each
64. e must be taken not to bend or harm the thermocou ple probe which looks like a small wire protruding 1 2 1 25 cm into the cham ber from the side wall If there are no obstructions in the chamber turn off the instrument unplug the power cord lay the instrument on its side and using pencil or pen carefully turn the lower fan blade be very careful not to bend the lower blade Check the lower fan blade for contact with the fan guard If the lower fan blade has one blade which contacts the guard carefully use the pencil or pen to gently bend the contacting blade slightly up If anything more than a very slight contact is occurring please call our service department at the appropriate number listed at the beginning of this section If no problem is found in the lower fan blade area and the noise problem per sists please call our service department at the appropriate number listed at the beginning of this section z 0 N bu m a EJ lo a E Q The machine is slow to heat up A If the instrument is taking an excessively long time to reach a set tempera ture it is possible there is an air leak from the reaction chamber First check to be certain that all three of the sample modules are in place and firmly seated It is not necessary for all of the modules to contain sample tubes but the instrument cannot operate correctly without all three modules in place If all modules are seated correctly inspect t
65. e sionaorar vele L LLLI EEG ES EMT EEES EAS AAA jpeseneriePrimer rere er ere He _ ewendown ML LEGE A e CTT CRE use ur ner rs ST Shs Chor I D ied Lo ey ho n ko c u elu o ro oo IRE jo HL co F o z 5 SO po jo po r co oou HL o un gm a E la ho uo fo r r IJI B I epp lo o j o a I2 fo I 2 rm ka for ES e n rm ko a I2 fo I Lo rm o for ES fou n jr fo or un ui Lu un Lo um o appe r m m r r r ka foo foo po 00 foo ea foo pa Joo Fer Jer a e o jov Jar Jor Fo or 1 ji apa indien ini a aja aa m ala 1 ala Trouble S ooting Phone numbers to call for service problems US and Canada 1 800 735 6544 Outside the US 1 801 736 6354 Fax 1 801 588 0507 u mn a E fe e 0 z e e 7 E mail addresses Web address Idaho Technology it idahotech com www idahotech com User s Group lightcycler idahotech com Q There is no display when the instrument is turned on A Make sure that it is plugged in if so then check electrical fuses as per instructions found in the Service and Maintenance section of this manual If the problem persists please call our service department at the appropriate number listed at the beginning of this section Q When RUN is pressed nothing happens A Be sure the proper protocol screen is visible on the LCD display
66. e with a quick rebound to the elongation temperature With the door open the airstream and sample temperatures are not in equilibrium with the sys tem aluminum housing fan blades heating coil so when the door closes the sample temperature is quickly increased by heat transfer from the sys tem back to the airstream and sample This has previously prevented study of extended anneal ing times or low elongation temperatures This limi tation was overcome by only partly opening the solenoid activated door resulting in partial air recirculation and a slower denatu ration to annealing transition The transition time was increased from 9 to 20 25 s and the system and sample were in temperature equilibrium when the door closed This allowed annealing times at 54 56 C longer than 1 s Figure 4 and elongation temperatures below 70 C Figure 5 Sa1DILaV The time or temperature of individual amplification stages was varied sys tematically as indicated in each figure The optimum temperature was first deter mined and then the effects of varying the time at that temperature were inves tigated Finally rapid cycling was compared to conventional heat block cycling using an identical amplification mixture RESULTS Using the RS42 KM29 primer pair for ampli _Denaturation Temperature CC fying a 536 base pair fragment of B globin from human genomic DNA the effects of varying temperatures and times for denatura tion annealing
67. eactions specificity and yield B Systematic Optimization B B Protocol for Rapid Cycling When trying to optimize a new primer pair we run test reactions at annealing temperatures of 40 50 and 60 C At each of these temperatures we run high medium and low Mg2 concentrations 1 0 2 0 and 3 0 mM MgCl2 This gives nine different reaction conditions which cover a wide range of DNA hybridization stringencies The low Mg2 buffer at 60 gives the highest stringency while the high Mg2 buffer at 40 gives very low stringency Figure 1 Usually one or more of these conditions will provide good specificity and yield If needed intermedi ate temperatures or Mg2 concentrations can be tried in a second experiment If you are running a large number of primer pairs then nine reactions per pair can get a little out of hand About 80 of primer pairs can be successfully ampli fied in the medium Mg2 buffer at 40 50 or 60 C Even if none of these three conditions is ideal you will offen get a clue as to what conditions to try next If you have no band at 50 or 60 and a weak band at 40 then you will want to try the high Mg2 buffer next If 60 is giving non specific amplification you will want to try the low Mg2 buffer z Qe oe 5a as aw z Conclusion To paraphrase Robert Pirsig optimization of new primer pairs requires great peace of mind Our lack of understanding of the amplification reaction prevents t
68. echnology Reaction Mixes and Buffer Recipes Rapid Cycle DNA Amplification The 10 Most Common Mistakes Volume 3 Number 1 Fall 1995 Pg 112 Capillary Tube Handling with the Rapidcycler Use of Thin Walled Microcentrifuge Tubes with the Rapidcycler Direct Sequencing of Long PCR Products Rapid PCR Fingerprinting of Bacterial Genomes with REP Primers in Capillary Tubes Using the Air Thermo Cycler Comparison of PCR Cycler Machines for Rapid and Sensitive Detection of Pathogens New from Idaho Technology Tr E fT a N rf z The RAPIDCYCLIST newsletter has been modified to best fit into this manual All of the articles that were published in the original versions of the newsletter have been included There were only three publications of The RAPIDCYCLIST 2 pr 9 gt Q a a lt c DCYCLIST Volume 1 Number 1 Spring 1992 Optimizing Rapid Cycle DNA Amplification Reactions Randy Rasmussen Department of Biology University of Utah Gudrun Reed Department of Pathology University of Utah The complete optimization of a DNA amplification reaction unfortunately requires some trial and error Optimizing an amplification requires finding condi tions such that 1 the template melts at the denaturation temperature 2 the primers pair with their complement at the annealing temperature but not with non specific sequences 3 Temperature and time conditions are adequate for the complete extens
69. ed for rapid cycling and include 10 12 30 40 or 50 Mg buffers If your reaction involves primer extension briefly denature template nucleic acid before rapid cycling is begun We recommend linking a preliminary 15 30 sec hold at 94 C to your rapid cycle program Prolonged exposure of template to high temperatures is not recommended especially when long products are desired because of the possibility of strand breakage Only partial renaturation occurs on cooling allowing rapid denaturation to occur during cycling If a plasmid is your source of template cutting the plasmid with a restriction enzyme may increase yield although it is usually not necessary 2 PREPARING MULTIPLE SAMPLES To simplify preparation of multiple samples we suggest making a master mix containing all solutions common to the samples you intend to run in one well of a microtiter plate with U shaped wells If you are not using the buffer BSA sup plied by Idaho Technology make sure BSA is added to the master mix before the enzyme to avoid possible absorption of enzyme to the surface Alternately use enzyme diluent to make a 10X enzyme solution that already contains BSA To prepare individual samples first distribute DNA primers or which ever ele ment is unique to each sample into a row of individual wells of the microtiter zz sa z aa d plate Then transfer the appropriate volume of master mix and aspirate several times with the pipette tip to
70. eme of Rasmussen Rapid Cyclist vol 1 no 1 1 5 1992 This takes only a couple of hours and pays great dividends PCR Reaction for a Typical Analytical Amplification Use 10 15 uL of the following in a single capillary For a preparative run scale by 5 and load into 6 capillaries A Typical Amplification Program For products longer than 1 kb assume an elongation rate of 20 bases sec for the elongation time The annealing temperature can vary from 40 to 65 and is determined empirically in a 3 x 3 optimization For products longer than 3 kb a denaturation time of 5 sec frequently improves the yield If primers are poorly balanced or imper fectly match their sites a ramp constant S of 6 will sometimes help For single product preparative runs use Wizard PCR Prep Promega 2800 Woods Hollow Road Madison WI 53711 5399 800 356 9526 for rapid cleanup Elute with H2O and store at 20 When more than one band is present excise the correct one and purify with GeneClean Bio 101 PO Box 2284 La Jolla CA 92038 2284 800 424 6101 Again elute with H2O and store frozen 8 uL water 2 uL 10X PCR Reaction Buffer 2 uL 4 dNTP s each at 2 mM 2 uL primer 1 at 5 uM 2 uL primer 2 at 5 uM 2 uL DNA diluted 1 100 2 ul Taq Tagstart see above Total 20 uL 10X PCR Reaction Buffer 500 mM Tris pH 8 3 2 5 mg ml BSA 5 Ficoll and 10 mM Cresol Red MgCl2 added to 10 20 or 30 mM 1 Hold 30 sec at 94
71. enaturation and annealing 50 ul samples 60 second holds at denaturation and annealing Elongation requires 25 nucleotides per second plus about 15 sec onds Figure 3 Optimization of RS KM primer pair in microfuge tubes Lanes 1 3 60 C annealing 4 3 and 2 mM MgCl Lanes 4 6 50 C annealing 4 3 and 2 mM MgCl Lanes 7 9 40 C annealing 4 3 and 2 mM MgCl 10 ul reaction volume no oil 10 sec holds at annealing and denaturation 3 OPTIMIZATION OF REACTIONS IN THIN WALLED MICROCENTRIFUGE TUBES The same optimization protocol that has been recommended in capillaries Optimizing Rapid Cycle DNA Amplification Reactions Rasmussen and Reed Rapid Cyclist 1 1 5 1992 has provided excellent results in thin walled microcen trifuge tubes gt z iS E z o JIdNVS Optimal reaction conditions are found by running amplifications at 40C 50C and 60C with 2 mM 3 mM and 4 mM MgCl at each temperature This allows you to test 9 different stringencies while only requiring you make up three different reaction mixes have used this optimization protocol successfully with Idaho Technology buffers low medium and high MgCl buffers Promega 10X Taq buffer and Stratagene 10X Pfu buffer 4 ARE MINERAL OIL OVERLAYS REQUIRED The thin walled microcentrifuge tube holders for the RapidCycler put the entire tube inside the reaction chamber This keeps the whole tube at the same temperature and thus reduces condensation A
72. ependent oligonucleotide target duplex stabilities rules from empirical studies with a set of twenty mers BioTechniques 8 674 678 McLeod A 1990 A comparison of thermo cycling devices for automating the polymerase chain reaction J Med Eng Technol 14 60 68 Mullis K B and F A Faloona 1987 Specific synthesis of DNA in vitro via a polymerase catalyzed chain reaction Methods in Enzymol 155 335 350 Saiki R K 1989 The design and optimization of the PCR p 7 16 In H A Erlich Ed PCR Technology Stockton Press New York Saiki R K C A Chang C H Levenson T C Warren C D Boehm H H Kazazian and H A Erlich 1988 Diagnosis of sickle cell anemia and beta thalassemia with enzymatically amplified DNA and nonradioactive allele specific oligonucleotide probes N Engl J Med 319 537 541 Saiki R K D H Gelfand S Stoffel S J Scharf R Higuchi G T Horn K B Mullis and H A Erlich 1988 Primer directed enzymatic amplification of DNA with a thermostable DNA polymerase Science 239 487 49 Saiki R K U B Gyllensten and H A Erlich 1988 The polymerase chain reaction p 141 152 In K E Davies Ed Genome Analysis A Practical Approach IRL Press Washington DC Sambrook J E F Fritch and T Maniatis 1989 In vitro amplification of DNA by the polymerase chain reaction p 14 1 14 35 In Molecular Cloning A Laboratory Manual 2nd Ed Cold Spring Harbor Laboratory Cold Spring Harbor NY Sc
73. equent screenings To validate this protocol designed for the ATC we compared REP amplifi cations in MBTC with those obtained with the conditions here described Figure 2 shows that DNA amplifica tion products were comparable and tended to parallel each other when BSA was present in the reaction indi Figure 2 REP amplification patterns using metal block MBTC and capilary air thermo cyclers ATC Lane 1 Rm 2011 MBTC lane 2 Rm 2011 MBTC BSA lane 3 RM 201 ATC BSA lane 4 Rm 1029 MBTC lane 5 Rm 1029 MBTC BSA lane 6 Rm 1029 ATC BSA lane 7 Rm 41 MBTC lane 8 Rm 41 MBTC BSA lane 9 Rm 41 ATC BSA lane 10 Rm 1 74 MBTC lane 11 Rm 1 74 MBTC BSA lane 12 Rm 1 74 ATC BSA lanes 13 14 and 15 controls with out template for MBTC MBTC BSA and ATC BSA respectively Molecular weight marker pUC 9 Haelll ze ze 5 20 2 m lt Jo me An 2 cating that BSA has additional effects other than the enzyme protection in the capillary system Moreover the presence of BSA allowed the amplification of DNA from the strain Rm 1 74 Total DNA preparation from these rhizobia was sys tematically contaminated by a yet unknown pigment which strongly inhibited conventional PCR amplifications The system here described for the characterization of bacterial genomes is fast reproducible strain specific and suitable for amplification of samples con taining natural PCR inhibitors not removed during the cell heating or template DNA prepara
74. erials and fication yield The denaturation to annealing Methods except that the annealing transition time was either 9 sec door completely temperature was varied from 40 to open or 25 sec door partially open The 70 C The annealing time at each annealing time at 54 56 C was varied from 1 80 temperature 1 C was 1 sec sec Ofher conditions were as given in Figure 3 Elongation Temperature C Elongation Time at 77 C sec 87 83 80 79 40 75 20 71 10 67 5 63 2 5 PhiX 174 RF PhiX 174 RF Hae lll Digest j Hae III Digest Figure 5 Effect of elongation temper ature on DNA amplification yield Amplification was performed as described in Materials and Methods except for the following the elonga tion temperature was varied from 63 to 87 C the elongation time was extended to 40 sec to decrease the artifact of transitions to and from the elongation temperature only 0 1 U of polymerase was used per 10 ul reac tion and a 20 sec denaturation to annealing transition time was used Figure 6 Effect of elongation time on DNA amplification yield The elonga tion time at 75 79 C was varied from 2 5 160 sec a 9 sec denaturation to annealing transition and 0 4 U poly merase per 10 ul amplification mixture were used Other conditions were as given in Materials and Methods DISCUSSION It is well recognized that DNA amplification is critically dependent on the sample temperature time profile Howeve
75. es Fuse size and style locat ed on the instrument tag on back of instrument Install fuse tray 4 Plug instrument back in Turn switch back on Check for proper operation of instrument If problems persist call our service department at 800 524 6354 20 zz X uz ou zs E E THERMAL FUSE REPLACEMENT Tools amp supplies needed Flat blade screwdriver 5 64 hex wrench replacement thermal fuse 1 Turn off the power switch on the back of the instru ment Unplug instrument If the instrument has been recently in operation wait for approximately five minutes for the light bulb to cool lt lt NEVER ATTEMPT TO REMOVE A HOT BULB gt gt 2 Completely loosen the four top corner screws Figure 1 These screws are captive style screws and do not come completely out of the instrument top but can be completely loosened in place 3 Lift the back of the top duct straight up Figure 2 Figure 2 The top of the instrument and the top duct should lift up approximately 7 16 1 cm If the instrument top does not lift up check the four corner screws to ensure they are completely loose If the top still does not easily lift up gently pry up the back of the instrument top near the back duct Figure 3 4 After the instrument top lifts straight up raise the front of the instrument top up and back to allow access to the bulb Figure 4 5 Carefully check the bulb to ensure it is cool Unscrew and remove the
