PROT76834/AdvHF Kit(PT3139-1)
Contents
1. Advantage HF PCR Kit User Manual PT3139 1 Catalog K1909 1 y Storage conditions 20 C FOR RESEARCH USE ONLY PR76834 CLONTECH Laboratories Inc Table of Contents I Introduction 3 ll List of Components 7 Ill Additional Materials Required 8 IV Advantage HF PCR Kit Protocol 9 A General Considerations 9 B Control PCR Reactions 11 C Recommended Cycling Parameters 12 D Amplification of Longer Fragments with the Advantage Buffer 13 Recommendations for Electrophoresis 13 V Troubleshooting Guide 14 VI References 18 Vil Related Products 19 Notice to Purchaser Alicense under U S patents 4 683 202 4 683 195 and 4 965 188 or their foreign counterparts owned by Hoffmann La Roche and F Hoffmann La Roche Ltd Roche has an up front fee component and a running royalty component The purchase price of this product includes limited non transferable rights under the running royalty component to use only this amount of the product to practice the Polymerase Chain Reaction PCR and related products described in said patents solely for the research and development activities of the purchaser when this product is used in conjunction with a thermal cycler whose use is covered by the up front fee component Rights to the up front fee component must be obtained by the end user in order to have acomplete license These rights under the up front fee component may be purchased from Pe2. 415 424 1064 or 800 424 1350 CLONTECH Laboratories Inc V Troubleshooting Guide continued Too little enzyme Advantage HF Polymerase Mix is 50X for most appli cations Therefore try to optimize the cycle param eters as described above before increasing the en zyme concentration In rare cases the yields can be improved by increasing the concentration of the enzyme mix However increasing the concentration gt 2X is likely to lead to higher background levels Mg is too low KlenTaq 1 DNA polymerase has a broader Mg optimum than native Taq DNA polymerase i e it performs well over a wider range of Mg with no loss of efficiency Therefore as long as you use the buffers included in the kit it is unlikely that a lack of productis due to problems with the Mg concentration However if the concentration of EDTA in the cDNA sampleis more than5 mM this can reduce the effective concentration of Mg to below a minimum level Increas ing the concentration of Mg can result in lower fidelity dNTPs not optimal The Advantage HF PCR Kit contains a carefully balanced mixture of the 4 dNTPs Replacement of this mixture with a standard dNTP mix 200 uM each may improve the DNA yield but may also result in lower fidelity Difficult target Some targets are inherently difficult to amplify In most cases this is due to unusually high GC content and or secondary structure The Advantage GC Kits are recommended in these
3. CLONTECH Laboratories Inc ll List of Components Advantage HF PCR Kit K1909 1 100 rxns 1909 y 10 rxns Store all components at 20 C Enough reagents are supplied for 100 PCR reactions of 50 ul each 10 rxns 100 rxns e 10ul 100ul 50X Advantage HF Polymerase Mix Includes KlenTaq 1 DNA polymerase and TagStart Antibody 1 1 ug ul in the following storage buffer Concentration 1X in 50X Component Concentration 50 Glycerol 1 0 40 mM Tris HCl pH 7 5 0 8 mM 50 mM KCI 1 0 mM 25 mM NH 4 2SO 0 5 mM 1 mM EDTA 20 uM 5 0 mM B mercaptoethanol 0 1 mM 0 25 Thesit 0 005 Deep Vent IM is a minor component of the Advantage HF Polymerase Mix e 60ul 600ul 10X HF PCR reaction buffer e 60uI 600 ul 10X cDNA PCR reaction buffer e 60ul 600ul 10X HF dNTP mix e 400ul 4ml Purified Water Millipore purified e 10 100 ul Control DNA template A DNA 0 2 ng L e 10u 40 ul Control primer mix 10 uM each The sequences are 5 primer 5 TTGGTTGATCGTGGTGCAGAGAACGTTG 3 3 primer 5 GAGAAGGTCACGAATGAACCAGGCGATAA 3 TEL 415 424 8222 or 800 662 CLON Technical Support Protocol PT3139 1 page FAX 415 424 1064 or 800 424 1350 Version PR76834 7 CLONTECH Laboratories Inc lll Additional Materials Required The following reagents are required but not supplied e Mineral oil We recommend Sigma Cat M 3516 0 5 ml PCR reaction tubes We recommend Perkin Elmer GeneAmp 0 5 ml reaction tubes
