Home

Paradise Plus Guiide_RevC.book

1. RNA Yield Comparison Company A CompanyB Company C ParadiseP1US Replicate Yield ng Yield ng Yield ng Yield ng Day 1 1 1 173 756 155 8 235 Day 1 2 977 658 378 9 319 Day 2 1 2 342 351 384 9 185 Day 2 1 2 165 476 376 6 836 Ovetall 1 664 560 323 8 394 SD 688 9 181 4 112 2 1145 1 CV 41 4 32 4 34 7 13 6 NB Canada Frozen LCM2 4 6 a 130 12 Frozen LCM1 FFPE scrape FFPE LCM Comparative Microarray Data A comparison of various extraction kits on RNA recovery yield using various FFPE extraction kits Breast cancer tissue scrapes were run in triplicate using serial sections each 1 0 cm x 1 1 cm The ParadisePLUS reagent system gave the highest and most consistent yield compared to alternate FFPE RNA extraction kits Data provided by M Davey and R Oullette Atlantic Cancer Research Institute Moncton Frozen vs FFPE Comparison Company A Company B Company C ParadisePLUS Replicate Delta Ct Frozen Delta Ct Frozen Delta Ct Frozen Delta Ct Frozen vs FFPE vs FFPE vs FFPE vs FFPE Day 1 1 10 2 10 3 8 7 8 1 Day 1 2 10 2 10 8 12 3 7 4 Day 2 1 8 0 9 4 10 4 7 6 Day 2 1 8 5 10 6 12 5 7 8 Or 9 21 10 27 10 95 7 73 SD 1 2 0 6 1 8 0 3 CV 12 6 6 3 16 4 4 0 A comparative ORT PCR study of frozen tissue vs FFPE tissue using various FFPE RNA extraction kits Each sample was run in triplicate Real time PCR reactions we
2. Paradise Plus Reagent System User Guide 12872 00 Rev C 29 5 RNA Amplification Table 5 3 In Vitro Transcription IVT 2 roun d RA7009 D WAG NARHA Component Vial Color Vial Label IVT Buffer Blue 1 IVT Master Mix Blue 2 IVT Enzyme Mix Blue 3 DNase Mix Blue 4 Table 5 4 Amino Allyl IVT RA7010 Component Vial Color Vial Label IVT Buffer Blue 1 IVT Master Mix Blue 2 IVT Enzyme Mix Blue 3 DNase Mix Blue 4 Amino allyl IVT Master Mix Light Blue AA Labeling Buffer Light Blue LB DMSO Light Blue DMSO Table 5 5 aRNA Purification RA7011 Component Vial Color Vial Label DNA Binding Buffer Red DB DNA Wash Buffer Red DW DNA Elution Buffer Red DE RNA Binding Buffer Blue RB RNA Wash Buffer Blue RW RNA Elution Buffer Blue RE 0 5 mL Microcentrifuge Tubes Purification columns 30 Paradise Plus Reagent System User Guide 12872 00 Rev C 5 2 Preliminary Steps 5 2 5 2 1 5 2 2 Table 5 6 Amino allyl aRNA Purification RA7012 Component Vial Color VialL JAt A PUE RNA Binding Buffer Blue RB RNA Wash Buffer Blue RW RNA Elution Buffer Blue RE 0 5 mL Microcentrifuge Tubes Purification columns NOTE Please read this entire protocol prior to performing amplifications NOTE MDS Analytical Technologies recommends using quantitative real time PCR for the most
3. 21 Tissue Scrape Pipe PRI Do cob bc eae dell outta 25 Paradise Plus Reagent System User Guide 12872 00 Rev C i 5 RNA Amplification Components ssh ded Aha wud dhe Pease dada S eae ed gt JZE Reagents and Supplies 424 rousse inst evi Paceud aep henna Preliminary SING oi eens PER Bai Hire EORR S JEDER tienne Material and Protocol Review sis osseuses ROS ea mette f es wil p Thermal Cycler Programming is css sise thea ERG cies dds bee Ed bid wes Time Requirements aa aacr edumaa saatis p ar eR DEOR Gl ER p ade ato Protocol IN oies cia eat keen EIER AA e UC Rr Rd per Rap Paid Sample and Reagents Peas uo oues sb oda rex RENE EDAM Sa Nucleic Acid Elution Using Spin Columns Control Amplific tionS nn carte ede dtd eed eeu baw acsi tnt etes Work Space Recommendations Lise side steele ERE shader seers Important Additional Considerations POCO in Ponce reece E oR Eee GEERT Ee Ae ioe Ree A E apt een ut x 5 Round One Ist Strand cDNA Synthesis Round One 2nd Strand cDNA Synthesis Round One cDNA purification ia opes cepe eda dee Rn ea Round One In Vitro DranscHptlon 2 5 use vids retire Round One ak NA Purification es du Loki dm ep cad 5 Round Two Ist Strand cDNA Synthesis 5 Round Two 2nd Strand cDNA Synthesis