76. f time ACKNOWLEDGEMENTS We thank Mr Charles Schaemal for design and construction assistance and Dr David Low for the E coli probes and DNA wn wi a Q E lt REFERENCES IH Mullis K B and Faloona F A 1987 Methods in Enzymology Vol 155 Academic Press New York pp 335 350 Saiki R K Gelfand D H Stoffel S Scharf S J HiguchiR Horn G T Mullis K B and Erlich H A 1988 Science 239 487 491 Rollo F Amici A and Salvi R 1988 Nucleic Acids Res 16 3105 3106 Foulkes N S Pandolfi de Rinaldis P P Macdonnell J Cross N C P and Luzzatto L 1988 Nucleic Acids Res 16 5687 5688 Kogan s C Doherty M and GitschierJ 1987 N Eng J Med 317 985 990 Blyn L B Braaten B A White Ziegler C A Rolfson D H and Low D A 1989 EMBO 8 613 620 Saiki R K Scharf S Faloona F Mullis K B Horn G T Erlich H A and Arnheim N 1985 Science 230 1350 1354 Saiki R K Chang C A Levenson C H Warren T C Boehm C D Kazazian H H and Erlich H A 1988 N Eng J Med 319 537 541 gt a E O Es m m Y wi 9 e lt Minimizing the time required for DNA amplification by efficient heat transfer to small samples Analytical Biochemistry Vol 186 328 331 1990 Carl T Wittwer G Chris Fillmore and David J Garling Department of Pathology University of Utah Medical School and Associated Regional and University Pathologists Hot
77. fter a total amplifi cation time of only 10 min Control samples without template DNA or polymerase did not show visible bands not shown DISCUSSION The advantages of an air cycling system for DNA amplification include sim plicity low cost and rapid temperature cycling Air is an ideal heat transfer medi um which can change temperature quickly because of its low density Air can he rapidly mixed with baffles 6 or by a fan Fig I to provide homogeneous tem perature exposure over the sample containers The low thermal conductivity of air requires that air be rapidly blown past the heating coils and sample contain ers for efficient heat transfer Any temperature cycling protocol for DNA amplification can be divided into six segments three endpoint temperatures and three temperature transitions Time spent in transition is usually wasted although theoretically a slow transition between annealing and elongation may be useful for a poorly annealing primer Transition times after elongation and denaturation have no function the faster the sample can be cooled after denaturation the better Rapid cooling after denaturation favors the kinetic process primer annealing to template product over the equilibrium process product dimerization SiTOlLAV Annealing and denaturation are claimed to occur almost instantaneously once the sample has reached the appropriate temperature 3 Classical kinetic studies on DNA renaturation 8 9 al
78. g 20 mers to 30 mers can lead to synthesis of cCDNA s from non specifically hybridized primers These prod ucts might be specifically amplified during the quantitation The Relative versus Absolute Quantitation Problem When measuring product by radiolabel it is difficult to convert CPM s to absolute measures of DNA quantity One solution to this problem is to set up an external standard curve by running known amounts of DNA each in their own reaction tube Unfortunately this straightfor ward method has run into trou ble due to large variation in the efficiency of different reactions Further complications arise with RT PCR because of the desire to control for the efficiency of the reverse transcriptase step These problems have led to the use of internal standards of various types 7 123456789 1011 12 r The simplest internal stan dard is to simultaneously quanti TENE lae ihe sequence of interest Figure 4 Reproducibility of PCR amplification for quanti with some more or less invariant tation of products multiple tissue samples PCR analysis housekeeping MRNA If the for 24 cycles with Cr2 oligos lanes 1 6 and B actin oligos level of the housekeeping lanes 7 12 with 100ng of CDNA generated from three gene s message is constant different spleens lanes 1 3 and 7 9 and livers lanes 4 6 and 10 12 from Tan 1992 ze Su 20 2 m lt Jo me An 2 between samples then the amount of the unknown t
79. g2 at all 5 Reaction Buffer Our standard reaction buffer is a 10X buffer containing 500 mM Tris pH 8 3 2 5 mg ml crystalline BSA and MgCl2 at 10 20 or 30 mM The BSA is critical for pre venting denaturation of the polymerase on the glass surface of the capillary If you plan to run your finished reaction on an agarose gel you can add 5 Ficoll 400 and 10 mM tartrazine to your 10X buffer This allows you to add the reac tion directly from the capillary tube to an agarose gel well We use tartrazine instead of bromphenol blue or xylene cyanol because it does not affect the amplification reaction Tartrazine runs faster than bromphenol blue If you wish you may use commercially available reaction buffers for rapid cycling but you must add BSA Failure to add BSA will cause denaturation of the polymerase and therefore failure of the reaction 2 zi zo 2o 2 m lt e ne An V Qe di gr as aw z 6 Enzymes Most heat stable enzymes come at a concentration of 5 U ul We make a 1 12 5 dilution in a enzyme dilution buffer that consists of 10 mM Tris pH 8 3 and 2 5 mg ml crystalline BSA This gives a 10X stock solution This dilute enzyme solution is stable for at least 2 days at 4 C We have found little significant difference between the enzymes from different suppliers However different heat stable enzymes may differ in their reaction rates and temperature and time paramters may need to be adjusted accordin
80. gly 7 Reaction Volume Our standard reaction volume is 10 pl This produces enough DNA product for most applications If you do need more DNA multiple 10 ul capillaries can be filled from the same master mix or you can use larger 25 or 50 ul capillaries The larger capillaries require a short 5 20 second hold at denaturation and anneal ing to allow the larger sample to reach temperature Because the temperature is not as well defined we prefer to use multiple small capillaries 8 Cycling Times and Temperatures A cycling protocol requires setting three temperatures denaturation anneal ing and elongation temperatures Denaturation should be set at as high a temperature as possible without killing the enzyme We routinely use 94 C Altering this temperature has not been helpful A rapid air cycler Idaho Technology Salt Lake City Utah can hold the denaturation time for as long as desired but we have not found any advantage in holding denat uration We recommend a denat uration time of O seconds when using the standard 10 ul capillary tubes Because of a larger ther mal mass samples in the 25 yl tubes require a hold time of 5 10 sec and samples in 50 ul tubes require 10 20 sec o A A ET LL LLLI 11 LI ssssussssczc To Gc EERENAA s Se ee oe ee eee Saas ea ions Gas en Ses E dE ODA ES DS PEA ES 20 30 40 50 60 70 80 Temperature o o 2 o o Uu inr
81. he formation of a set of rules for predicting conditions that will be successful This lack of simple rules can make the optimization process frustrating Fortunately there are usually only two variables to worry about and the reasonable range of these variables is limited Annealing temperatures are rarely less than 37 or more that 70 Magnesium concentration is never less than about 1 mM and rarely more than 5 mM It doesn t take many experiments to cover this range With per severance you can eventually get any primer pair to work Good Luck Buffers and Reaction Components for Rapid Cycling Carl T Wittwer Department of Pathology University of Utah Medical School Many different buffers and reactant concentrations have been reported for DNA amplification Rapid cycle DNA amplification was originally optimized with the following buffer 1 20 mM KCI 50 mM Tris pH 8 5 3 mM MgCl2 with 500 uM each dNTP 500 ug ml BSA BSA is required when capillary tubes are used gelatin is a poor substitute and greatly reduces amplification yield Although we have tried conventional buffers that contain 50 mM KCI 2 a greater number of amplifications with various primers were successful at lower KCI concentrations In sequencing reactions the best extensions are reportedly obtained when no KCI is included 3 We now rou tinely use a buffer system without KCI zm 55 5 20 2 m lt Efe me An 2 E Da di 53 as aw z
82. he least nonspecific amplification The optimal elongation temperature was between 75 79 C with little ampli fication above 80 C or below 70 C Figure 5 Longer elongation times increased product yield as shown in Figure 6 although the increase in yield appeared to plateau after 40 80 s wn wi a Q E lt Figure 7 compares the 30 cycle amplification product obtained with four dif ferent temperature profiles Conventional heat block microcentrifuge tube cycling was used in Figure 7A and 7B The transitions between temperatures were relatively slow and many nonspecific amplification bands were present Nonspecific amplification was reduced by limiting the time at each temperature Figure 7B compared to Figure 7A Using rapid hot air cycling Figures 7C and 7D nonspecific amplification was dramatically reduced Easily visible specific prod uct was apparent using only a 10 s elongation Figure 7D although extending the elongation time to 60 s did increase the yield Figure 7C Annealing Temperature CC Ramp Time Annealing Time 29 to 55 C sec at 55 C sec 70 65 lt 1 60 5 55 10 45 2 40 40 80 PhiX 174 RF Hae III Digest f PhiX 174 RF Hae Ill Digest SIMDILAV Figure 3 Effect of annealing temper ature on DNA amplification yield Figure 4 Effect of annealing time and denatu Amplification was performed for 30 ration to annealing transition time on DNA ampli cycles as described in Mat
83. he perimeter of the instrument top for fit and check the four corner screws securing the instrument top to ensure they are tightened snugly If the instrument top is not aligned correctly undo the top and reset in place following the instruction for top removal and replacement in the Service and Maintenance section of this manual The other potential source for a leak is the solenoid operated door located at the top of the rear air duct If the door does not completely close when the instrument is attempting to reach a denaturation temperature look around the door for any obstructions If the door does not close and no obstructions are apparent please call our service department at the appropriate number listed at the beginning of this section Q The machine is slow to cool down 15 sec from denaturation to annealing temperatures A The RapidCycler requires an unobstructed supply of room temperature air around the entire base of the machine Setting the machine too close to a wall or surrounding it with books or other objects cuts off the air supply and slows the cooling down It is also important for the air outlet at the top rear of the machine to be unobstructed If after clearing all obstructions the cool down is still slow run a cycle proto col and watch the solenoid activated door during the transition between denat uration and annealing The door is visible by looking through the grill at the top rear ofthe instrument If the
84. hildkraut C 1965 Dependence of the melting temperature of DNA on salt concentration Biopolymers 3 195 208 20 21 22 Smith M 1983 Synthetic oligonucleotides as probes for nucleic acids and as primers in sequence determination p 23 68 In S M Weissman Ed Methods of RNA and DNA sequencing Praeger Press New York Wetmer J G and N Davidson 1968 Kinetics of renaturation of DNA J Mol Biol 31 349 370 Wittwer C T G C Fillmore and D R Hillyard 1989 Automated polymerase chain reaction in capillary tubes with hot air Nucleic Acids Res 17 4353 4357 Wittwer C T G C Fillmore and D J Garling 1990 Minimizing the time required for DNA amplification by efficient heat transfer to small samples Anal Biochem 186 328 331 Zimran A W C Kuhl and E Beutler 1990 Detection of the 1226 Jewish mutation for Gaucher s disease by color PCR Arn J Clin Pathol 93 788 791 SIMOILAV Ihe RAPIDCYCOIST Newsletter Volume 1 Number 1 Spring 1992 Pg 77 Optimizing RapidCycler DNA Amplification Reactions Buffers and Reaction Components for RapidCycling A R A P I D Protocol for the ATC Research in Progress at Idaho Technology Volume 2 Number 1 Spring 1994 Pg 91 Creating a DNA Probe Thermal Cycling with Degenerate Primers Superior Quantitation of Rare mRNA s Using Rapid Cycling Rapid Cycle Amplification of VNTR Loci for Engraftment in Bone Marrow Transplantation New from Idaho T
85. ideal heat transfer medium which can change temperature quickly because of its low density Temperature homo geneity problems are solved by rapidly mixing air with a fan to provide homoge neous temperature exposure over the sample containers The sample container is just as important as the heat transfer medium An optimal sample container should be water vapor tight and have i low thermal mass ii good thermal conductivity iii minimal internal condensation iv easy sample recovery without cross contamination v No adverse effects on the reaction Whatever the container material temperature equilibration will always be achieved faster if the sample volume is small if the container wall is thin and if the surface to volume ratio of the sample exposed to the container wall is high Problems with condensation can be reduced by minimizing the free air space surrounding the sample Microfuge tubes are kept water vapor tight by mechanical closure and if necessary overlaid mineral oil Thermal conductivity is poor because of the material and its thickness about 1 mm Internal condensation can occur if min eral oil is not used and particularly if different parts of the tube are at different temperatures Sample mixing by convection has been used in conical tube instruments The temperature gradients that cause convection are not a good idea for a temperature dependent reaction Capillary tubes are kept vapor tight by flame closu
86. ight tubes can then be staggered off from each other by pressing the tubes down on a bench top The bottom of the first row of eight tubes and the top row of the second row of eight can then be sealed one at a time by passing through the flame The staggered rows can then be switched and the remaining two ends can be sealed After the reaction is done the ends can be scored as in the eight sample example Figure 8 Scoring all eight tubes at once by lightly drawing the sapphire knife across the top of the module Figure 9 Breaking off tube top after scoring EP TENERE WERE Figure 2 Temperature traces of the hold method 2B versus the over heat and under heat method 2A Traces are of air temperature and actual sample temperature Notice how the sample temperature always lags behind the air temperature and how the over under heat method brings the sample to temperature more quickly YdLLITSMIN LsMDADdidva Use of Thin Walled Microcentrifuge Tubes with the RapidCycler Randy P Rasmussen Dept of Biology University of Utah The development of thin walled micro test tubes makes it possible to com bine the speed of the air cycling with the convenience of that universal vessel of molecular biology the microcentrifuge tube While the Rapidcycler was developed for use with glass capillaries it provides excellent results with thin walled microcentrifuge tubes Using modified sample modules the Rapidcycler can hold up to
87. illation counting tration of DNA m 5 o 2o 2 m lt ke mr An ea Qe oe Ji as aw z When doing a quantitation experiment with the Air Thermo Cycler a typical experiment would include making up a large master mix filling multiple capillar ies from that master mix and starting all the tubes at the same time As the reac tion goes on tubes are pulled out at increasing numbers of cycles The amount of DNA in each tube can be quantitated in various ways The points that fall in the log linear portion of the curve can be used to determine the amount of start ing material and the efficiency of the reaction For Figure 2 the efficiency of the reaction during the log linear phase was about 1 7 which is typical for a real reaction The Quantitation and Detection Problem The most common technique for detection and quantitation of DNA is radio labeling with 32P Amplified products can be labeled by incorporation of radio labeled nucleotides or by end labeling one of the primers End labeling tends to be more sensitive because a higher fraction of the product carries a label 6 but labeling by incorporation is easier if you don t need the sen sitivity After the amplification reactions are size separated by gel electrophoresis The gels can then be directly quantitated by autoradiography using film or a Phosphorlmager type system The limited linear range of film usually 3 orders of magnitude or less