4. absence of product shorter than full length products or smearing For 5 and 3 RACE and general PCR from cDNA you can ensure the quality of your cDNA by using Marathon Ready cDNA from CLONTECH TEL 415 424 8222 or 800 662 CLON Technical Support Protocol PT3139 1 page FAX 415 424 1064 or 800 424 1350 Version PR76834 9 CLONTECH Laboratories Inc IV Advantage HF PCR Kit continued 4 Good PCR practices a Prepare reactions with dedicated pipettors in a dedicated work space Due to the tremendous amplification power of PCR minute amounts of contaminating DNA can produce nonspecific amplification in some instances contaminants can cause DNA bands even in the absence of added template DNA We recommend that you set up your PCR reactions in a dedicated lab area or noncirculating containment hood and use dedicated pipettors PCR pipette tips with hydrophobic filters and dedicated solutions Perform post PCR analysis in a separate area with a separate set of pipettors b Pipetting Because of the small volumes used in PCR experiments and the potential for tube to tube variation careful pipetting technique is extremely important Always be sure that no extra solution is on the outside of the pipette tip before transfer When adding solution toa tube immerse the tip into the reaction mixture deliver the solution and rinse the pipette tip by pipetting up and down several times c Use a Master Mix Using a Master Mix grea
5. Cat N801 0737 Thermal cycler Perkin Elmer DNA Thermal Cycler 480 9600 or equivalent e Dedicated pipettors 1 2 ul 1 10 ul 1 20 ul 20 200 ul 200 1000 l e PCR pipette tips suitable for the above pipettors and equipped with aerosol barrier filters Do not autoclave pipette tips e DNA size markers See Section IV D 5X Stop loading buffer Sambrook et al 1989 provides several recipes page Protocol PT3139 1 Technical Support TEL 415 424 8222 or 800 662 CLON 8 Version PR76834 FAX 415 424 1064 or 800 424 1350 CLONTECH Laboratories Inc IV Advantage HF PCR Kit Protocol PLEASE READ ENTIRE PROTOCOL BEFORE STARTING A General Considerations 1 Thermal cycler The guidelines for cycling parameters in this protocol have been developed for a Perkin Elmer DNA Thermal Cycler 480 or 9600 and Perkin Elmer GeneAmp 0 5 ml PCR reaction tubes Newer cyclers may allow for shorter cycle times and eliminate the need to use oil The optimal cycling parameters may vary with different templates primers experimental protocols tubes and thermal cyclers Refer to the Troubleshooting Guide Section V for suggestions on optimizing PCR conditions 2 Primer design Primer design is the single largest variable in PCR applications and the single most important factor in determining the success or failure of PCR reactions Always check and recheck your primer design before constructing or ordering primers CLO
6. RNA e Multiple Tissue Northern MTN Blots e UltraPure PCR Deoxynucleotide Mix TEL 415 424 8222 or 800 662 CLON Technical Support FAX 415 424 1064 or 800 424 1350 Cat K1905 1 y 8417 1 K1906 1 y 8418 1 K1907 1 y 8419 1 K1908 1 y 8420 1 many 5400 1 2 5401 1 many many many 4700 1 Protocol PT3139 1 page Version PR76834 19 Advantage Advantage GC Advantage HF Delta Marathon Ready TaqStart and TthStart are trademarks of CLONTECH Laboratories Inc GeneAmp is a trademark of Hoffmann La Roche Inc Deep Vent is a trademark of New England Biolabs Inc 1997 CLONTECH Laboratories Inc All rights reserved
7. situations B Multiple products Too many cycles Reducing the cycle number may eliminate nonspe cific bands Annealing temp Increase the annealing extension temperature in too low increments of 2 3 C Suboptimal primer Redesign your primer s after confirming the accu design racy of the sequence information If the original primer s was less than 22 nt long try using a longer primer If the original primer s had a GC content of less than 45 try to design a primer with a GC content of 45 60 TEL 415 424 8222 or 800 662 CLON Technical Support Protocol PT3139 1 page FAX 415 424 1064 or 800 424 1350 Version PR76834 15 CLONTECH Laboratories Inc V Troubleshooting Guide continued Touchdown PCR Touchdown PCR significantly improves the speci needed ficity of many PCR reactions in various applications Don et al 1991 Roux 1995 Touchdown PCR involves using an annealing extension temperature that is several degrees higher than the T of the primers during the initial PCR cycles The annealing extension temperature is then reduced to the primer Tm for the remaining PCR cycles The change can be performed either in a single step or in increments over several cycles Contamination See Section D below C Products are smeared Too many cycles Reduce the cycle number by 3 5 to see if non specific bands go away Denaturation temp Try increasing the denaturation temperature in incre too low ments o