4. Round Two cDNA Purification ds abode EDI die Round Two In Vitro Transcription as coe nes coe e ene a S Round Two aRINA Purification 424 at see cree eva Paradise Paradise Paradise Paradise Paradise Paradise Paradise Paradise Paradise Paradise hd B hj ot tgo hd Jg H3 nd SSS 2X 2 2 2 A Applications of aRNA Direct aRNA Labeling with Turbo Labeling Kit Direct cDNA Fluorescent Labeling same etes MR Ra ailes Generation of Template for OR I PGR cis eins awe OI hens nae es SR B Sample Assessment Protocol C Amino Allyl aRNA Labeling D aRNA Analysis RNA QuantitationUsing Spectramax Microplate Readers with Absorbance Mode and Pathcheck Sensor sites ssssedenmteseniusensess aRNA Yield and Purity Determination Paradise Plus Reagent System User Guide 12872 00 Rev C Assessment of Rna Quality Using the Agilent Bioanalyzer 76 Analysis of aRNA by Agarose Gel Electrophoresis Generation of Labeled aRNA Using Alternative IVT Kits Cleaning the Staining Jars Centrifuge Information Troubleshooting SDE ea a e ate ope ce n eO doen ee i Minky wate Wak AM ares 87 Extraction and Isolation esse s Ea extre bead eoa eo ede Ra edi eee os 88 Amplification koe view dria cole de ter ee ee Seren cedes 89 Quality Assessment Protocol 91 Paradise Plus Reagent System
5. Figure 5 17 Centrifuge NOTE To avoid potential breakage of the microcentrifuge tube cap during centrifugation insert the purification tube 0 5 mL tube assembly into a lidless 1 7 2 0 mL tube Insert this assembly into adjacent rotor holes as illustrated Rest the tube cap against the tube immediately clockwise to it Place an empty lidless 1 7 2 0 mL tube into the rotor hole adjacent in the clockwise direction to the last assembly 11 Immediately proceed to Round Two or store the purified aRNA at 70 C overnight END OF ROUND 1 46 Paradise PUS Reagent System User Guide 12872 00 Rev C 5 3 Protocol 5 3 6 PARADISE PLUS ROUND TWO 1ST STRAND cDNA SYNTHESIS 1 Thaw samples at 4 8 C if necessary Place samples on a 4 8 C as D TAG AKA 2 Thaw Primer 2 Gray 2 thoroughly mix spin down and pla Arcturus Paradise Plus 2 PRIMER 2 Store at ADS PC 10 300 Analytical Technologies Figure 5 18 Gray 2 3 Into eluted aRNA product from Round One add 1 0 pL of Primer 2 mix thoroughly by flicking the tube and spin down 4 Incubate the microcentrifuge tube at 70 C for 5 minutes then chill the samples to 4 8 C for one minute Spin down the contents and place on 4 8 C block before proceeding to next step 5 Place 1 Strand Synthesis components Red at 4 8 C 1 Strand Master Mix and Enhancer Yellow must be thawed thoroughly mixed with all solids dissolved and maintained at 4 8 C until used
6. 86 G Centrifuge Information Paradise Plus Reagent System User Guide 12872 00 Rev C D WAG NARHA H 1 STAINING Symptom Targeted cells do not lift from the slide during LCM H Troubleshooting Cause The sample may contain residual water D WAG AAR Suggestion Ensure that the ethanol solutions are fresh Ethanol is hygroscopic Keep the ethanol bottles tightly capped and do not pour ethanol solutions until you are ready to use them If you suspect that the 100 ethanol solution has absorbed water discard and use a new bottle The sample may have dried in between protocol steps Carry out the Staining and Dehydration segment of the protocol at a steady pace RNA cannot be recovered from the sample The sample starting material may contain poor quality RNA Run a quality control assesmnet detailed in this protocol on the tissue block to ensure it contains useable quality RNA RNA may become degraded during RNA isolation Wear gloves use RNase free technique and RNase free instruments and reagents RNA may not be fully extracted and isolated from cells on the LCM cap Perform RNA extraction immediately after LCM to ensure complete extraction and optimum recovery of RNA Amount of starting material may be insufficient Capture more cells Amount of RNA in each cell may vary depending on cell type RNA quality and length of fixat