88. illyard University of Utah Medical School ABSTRACT We describe a simple compact inexpensive thermal cycler that can be used for the polymerase chain reaction Based on heat transfer with air to samples in sealed capillary tubes the apparatus resembles a recirculating hair dryer The temperature is regulated via thermocouple input to a programmable set point process controller that provides proportional output to a solid state relay control ling a heating coil For efficient cooling after the denaturation step the controller activates a solenoid that opens a door to vent hot air and allows cool air to enter Temperature time profiles and amplification results approximate those obtained using water baths and microfuge tubes INTRODUCTION Cyclic DNA amplification using a thermostable DNA polymerase allows auto mated amplification of primer specific DNA widely known as the polymerase chain reaction 1 2 Automation requires repetitive temperature cycling Commercial programmable heat blocks are available and low cost machines using water baths with fluidic switching 3 or mechanical transfer 4 have been described Instead of heat transfer from metal blocks or water through high ther mal resistance plastic microfuge tubes we describe a device that uses hot air for temperature control of samples in thin glass capillary tubes D wi I 9 e lt Figure 1 Drawing of the capillary tube hot air DNA amplifier 1 reaction cha
89. in long product amplifications CE Gustafson et al 1993 Gene 123 241 244 and W M Barnes 1994 PNAS 91 2216 2220 Mistake 7 Using nonstandard capillary tubes The tubular metal sheathed thermocou ple that monitors temperature in the air cycler is precisely matched in thermal response to aqueous samples in the 10 ul capillary tubes sold by Idaho Technology When nonstandard capillary tubes are used the temperature of the sample will not correspond to the temperature indicated on the instrument read out If you optimize a reaction in 10 ul tubes and later run the reaction in larger tubes you should not expect similar results Larger tubes will not reach target temperatures without setting a hold time If you insist on using larger or nonstan dard tubes you can monitor the sample temperature inside the tube with an IT 23 micro thermocouple probe available from Sensortek Clifton NJ and empiri cally adjust target temperatures and hold times Be aware that some types of glass interfere with the reaction presumably because ions on or near the surface of the glass are absorbed into the reaction buffer Mistake 8 Forgetting to add a critical component Accidental omission of polymerase ONTP 1s or buffer components can be avoided by master mixes that include everything necessary for amplification except primers and template Such a master mix if sterile lasts for 3 6 weeks at room temperature gt 15 weeks at 4 C and gt 26
90. ing Our selection for final testing is poly carbonate tubing which has thermal response characteristics almost identical to our 10 ul glass tubes The polycarbonate does not interfere with the reaction and it should be of great help in those situations where the fragility of glass capillary tubes is an excessive hazard However those who are interested in using plastic capillary tubes should be aware that plastic tubes are not without their drawbacks Glass tubes can be easily loaded either singly or eight at a time by capillary action However hydrophobic plastic tubes require a loading mechanism such as a micro aspirator or a similar device We are working on ways of loading and sealing eight tubes at a time but at present it can only be done one tube at a time The second drawback is sealing the ends of the plastic tubes It is tricky but possible to flame seal plastic tubes by intentionally igniting the ends For many people this tends to be somewhat disconcerting therefore we have developed an electric tip sealer The last potential problem with plastic tubes is price At a cost of approxi mately 80 per 1000 plastic tubes will be about twice as expensive as similar glass tubes Even at that price plastic tubes would still be less expensive than other second generation sample containers We will know more about pricing after final testing on the tubes is complete We hope to be completely finished with the final tests on the plastic
91. ing the microaspirator back a bit as you insert the capillary tube The silicon tips of the microaspirator wear out quite quickly so if your microaspirator stops working try replacing the tip IT 1870 Multiple Tube Handling Once you get single sample handling down you may want to try some of these advanced multiple sample handling tricks Eight Sample Handling When sample modules are made with microtiter spacing it is possible to mix up eight samples at a time in a microtiter dish and draw them up simultaneously by capillary action Figure 6 All eight samples can be centered by tilting the module and then the tubes can be sealed by passing the tubes through a flame one at a time Figure 7 Once the reaction is done you can score all eight tubes at once by lightly drawing the sapphire knife across the top of the module Figure 8 and then breaking off each tube top Figure 9 Press the module down to the other end of the capillary tubes and repeat the scoring and breaking Figure 6 Mixing up simultaneous ly with capillary action Figure 7 Sealing capillaries by passing the tubes through the flame one at a time a me zo 20 e m lt Jo mre An E Qe oe WI as ow z oz Sixteen Sample Handling After mastering the eight sample tricks you may want to try 16 at a time All sixteen tubes in the module can be filled simultaneously by capillary action After centering the samples the two rows of e
92. ink programs available Many of them come preprogrammed for the more commonly used reaction profiles 2 p o gt 9 a a lt c New Optimizer Kit The Optimizer kit has been modified to allow more flexibility and to reduce waste There are now four base buffers available ranging in Mg concentration from 10 mM to 40 mM Either of two gel loading additives Ficoll tartrazine or sucrose cresol red can be added along with dNTPs and other reaction con stituents into a master mix which will keep for months in a refrigerator Blazer mini torch We now ship a Blazer butane torch with the Rapidcycler The torch is fast igniting light weight and burns very hot It is a good general purpose lab torch and is ideal for sealing glass capillaries We recommend that everyone using glass capillaries keep one handy They are available either direct ly from us or from some sporting goods out lets Research in Progress at IT Idaho Technology Inc together with the University of Utah has received gener ous funding from the National Institutes of Health STTR program and from the University of Utah This joint research project is an effort to develop a system to continuously monitor the progress of an amplifica tion reaction The use of capillary tubes lends itself to fluorescent analysis of reac tion product during the course of a reaction By combining a fluorimeter and thermal cycler into a single mechanism it is possible to esse
93. ion Flame seal the loading end of the tubes then seal other end Place into the Air Thermo Cycler and run at desired protocol When reaction is complete score each end of the glass tubes while still in the modular top break glass and transfer directly into the gel wells T Qe oe os ag aw z Working Solutions 1 Primers and DNA are prepared in 1X TE 50X TE solution pH 8 3 500 mM Tris 5mM EDTA 10m12 M Tris pH 8 3 400 ul 0 5 M EDTA dH20O to 40 ml 1X TE solution pH 8 3 10 mM Tris 0 1 mM EDTA 200 ul 50X TE dH20 to 10 ml 10 ml 50X TE dH20O to 500 ml Or 2 Make 50 uM primer stocks with 1X TE Makel10X primers 5 uM either separately or com bined For 10X separate primers 40 ul 1 part 50 uM Primer 360 ul 9 parts 1X TE For 10X combined primers 40 ul 1 part 50 uM Primer 1 40 ul 1 part 50 uM Primer 2 320 ul 8 parts 1X TE Stock Solutions 3 10X Nucleotides 2 mM each dATP dCTP dGTP dTTP 250 ul 100 mM dATP Sigma D4788 250 ul 100 mM dCTP Sigma D4913 250 ul 100 mM dGTP Sigma D5038 250 ul 100 mM dTTP Sigma T9656 to 12 5 ml with dH2O 4 10X Buffer 2 5 ml Tris pH 8 3 2 M stock 0 5 ml BSA 50 mg ml stock 5 0 ml 40 Sucrose 1 0 ml 10 mM Cresol Red Low Mg2 Medium Mg2 High Mg2 200 ul 1M MgCl2 800 ul H2O 300 ul 1M MgCl2 700 ul H2O 400 ul 1M MgCl2 600 ul H2O 5 Enzyme diluent 10 mM Tris pH 8 3 2 5 mg ml BSA 50 ul 2 M Tris pH 8
94. ion of the product Failure to meet any of these conditions will cause failure of the amplification reaction You may notice that two of these conditions involve DNA duplex stabil ity so it s not surprising that two of the most important variables in DNA amplifi cation annealing temperature and salt concentration both affect DNA duplex stability What follows is a short discussion of each of the components of an amplifi cation reaction and then an outline of a systematic optimization protocol This protocol has allowed the successful amplification of both DNA and RNA via CDNA using many different primer pairs 2 me Su BO E m lt e mre BG E A Components of an Amplification Reaction 1 Primers Primer selection can greatly influence amplification success Sometimes there is little or no latitude in the selection of primer position in which case the fol lowing discussion is moot Since the amplification reaction is quite robust the chances are good that any primer pair can be made to work However with forethought the optimization time can be minimized Given flexibility in primer selection an intelligent choice of primers can simpli fy the optimization process and maximize both product yield and specificity There are several commercially available programs for selection of primer pairs and we have found them helpful These programs can help you avoid cross hybridization with other parts of your sequence inter
95. ion was as follows 50 mM Tris pH 8 3 500 ug ml BSA 3mM MgCI2 1x high magnesium buffer Idaho Tech 200 uM dNTPs 1U Taq DNA polymerase Promega Corp 15 uM of each REP primers and 1 ul of bacterial cells from a fresh isolated colony as the source of DNA template in a final volume of 25 ul The cycling conditions were as follows 95 C for 5 min 30 cycles at 94 C for 10 sec 40 C for 10 sec and 65 C for 2 min 1 final step at 65 C for 4 min All PCR amplifications were carried out using an Idaho 1605 Air Thermo Cycler ATC in 25 ul capillary tubes Ten ul of each sample were electrophoresed in 0 8 1 5 agarose gels added with 150 ug l ethidium bromide Results We set up the experimental con ditions using 4 strains of the soil bac teria Rhizobium meliloti Rm 2011 Dr J D narie Toulouse France Rm USDA 1029 Rm 41 Dr A Kondorosi Paris France and Rm 1 74 Dr A Puhler Bielefeld Germany The rapid transfer of heat in the capillary sam ple container allowed the shortness of amplification cycles from the required 600 sec in metal block ther mo cyclers MBTC to 140 sec in the ATC Thus the whole protocol could be carried out in less than 2h using either 1 ul of intact bacterial cells or purified DNA as template The obtained DNA amplification patterns Rm2011 USDA1029 Rm41 Rm1 74 M123 456 789 101112 131415 were all different among the strains Fig 1 and allowed us to identify any of them in subs
96. itated Upgrades to a lin ear actuator system should be available by the summer of 1992 Sample Handling Advances We recently received sample quantities of a 25 u plastic capillary tube Initial tests confirm that the reaction runs at slightly reduced speeds compared to glass capillary tubes Using the 25 y plastic capillary tubes the sample comes to tem perature in 5 10 secs which is comparable to sample response when using 25 glass capillary tubes We intend to continue our tests and make a positive dis placement sample handling system available soon We have recently tested a microscope slide rack using 24 x 60 mm cover slips Fisher Scientific Early test results look promising The slide rack will be available for purchase in May g Qe dii TE ag aw z a4 DCYCLIST Volume 2 Number 1 Spring 1994 Creating a DNA Probe Thermal Cycling with Degenerate Primers Marianne Schroeder Dept of Biology University of Utah We are cloning the DNA from a structural protein in Xenopus leavis to further characterize it A DNA probe was needed for Southerns northerns and probing libraries for our gene of interest The following is our procedure using the Air Thermo Cycler to clone and amplify a fragment of DNA using degenerate primers We found increased primer concentration as well as longer annealing times were beneficial in obtaining DNA products from degenerate primers Primer Design The protein of intere
97. itation by liquid scintillation counting A 32P end labeled Mspl digest of pBR322 was used as a size standard References 1 Murphy L D C E Herzog J B Rudick A T Fojo S E Bates 1990 Use of the polymerase chain reaction in the quantitation of mar 1 gene expression Biochemistry 29 10351 10356 2 Noonan K E C Beck T A Holzmayer J E Chin J S Wunder I L Andrulis A F Gazdar C L Willman B Griffith D D Von Hoff I B Roninson 1990 Quantitative analysis of MDR1 multidrug resistance gene expression in human tumors by poly merase chain reaction Proc Natl Acad Sci 87 7160 7164 3 Park O K K E Mayo 1991 Transient expression of progesterone receptor messenger RNA in ovarian granulosa cells after the preovulatory luteinzing hor mone surge Molecular Endocrinology 5 967 978 4 Weis J H S S Tan B K Martin C T Wittwer 1991 Detection of rare mRNAs via quantitative RT PCR Trends in Genetics 8 263 264 5 Tan S S Weis J H 1992 Development of a sensitive reverse transcriptase PCR assay RT RPCR utilizing rapid cycle times PCR Methods and Application 2 137 143 6 Gilliland G S Perrin and H F Bunn 1990 Competitive PCR for quantitation of MRNA In PCR Protocols ed M A Innis D H Gelfand J J Sninsky T J White pp 60 69 Academic Press New York 7 Wang M M V Doyle and D F Mark 1989 Quantitation of mRNA by the polymerase chain reaction Proc Natl Acad Sci 86 9717 9
98. itative power of reverse transcriptase PCR RT PCR is as good or better than the traditional methods of mRNA quantitation such as northern blot 1 dot blot 2 and in situ hybridization 3 Two recent papers from the John Weis lab report a sensi tive RT PCR assay using rapid air ther mocycling 4 5 The Weis lab was trying to measure mRNA for the complement receptor Cr2 a rare mRNA in mouse spleens They were unable to quanti tate the message when they used slow heat block cyclers because of very low yields of product DNA and highly vari able amounts of product They switched to an Air Thermo Cycler and solved both of these problems The amount of DNA produced was at least 100 fold greater in the air cycler than in the heat block instrument and the vari ability problem disappeared Figure 1 Heat Block Cycler Air Thermo Cycler 12345 12345 Figure 1 Comparison of RT PCR products using heat block instrument and the Air Thermo Cycler ATC Five different spleen cDNA samples were set up for PCR amplification and equally split between the standard heat block instrument first 5 lanes and the ATC last 5 lanes for the same number of cycles Quantitation of these results cutting the bands out of the gel and counting incorporated 32P dCTP indicated that there was at least 100 fold more product from the ATC than the heat block machine This short review will include some general considerations in quantitative PCR foll