8. NTECH offers PRIMER PREMIER V1072 1 V1079 1 powerful easy to use software that ensures optimal primer design Length and G C content The Advantage HF PCR Kit can be used in a wide variety of PCR applications and the constraints on primer design will vary from one application to the next In general however primers should have a T of at least 70 C to achieve optimal results in a two step cycling program with a 68 C annealing extension step Therefore whenever possible primers should be at least 22 nucleotides nt long 25 30 mers are preferred and have a GC content of 45 60 3 Template quality Because of the exponential nature of PCR amplification many conven tional PCR applications work well with templates of average or even low quality However the longer the target the more important tem plate quality becomes This is because the number of unnicked full length targets decreases as the target length increases so poor quality DNA will have very few large unnicked targets Furthermore some depurination occurs when DNA is denatured during thermal cycling and this can lead to strand scission Therefore it is particularly important to prepare high quality high molecular weight DNA when amplifying large targets Template quality is also important when the highest possible sensitivity is needed Furthermore in cDNA applications such as RACE and other RT PCR protocols incomplete reverse transcription can lead to an
9. Thermococcus litoralis DNA polymerase Vent in PCR determined by denaturing gradient gel electrophoresis Nucleic Acids Res 19 15 4193 4198 Cheng S Fockler C Barnes W M amp Higuchi R 1994 Effective amplification of long targets from cloned inserts and human genomic DNA Proc Natl Acad Sci USA 91 5695 5699 Chou Q Russell M Birch D Raymond J amp Bloch W 1992 Prevention of pre PCR mispriming and primer dimerization improves low copy number amplifications Nucleic Acids Res 20 1717 1723 d Aquila R T Bechtel L J Videler J A Eron J J Gorczyca P amp Kaplan J C 1991 Maximizing sensitivity and specificity of PCR by preamplification heating Nucleic Acids Res 19 3749 Don R H Cox P T Wainwright B J Baker K amp Mattick J S 1991 Touchdown PCR to circumvent spurious priming during gene amplification Nucleic Acids Res 19 4008 Frey B amp Suppmann B 1995 Demonstration of the Expand PCR system s greater fidelity and higher yields with a lacl based PCR fidelity assay Biochemica 2 8 9 Kellogg D E Rybalkin l Chen S Mukhamedova N Vlasik T Siebert P amp Chenchik A 1994 TaqStart Antibody Hotstart PCR facilitated by a neutralizing monoclonal antibody directed against Taq DNA polymerase BioTechniques 16 1134 1137 Ling L L Keohavong P Dias C amp Thilly W G 1991 Optimization of the polymerase chain reaction with regard to f
10. This final extension may reduce background in some cases Protocol PT3139 1 Technical Support TEL 415 424 8222 or 800 662 CLON Version PR76834 FAX 415 424 1064 or 800 424 1350 CLONTECH Laboratories Inc IV Advantage HF PCR Kit continued D Amplification of Longer Fragments with the Advantage Buffer The Advantage HF Kit is provided with two buffers the HF Buffer and the standard cDNA Buffer When used with the HF Buffer this kit delivers the highest possible fidelity Fragments of up to 2 5 kb can be amplified under these conditions To amplify longer fragments some of the increase in fidelity can be sacrificed to improve elongation efficiency by combining the HF and cDNA buffers in varying proportions see Figure 4 To amplify longer fragments we recommend replacing the smallest amount of HF Buffer that allows satisfactory amplification For example the 6 kb frag ment in Figure 4 can be amplified from a cDNA library in a 50 ul PCR reaction containing 4 ul of 10X HF Buffer 80 final and 1 ul of 10X cDNA Buffer Optimal conditions forthe amplification of other fragments should be determined individually We recommend initially trying HF Buffer concen trations in the 50 100 range for fragments up to 10 kb E Recommendations for Electrophoresis We recommend that you transfer a 5 ul sample of your PCR reaction to a fresh tube and add 1 ul of 5X stop loading buffer The remaining 45 ul of the reaction mixture can