7. Cover glass forceps Paradise Plus Reagent System User Guide 12872 00 Rev C 5 1 Introduction 5 5 5 E Microslide box plastic VWR Cat 48444 004 Tissue Flotation Water Bath gt TZE NAA AA Oven 20 200 pL pipettor Materials Vo dd Vv vv ov Disposable gloves Detergent Fisher Scientific Cat 04 355 RNase AWAY Life Technologies Cat 10328 011 100 ethanol Kimwipes or similar lint free towels Disposable microtome blades Microslides Pipette tips nuclease free Extraction Isolation Equipment gt gt gt gt Microcentrifuge Eppendorf 5415D or similar 2 20 pL pipettor 20 200 pL pipettor Incubation oven 50 C Materials gt gt Nuclease free pipette tips 0 5 ml extraction tubes Applied BioSystems N8010611 or USA Scientific Inc 1605 0000 Amplification Equipment VO dd Vv Vv Vv v Thermal cycler with heated lid Microcentrifuge for 1 5 mL and 0 5 mL tubes Eppendorf 5414D or similar 0 5 10 pL pipettor 20 pL pipettor 200 uL pipettor 1000 pL pipettor Ice bath or cold block 4 C Vortex mixer optional Paradise Plus Reagent System User Guide 12872 00 Rev C 1 9 Recommendations for Nuclease free Technique 1 9 Materials gt 0 5 mL or 0 2 mL RNase free microcentrifuge tubes E m gt 2mLl lidless tube for centrifuge PGC Scientific Cat 16 81 JAEJVOPHRIURSE gt Nuclease free pipette tips Reagents gt Su
8. 2 Clean surfaces and devices pipettors racks centrifuge etc with commercially available decontamination solutions everyday or more frequently depending on use Paradise Plus Reagent System User Guide 12872 00 Rev C D WAG NAAR 2 Configurations 2 1 KIT COMPONENTS Table 2 1 Paradise P S Kit Configuration with Catalog Numbers Paradise P 5 Kit Configurations with Catalog Solvents Stain Extraction Amplification IVT Turbo Numbers Isolation Label Description Catalog of Room Room Frozen Room Frozen Room Frozen Room Number Samples temp temp temp temp temp Arcturus Paradise PlUS 1 5 KITO311 12 1x 1x 1x 1x 2x 2x 2x x x Round 12 reactions RA7013 RA7014 RA7007 RA7001 RA7018 RA7011 RA7008 Arcturus Paradise P S 1 5 KIT0321 6 1x 1x 1x 1x 1x 1x 1x x x Round 12 ext iso 6 amp RA7013 RA7014 RA7007 RA7001 RA7018 RA7011 RA7008 Arcturus Paradise PIUS 1 5 KITO321 A 6 x x x x 1x 1x 1x x x Round 6 Amplification only RA7018 RA7011 RA7008 Arcturus Paradise PlUS 1 5 KIT0312 1 12 x x 1x 1x x X x X x Round 12 extractions only RA7007 RA7001 Arcturus Paradise PUS staining KIT0312 S 12 1x 1x x x x x x x x components 24 samples RA7013 RA7014 Arcturus Paradise P S stain KITO312 J 24 x 1x x x x x x x x slide jars amp slides 24 samples RA7014 Arcturus Paradise PlUS 1 5 KITO311 NS 12 x 1x 1x 1x 2x 2x 2x x x Round 12 reactions No RA7014 RA7007
9. Table 4 3 RNA Incubation Times Samples Age Incubation Time Samples 3 years old 16 hours Samples 3 years old 5 hours For complete extraction this time can be increased to 16 hours NOTE If multiple LCM captures are performed it is recommended that each cap be incubated in Pro K Mix immediately after collection Caps may be incubated up to 24 hours Paradise Plus Reagent System User Guide 12872 00 Rev C 19 4 RNA Extraction Isolation 6 After incubation remove the tubes from the incubator place them in a D TAG AAR microcentrifuge and centrifuge for one minute at 800x g 7 Remove the CapSure Macro LCM Cap Close the microcentr the extract 8 Proceed with RNA isolation protocol or freeze cell extract at 70 C D It is okay to stop at this point in the protocol RNA Isolation 1 Pre condition the MiraCol Purification Column as follows a Pipette 200 pL Conditioning Buffer CB onto the purification column filter membrane b Incubate the purification column with Conditioning Buffer for 5 minutes at room temperature c Centrifuge the purification column in the provided collection tube at 16 000 x g for one minute 2 Pipette 53 pL of Paradise Plus Reagent System Binding Buffer BB into the cell extract from Part 1 RNA Extraction Mix well by pipetting up and down DO NOT CENTRIFUGE Pipette 103 pL of Ethanol Solution EtOH into tube and mix well 3 The cell extract mixture wil