99. l with 0 4 M NaCl and was phenol extracted and precipitated with ethanol cDNA con centration was determined by UV absorbance 3 The optimal cDNA concentration and number of cycles was determined by a titration from 1 to 500 ng of cDNA and from 18 to 39 cycles Optimal param eters were 200 ng of cDNA for 20 cycles Each 10 ul reaction contained 200 ng of cDNA 70 pmoles of each primer 50 mM tris pH 8 3 3 mM MgCl2 20 mM KCI 0 5 mg ml BSA 0 2 mM each dNTP 2 5 uCi 32P dCTP 3000 Ci mmol New England Nuclear 0 72 units AmplirTag DNA Polymerase Cetus To improve reproducibili ty a master mix was prepared without primers and then aliquoted to separate tubes containing the different primer pairs These mixtures were then aliquoted to the cDNA samples Each 10 ul reaction was loaded into a glass microcapillary tube Idaho Technology and the ends were flame sealed Capillaries were cycled in the 1605 Air Thermo Cycler Idaho Technology Cycling parameters Qe di Ji as aw z were denaturation 94 C for 1 sec annealing 59 C for 1 sec elongation 72 C for 4 seconds products ranged in size from 80 to 200 base pairs Total cycle time was 24 seconds 4 Following amplification the ends of the capillary tubes were scored and the samples removed using a microaspirator and then 5 ul were electrophoresed in a 6 acrylamide gel Radioactive bands were detected by autoradiography and then the bands were cut from the gel for quant
100. lantation 2 Donor 3 36 days after bone marrow transplan tation 4 100 days after bone marrow trans plantation In lane 3 alleles from both the donor and recipient are present at approxi mately equal amounts After 100 days lane 4 the unique donor band has dis appeared and only the original recipi ent alleles are present References 1 Horn GT B Richards KW Klinger 1989 Amplification of a highly polymorphic V Res 17 2140 2 Nakamura Y M Carlson V Krapcho R White 1988 Isolation and mapping of a polymorphic DNA sequence pMCT118 on chromosome 1p D1880 Nucl Acids Res 16 9364 3 Wittwer CT DJ Garling 1991 Rapid cycle DNA amplification time and tem perature optimization BioTechniques 10 76 83 4 Rasmussen R G Reed 1992 Optimizing rapid cycle DNA amplification reac tion The Rapid Cyclist 1 1 5 a Tr IT a ES Lu z 5 Wittwer CT G Reed K Ririe 1994 Rapid Cycle DNA Amplification The Polymerase Chain Reaction Mullis Ferre and Gibbs eds pp 174 181 2 9 gt Q o a lt e New From Idaho Technology Kirk Ririe Idaho Technology Inc Polycarbonate tubes There has been a great deal of interest displayed by users of the 1605 Air Thermo Cycler ATC in the possibility of using plastic capillary tubes to augment the glass capillary tubes currently standard in our instrument The results of our tests on various plastic tubes have been very encourag
101. lich H A 1988 N Engl J Med 319 537 541 Smith M 1983 in Methods of RNA and DNA Sequencing Weissman S M Ed pp 23 68 Praeger Press New York Wetmur J G and Davidson N 1968 J Mol Biol 31 349 370 10 Innis M A Myambo K B Gelfand D H and Brow M A D 1988 Proc Natl Acad Sci USA 85 9436 9440 Rapid cycle DNA amplification time and temperature optimization BioTechniques Vol 10 No 1 76 83 1991 Carl T Wittwer and David J Garling University of Utah Medical School ABSTRACT Rapid temperature cycling with hot air allows rigorous optimization of the times and temperatures required for each stage of the polymerase chain reac tion A thermal cycler based on recirculating hot air was used for rapid temper ature control of 10 ul samples in thin glass capillary tubes with the sample tem perature monitored by a miniature thermocouple probe The temperatures and times of denaturation annealing and elongation were individually optimized for the amplification of a 536 base pair B globin fragment from human genomic DNA Optimal denaturation at 92 94 C occurred in less than one second yield decreased with denaturation times greater than 30 seconds Annealing for one second or less at 54 56 C gave the best product specificity and yield Non spe cific amplification was minimized with rapid denaturation to annealing tempera ture transition 9 seconds as compared to a longer transi
102. long as you can end up with a big ugly glob of glass which will not fit into the holder This is more torch zm 5 Su 20 m lt Jo mr An E m Qe JE 5 as aw z oz likely in very hot flames m Figure 4 Scoring Cutting down the air to the capillary ends with flame will cool these burn sapphire cutter ers down and make the capillaries easier to seal You can confirm that the end is sealed by looking carefully at the end for a continuous wall of glass around the end You can also confirm sealing by blowing on the hot end of the capillary and watching to see if the liquid moves toward the end of the cap AAA illary as the glass cools This is more dramatic for the first seal than the second Repeat the sealing process on the other end and then insert the tube into the capillary holding module A module rack 59 IT 1735 makes these manipulations easier Sample Recovery ple into gel After your reaction is done you pull the tube from the module lightly score the two ends with a sapphire knife Figure 4 IT41691 and break off the ends The capillary tube then becomes a 3pipet tip2 for the Drummond microaspirator IT 1690 and can be used to directly load your sample into a gel Figure 5 or into a storage tube Beware the pressure caused by sliding the capillary into the microaspirator can cause your sample to be blown out of the tube This is easily prevented by dial
103. ly one cycle of 2 minutes at 74 C 2 seconds at 45 C The fastest transition speed S 9 on the 1605 Air Thermo Cycler and 2 0 on the Rapidcycler was chosen oux di 5s as aw z For the MiniCycler Perkin Elmer Cycler 480 and PHC 2 the PCR reac tion has to be covered with 50 ul of mineral oil but for the BioOven and the Air Thermo Cycler no oil was bp needed mi2z346466 7 The PCR products 6 10 ul each were separated by gel electrophore sis in a 2 3 agarose gel containing ethidium bromide 1 ug ml Results and Discussion Figure 1 shows the PCR results using the four different PCR cycler machines Only the two Mycoplasma gallisepticum strains gave 138 bp PCR products lanes 1 and 2 M syn oviae and H20 lanes 3 and 4 were negative The most intense bands were in panel d Air Thermo Cycler and panel c PHC 2 compared with less intense bands in panel a MiniCycler and panel b BioOven Cycle times were 50 seconds in Air Thermo Cycler 2 minutes 5 sec Figure 2 PCR results for different bacterial species in the 1605 Air Thermo Cycler 105 cells of each bacterial species was used for this test 296 agarose gel was used for the electrophoresis Lane m molecular size marker Lane 1 Clostridium perfringens The product is 280 bp Lane 2 C leptum The product is 257 bp Lane 3 C clostridiiforme The product is 255 bp Lane 4 Bacteroides distanonis The product is 273 bp Lane5 B the
104. ly reduce nonspecific amplification and poly merase inactivation respectively When the temperature response of the cycler and thermal equilibration of the sample are not limiting questions about optimal temperatures and times for DNA amplification can be answered to much greater accuracy than before The physical processes of denaturation and annealing and the enzymatic process of elongation can be specifically studied without the confounding effects of long transitions between temperatures This should lead to a more detailed under standing of DNA amplification and improved reaction efficiency and specificity ACKNOWLEDGMENT We thank Mr Charles Schamel for design and construction assistance EELER AA wn wi a Q E lt REFERENCES 1 Mullis K B and Faloona F A 1987 in Methods in Enzymology Wu R Eds Vol 155 pp 335 350 Academic Press San Diego Saiki R K Gelfand D H Stoffel S Scharf S J Higuchi R Horn G T Mullis K B and Erlich H A 1988 Science 239 487 491 Saiki R K 1989 in PCR Technology Erlich H A Ed pp 7 1 6 Stockton Press New York Hoffman L M and Hundt H 1988 BioTechniques 6 932 936 Cao T M 1989 BioTechniques 7 566 567 Wittwer C T Fillmore G C and Hillyard D R 1989 Nucleic Acids Res 17 4353 4357 Saiki R K Chang C A Levenson C H Warren T C Boehm C D Kazazian H H and Er
105. m materials to approximate the heating response of microfuge tubes transferred between water baths Although the current performance profile seems perfectly ade quate thinner housing material and an external fan motor with only the blades and shaft exposed to the circulating hot air could give even faster response A BC DEF G H 1857 bp 1060 bp 929 E Coli 560 B Globin 536 E 441 A 383 205 110 FERIe H T Figure 4 Ethidium bromide stained amplification products Lane A shows the product of amplifi cation in microfuge tubes manually transferred between water baths for comparison to the hot air amplifier in lanes B G Lanes A C 560 bp fragment of E coli DNA defined by primers TGAATCTG TACTCTGATGTAAC and CACTAATAGCAAGAGGGTACTCAG covering a portion of the regulatory region for pyelonephritis associated pili 6 An asymmetric amplification 50 pmol of one primer and 0 5 pmol of the other is shown in lane C Lanes D G amplification products of 4 different combina tions of the human B globin gene primers PCO3 PCO4 7 KM29 and RS42 8 Lane H BstN digest of pBR322 DNA size markers 0 5 ug times This might allow optimization of denaturation annealing and elongation steps in terms of time and temperature and shorten the ramp times between temperatures This could decrease the time required for a complete amplifica tion as well as allow specific study of annealing denaturation and enzyme kinet ics within a p
106. makes this approach diffi cult Phosphor Imager type sys tems are convenient and have extended linear ranges 5 to 9 orders of magnitude but are very expensive The Weis proto col uses labeling by incorpora tion of 32P dCTP location of the g product by autoradiography and quantitation by excision of the band and liquid scintillation counting Figure 3 Effect of amplifying two different gene products in one reaction PCR analysis of 100 ng of splenic cDNA with Cr2 and 8 actin oligos Lanes 1 3 were done for 18 some users of ihe Air cycles Lane 1 Cr2 oligos alone lane 2 B actin oligos Thermo Cycler are hesitant to alone lane 3 Cr2 B actin oligos Lanes 4 6 were done load glass capillaries with a for24 cycles Lane 4 Cr2 oligos alone lane 5 Cr2 B radioactive reaction mixture actin oligos lane 6 B actin oligos alone from Tan 1992 because of a fear of breakage While Weis reports that this has not been a prob lem plastic capillary tubes are now available see New from Idaho Technology in this issue The Reverse Transcriptase Problem In most protocols the reverse transcription is primed with the same primer that is later used for the amplification The Weis group uses random hexamers to prime the cDNA synthesis and they report several advantages to this approach First it ensures that all RNA s are represented equally in the cDNA pool Second as reverse transcription is done at low temperatures usin
107. mally held shut with a spring attached to a cam along the central axis Baffles are placed downstream of the heating coil to mix the air efficiently before it reaches the sample compartment Air is circulated through the system with an in line 75 cubic feet per minute air blower Fasco B75 Cassville MO Temperature monitoring during routine operation of the cycler is achieved by a 30 gauge iron constantan J type thermocouple placed just before the sample compartment in the air stream and connected to the temperature controller The sample compartment is a 5 cm wide x 5 cm long x 10 cm high chamber accessible by manually opening the solenoid controlled door The housing of the apparatus is formed from aluminum sheeting The polymerase chain reaction was run in a 100 ul volume with 1 ug template DNA 1 5 mM of each deoxynucleotide 50 pmol of each oligonucleotide primer and 10 dimethyl sulfoxide in a reaction buffer consisting of 17 mM ammonium sulfate 67 mM Tris HCI pH 8 8 at 25 C 6 7 mM magnesium chloride 10 mM beta mercaptoethanol 6 7 uM EDTA and 170 ug ml bovine serum albumin 5 After denaturing the reaction mixture at 94 C for 5 minutes 1 unit of Thermus aquaticus polymerase Taq polymerase Stratagene La Jolla CA was added the samples placed in 10 cm long thin walled capillary tubes Kimble Kimax 34500 and the ends fused with an oxy gen propane torch so that an air bubble was present on both sides of the sample
108. may be sucked into or cover the intake NOTE Lab bench paper is particularly effective at blocking the air intake Heated air up to 90 C is expelled from the top rear of the RapidCycler so it is important that the exhaust area be kept clear to avoid restricting the airflow through the RapidCycler Be especially careful to keep the exhaust area clear of anything that could be damaged by heat especially volatile organic solvents UD PROTECTING YOUR RHPIDCTCLER Plug the power cord into the RapidCycler and into a grounded surge suppressor The RapidCycler like all microprocessor controlled equipment is sen sitive to damaging power fluctuations uz ss P4 aa du Sample Han ling The RapidCycler is the only instrument which can approach the kinetic limits of amplification reactions The high surface area to volume ratio of capillary tubes and the use of air as the cycling medium makes the RapidCycler the fastest thermal cycler in the world This comes at the cost of non standard sam ple handling techniques Sometimes it may not be necessary to have the highest possible reaction specificity In this case it may be more convenient to use thin walled microcen trifuge tubes While much slower these allow the use of standard reagents and protocols Following are instructions for rapidcycling with A GLASS CAPILLARY TUBES and B THIN WALLED MICROCENTRIFUGE TUBES and C CAPILLARY TUBE HANDLING WITH THE RAPIDCYCLER
109. mber where a removable stand for capillary tubes can be placed 2 aluminum housing 3 air blower 4 sole noid mechanically coupled to open door on activation 5 door normally held closed with a spring 6 tem perature controller MATERIALS AND METHODS The device for temperature cycling is a closed loop hot air chamber resem bling a recirculating hair dryer Fig 1 and 2 The heating element is a 1000 W 125 VAC nichrome wire coil Johnstone Supply Portland Oregon wound around a mica support The heating coil is activated via a 25 A 125 VAC solid state relay Crydom D1225 available as Omega SSR 240 D25 through Omega Engineering Inc Stamford CT connected to a Partlow MIC 6000 propor tional temperature con troller available through Omega as the CN8600 process controller with thermocouple input and at least one SSR driver and one relay output The relay output controls a solenoid Dormeyer 2A173 Chicago IL mechanically coupled to open a door on activation that inter rupts the recirculating hot air and introduces ambi rigure 2 scale diagram of the amplifier A heating coil con ent temperature air during nected to the controller via a solid state relay B baffles to the cool down portion of uniformly mix the hot air C thermocouple leads connected each cycle The door piv to controller D reaction chamber E air blower CELO JR N W 9 E a ots on a central axis and is nor
110. n agarose gels after a total reaction time of 15 30 minutes The rapid temperature response of this instru ment can improve product specificity significantly while decreasing the required reaction time by up to an order of magnitude Average temperature transition rates in most instruments are commonly about 1 C sec when metal blocks or water are used for thermal equilibration and samples are contained in plastic microfuge tubes A significant fraction of the cycle time is soent heating and cooling the sample as opposed to being spent at optimal temperatures Long reaction times of 2 6 hours are common and slow transition rates make it difficult to determine optimal temperatures and times for each stage of the cyclic reactions Instantaneous temperature changes are not possible because of sample container and cycler heat capacities Second generation instrumentation can complete 30 cycles in about one hour It is unlikely any instrument based on samples contained in conical tubes with heating and cooling through a metal block can achieve faster cycles at any price However with capillary tubes and air heating transition rates of 5 10 C sec are easily obtained Complete 30 cycle reactions can be finished in as little as 10 min Biochemical reactions are fast The RapidCycler is the first instru ment engineered to match this speed The advantages of an air cycling system include simplicity low cost and rapid temperature cycling Air is an