11. aporation during cycling and cap firmly A good capping of mineral oil should have a well defined meniscus between the two phases 5 Commence thermal cycling If using a Perkin Elmer DNA Thermal Cycler Model 480 or 9600 use the parameters described in Section C below 20 22 cycles with a 4 min annealing extension time is sufficient for amplification of the positive control template provided in the kit 6 Transfer a 5 ul sample of your PCR reaction to a fresh tube and add 1 ul of 5X stop loading buffer Analyze your sample s along with suitable DNA size markers by electrophoresis on a 0 8 1 2 agarose ethidium bromide gel Expected results If you are using the positive control reagents provided in the kit the reaction should produce a single major band of 2 kb No bands should be generated in the negative i e no DNA template control TEL 415 424 8222 or 800 662 CLON Technical Support Protocol PT3139 1 page FAX 415 424 1064 or 800 424 1350 Version PR76834 11 CLONTECH Laboratories Inc IV Advantage HF PCR Kit continued C page 12 Recommended Cycling Parameters Use the following guidelines when setting up your initial experiments with the Advantage HF Polymerase Mix These are general guidelines the optimal parameters may vary with different thermal cyclers and will depend on your particular primers and templates and on other experimental variables Note When using the Advantage HF Kit with
12. be subjected to further cycling if you do notsee a product Analyze your sample s along with suitable DNA size markers by electrophoresis on a suitable agarose gel containing 0 1 0 5 pg ml ethidium bromide The percentage agarose and the DNA size markers you choose will depend on the expected range of insert sizes You may wish to refer to the following general guidelines before assembling your gel Recommendations for agarose gels Expected Recommended Recommended insert size range agarose DNA size markers 0 3 1 5 kb 1 5 6X174 Hae Ill 0 5 10 kb 1 2 1 kb DNA ladder gt 5 kb 0 8 A Hind III FAX 415 424 1064 or 800 424 1350 Version PR76834 13 CLONTECH Laboratories Inc V Troubleshooting Guide The following general guidelines apply to most PCR reactions However no attempt has been made to address troubleshooting for all of the many applica tions for which the Advantage HF Kit can be used When using the kit with another CLONTECH product additional application specific troubleshooting information can be found in the relevant User Manual A No product observed PCR component Use a checklist when assembling reactions Always missing or degraded perform a positive control to ensure that each com ponent is functional If the positive control does not work repeat the positive control only If the positive control still does not work repeat again replacing individual components to identify the faulty reag
13. ent Too few cycles Increase the number of cycles 3 5 additional cycles at a time Annealing temp Decrease the annealing temperature in increments too high of 2 4 C Suboptimal primer Redesign your primer s after confirming the accu design racy of the sequence information If the original primer s was less than 22 nt long try using a longer primer If the original primer s had a GC content of less than 45 try to design a primer with a GC content of 45 60 Not enough Repeat PCR using a higher concentration of DNA template after trying more cycles Poor template Check template integrity by electrophoresis on a quality standard TBE agarose gel If necessary repurify your template using methods that minimize shearing and nicking Denaturation temp Optimize denaturation temperature by decreasing or too high or low increasing it in 1 C increments A denaturation temperature that is too high can lead to degradation ofthe template especially forlong target sequences Denaturation time Optimize denaturation time by decreasing or increas too long or too short ing it in 10 sec increments A denaturation time that is too long can lead to degradation of the template especially for long target sequences Extension time too Especially with longer templates Increase the short extension time in 1 min increments page Protocol PT3139 1 Technical Support TEL 415 424 8222 or 800 662 CLON 14 Version PR76834 FAX