10. 1 Strand Enzyme Mix does not require thawing and can be placed directly at 4 8 C Mix enzyme thoroughly by inverting several times Spin briefly SuperScript III Paradise Plus iststRANO MASTER MIX Paradise Plus E Enhancer Enzyme Paradise Plus 1st 2 STRAND ENZYME MIX Store at Store at Store at ADS cu p ssec DS eec provided by end user Analytical Technologies Analytical Technologies Analytical Technologies Figure 5 19 Red 1 Red 2 Yellow Enhancer and SuperScript Ill Enzyme 6 Add 1 Strand Synthesis components in the order listed in the following table If you are performing several amplifications you may wish to prepare a Complete 1 Strand Synthesis Mix based on the following table and add 9 0 pL Complete 1 Strand Synthesis Mix to each sample Mix thoroughly by flicking the tube and spin down DO NOT VORTEX Paradise Plus Reagent System User Guide 12872 00 Rev C 47 5 RNA Amplification Table 5 13 Complete 15 Strand Synthesis Mix D DAE NRTA 6 reac Component Amount uL Vial 10 overage pL Enhancer 2 Yellow E 13 2 15t Strand Master Mix 5 Red 1 33 0 15t Strand Enzyme Mix 1 Red 2 6 6 SuperScript Ill Enzyme 1 6 6 Total per sample 9 59 4 Not included in the kit 7 Incubate the sample s at 25 C for 10 minutes then at 37 C for 1 5 hours 8 Chill the sample s to 4 8 C for at least one minute NOTE Place components bac
11. 0 25 625 nM 3 R actin Reverse Primer 50 uM 0 25 625 nM Water nuclease free 1 Table B 6 For the 5 R actin Primers Amount for Each Reaction Component Volume pL Final Conc SYBR Green PCR Master Mix 10 Uracil DNA Glycosylase 0 5 5 R actin Forward Primer 50 uM 0 25 625 nM 5 R actin Reverse Primer 50 uM 0 25 625 nM Water nuclease free 1 The volumes listed above are specific to the Applied Biosystems 7900HT Fast Real Time PCR System Other real time PCR instruments may require adjustments to these volumes Please consult your instrument s user manual 2 Mix thoroughly by inverting then spin quickly to collect the master mix at the bottom of the tube 3 Proceed to Running the ABI PCR Reactions on page 67 Preparing the reaction plate 1 66 Assemble the reactions in an optical tube or optical reaction plate a Dispense 12 pL of the 3 Primer Set into the appropriate wells or tubes b Dispense 12 pL of the 5 Primer Set into the appropriate wells or tubes c Add 8 pL of the diluted cDNA into the appropriate wells or tubes d Add 8 uL of the nuclease free water into the appropriate NTC wells or tubes Paradise Plus Reagent System User Guide 12872 00 Rev C 4 NOTE For both the 3 and 5 Primer Sets include the RNA samples positive control diluted control for a standard curve and the blank NTC in the Seal the tube or reaction p
12. 150 pL into a 0 5 ml extraction tube not provided Using a clean sterile scalpel blade take the dried slide and scrape off the tissue section and place the scrape into the microcentrifuge tube containing the Proteinase K solution Vortex slightly Visually inspect to ensure that the tissue scrape is in the Pro K solution and not stuck to the side of the microcentrifuge tube Incubate at 37 C for the correct time period according to the following table Table 4 5 RNA Incubation Times Samples Age Incubation Time Samples gt 3 years old 16 hours Samples lt 3 years old 5 hours For complete extraction this time can be increased to 16 hours 6 Proceed to RNA isolation or store at 70 C or below RNA Isolation 1 Pre condition the MiraCol Purification Column as follows a Pipette 200 pL Conditioning Buffer CB onto the purification column filter membrane b Incubate the purification column with Conditioning Buffer for 5 minutes at room temperature c Centrifuge the purification column in the provided collection tube at 16 000 x g for one minute Paradise PIus Reagent System User Guide 12872 00 Rev C 4 3 Protocol Ta Using the amounts indicated in the table below a Pipette the Binding Buffer BB into the cell extract then r gt JZE AHSA and down b Pipette the Ethanol Solution EtOH into the cell extract then mix well by pipetting up and down ble 4 6 Binding so