111. n is desired Conversely better discrimination of mismatches should be attainable with rapid cycling This study was based entirely on a single primer pair for DNA amplification However we have also used rapid cycling to amplify the DNA defined by 20 dif ferent primer pairs from 6 different genes The GC content of the primers varied from 2396 9096 and the product lengths ranged from 80 1400 base pairs The increased temperature time definition of rapid cycling may allow rigorous corre lation of the free energy released by nearest neighbor base stacking interactions with optimal annealing temperatures This could be incorporated into an expert system for DNA amplification that suggests time temperature and reaction con ditions for any given primer pair Unfortunately we are not aware of any rapid temperature cyclers that are commercially available The apparent advantages of rapid cycling include decreased amplification times increased specificity and decreased reagent cost because of smaller reaction volumes Until the biomedical community and commercial manufacturers realize the advantages of rapid cycling the tech nique will only be available to those willing to build calibrate and optimize their own machines ACKNOWLEDGMENTS We thank Mr Charles Schamel for design and construction assistance of the hot air thermal cyclers Dr David Hillyard for helpful discussions and encourage ment and Robert Brower for the figure illustratio
112. nal primer complementarity and the like If you are picking primers by eye you should try to make them similar in length 20 30 nucleotides and GC content 30 70 as balanced primers are easier to optimize We have found that using longer primers 25 30 nt and relatively GC rich primers 50 6096 increases product yield with rapid cycling There are reports of primer dimer formation when the last two 3 bases are complementa ry but they are seldom seen in rapid cycling reactions Primer selection and DNA sequence analysis programs will provide a Tm value or even an annealing temperature for a given primer sequence All of these numbers should be viewed with healthy skepticism Different programs can give Tm values for the same primer that differ by as much as 20 C In fact the actual Tm value of primers under DNA amplification conditions is controversial because of the unknown effects of buffer constituents and changing DNA con centrations We use primers at a final concentration of 0 5 uM We make a 10X 5 UM stock solution containing one or both primers 2 Template DNA DNA amplifications are normally done on one of two types of template genomic DNA or plasmid DNA We usually put about 104 to 105 copies of the ta get sequence into a 10 ul reaction For human genomic DNA that is about 50 ng of DNA for Escherichia coli genomic DNA it is about 50 pg and for plasmid DNA it is about 100 fg Tr fT a Ya rf z
113. nely amplify product in the range 3 5 Kb A major problem when gen erating molecules of this size is the tendency of non specific smaller products to deplete reactants Such parasites arise through false priming events and become favored as efficiency per cycle is inversely correlated with product size The short dwell times used by the Air Thermo Cycler during annealing discourage false priming Nevertheless single primer controls should always be run to verify that a given product is dependent on both primers eliminate primer dimer formation and false priming prior to the first denatu ration step by including TagStart antibody Clonetech Catalog 5400 x 4030 Fabian Way Palo Alto CA 94303 4607 800 662 2566 This temporarily inactivates the polymerase which reactivates as increasing temperature denatures the anti body To use the reagent combine 1 volume Taq polymerase 5 units ml 1 vol ume of Tagstart 7 uM and 10 5 volumes of enzyme dilution buffer 2 5 mg ml bovine serum albumin BSA in 10 mM Tris pH 8 3 This is then used as normal Taq polymerase stock at 0 4 units ul Primer Design Best results always correlate with well designed primers 20 30 nucleotides with approximately 50 G C content no 3 terminal complementarities no inter nal palindromes no runs of G or C near 3 end Primers should be balanced in the sense that overall lengths and compositions are about the same often include 5 tails for special purpo
114. ns REFERENCES 1 Breslauer K J R Frank H Blocker and L A Marky 1986 Predicting DNA duplex stability from the base sequence Proc Natl Acad Sci USA 83 3746 3750 Chien A D B Edgar and J M Trela 1976 Deoxyribonucleic acid polymerase from the extreme thermophile Thermus aquaticus J Bacteriol 127 1550 1557 Dove W F and N Davidson 1962 Cation effects on the denaturation of DNA J Mol Biol 5 467 478 Gelfand D H and T J White 1990 Thermostable DNA polymerases p 129 141 In M A Innis D H Gelfand J J Sninsky and T J White Eds PCR Protocol A Guide to Methods and Applications Academic Press San Diego Innis M A and D H Gelfand 1990 Optimization of PCRs p 3 12 In M A Innis D H Gelfand J J Sninsky and T J White Eds PCR Protocols A guide to methods and applications Academic Press San Diego Innis M A K B Myambo D H Gelfand and M A D Brow 1988 DNA sequencing with Thermus aquaticus DNA polymerase and direct sequencing of polymerase chain reaction amplified DNA Proc Natl Acad Sci USA 85 9436 9440 SiMDILAV Lathe R 1985 Synthetic oligonucleotide probes deduced from amino acid sequence data Theoretical and practical considerations J Mol Biol 183 1 12 Linz U 1990 Thermo cycler temperature variation invalidates PCR results BioTechniques 9 286 293 wn wi a Q E lt McGraw R A E K Steffe and S M Baxter 1990 Sequence d
115. nt The denatura tion time at each temperature 1 C was 1 sec or less the total amplifi cation time was 14 16 mln and the temperature time profiles approximat ed that shown in Figure 7D Ethidium bromide stained amplification prod ucts of human genomic DNA delimit ed by the beta globin primers RS42 and KM29 7 were electrophoresed on a 1 5 agarose gel Captrol Ill Drummond Scientific electrophoresed and viewed with ethidium bromide UV transillumi nation All experiments included a control without genomic DNA where no amplification was observed The hot air thermal cycler 20 and modifica tions necessary for rapid cycling 21 have been previously described The temperature response of the sample was recorded with a miniature ther mocouple IT 23 0 005 s time constant Sensortek Clifton NJ Unless otherwise specified the times and temperatures of the sample for each amplifi cation stage were as follows denaturation 1 s at 92 94 C annealing 1 s at 54 56 C and elonga tion 10 s at 75 79 C Transition times were usu ally as follows denaturation to annealing 92 56 C 9 s annealing to elongation 56 75 C A s and elongation to denaturation 79 92 C 5 s The hot air cycler uses a solenoid activated door to allow room temperature air to cool the samples between denaturation and annealing 21 Under normal operation a low temperature spike occurs at the annealing temperatur
116. ntially watch a reac tion occur It is hoped that this research will lead to extremely rapid detection sys tems as well as becoming a general purpose window into reaction mechanics E me z0 20 E m lt e mre BG E Capillary tubes dispensing from 4 6 15 20 Imodule i ette 7 18 20 SOCO 2 ad 6 16 20 Cycle Mode Criteria uie meras 24 editing programss 23 25 parameters sse 23 running a program 24 25 table of programs 29 33 Editing Numbers cette 22 Electric fuse replacement 40 Hold Mode A sees 26 editing programs 25 26 parameters sss 25 running a program 26 27 table of programs 29 33 Light bulb replacement 38 39 Index Link Mode editing Programs cece 27 PArAME ETS 27 running A program srecen 28 table of prograrms 29 33 Microcentrifuge tubes oil overlays ssseeene 13 protocols eec 10 reaction optimization 12 13 real vs set temperatures 13 14 Program Mermory sse 28 Setting Up the RapidCycler 3 Thermal fuse replacement 40 41 Troubleshooting reaction problerms ss 37 slow cooling eene 35 slow heating 36 Warranty information eee 46 Idaho Technology Inc 390 Wakara Way Salt Lake City Utah 84108 1 800 735 654
117. ny programs available it may be difficult to remember which programs belong to whom We suggest making copies of the Program Tables at the end of this chapter and posting them near the RapidCycler Name the Cycle Hold and Link programs and thereby claim them as your own Diagram showing restraints when programming temperature parameters Denaturation 999C Elongation The elongation temperature must be between annealing and denaturation temperatures Set a 0 sec hold for two temperature cycles Annealing 30 C To edit a program tab to the PROG position and enter both digits of the program you wish to modify The program you were in will be saved automati cally as you exit to the new program number Keep in mind that whenever you enter numbers the program is changed If you edit a program that someone else routinely uses in a link program they may not see the changes you have made and it may ruin their run 4 RUNNING A CYCLE PROGRAM After all required parameters are entered you are ready to run the program Press the RUN STOP key to start the program Should you want to stop the pro gram before it reaches completion press the RUN STOP to halt the program The RapidCycler will then return to the CYCLE MODE screen If you try to run a program that does not meet the criteria for a valid cycle program the RapidCycler will display an error message and beep then return to the program you tried to run See the Ch
118. odify them now Otherwise the link program will not run properly 2 RUNNING A LINK PROGRAM Press the RUN STOP key to start the program If you wish you may press the RUN STOP to halt the program and the RapidCycler will return to the LINK MODE screen Running a link program displays the appropriate screen cycle or hold for each individual link segment and adds a fourth line to the display of each screen This additional line lets you know what link segment you are on z z po 0 9 L a Should you try to run a program that is not valid the RapidCycler will display an error message beep and return to the failed program qu RAPIDCYCLER S MEMORY 1 FACTORY SET PROGRAMS The RapidCycler is preprogrammed with 32 cycle programs 51 hold pro grams and 10 link programs For a description of these programs see the accompanying pages These programs in addition to any you may add will remain in memory even when the RapidCycler is turned off However this means that once a preprogrammed protocol is altered the original program is lost and the altered program will remain in memory There is one exception however In each mode program 1 is reset to default values whenever the RapidCycler is powered up This means that modifications to program 1 in cycle hold and link modes will not be saved when the RapidCycler is turned off 2 PROGRAM TABLES The tables on the following pages list the preprogrammed cycl
119. oiling before amplification is begun Thoroughly boiling the template DNA before amplifica tion is apparently necessary when very short denaturation times are used during cycling An annealing time of less than 1 sec was also found optimal Figure 4 Kinetic studies on DNA renaturation predict rapid annealing because of the high primer concentration used in DNA amplification 18 19 Product yield and specificity were improved with shorter annealing times and faster denaturation to anneal ing transitions Current commercial machines are limited to temperature transi tions of less than 1 C s for a total transition time 90 55 C of at least 35s In addi tion most protocols call for an annealing time of 20 120 s According to Figure 4 poor specificity would be expected under these conditions Experimentally rel atively poor specificity was seen when slow heat block amplifications Figure 7A and 7B were compared to rapid cycling amplifications Figure 7C and 7D Although short denaturation and annealing times appear desirable decreas ing the elongation time can limit product yield Primer extension is not instanta neous Taq polymerase has an extension rate of 35 100 nucleotides s at 72 C 5 6 As elongation times are decreased product yields are eventually com promised Figure 6 For the RS42 KM29 primer pair a 10 s elongation time total amplification time of 15 min for 30 cycles gives a moderately strong specific band Figure
120. olymerase chain reaction protocol Because of the low heat capacity of air thin glass capillary tubes were used to contain the samples rather than plastic tubes Attempts to amplify DNA in var ious plastic tubes with the air cycler were unsuccessful and temperature profiles were sluggish Capillary tubes require a torch to seal the ends but this can be readily achieved with only minimal practice In order to obtain adequate tem perature homogeneity within the sample compartment baffles were installed between the heating coil and the samples With the cycler set at a constant tem perature from 70 to 95 C simple structural baffles decreased the temperature variation observed throughout the sample compartment from about 10 C to 2 C This can be improved further by more complicated baffles if necessary Amplification products obtained with the device are qualitatively and quan titatively similar to those observed after manual water bath cycling Fig 4 We have used the apparatus to amplify both bacterial and human genomic DNA Best results have been obtained with denaturation temperatures between 90 and 94 C At temperatures above 94 C amplifications are often not successful apparently due to enzyme denaturation This may result from faster equilibration of the sample at high temperature with the air cycler compared to other machines This would effectively expose the polymerase to the high denaturation temperature for a longer period o
121. onine biosynthesis Knowing the sequence of the eut operon forms a fundamental part of our strategy in characterizing the synthesis and importance of B12 in Salmonella have not been able to clone eut using standard techniques suggesting that minor variations in its expression levels may have dramatic effects on the well being of the cell Instead have chosen to amplify portions of the operon from the genome and to sequence these PCR products directly Sequencing Strategy Direct PCR sequencing has the advantage of blending Taq polymerase induced errors into the background However linearized double stranded tem plate yields short dirty teads with many premature stops The technique is usu ally avoided in favor of sequencing cloned amplified DNA Such inserts often contain polymerization mutations Two and sometimes three independent clones must be sequenced to determine the primary structure with confidence This together with the overhead of plasmid preparation increases the time required Recently a fast and efficient method for DNA strand separation based on magnetic bead technology became commercially available Dynal 5 Delaware Drive Lake Success NY 11042 800 638 9416 This allows exceptionally Clean direct PCR sequencing using single stranded templates In addition by optimizing for long amplification products less time is spent preparing DNA Qe JE e as aw ET oz Mispriming amp Parasites routi
122. owed by the detailed Weis protocol The Linearity Problem The amount of DNA produced in a PCR reaction is predicted by the well known equation y x E where y is the concentration of DNA produced by the amplification X is the initial concentration of DNA E is the efficiency of the reaction For example in a reaction where the amount of DNA is doubled every cycle the efficiency is 2 n is the number of amplification cycles This equation can be linearized to log y nlog E log x The y intercept of this line gives the log of the starting con centration of DNA while the slope of the line gives the log of the efficiency of the reaction When the DNA concentra tion of an amplification is deter mined after varying numbers of cycles the results fit quite nicely to the equation above during the early cycles Efficiency is reduced during the later cycles of an amplification reaction Figure 2 This is probably due to 20 25 30 35 primers competing less effec Number of Cycles ively with Template leanneaiing Figure 2 Amplification of mouse splenic CDNA with and a lower molar ratio of primers complimentary to the complement receptor Cr2 enzyme to product The number Eight identical samples were prepared with 250 ng of of cycles after which these cDNA and removed sequentially every third cycle After effects become important electrophoresis and autoradiography bands were ee excised and quantitated by liquid scint