14. f 1 C Extension time Decrease the extension time in 1 2 min increments too long Poor template Check template integrity by electrophoresis on a de quality denaturing agarose gel Repurify your template if necessary Touchdown PCR See Touchdown PCR needed under previous needed section Too much enzyme Advantage HF Polymerase Mix is 50X for most appli cations however a 1X final concentration of the enzyme mix may be too high for some applications If smearing is observed first try optimizing the cycle parameters as described above then try reducing the enzyme concentration to 0 5 0 2X Mg is too high KlenTag 1 DNA polymerase has a broader Mg optimum than native Taq DNA polymerase i e it performs well over a wider range of Mg with no loss of efficiency Therefore as long as you have used the buffers supplied in the kit it is unlikely that smearing is due to problems with the Mg concentration Altering the concentration of Mg can result in lower fidelity Too much template Try a lower concentration of DNA template in the PCR reaction Contamination See Section D below page Protocol PT3139 1 Technical Support TEL 415 424 8222 or 800 662 CLON 16 Version PR76834 FAX 415 424 1064 or 800 424 1350 CLONTECH Laboratories Inc V Troubleshooting Guide continued D Dealing with contamination Contamination most often results in extra bands or smearing Itis important to include an H O co
15. f cDNA fragments Several fragments were amplified from Human Placenta cDNA under standard Lanes 1 3 amp 5 and high fidelity PCR conditions Advantage HF Lanes 2 4 amp 6 M A Hind III DNA size markers Lanes 1 amp 2 0 5 kb fragment of glycerol 3 phosphate dehydrogenase gene Lanes 3 amp 4 1 3 kb fragment of transferrin receptor gene Lanes 5 amp 6 2 5 kb fragment of lactoferrin gene Cycling parameters 30 sec at 94 C 30 x 30 sec at 94 C 5 min at 68 C 5 min at 68 C page Protocol PT3139 1 Technical Support TEL 415 424 8222 or 800 662 CLON 4 Version PR76834 FAX 415 424 1064 or 800 424 1350 CLONTECH Laboratories Inc I Introduction continued The Advantage HF Kit ensures high fidelity amplification of ge nomic as well as cDNA tem plates In Figure 3 the Advan tage HF Kit was used to amplify a 2 1 kb fragment of the bovine pancreas trypsin inhibitor gene from different amounts of total calf thymus DNA The fragment was efficiently amplified from as little as 25 ng of genomic DNA Lane 4 Increase elongation efficiency for longer fragments Two reaction buffers are included inthe Advantage HF Kit the HF Buffer and the original cDNA Buffer Use of the HF buffer de livers the highest possible fidel ity as represented in Figure 1 Fragments of up to 2 5 kb can be amplified under these condi tions To amplify longer frag ments some of the increase in fidelity can be sacrificed to i
16. idelity modified T7 Taq and Vent DNA polymerases PCR Methods Appl 1 63 69 Longo M C Berninger M S amp Hartley J L 1990 Use of uracil DNA glycosylase to control carry over contamination in polymerase chain reactions Gene 93 3749 Mo J Y Maki H amp Sekiguchi M 1991 Mutational specificity of the dnaE173 mutator associated with a defect in the catalytic subunit of DNA polymerase III of Escherichia coli J Mol Biol 222 925 936 Nelson K Brannan J amp Kretz K 1995 The fidelity of TaqPlus DNA Polymerase in PCR Strategies Mol Biol 8 24 25 Roux K H 1995 Optimization and troubleshooting in PCR PCR Methods Appl 4 5185 5194 Sambrook J Fritsch E F amp Maniatis T 1989 Molecular Cloning A Laboratory Manual Second Edition Cold Spring Harbor Laboratory Cold Spring Harbor NY page Protocol PT3139 1 Technical Support TEL 415 424 8222 or 800 662 CLON 18 Version PR76834 FAX 415 424 1064 or 800 424 1350 CLONTECH Laboratories Inc Vil Related Products Product e Advantage cDNA PCR Kit e Advantage cDNA Polymerase Mix e Advantage Genomic PCR Kit e Advantage Genomic Polymerase Mix e Advantage GC cDNA PCR Kit e Advantage GC cDNA Polymerase Mix e Advantage GC Genomic PCR Kit e Advantage GC Genomic Polymerase Mix e Advantage UltraPure dNTPs Other Related Products e TaqStart Antibody e TthStart Antibody PRIMER PREMIER Poly At
17. la et al 1991 or wax bead mediated hot start Chou ef al 1991 In particular TaqStart reduces or eliminates nonspecific amplification products and primer dimer artifacts In some cases specific products can only be obtained by using TaqStart A PCR system for every application The Advantage cDNA and Genomic PCR Kits containing the Advantage cDNA and Genomic Polymerase Mixes respectively are designed for high efficiency long distance PCR amplification and are the foundation of the Advantage PCR Enzyme Systems CLONTECHniques July 1995 Barnes 1994 These versatile kits are designed for high performance amplification in the vast majority of PCR applications including all of our PCR based kits and have firmly established the benefits of PCR enzyme mixes containing hot start antibodies Our other Advan tage based kits have been developed for certain specialized applications The Advantage GC cDNA and Genomic PCR Kits and Mixes CLONTECHniques January 1997 combine the high efficiency of the Advantage system with a novel reagent GC Melt and an optimized buffer containing DMSO to permit amplifi cation of problematic GC rich templates up to 90 GC As the newest addition to the Advantage line Advantage HF allows a new level of fidelity balanced by the efficiency that is characteristic of Advantage page Protocol PT3139 1 Technical Support TEL 415 424 8222 or 800 662 CLON 6 Version PR76834 FAX 415 424 1064 or 800 424 1350