13. 22 Binding Buffer DB NOTE DNA Binding Buffer DB must be at room temperature and thoroughly mixed before use A precipitate may form during long term storage Dissolve precipitate by mixing If necessary warm the DB vial to re dissolve 2 Add 200 pL of DB to the 2 4 Strand Synthesis sample tube mix well and pipette the entire volume into the purification column 3 To bind cDNA centrifuge at 100 x g or lowest speed setting available for two minutes immediately followed by a centrifugation at 10 000 x g for 1 minute to remove flow through 4 Add 250 pL of DNA Wash Buffer DW to the column and centrifuge at 16 000 x g for two minutes Check the purification column for any residual wash buffer If any wash buffer remains re centrifuge at 16 000 x g for one minute DNA DW wis BUFFER Sio t laps Room Temp Analytical Technologies Figure 5 23 Wash Buffer DW NOTE Avoid splashing flow through in the collection tube onto the column If flow through waste liquid wets the outside of the purification column re centrifuge the column at16 000 x g to remove liquid 5 Discard the collection tube and flow through 6 Place the column into the provided 0 5 mL microcentrifuge tube and carefully add 11 uL of DNA Elution Buffer DE onto the center of the purification column membrane Gently touch the tip of the pipette to the surface of the membrane while dispensing DE to ensure maximum absorption of DE into the membrane Gentl
14. DNase Treatment Wash 2 Elute Total RNA Figure 4 1 Paradise PlUS Reagent System RNA Extraction Isolation procedure Refer to the instrument User Guide for complete instructions Paradise PIus Reagent System User Guide 12872 00 Rev C 4 3 Protocol b Add 300 pL of Reconstitution Buffer to vial of dried Pro K Mix 600 ug tube Dissolve completely by gently vortexing the tube to mix th tube on ice immediately Excessive mixing may denature Pi gt JAE WO EAE Pro K Mix is adequate for 12 extractions All mixed proteinase K solution should be used within one workday up to 12 hours Discard any mixed Proteinase K solution that is not used within one day 2 Pipette 50pL of mixed Proteinase K Extraction Solution into a 0 5 ml extraction tube not provided Cap Insertion Tool e CapSure LCM Cap m Microcentrifuge 9 Tube Ue Proteinase K Extraction Solution as quickly as possible following reconstitution Discard any unused Proteinase Ksolution Figure 4 2 Proteinase K Extraction Solution 3 Insert the CapSure Macro LCM Cap with LCM captured cells into the microcentrifuge tube using the LCM Cap Insertion Tool 4 Invert the extraction tube with the inserted CapSure Macro LCM Cap and shake down the 50 pL volume of Proteinase K Extraction solution until it completely covers the inside surface of the CapSure Macro LCM Cap 5 Incubate at 37 C for the correct time period according to the following table
15. Discard flow through Place the column back into the same collection tube Centrifuge at 13200 rpm for an additional 2 minutes to remove residual wash solution Place the column into a clean 2 ml microcentrifuge tube Add 50 pL of nuclease free water pH 8 5 directly onto the column membrane Incubate for 3 5 minutes and then centrifuge at maximum speed for 1 minute If the column still shows residual probe add another 30 pL of nuclease free water pH 8 5 directly onto the column membrane incubate for 1 minute and centrifuge at maximum speed for 1 minute NOTE After centrifuging make sure that the entire sample has passed through the column and that the column is completely dry If not centrifuge for an additional 1 minute at 6000 rpm When dry the column will be visibly pink Cy3 or blue Cy5 if the reaction was successful NOTE If the labeling reaction was successful the eluate should be visibly pink Cy3 or blue Cy5 in color GENERATION OF TEMPLATE FOR ORT PCR The aRNA generated using the Paradise 2 Reagent System RNA Amplification reagents can be used in reactions measuring relative gene expression using quantitative PCR methods Paradise Plus Reagent System User Guide 12872 00 Rev C 59 A Applications of aRNA The amplification process generates product from the 3 end of the mRNA For best results use qRT PCR primer sets designed within the first 300 ba D TAG RAR The following protocol ma