123. phosphatase catalog 70175 with 1 6 uL H2O 1 0 uL 0 1 M DTT included in kit 0 4 uL Sequence Labeling Mix incl in kit diluted 1 5 with H2O 0 5 uL labeled dATP 32P 33P or 35S 2 0 uL enzymes Total 5 5 uL Mini Trays InterMountain Scientific 1610 S Main Suite H Bountiful UT 84010 801 298 7884 Micro Well Mini Tray cat 438733 TdT Mix 3 4 uL H2O 0 3 uL 4 dNTP s each at 2 mM Pharmacia Ultrapure dNTP Set cat 272035 0 3 uL terminal deoxynucleotidyl transferase 20 u uL BRL cat 8008SB Total 4 0 uL 5 Electrophoresis place tray in vacuum jar evacuate 15 min add to each well 4 uL stop solution included in kit Total 6 uL 3 min at 75 place covered tray under slug of 75 temperature block load 1 5 ul sample per well E 55 Su 20 2 m lt Jo me An 2 Rapid PCR Fingerprinting of Bacterial Genomes with REP Primers in Capillary Tubes Using the Air Thermo Cycler Qe oe Ji as aw z Ricardo Dewey Oscar Grau Antonio Lagares Instituto de Bioqu mica y Biolog a Molecular IBBM Facultad de Ciencias Exactas Universidad Nacional de La Plata Argentina nstituto de Microbiolog a y Zoologia Agr cola IMYZA CICA INTA Castelar Argentina 3 CICA INTA Castelar Argentina Corresponding Author Introduction DNA fingerprinting of genomes using PCR methods has been intensively used during the last years to char acte
124. pillary tube Using a lighter can dle or regular labora Figure 1 tory burner flame seal Seal extreme tip of capillary tube in outer both ends of the cap most potion of the illary tube Fig 1 flame If the tube is Only a few seconds of heated too much or heating the extreme inserted too far into the flame it will sag tip of the capillary is necessary This will take some practice initially but becomes simple with repetition With careful observa and deform tion the capillary tip appears to clear up at the instant of closure If sealing is not complete the sample will evaporate during cycling After the tubes are sealed insert them into the holes in the capillary modules located in the instrument top Push the tubes gently downward until they lightly touch the padded chamber bottom This will place the sample column com pletely into the air chamber Then program and operate the cycler as detailed in section 4 Programming Preparing sam ples using the 16 place capillary tube module Fig 2 is sim ilar to preparing tubes individually However since the spacing of the holes in the modules are the same as the spac ing of microtiter wells up to sixteen samples Figure 2 Capillary tube module can be aspirated simultaneously The modules also greatly simplify the ordering and labeling of the capillary tubes For ease of handling the modules may be removed from the instrument top
125. pirator back a bit as you insert the capillary tube The silicon tips of the microaspirator wear out quite quickly so if your microaspirator stops working try replacing the tip IT 1870 2 MULTIPLE TUBE HANDLING Once you get single sample handling down you may want to try some of these advanced multiple sample handling tricks Eight Sample Handling When sample modules are made with microtiter spacing it is possible to mix up eight samples at a time in a microtiter dish and draw them up simultaneously by capillary action Figure 6 All eight samples can be centered by tilting the module and then the tubes can be sealed by passing the tubes through a flame one at a time Figure 7 Once the reaction is done you can score all eight tubes at once by lightly drawing the sapphire knife across the top of the module Figure 8 and then breaking off each tube top Figure 9 Press the module down to the other end of the capillary tubes and repeat the scoring and breaking Figure 6 Mixing eight samples at a time and drawing them up simultaneously with capillary action Figure 7 Sealing cap illaries by passing the tubes through the flame one at a time Figure 8 Scoring all eight tubes at once by lightly drawing the sapphire knife across the top of the module Figure 9 Breaking off tube top after scoring ONNOGNVH JIdNVS wi pr a lt wn o z a z a x Sixteen Sample Handling After mastering
126. plified sample already containing Ficoll and an electrophoresis indicator dye can be directly emptied into a gel well without exposure to an intermediate pipette tip or to extraction procedures A common protocol for DNA amplification is 1 min at 94 C for denaturation 2 min at 55 C for annealing and 3 min at 72 C for elongation 16 If instanta neous temperature transitions were possible one cycle would take 6 min However in conventional heat block machines it takes perhaps an additional 2 min to change the block temperature during each cycle Figure 7A When both heat block temperature transitions and sample time lags are considered about 4 out of 8 min in each cycle or 50 of the time is spent changing the sample tem perature Figure 7A When rapid cycling or turbo polymerase chain reaction is attempted in conventional machines the sample may be in continuous temper ature transition Figure 7B It is understandably difficult to optimize the time tem perature settings for the three stages of DNA amplification when the sample tem perature is always changing Recently there has been a trend toward faster protocols for DNA amplifica tion 5 15 Denaturation and annealing are claimed to occur almost instanta neously or within a few seconds once the appropriate temperatures have been reached by the sample 5 12 15 Adequate denaturation does appear to occur in less than 1 s Figure 2 as long as the DNA is denatured by b
127. r a precise description of this profile is seldom achieved Often heat block temperatures are used instead of actual sample temperatures The temperature of a 100 ul sample within a microcen trifuge tube in a heat block instrument reportedly lags 20 s behind the heat block temperature 12 In a representative commercial instrument we found that 35 s were required for the sample to reach the block temperature Figure 7B and leg end This lag time may vary with the exact position of the tube in the heat block as uneven heating and cooling have been reported 8 22 wn wi a o E e lt The actual sample temperature can be monitored by a thermocouple probe in the sample The probe needs to be small enough so that it does not signifi cantly affect the temperature response The thermocouple should be positioned to accurately reflect the sample temperature which is presumably homoge Figure 7 Effect of sample tem perature time profiles on product specificity Samples were cycled 30 times through profiles A B C or D and 10 ul of the product elec trophoresed and viewed by ethidium bromide staining Profiles A and B were obtained using a commercial heat block instrument Perkin Elmer Cetus Thermal Cycler set to Step Cycle mode fastest possible transition times Mineral oil 60 pl was used to overlay 100 ul sam ples contained in microfuge tubes as recommended by the manufacturer Samples were placed in a center well D 5
128. ranscript can be reported in relative terms Popular genes for standardization are B actin and HLA genes All of these internal standard methods are based on the presumptions that 1 the reverse transcription is not biased between the standard and test transcripts 2 the amplification of the standard and the unknown occur with the same effi ciency and 3 the amplifications do not interfere with each other significantly Weis uses B actin mRNA as an internal standard Figure 3 The autoradi ograph shown in figure 3 shows that both products can be simultaneously ampli fied with minimal interference The Variability Problem Sample to sample variability has long been a problem with RT PCR The effi ciency of reverse transcription has been reported to vary from 5 to 90 8 while the amplification itself may vary up to 200 300 between duplicate reac tions The Weis group reports good reproducibility not only between duplicate aliquots of the same cDNA but also between tissue samples Figure 4 The Protocol 1 Total RNA was prepared by the method of Chirgwin et al 9 2 RNA 5 ugs was reverse transcribed in 1X RT buffer GIBCO BRL 0 125 mM each dNTP 0 5 ug random hexamers New England Biolabs and 400 units of Moloney virus reverse transcriptase GIBCO BRL in a 50 ul reaction The reaction was incubated at 37 C for 60 minutes DNase free RNase was added and incu bated for 5 minutes at 37 C The reaction volume was adjusted to 270 u
129. rature used in the 1605 Air Thermo Cycler was 5 C lower than the other machines and gave better sensitivity and better specificity Figure 3 In conclusion the 1605 Air Thermo Cycler is the fastest and most sensitive PCR machine for the detec tion and identification of microbial pathogens n Figure 3 Comparison of the results of 5 PCR methods for 5 different bacterial species in the 1605 Air Thermo Cycler Idaho Technology and the Cycler 480 Perkin Elmer Panel A the 1605 Air Thermo Cycler 25 ul tube one cycle of 94 C for 15 sec 30 cycles of 94 C for 3 sec 50 C for 10 sec 74 C for 15 sec and finally one cycle of 74 C for 2 min and 45 C for 2 sec Panel B the Cycler 480 one cycle of 3 min at 95 C then 35 cycles of 20 sec at 94 C 20 sec at 55 C 40 sec at 72 C and finally one cycle of 3 min at 72 C and 2 sec at 20 C Line m molecular marker Lane 1 Escherichia coli the primer set is CACACGCT GACGCIGACCA with GACCTICGGTT TAGTICACAGA PCR product is 585 bp Lane 2 Eubacterium limosum the primer set is GGCTIGCTGGACAAATACTG with CTAG GCTICGTCAGAAGGATOG the PCR product is 274 bp Lane 3 Vibrio vulnificus the primer set is CICACTGGGGCAGTGGCT with CCAGCCGT TAACCGAACCA the PCR product is 383 bp Lane 4 Listeria monocytogenes the primer set is CGGAGGTICCGCAAAAGATG with CCTCCA GAGTGATCGATGTT the PCR product is 234 bp Lane 5 Staphylococcus
130. re of the ends They con duct heat to the sample better than microfuge tubes because of decreased wall thickness ca 0 2 mm and a better surface to volume ratio Dead air space is minimized to prevent significant condensation Different volumes of a sample can be placed in the same diameter capillary tube so that rapid heat transfer is maintained After amplification the ends of the glass capillaries can be quickly scored with a file and snapped off with less risk of aerosolization and contamination than microcentrifuge tubes The capillary tubes serve both as a transfer pipette and container for temperature cycling The reaction product already containing Ficoll and Sucrose an electrophoresis indicator dye can be directly emptied into a gel well without exposure to an intermediate pipette tip or to extraction pro cedures Decreasing the heat capacity of the cycling system can markedly decrease the total time required for reactions that require temperature cycling In addition air cycling and miniaturization can significantly decrease the costs of reagents and the personnel time required to optimize reactions dn NILIS Setting up the Rapi Cycler QU STORING YOUR RAPIDCYCLER In choosing a location to set up your RapidCycler remember that it uses room air for cooling Keep the RapidCycler open on all four sides to allow air to flow into the air intake beneath the machine Also do not set the RapidCycler on any material which
131. rize genomic diversity and to search for specific DNA markers 1 9 Different DNA banding patterns have been obtained using primers with length ranging from 8 to 25 nucleotides containing either arbitrary 2 3 5 8 9 or specific sequences 4 6 In particular the use of bacter ial Repetitive Extragenic Palindromic sequences REP and Enterobacterial Repetitive Intergeneric Consensus ERIC have been proved to be practical and appropri ate to fingerprint a number of different bacterial species 4 6 Although REP and ERIC primers do not lead to amplification patterns as complex as those obtained with the random primed DAF 1 visualization of amplified DNA fragments can be easily achieved by agarose gel electrophoresis ethidium bromide staining Thus classic REP and ERIC PCR amplifications may be efficiently used to characterize Gram negative and Gram positive bac terial genomes in a 10 hours experimental procedure Here we report a simple rapid and reproducible proto col to perform REP DNA amplifications in 2 h using capil lary tubes in air thermo cyclers o A o a wn gt 2 Figure 1 amplification patterns of four distinct R meliloti strains using whole bacteria as the source of DNA in ihe Air Thermo Cycler ATC Lane 1 Rm 2011 lane 2 Rm 1029 lane 3 Rm 41 lane 4 Rm 1 74 and lane 5 control without tem plate Molecular weight marker lambda Hindlll Methods The amplification mixture composit
132. s 6 and 7 If desired the elongation time can be further reduced while maintaining product yield by increasing the concentration of polymerase 21 However if maximal yield is more important than rapid amplification total amplification times of less than 15 min will seldom be of practical value The amplification yield was greatest at an elongation temperature of 75 79 C Figure 5 This is a higher elongation temperature than conventionally employed but is nearer the reported temperature optimum for the enzyme 2 Surprisingly some 536 base pair product was detected even with an elongation time of 2 5 s at 75 79 C Figure 6 Elongation rates in DNA amplification may be higher at 75 79 C than at 72 C and some elongation is expected to occur dur ing temperature transitions The optimal annealing temperature for DNA amplification depends on the base content nucleotide sequence and length of the primers and is related to the primer TM 5 12 Equations are available for estimating oligonucleotide TMs 7 However in DNA amplification adjustments for lower monovalent cation concentration 17 and higher Mg 3 are necessary In our buffer system 20 mM KCI and 3 mM MgCl2 with the RS42 KM29 primer pair the optimal denatu ration temperature was around 92 94 C Figure 1 and an annealing tempera ture of about 55 C resulted in maximal specificity and yield Figure 3 The propensity to anneal can most accurately be described b
133. ses and find little if any detrimental effect if the 3 end is at least 20 bases long Trailing sequences can be amazingly long Reamplification usually use reamplified template DNA for sequencing first prepare a starter by amplification of genomic DNA either purified crude or encapsulated in cells Subsequent template preparations are reamplified from a 1 100 dilution of the starter This is especially important when genomic DNA prepared according to Ausubel F A et al eds 1990 Current Protocols in Molecular Biology Greene Publishing and Wiley Interscience New York pp 2 4 1 2 4 2 is used in the pri mary reaction have also had excellent success using cells scraped form a plate in place of genomic DNA In this case I either simply touch the cells directly to the reaction mix or resuspend them in 50 uL TE 10 mM Tris pH 8 3 1 mM EDTA heat 2 at 95 spin down and use the supernatant diluted zero to 100 fold The remainder can be frozen for future use E 5 z0 20 E m lt e mre 25 E PS Qe JE 5s as aw z More Tricks for Large Products Purified genomic DNA should never be preboiled Too many nicks are intro duced and long products are more difficult to amplify Preceding a primary genomic amplification with a 30 sec hold at 94 and following PCR with a 5 min hold at 72 improves yield When characterizing a new primer pair always opti mize according to the simple 3 x 3 sch
134. so predict rapid annealing because of the high primer concentration used in DNA amplification However to our knowl edge this has not previously been tested Our results suggest that denaturation wn abd mri o E 4 lt and annealing do in fact occur very quickly in DNA amplification with good amplification occurring even when the denaturation and annealing segments are reduced to spikes Figs 2 5 and 6 The polymerase chain reaction need not take hours to perform with appropriate temperature cycling equipment DNA amplification can occur in minutes The ultimate limit of how fast DNA amplification can occur is not answered by this study The times required for denaturation and annealing are apparently minimal Primer extension is not instantaneous and the elongation time required depends on the length of the amplified product Tag polymerase is highly pro cessive with an extension rate of gt 60 nucleotides s at 70 C 10 The large effect of polymerase concentration on band intensity with rapid cycling Fig 5 suggests that polymerization time becomes the limiting factor at very short cycle times Fig 6 For rapid temperature cycling the sample container is just as important as the thermal cycler An optimal sample container should be water vapor tight and have i low thermal mass ii good thermal conductivity iii minimal internal condensation iv easy sample recovery without cross contamination and v no inhibi