18. m prove elongation efficiency by combining the HF and cDNA buffers in varying proportions Figure 4 Panel A shows the fidelity resulting from the use of varying percentages of the HF Buffer see p 3 for description of assay Panel B demonstrates amplification of a 6 0 kb cDNA fragmentusing the indicated con centrations of HF Buffer In this example the fragment is suc cessfully amplified in 80 HF Buffer conditions allowing a 3 fold increase in fidelity over the cDNA buffer Optimal conditions forthe amplification of other frag ments should be determined in dividually ng 100 75 50 25 0 Figure 3 Advantage HF amplification from genomic DNA The indicated amounts of calf thymus DNA were used to amplify a 2 1 kb fragment of the bovine pan creas trypsin inhibitor gene M A Hind IIl DNA size markers Cycling parameters are the same as in Fig ure 2 on Mutants 0 r T r T 1 HF Buffer 0 20 40 60 80 100 4 4 2 0 Figure 4 The effect of HF Buffer concentration on PCR fidelity A and amplification B of a 6 0 kb cDNA fragment from Human Placenta cDNA Size markers are W Hind Ill DNA TEL 415 424 8222 or 800 662 CLON Technical Support Protocol PT3139 1 page FAX 415 424 1064 or 800 424 1350 Version PR76834 5 CLONTECH Laboratories Inc I Introduction continued Automatic hot start with TaqStart Antibodies Advantage HF provides hot start PCR by including TaqSta
19. me systems Accuracy assay is based on 25 cycles of amplification see text TEL 415 424 8222 or 800 662 CLON Technical Support Protocol PT3139 1 page FAX 415 424 1064 or 800 424 1350 Version PR76834 3 CLONTECH Laboratories Inc l Introduction continued transformants provides a comparative measure of PCR fidelity The fidelity of Advantage HF was confirmed by sequencing Table The high level of fidelity delivered by the Advantage HF system increases confidence in sequence de rived from PCR products and is beneficial in a variety of PCR applications including expression studies of amplified full length cDNAs generation of cDNA libraries RACE and analysis of homologous genes amplified with degenerate primers TABLE I FIDELITY OF ADVANTAGE HF BASED ON SEQUENCING DATA Error rate 2 Enzyme per 100 000 bp Taq 180 Advantage HF 2 4 2 determined with individual clones after 25 PCR cycles b agrees with published data Ling et al 1991 Cariello et al 1991 High fidelity amplification of cDNA and Genomic templates Advantage HF was used to amplify several cDNA templates of different lengths Figure 2 Although amplification of the longest template yielded a reduced amount of product Lane 6 this amplified product contains a higher percentage of accurate copies nearly 6 fold higher than Advantage and 20 fold higher than Taq according to Figure 1 M 1 2 3 4 5 6 Figure 2 Advantage HF amplification o
20. ntrol i e a control using H O instead of the DNA template in every PCR experiment to determine if the PCR reagents pipettors or PCR reaction tubes are contaminated with previously amplified targets If possible set up the PCR reaction and perform the post PCR analysis in separate laboratory areas with separate sets of pipettors Laboratory benches and pipettor shafts can be decontaminated by depurination Wipe surfaces with 1N HCl followed by 1N NaOH Then neutralize with a neutral buffer e g Tris or PBS and rinse with H O It is advisable to use one of the commercially available aerosol free pipette tips There is an enzymatic method for destroying PCR product carryover Longo et al 1990 It involves incorporation of dUTP into the PCR products and subsequent hydrolysis with uracil N glycosylase UNG When performing PCR directly on phage plaques or bacterial colonies failure to isolate single plaques or colonies will also produce multiple bands TEL 415 424 8222 or 800 662 CLON Technical Support Protocol PT3139 1 page FAX 415 424 1064 or 800 424 1350 Version PR76834 17 CLONTECH Laboratories Inc VI References Advantage GC PCR Kits January 1997 CLONTECHniques XII 1 2 3 Barnes W M 1994 PCR amplification of up to 35 kb DNA with high fidelity and high yield from bacteriophage templates Proc Natl Acad Sci USA 91 2216 2220 Cariello N F Swenberg J A amp Skopek T R 1991 Fidelity of