16. Thaw IVT Buffer Blue 1 Master Mix Blue 2 and Enhancer Yellow to room temperature and thoroughly mix to dissolve all solids IVT Enzyme Mix Blue 3 does not require thawing and can be put directly 4 8 C Mix enzyme thoroughly by inverting several times Spin briefly NT VT Paradise Plus E enuancer INT 2 1 BUFFER MASTER MIX ENZYME MIX Steve at Soret Store at Store st IPC 10 200 aps 19C 10 20 APC 10 300 DS MPCI 30C Analytical Tececlogies Figure 5 12 Blue 1 Blue 2 Blue 3 and Yellow E NOTE IVT reaction components must be thawed thoroughly mixed with all solids dissolved and brought to room temperature just before use 2 Add IVT components in the order listed in the following table If you are performing several amplifications you may wish to prepare a Complete IVT Reaction Mix according to the following table and add 12 pL Complete IVT Reaction Mix to each sample Mix thoroughly by flicking the tube and spin down Paradise Plus Reagent System User Guide 12872 00 Rev C 43 5 RNA Amplification Table 5 12 Complete IVT Reaction Mix 6 reaction I JAE AARRE Component Amount uL Vial 10 overage L IVT Buffer 2 Blue 1 13 2 IVT Master Mix 6 Blue 2 39 6 IVT Enzyme Mix 2 Blue 3 13 2 Enhancer 2 Yellow E 13 2 Total per sample 12 79 2 3 Incubate at 42 C for 8 hours Chill the sample s to 4 8 C D At this point in the protocol you may hold the reaction mix
17. accurate measurement of RNA quantity of FFPE samples NOTE For maximum stability store the frozen reagents at 70 C or below until used After use storage at 20 C is recommended PRELIMINARY STEPS MATERIAL AND PROTOCOL REVIEW To get the most from your amplification reagents take a few moments to examine the components of the kit and read the information in the following sections OVERVIEW The Paradise PS Reagent System RNA Amplification reagents are optimized to amplify formalin fixed RNA The reagents utilize two rounds of a five step process for linear amplification of the mRNA fraction of total cellular RNA a first strand synthesis reaction that yields cDNA incorporating a T7 promoter sequence b second strand synthesis reaction utilizing exogenous primers that yields double stranded cDNA c cDNA purification using specially designed MiraCol Purification Columns d in vitro transcription IVT utilizing T7 RNA polymerase yields antisense RNA aRNA and e aRNA isolation with the MiraCol Purification Columns To save time in vitro transcription may be performed overnight with the proper thermal cycler programming Paradise Plus Reagent System User Guide 12872 00 Rev C 31 32 5 RNA Amplification 5 2 3 ROUND Total Cellular RNA ONE Wy VALL mRNA specific Y 1st Strand Synthesis 1st Primer cDNA TTITTTITTT Exogenous Vit USE 2nd Strand Synthesis ds cDNA i MiraCol cDNA Purificat
18. columns are tested by lot to confirm the absence of nucleic acids and nuclease activity Column nucleic acid binding and recovery performance must meet quality standards Visual Inspection Finished kits are inspected for proper assembly Challenges of FFPE Tissue MDS Analytical Technologies strongly recommends performing quality assessment of FFPE samples Tissue that has degraded RNA prior to fixation will not yield good results nor will samples that have been over fixed If the quality of the source tissue is unknown then performing a quality assessment of the tissue block prior to spending the time and expense of Laser Capture and amplification is imperative The amplification process generates product from the 3 end of the