135. st was digested with endo Asp N to obtain protein frag ments for amino acid sequencing Of these a 35 amino acid peptide was cho sen to design degenerate primers for amplification of the peptide DNA Coding lc and non coding Inc primers were made from termi nally located amino acids with minimal codon degeneracy A Memmi one third non coding 2nc primer 35 amino acid peptide was made internal to Inc primer see figure Each primer was 26 nucleotides long All combinations of nucleotides at codon wobble positions were synthesized with the following exceptions inosines were used for 4 fold degeneracy at the wobble position when appropriate vA 5 o 20 m lt J0 me Aa E according to Molecular Cloning a Laboratory Manual Sambrook et al page 11 18 to accommodate a serine in 1c and a leucine in 1nc primers had to be made in duplicate for serine the codons TCI and AGT C were used for leucine Inc 2nc IAG and T CAA were used Each primer was synthesized with a GGC clamp and an EcoR site at the 5 terminus The degeneracy of the 1c Inc and 2nc primers were respectively 48 fold 8 fold and 48 fold The expected size of the product from the 1c and Inc primers was 100 bp and from the 1c and 2nc primers 94 bp Reaction Mix primers 7 uM working concentration 1 ul each of 1c and Inc template 7 6 ng ul Xenopus leavis oocyte cDNA lul Mg2 30 mM 1 ul ANTP mixture _2 mM each ANTP 1 ul 10 X buffer 500 mM
136. start up program number 01 in each of the three modes is reset to the standard parameters found in the Program Tables at the end of this section Each of the other 98 programs in each mode retain whatever values have been entered in thern SNIINWV lIOO ld If you have not already done so you may wish to familiarize yourself with the function of the machine by entering each of the three modes and pressing RUN STOP Cycle program C 01 will take about 15 minutes but can be stopped at any time by pressing RUN STOP Hold program H 01 only takes a few minutes Link program 01 runs hold program H 01 and cycle program C 01 in sequence and can also be interrupted at any time by pressing RUN STOP USER INTERFACE EDITING NUMBERS Programming the RapidCycler is easy It is done by first entering Cycle Hold or Link mode Move the blinking cursor using the cursor keys arrows and enter the desired values using the numeric keypad 0 z z a 0 o a a When editing a number remember to type in the same number of digits as the number you are editing For example if you want to change the program number from 01 to 02 type O and 2 rather than just typing 2 Programs 02 through 99 in each mode will be remembered by the RapidCycler even if the machine is turned off Note that there are not any numbers to edit when the RapidCycler is in the RAPIDCYCLER FUNCTION mode or while running a program therefore no blinking
137. supplied with the start up kit tighten all of the exterior screws and wipe the surface of the instrument with a damp cloth 3 Tighten thermal fuse screw Remove the four screws that hold the top down Lift the top straight up about one inch then swing towards the back of the machine being careful not to touch the halogen bulb With the hex driver tighten the screw holding the ther Zo 25 Z lt mO oo zz QU a z lt Q z amp wi o w Q z lt z w z mal fuse Brown rectangle with two wire connectors located next to the bulb mount on the duct sidewall 4 Inspect door motor and hinge for friction Remove the four screws on the rear duct and swing it up Move the door hinge assembly and make sure that it moves freely and does not bind If it binds on the leverage arm oil the connecting points with light machine oil DO NOT OIL THE NYLON HINGE SERVICE AND MAINTENANCE IDAHO TECHNOLOGY TITLE RAPIOCYCLER BOARD VER 7 1 DATE 3 9 95 Warranty an Upgrades Warranty Idaho Technology warrants the RapidCycler and related equipment for a period of one year from the date of pur
138. t from genomic DNA can be easily visualized with ethidium bromide on agarose gels after a total amplification time of 15 min or less 21 The rapid temperature response of this instrument allows systematic study of the times and temperatures required for annealing elongation and denatura tion in DNA amplification because transition times can be reduced to a mini mum MATERIALS AND METHODS DNA amplification was performed in 50 mM Tris pH 8 5 25 C 3 mM MgC12 20 mM KCI 500 ug ml bovine serum albumin 0 5 uM each of the human B globin genomic primers RS42 and KM29 13 0 5 mM of each deoxynucleoside triphos phate ANTP 2 5 wt vol Ficoll 400 50 ng of human genomic DNA and 0 4 U of Taq polymerase per 10 ul unless specified otherwise Although 5 dimethyl sul foxide DMSO was used with this primer pair in our previous study 21 it was omit ted here because of its reported effect on polymerase activity 4 Tartrazine I mM or xylene cyanole 0 02 wt vol was sometimes added to the reaction mix ture for easy visualization Ficoll 400 and the indicator dyes could be added to the reaction mixture at the concentrations listed without significantly affecting product yield or specificity Ten times stock solutions of the primers dNTPs and DNA contained 10 mM Tris pH 8 0 and 0 1 mM EDTA Human genomic DNA 50 ug ml was denatured for 1 min by boiling and then rapidly cooled on ice before use in amplification One unit of polymerase
139. t modification Published protocols developed in heat block instruments seem to transfer more readily to the RapidCycler when micro test tubes are used o az sa z aa P e The thermal properties of thin walled microcentrifuge tubes are much better than their thick walled ancestors but they are still no match for a capillary tube Using thin walled microcentrifuge tubes requires a sacrifice in speed and in sam ple temperature uniformity A 10 ul reaction that would take 15 minutes in a cap illary tube takes 35 minutes in a thin walled microcentrifuge tube a 50 ul reac tion that would take 20 minutes in a capillary takes 50 minutes in a microcen trifuge tube Because the RapidCycler was developed for capillary tubes the temperature values that you program into the machine and the temperatures displayed dur ing cycling reflect what the temperature would be in a 10 ul capillary When using microcentrifuge tubes you must modify the program parameters to com pensate for the thermal differences between capillaries and microcentrifuge tubes 2 THIN WALLED MICROCENTRIFUGE TUBE CYCLING PROTOCOLS FOR THE RAPIDCYCLER There are two possible approaches when using microcentrifuge tubes You can set the machine to the temperature you want and wait for the microcen trifuge tube to get to that temperature Figure 2B This is what the slower heat block cyclers do This method is slow but it assures you that no part of your sam ple is e
140. t the quartz halogen heating bulb has burned out Check the chamber for light before replacing the bulb If the bulb has burned out unplug the machine and replace the bulb following instruc tions shown in the Service and Maintenance section wm x e e z 31INOAL If the problem continues it is possible the thermal fuse in the instrument needs to be replaced Unplug the machine and follow the thermal fuse replacement instructions shown in the Service and Maintenance section of this manual If the problem persists please call our service department at the appropriate number listed at the beginning of this section Q There is unusual noise coming from the machine A First check underneath the instrument to verify that the air intake fan is free of obstruction If there are no visible obstructions go to a standard cycle proto col put on protective eye wear remove the front module and press RUN When the instrument starts the heating lamp will illuminate the chamber allowing you to check for debris or obstructions lt lt Do not reach into the instrument while it is running gt gt If an obstruction is seen unplug the machine and remove the instrument see instructions for removal in light bulb replacement in Service and Maintenance When the cover is up and the chamber is accessible check the cover for obstructions or debris If the interior requires cleaning use only water or water based cleaners Car
141. taiotaomicron The product is 423 bp Lane 6 B vulgatus The product is 287 bp Lane 7 Bifidoacterium sp The product is 190 bp onds in MiniCycler 4 minutes in PHC 2 and 7 minutes 10 seconds in BioOven The total cycle times were 30 minutes in 1605 Air Thermo Cycler 1 5 hours in the MiniCycler 2 5 hours in the Perkin Elmer Cycler 480 data not shown 2 8 hours in the PHC 2 and 5 hours in the BioOven High concentrations of BSA were essential for the PCR assay in the 1605 Air Thermo Cycler BSA is thought to prevent denaturation of the Taq polymerase on the large internal surface area of the glass capillary tubes 6 We have already used this protocol and the 1605 Air Thermo Cycler to detect many other bacteria such as Clostridium perfringens C Clostridiiforme C lep tum Bacteroides distasonis B thetaiotaomicron B vulgatus and Bifidobacterium Figure 2 shows the results Different primers were used for differ ent bacterial species but the same program and same 1605 Air Thermo Cycler ze 5 Su 20 m lt Jo mr An E 7 Qe ae Bu as aw ET fa were used All of them gave good results We directly used the bacterial cells lysed in 1 Triton X 100 for DNA template of the PCR so the final con centration of the Triton X 100 in the reaction tubes was about 0 1 This concentration of Triton X 100 did not interfere with the PCR assay data not shown In general the optimal annealing tempe
142. tems have capitalized on the potential for even faster response times Our objective was to see if amplification times could be significantly reduced by decreasing both the heat capacity of the air cycling system and the sample vol urne MATERIALS AND METHODS The rapid air cycler is based on a previously described design 6 Its thermal mass was reduced by using thin aluminum sheeting for the housing and placing the fan motor 3000 rpm 1 40 HP ball bearing C frame motor No 4MO80 Grainger Salt Lake City UT outside of the airstream Fig 1 The fan blades 3 5 in aluminum No 2C951 Grainger were placed downstream from the heating coil to mix the heated air before reaching the samples Up to 30 capillary tubes could easily be placed in the sample compartment The sensing thermocouple proportional temperature controller and solenoid activated door for cooling with ambient air have been previously described 6 The proportional controller was programmed to obtain desired cycle times of 20 30 60 120 and 180 s The temperature response of the sample was recorded from the analog output of a BAT 12 temperature monitor Sensortek Clifton NJ connected to a miniature thermocouple IT 23 0 005 s time constant Sensortek placed within a 10 ul sample in a microcapillary tube KIMAX 46485 1 Kimble Vineland NJ DNA amplification was performed with 50 mM Tris pH 8 5 at 25 C 3 mM MgC12 20 mM KCI 500 ug ml bovine serum albumin
143. the rate of liquid uptake by tipping the capil lary tube sideways figure 1 You can also load the capillaries using a Drummond microaspirator IT 1690 to draw the reac tion mix up into the tube or you can use a pipetman to directly inject sample into the tube Figure 2 The 10 ul size tubes hold 2 2 ul cm and can be used for reac tion volumes from 5 to 15 ul The 10 ul cap ilaries come to temperature so quickly that they require no holds at denaturation or annealing The 50 ul tubes hold 9 ul cm and are useful for reaction volumes from 15 to 70 ul These tubes require a 15 sec ond hold at the denaturation and anneal ing temperature Sealing the capillary Figure 2 Directly injecting sample into the tube using a pipetman The glass capillaries sold by Idaho Technology are made out of a high sodi um low melting temperature glass This makes them very easy to flame seal with just about any flame They can be sealed with a Bic lighter Figure 3 a Bunsen burner a candle or my favorite a Blazer mini propane torch IT22721 After the capillary is loaded tip the tube to Figure 3 Sealing center the liquid Hold capillary with a Blazer mini butane the tube in the center and place the end just into the flame Rotate the tube in the flame by rolling it between your thumb and index finger You should be able to see the glass slowly close in on itself Try to avoid leav ing the tube in the flame too
144. the eight sample tricks you may want to try 16 at a time All sixteen tubes in the module can be filled simultaneously by capillary action sim ilar to the process for sampling 8 tubes After centering the samples the two rows of eight tubes can then be staggered off from each other by pressing the tubes down on a bench top The bottom of the first row of eight tubes and the top row of the second row of eight can then be sealed one at a time by passing through the flame The staggered rows can then be switched and the remaining two ends can be sealed After the reaction is done the ends can be scored as done in the eight sample example Programming OVERVIEW PROGRAM MODES A gt AND USER INTERFACE 1 RAPIDCYCLER FUNCTION When you switch the RapidCycler on a title screen which contains the soft ware version number is displayed while the controller boots up After a few sec onds the RAPIDCYCLER FUNCTION screen appears This is the main menu of the RapidCycler To enter one of the three operating modes of the RapidCycler sim ply press the corresponding number RAPIDCYCLER FUNCTION 1 CYCLE MODE 2 HOLD MODE 3 LINK MODE To return to the RAPIDCYCLER FUNCTION screen from within the three modes press the FUNCTION key If you have pressed RUN STOP in any of the modes while you are running a program you must first stop the program by pressing RUN STOP then press FUNCTION to return to the RAPIDCYCLER FUNCTION screen At
145. tion 25 seconds An elongation temperature of 75 79 C gave the greatest yield and increased yields were obtained with longer elongation times Product specificity was improved with rapid air cycling when compared to slower conventional heat block cycling Rapid thermal control of the temperature dependent reaction in DNA amplifica tion can improve product specificity significantly while decreasing the required amplification time by an order of magnitude INTRODUCTION gt a O MA m n Automated in vitro DNA amplification with a heat stable DNA polymerase requires temperature cycling of the sample 11 14 Temperature transition rates in commercial instruments are usually less than 1 C s when metal blocks or water are used for thermal equilibration and samples are contained in plastic micro centrifuge tubes 10 12 A significant fraction of the cycle time is soent heating and cooling the sample as opposed to being spent at optimal denaturation annealing and elongation temperatures Extended amplification times of 2 6 hours are common and long transition times make it difficult to determine opti mal temperatures and times for each stage Instantaneous temperature changes are not possible because of sample container and cycler heat capacities We have recently constructed a rapid cycling system of low heat capacity based on heat transfer by hot air to samples contained in thin glass capillary tubes 20 21 Amplified produc