21. or 800 424 1350 CLONTECH Laboratories Inc IV Advantage HF PCR Kit continued 7 Use of additives TaqStart Antibody binds KlenTaq 1 DNA polymerase with high affinity under the conditions described in this protocol The addition of 2 5 DMSO will not interfere with TagStart function and may improve results in some instances see Section V A However the addition of formamide or other cosolvents may disrupt TaqStart function Further more excessive glycerol solutes e g salts pH extremes or other deviations from the recommended reaction conditions may reduce the effectiveness of the antibody and or DNA polymerases B Control PCR Reactions The following PCR reactions can be performed in parallel with your experiments as controls to ensure that the Advantage HF Kit is working properly A positive control template and primers are provided in the kit 1 Place all components on ice and allow to thaw completely Mix each component thoroughly before use 2 Combine the following reagents in a 0 5 ml PCR tube Positive Negative Control Control 32 ul 37 ul Purified HO 5 ul 5 ul 10X HF PCR reaction buffer 5 ul Control DNA template 0 2 ng ul 2 ul 2 ul Control primer mix 10 uM ea 5 ul 5 ul 10X HF dNTP mix 1 ul 1 ul 50X Advantage HF Polymerase Mix 50 ul 50 wl Total 3 Mix well and spin the tube briefly to collect all the liquid in the bottom of the tube 4 Add 1 2 drops of mineral oil to prevent ev
22. products such as CLONTECH s Marathon cDNA Amplification Kit Marathon Ready cDNAs or the Delta Differential Display use the parameters recom mended in the protocol for that kit Cycle Parameters PE 480 PE 9600 94 C for 1 min e 94 C for 15 sec e 25 35 cycles e 25 35 cycles 94 C 30sec 94 C 5 15sec 68 C 4min 68 C 4min 68 C for 3 min 4 e 68 C for 3 min 4 e Soak at 15 C e Soak at 15 C a 25 cycles for multiple copy genes or medium to high abundance cDNAs 30 35 cycles for single or low copy number genes or rare cDNAs For most applications we prefer two step cycles denaturation at T followed by annealing and extension at T over three step cycles denaturation at T followed by annealing at T followed by extension at T3 Three step cycles will be necessary when the T of the primers is less than 60 65 C and in certain special protocols such as Delta Differential Display b Use the shortest possible denaturation time Exposure of DNA to high temperatures causes some depurination of single stranded DNA during denaturation which eventually leads to strand scission High temperature also leads to gradual loss of enzyme activity c Use the highest possible annealing extension temperature See Note a Shorter targets may be amplified using shorter extension times Some researchers prefer to use an annealing extension time equal to the expected target size plus two minutes d Optional
23. rkin Elmer or obtained by purchasing an authorized thermal cycler No right to perform or offer commercial services of any kind using PCR including without limitation reporting the results of purchaser s activity for a fee or other commercial consideration is hereby granted by implication or estoppel Further information on purchasing licenses to practice the PCR process may be obtained by contacting the Director of Licensing at the Perkin Elmer Corporation 850 Lincoln Centre Drive Foster City CA 94404 or at Roche Molecular Systems Inc 1145 Atlantic Avenue Alameda CA 94501 This product is sold under licensing arrangements with F Hoffmann La Roche Ltd Roche Molecular Systems Inc and the Perkin Elmer Corporation Advantage HF cDNA Polymerase Mix is covered by U S Patent No 5 436 149 Foreign patents pending TaqStart Antibodies are licensed under U S Patent No 5 338 671 and corresponding patents in other countries page Protocol PT3139 1 Technical Support TEL 415 424 8222 or 800 662 CLON 2 Version PR76834 FAX 415 424 1064 or 800 424 1350 CLONTECH Laboratories Inc I Introduction The Advantage HF High Fidelity PCR Kit is a KlenTag based system de signed to deliver Pfu like fidelity in the amplification of cDNA or genomic templates High fidelity and efficiency While Pfu polymerase is known for its exceptional fidelity it suffers from subop timal efficiency that can be problematic in many PCR applica