mRNA For best results use qRT PCR primer sets designed within the first 300 bases from the poly A tail Expiration All reagents included with the system should be used within six 6 months of receipt Paradise Plus Reagent System User Guide 12872 00 Rev C Questions Phone 1 800 635 5577 A1 408 747 1700 D IRENA Fax 1 408 747 3603 Web www moleculardevices com For additional offices please see the contact information on the back cover of this User Guide Paradise Plus Reagent System User Guide 12872 00 Rev C Cantante D 2er Introduction Backereuntiu vig edd E CHE EEEE dade ded dee ACE ee hee eee 1 Performance Specifications ceened ui ese Det bg sta cou dono diu Dog ac 2 Master
19. milxeS eriin eme un bose go G5 GP Gu Ra a EEEN EERE ERG Ra aus 2 RNA Input Requirements 2 2 Stot pe and Stability drm 3 Material Safety and Data Sheet MSDS 54 esc ses eee EROR ERROR boda edd d s 3 Related Arcturus PHOQUCSa cn sate Gas ames toe o o eie aD yati s e daa 4 Additional Equipment and Materials Required 54448 eee ede wad een 5 Recommendations for Nuclease free Technique 7 Configurations Kit Components ices cies ee ree ke Reg RH Rob Ra OR dee OR CUR a ee dog e P ene 9 Sample Preparation and Staining Components rU 13 Reagents and Supplies iris sce eer sets sde ere tob do eda db doe icd 13 Preliminary SUR a da eeedses dover edes a ede ee asia n e keen do 13 Material and Protocol Review a pie eX ra dC E CURIE PER Hg 13 ln C M 14 Slide Prep rati i FPE need e br ie En a Ea Adobe ce keene 14 Deparaffinization Staining and Dehydration 15 RNA Extraction Isolation COMPONRENES 0 cesse sane eens ct sde ce dent em ele baw es 17 Reagents and Supplies sus Cbr cotes Eod pa S CR te des imite ed 17 Preliminary Steps ees Sead eke ea cae eras db God tiia eoe dod aeter DDR 18 Material and Protocol Review ids se ns ay Dee e ok Pa C RR M et 18 Protocol bae ER Rois ies Kopi aids t deba pide pibe 18 Protocol For Use with Capsure Macro LCM Caps sese eee ee 18 Protocol For Use with Capsure HS LCM Caps
20. reagents and protocol tested to ensure complete extraction of DNA from LCM samples prepared with any standard tissue preparation procedure DNA prepared using the kit is PCR ready and needs no additional purification to perform amplification KITO103 150 HS cap or 30 Macro cap extractions RiboAmp Plus RNA Amplification Kit The RiboAmp Plus RNA Amplification Kit enables the production of microgram quantities of antisense RNA aRNA from as little as picogram quantities of total cellular RNA Amplified RNA produced using the kit is suitable for labeling and use for probing expression microarrays The kit achieves amplifications of 1 000 3 000 fold in one round of amplification and amplifications of up to 1 000 000 fold in two rounds The kits include microarray labeling options such as biotin fluorescent dyes and amino allyl Kits Paradise Plus Reagent System User Guide 12872 00 Rev C D WAG AAR 1 8 Additional Equipment and Materials Required 1 8 are available in two sensitivity options RiboAmp Plus 5 40 ng and a high sensitivity version RiboAmp HS Plus 0 1 5 ng i D IZEARA KITO521 RiboAmp US 12 1 round amplifications or 6 2 rou eee KITO525 RiboAmp HS PUS 6 2 round amplifications Paradise P S Whole Transcript Reverse Transcription WT RT Reagent System The Paradise PLUS WI RT reagent system was developed specifically to overcome obstacles such as chemical modification and fragme