146. tion of DNA amplification Whatever the container temperature equilibra tion will always be achieved faster if the sample volume is small if the container wall is thin and if the surface to volume ratio of the sample exposed to the con tainer wall is high Problems with condensation can be reduced by minimizing the free air space surrounding the sample Microfuge tubes are kept water vapor tight by mechanical closure and if necessary overlaid mineral oil Thermal conductivity is poor because of the material and its thickness ca 1 mm Internal condensation can occur if mineral oil is not used and particularly if different parts of the tube are at different tem peratures which depends on the temperature cycler configuration In contrast glass capillary tubes are made vapor tight by flame clo sure of the ends They conduct heat to the sample better than microfuge tubes because of decreased wall thickness ca 0 2 mm and a better surface to vol urne ratio Dead air space can be minimized to prevent significant condensation Different diameter capillary tubes can be chosen for the sample volume desired Decreasing the heat capacity of the cycling system can markedly decrease the total time required for the polymerase chain reaction In addition air cycling and miniaturization significantly decrease the cost of DNA amplification There may be other advantages of rapid cycling decreased annealing and denatu ration times should theoretical
147. tions The high number of individual isolates in strain collections rep resent a limiting factor during the selection of molecular characterization meth ods The possibility to obtain reproducible DNA fingerprints in a short time repre sents a valuable alternative for programs of germoplasm characterization References 1 Bassam B J G Caetano Anoll s and P Gresshoff 1992 DNA amplifica tion fingerprinting of bacteria Appl Microbiol Biotechnol 38 70 76 2 Caetano Anoll s G 1993 Amplifying DNA with arbitrary oligonucleotides primers PCR Methods and Applications 3 85 94 3 Caetano Anoll s G Bassam B J and P Gresshoff 1991 DNA amplifica tion fingerprinting using very short arbitrary oligonucleotide primers Bio Technology 9 553 557 4 DeBruijn F J 1992 Use of repetitive Repetitive Extragenic Palindromic and Enterobacterial Repetitive Intergeneric Consensus sequences and the poly merase chain reaction to fingerprint the genomes of Rhizobium meliloti isolates and other soil bacteria Appl Environ Microbiol 58 2180 2187 5 Scroch P and J Nienhuis 1992 A RAPD protocol for the Air Thermo Cycler The Rapid Cyclist 1 9 10 6 Versalovic J Koeuth T and J R Lupski 1991 Distribution of repetitive DNA sequences in eubacteria and application to fingerprinting of bacterial genomes Nucleic Acids Res 19 6823 6831 augh R W Powell 1992 Using RAPD markers for crop improvement TIBT CH 10 186
148. tions up to 500 ug ml in the reaction Using gelatin gives a poor yield in capillary tubes You can make up your own buffers We recommend including 2 5 mg ml BSA in the 10X buffer and 2 5 mg ml in a 10X polymerase dilution The grade of BSA is not critical We use Sigma A2153 Mistake 2 Using acetylated bovine serum albumin It is expensive and does not work Presumably the same sites that are acetylated are those sites necessary to coat the glass walls and prevent polymerase inactivation Mistake 3 Using Triton X 100 Some manufacturers of heat stable polymerases state that 0 1 Triton X 100 is needed for enzyme activation Triton X 100 does activate some enzymes when BSA is not present and amplification occurs in microfuge tubes However Triton X 100 is not necessary when BSA is present Furthermore if Triton X 100 is added yield substantially decreases in capillary amplifications that include BSA Mistake 4 Adding polymerase to a microtiter plate before BSA For convenience many people mix reactions in a microtiter plate so they can be loaded simultaneously by capillary action into tubes already placed in modular tops However if the polymerase is added to a microtiter well before BSA the polymerase can be adsorbed onto the plastic surface and not loaded into the capillaries To prevent adsorption of polymerase during handling we recommend diluting the poly merase to a 10X concentration with a diluent that includes BSA at 2 5
149. trations 2 mM 3 mM and 4 mM E 5 o 2o e m lt ke mr An 4 Qe JE ou ag O Lu z a DGYCLIST Volume 3 Number 1 Fall 1995 Capillary Tube Handling with the Rapidcycler Randy P Rasmussen Dept of Biology University of Utah One of the biggest concerns for new users of air cyclers is the handling and sealing of glass capillary tubes While they are a bit more difficult to use than the traditional microcentrifuge tube the rapid cycle times and temperature homo geneity made possible by the capillaries makes them more than worth the extra trouble After a little practice you may wonder why you ever worried Single Tube Handling Mixing the Sample You can mix your reaction in any sort of container use low protein absorbing microtiter dishes IT 2590 Take care at the mixing step as one of the most com mon causes of reaction failure is forget ting a component of the reaction see Ihe 10 most common mistakes Rapid Cyclist 2 11 12 The chances of leaving something out can be reduced by mak ing up master mixes that contain every thing but primer and template The mix can be stored at 4 C for up to 3 months see Reaction mixes and buffer recipes A Figure 1 Tipping the capillary tube sideways Rapid Cyclist 2 9 to increase the rate of liquid uptake Loading the capillary Glass capillary tubes are easily loaded by capillary action You can increase
150. ulb with bare fingers as any residue can shorten the bulb life MONTHLY MAINTENANCE CONTINUED 1 Inspect fan blade for fatigue at collar attachment point and tighten set screw Inspect the area where the fan blade attaches to the mounting collar for any bending or cracking Check the tightness of the set screw in the fan collar 2 Inspect and clean chamber including fan blade foam and modules Wipe the entire chamber down with a damp cloth light soap and water including the chamber fan blade Be careful not to bend the thermocouple 3 Inspect the condition of the duct foam and the door foam Inspect the foil Covered foam and make sure it is not beginning to peel off the duct sides or top Make sure the black high temperature foam on the cham ber door is not binding with the movement of the door 4 Clean Keypad with damp cloth On the 1002 RapidCycler wipe the keypad and display area clean with a damp cloth On the 1605 Air Thermo cycler use a dry cloth EVERY SIX MONTHS 1 Inspect lower cooling fan blade and dust if necessary Lay the machine on its side and inspect the lower cooling fan and fan guard for anything blocking the air path If necessary remove the four screws on the fan guard and wipe the fan blade to remove excessive dust Also ensure that there is nothing rubbing on the fan blade and it does not hit anything REPHRASE THIS 2 Tighten all exterior screws and clean all surfaces Using the hex driver
151. ver over the target temperature A faster approach is to overheat and under heat the air This brings the sample to temperature more quickly Figure 2A The faster heat block instruments do this but some parts of your sample may be slightly above or below the target temperatures Figure 2 Temperature traces of the hold method 2B versus the over heat and under heat method 2A Traces are of air temperature and actual sample temperature ONNGNVH JIdNVS i ada Gh AN ih Er Notice how the sample PE Ae temperature always lags i ris 7B e HH behind the air tempera tz H d ture and how the f Ep E over under heat method deua brings the sample to tem m lo E A perature more quickly j Aae aE A have had good success with the faster overheat and under heat approach The following protocols have been successful with a variety of primers and DNA sources and are preprogrammed as cycle number 82 87 10 ul Reactions Predenature 98 C for 10 seconds SAMPLE HANDLING Cycle Denature 98 C for 10 seconds Anneal 40 C to 60 C for 10 seconds as appropriate for your primers Extend 74 C for 25 nucleotides per seconds 50 ul Reactions Predenature 96 C for 30 seconds Cycle Denature 96 C for 30 seconds Anneal 40 C to 60 C for 30 seconds as appropriate for your primers Extend 74 C for 25 nucleotides per seconds If you prefer the sit and wait approach 10 ul samples require 40 second holds at d
152. vortex magnetically separate discard supernatant resuspend beads in 30 uL HBWB 2 Bind DNA add 5 20 uL PCR product to bead pellet mix by flicking incubate 15 min RT with occasional resuspension magnetically separate discard supernatant resuspend beads in 40 uL HBWB magnetically separate discard supernatant 3 Denature DNA load tube C with 30 uL 3 M acetate solution resuspend beads in 15 uL 0 2 N NaOH incubate 15 min x RT with occasional resuspension magnetically separate add supernatant to tube C zm 5 zo 20 d m lt e ne An a 4 More strand separation repeat 3x resuspend beads in 50 uL 0 2 N NaOH magnetically separate add supernatant to tube C resuspend beads in 40 uL HBWB magnetically separate discard supernatant resuspend beads in 50 uL TE magnetically separate discard supernatant 5 W strand cleanup resuspend beads in 25 uL H2O store at 20 6 C strand cleanup add 1 uL glycogen to tube C and mix well add 500 uL 95 ethanol mix well 30 min x ice microfuge 10 min wash once with 400 uL 7096 ethanol draw off ethanol in vacuum jar avoid fully drying pellet resuspend in 25 uL H2O store at 20 Sequencing Reactions This is a synopsis of my current sequencing methods use Sequenase Version 2 with Pyrophosphatase USB Catalog 70175 and the Manganese Reagent Sequenase Kit USB Catalog 70130 which employs extensions and slight mod ification of commonly used
153. weeks at 20 C Master mixes also minimize pipetting errors particular ly with small volumes Mistake 9 Inappropriate Mg2 concentration Rapid cycling generally requires higher magnesium concentrations than slow cycling For example whereas 1 5 mM magnesium chloride is standard in slow cycling 2 4 mM is more typical for rapid cycling With 2 4 mM magnesium chloride excellent yield and specificity can be obtained with annealing times of 0 sec Magnesium chloride is hygroscopic and it may be difficult to prepare accurate solutions from the solid salt We use a 1 M solution of magnesium chloride available from Sigma M1028 Mistake 10 Poor temperature time optimization Rapid cycle temperature time parame ters are very different from slower cyclers It is a mistake to directly transfer a pro tocol like 1 min at 94 C 2 min at 55 C and 3 min at 72 C to a rapid cycler Denaturation should be set at 94 C for 0 sec The annealing time should almost always also be set at 0 sec The extension temperature should be 70 74 C The extension time should be O sec for products up to 100 bp 5 15 sec for products up to 500 bp and about 30 sec for a 1000 bp product Most amplifications with 20 mer primers will work well using 3 mM MgCI2 at an annealing temperature of 50 C Rapid cycling makes it feasible to rapidly test all combinations of 3 differ ent annealing temperatures 40 C 50 C and 60 C and 3 different Mg con cen
154. with buffers and reagents supplied by Idaho Technology 1761 Optimizer Kit The Mg2 concentration was 2 0 mM Cycling parameters were denaturation at 94 C for O sec annealing at 55 C for O sec and elongation at 73 C for 20 sec for 30 cycles The total cycle time was 23 7 min The samples were loaded directly on a 1 5 Agarose gel and elec trophoresed at 5 V cm Figure 2 illustrates a typical example of engraftment This is a sibling transplant where all four alleles are different At 14 days after transplantation both donor ze Su 20 2 m lt Jo me An 2 and recipient bands were observed Residual recipient lymphocytes may circu late for 2 3 weeks after transplantation However recipient bands should disappear by 4 weeks if engraftment has occurred Figure 3 illustrates a typical example of disease recurrence after bone marrow trans plantation This is a sibling transplant where one allele is shared between donor and recipient types At 36 days post bone mar row transplantation both donor specific and recipient specific alleles are apparent This indicates that the donor marrow has not entirely supplanted the recipient marrow at 36 days At 100 days post bone marrow transplantation only the recipient bands are present indicating failure of engraftment and recurrence of disease Figure 3 Disease recurrence after bone marrow transplantation The VNTR locus HGM D18802 was used 1 Recipient before transp
155. y nearest neighbor base stacking interactions 1 The free energy released on heteroduplex forma tion should be related to the required annealing temperature in DNA amplifica tion The mean stacking temperature of an oligo has been correlated with the temperature at which 50 hybridization occurs 9 This T50 hyb for the RS42 and KM29 primers averages 59 C and 51 C for the two buffers investigated 9 close to the optimal 55 C annealing temperature found for DNA amplification in our system The amplification volume can be scaled up as desired to 25 50 or 100 ul Flexible silica capillary tubing as currently used in capillary electrophoresis can be coiled to provide a wide range of volumes with excellent heat transfer charac teristics A less expensive alternative is to use rigid glass capillaries of larger diam eter Temperature transitions and total amplification times are somewhat longer with larger diameter tubes For example while a 10 ul sample can be amplified in a 0 52 mm i d tube in 15 min base profile described in Materials and Methods a 20 40 ul sample takes 20 min in a 0 96 mm tube and a 50 100 ul sam ple takes 25 min in a 1 26 mm tube The choice of buffer and reactant concentrations in Figure 7 were optimized for rapid cycling Other buffer systems may give a single specific band with con SIMDILAV eo rn O E 1 ventional slower cycling For instance the rapid cycling buffer included 500 uM
156. y objectives are to eliminate the noise produced by the solenoid and to gain better control of the tempera ture time curve While we have done our best to make the 1605 ATC a flexible instrument there are some restrictions imposed by the original design Since the solenoid is either fully open or fully closed the machine is limited to a single cool down rate This rate is factory set by adjusting the solenoid to cool down from 94 C to 55 C in about 8 sec Cool down rates as low as three secs are possible with this design however product yield is decreased with rapid cooling This is due to the temperature rebound which occurs when the door closes Apparently there 2 53 o 20 m lt Jo me Aa a is not enough time for the primers to anneal and the enzyme to function before the increasing temperature causes denaturation A linear actuator can in theo ry produce cool down rates in the range of 3 4 secs and then hold the lower temperature for precisely the required time This would allow a slight decrease in cycle time yet substantially increase product yield This work is especially impor tant for low annealing temperature protocols such as RAPD We are committed to developing a more flexible instrument while retaining the simplicity of the ATC The linear actuator will allow much finer control of the temperature time curve Two temperature cycling and three temperature cycles with unusually high annealing temperatures will be facil
157. ystem offers numerous advan tages over the previous model Improved Temperature Control The Rapidcycler is able to run a broader range of temperature cycle proto cols including two temperature cycling It is also less likely to overshoot elonga tion temperatures The temperature ramp rate between the annealing and elongation temper atures is now entered in degrees per second and is linear within and between runs Quiet Operation The actuator used to control air flow through the Rapidcycler is a soft shift solenoid as opposed to the AC solenoid used in the 1605 This offers two advan tages Besides being much quieter the new actuator allows intermediate door settings hence variable airflow This is in contrast to the solenoid in the 1605 which had just two settings open and closed The new actuator allows the control soft ware to more effectively dampen the temperature oscillations that tend to occur when driving rapid temperature changes Improved Programming The Rapidcycler user interface is a significant improvement over the 1605 The readout size has been increased so that everything is printed in clear English instead of abbreviations The three user modes Cycle Hold and Link are now accessible by a single button from the keypad Tr TT a N rf z Maneuvering around programming screens has been simplified by the addi tion of cursor keys There are now 99 Cycle programs 99 Hold programs and 99 L

1901-01 RC Manual

Contents

Download Pdf Manuals

Related Search

Related Contents