24. rt Antibody in the polymerase mix eliminating the need for additional pipetting or handling steps Hot start refers to any method for assembling PCR reactions that keeps one or more of the reaction components physically or functionally separate from the rest of the components prior to the onset of thermal cycling This prevents back ground due to low level DNA synthesis from nonspecifically primed sites prior to the onset of thermal cycling The advantages of hot start PCR have been demonstrated in many different applications However only CLONTECH s Advantage Polymerase Mixes provide automatic hot start TaqStart is a neutralizing monoclonal antibody directed against Taq DNA polymerase TaqStart recognizes both native Taq and N terminal deletions such as KlenTaq 1 When premixed with the appropriate polymerase the antibody blocks polymerase activity during the set up of the PCR reactions at ambient temperatures Polymerase activity is restored at the onset of thermal cycling because the antibody is denatured by temperatures greater than 60 C The loss of inhibition is complete and irreversible so the polymerase regains its full enzymatic activity for PCR TaqStart mediated hot start PCR has been shown to significantly improve the efficiency and specificity of DNA amplifications Kellogg ef al 1994 CLONTECHniques April 1994 Antibody mediated hot start with TaqStart has been proven to be at least as effective as manual hot start d Aqui
25. tions In contrast the Advantage HF PCR Kit offers Pfu like fidelity combined with the efficiency required to amplify DNA fragments of up to 2 5 kb These benefits are the result of reformulation of several components in CLONTECH s Advantage PCR Enzyme Systems The Advantage HF Polymerase Mix combines KlenTaq a 5 exonuclease deficient variant of Taq polymerase with a proofreading poly merase and TagStart Antibody to provide a superior level of specificity Advantage HF thus combines the benefits of Pfu and the Advantage Enzyme System to deliver a high fidelity enzyme system The HF Advantage The accuracy of Advantage HF is compared to other enzymes and enzyme mixes in Figure 1 Using a genetic assay that measures nucleotide misincorporation Advantage HF rivals Pfu in fidelity This fidelity assay is based on amplification of an E coli ribosomal protein gene Mo et al 1991 Mutations in this gene often confer streptomycin resistance on the host Upon introduction of the amplified DNA into E coli the ratio of total transformants to streptomycin resistant 500 gt 435 400 385 300 200 gt 100 4 67 n Accuracy total transformants strep transformants 19 Taq Advantage Advantage Pfu Taq HF Pwo Enzyme Figure 1 Comparison of fidelity of Advantage HF and other PCR systems The fidelity of Advantage HF compares favorably with that of the Pfu enzyme and is significantly higher than that of other enzy
26. tly reduces tube to tube variation There fore use a Master Mix whenever you set up multiple PCR reactions If multiple templates are being tested with the same primers include the primers in the Master Mix If one template is being tested with multiple primer sets include the template in the Master Mix For several sets of parallel samples assemble multiple master mixes e g each with a different set of primers The Master Mix should be thoroughly mixed before use i e vortexed without bubbling d Include positive and negative controls i e HO instead of DNA template 5 Touchdown PCR We have found that touchdown PCR significantly improves the specificity of many PCR reactions in a wide variety of applications Section V B Don et al 1991 Roux 1995 Briefly touchdown PCR involves using an annealing extension temperature that is several degrees typically 3 10 C higher than the T of the primers during the initial PCR cycles typically 5 10 The annealing extension tempera ture is then reduced to the primer T for the remaining PCR cycles 6 TaqStart Antibody provides automatic hot start PCR Do not use a manual hot start or wax bead based hot start when using Advantage HF As discussed in the Introduction hot start is automatic with Advantage HF because the enzyme mix already contains TagStart Antibody page Protocol PT3139 1 Technical Support TEL 415 424 8222 or 800 662 CLON 10 Version PR76834 FAX 415 424 1064
Download Pdf Manuals
Related Search