21. with Component Amount pL Vial 10 overage uL Enhancer 2 Yellow E 13 2 15t Strand Master Mix 5 Red 1 33 0 15t Strand Enzyme Mix 1 Red 2 6 6 SuperScript Ill Enzyme 1 6 6 Total per sample 9 59 4 Not included in the kit 7 Incubate at 42 C for 1 5 hours then chill the sample to 4 8 C for at least one minute Do not hold samples at this step for a prolonged period of time Keep samples at 4 8 C while creating the standard curve Creating the Standard Curve Using the cDNA generated from the 100 ng of Universal Human Reference RNA create other standard curve points from subsequent serial dilutions Use the following guidelines gt The standard curve should consist of four standard points gt 100 ng 10 ng 1 ng and 0 1 ng per reverse transcription input of total RNA gt Use 10 ng uL Poly I as the diluent gt Perform the serial dilutions as illustrated below 64 Paradise Plus Reagent System User Guide 12872 00 Rev C 100 ng 10 ng lng 0 1 ng RT Reaction Mix gt cDNA dilutions for Real Time cDNA PCR Standard Curve D WAG RAR Figure B 2 cDNA dilutions for Real Time PCR Standard Curve gt Store the unused volume of 100 ng cDNA at 65 to 80 C for use in creating subsequent standard curves NOTE Set up one AT reaction for each testing samples one for the blank and one for the uRNA standard NOTE Use 10 0 uL of testing samples 1
22. 0 Standard curve 1355 Use the uRNA equivalent from 1650 primer set to estimate the RNA quantity use the ratio of RNA 1650 RNA 1355 to estimate the RNA quality Interpreting the Results The RNA concentration using the 3 Primer Set is the quantity of the sample RNA The ratio of 3 5 is obtained for each sample using the corresponding RNA concentration Table B 10 Example of results Primer Ct Quantity Primer Ct Quantity 3 5 Ratio 1355 1472 28 70 0 09 1650 1717 23 80 2 56 30 12 1355 1472 27 80 0 16 1650 1717 23 90 2 32 14 50 1355 1472 23 60 3 50 1650 1717 20 10 35 37 10 11 1355 1472 21 00 22 50 1650 1717 19 50 57 70 2 56 NOTE The 3 5 ratio is the ratio of the quantities of each Primer Set For example in Sample 1 the ratio is equal to 30 12 this is derived from 2 56 0 085 Paradise Plus Reagent System User Guide 12872 00 Rev C 69 B Sample Assessment Protocol Explanation of results The 3 5 ratio evaluates the abundance of the average fi actin cD R primer 1650 1717 compared to the abundance is relatively 5 TAG VARIA 1472 using the quantified PCR yields of each amplicon If most of the cDNA contains both the 3 and 5 sequence target the ratio of the PCR product for 3 5 is close to 1 As the RNA from FFPE samples starts exhibiting some level of degradation the 3 5 ratio tends to become greater than 1 Depending on the ratio an estimatio
23. 0 0 ul of water for a blank tube and 10 0 uL of the uRNA standard NOTE Many real time PCR instrument systems utilize similar technology We provide protocols for the ABI PRISM 7900HT and the Light Cycler Modification to these protocols for other real time platforms can be made according to the manufacturers recommendations Protocol 1 Following the RT reaction serially dilute the uRNA control for use as a standard curve The cDNA generated from the 100 ng of Universal Human Reference RNA Stratagene PN 740000 see above is used as the highest template mass point for the standard curve Therefore the 100 ng sample represents 10096 of the reverse transcription product 2 Setup the PCR reactions following the steps below for the instrument you are using ABI PRISM 7900HT e Roche Light Cycler For ABI PRISM 7900HT 1 Prepare the PCR reactions per the table below combine the PCR master mix components in a clean nuclease free microcentrifuge tube To determine the total amount of PCR master mix required multiply the amount of each component by the number of reactions you are performing n plus one n 1 Paradise Plus Reagent System User Guide 12872 00 Rev C 65 B Sample Assessment Protocol Table B 5 For the 3 R actin Primers Amount for Each D DAE NAAR Component Volume pL a Final Conc SYBR Green PCR Master Mix 10 Uracil DNA Glycosylase 0 5 3 R actin Forward Primer 50 uM
24. 3 5 minutes at 65 C Cool on ice 5 Prepare IX RNA MOPS Running Buffer and fill gel electrophoresis unit Place agarose gel into the unit Paradise PIus Reagent System User Guide 12872 00 Rev C 77 78 D aRNA Analysis Load 12 pL of sample per well of the agarose gel Include RNA Ladder in one or more lanes D 2e TARA Stain the gel with SYBR Gold Nucleic Acid Gel Stain for 30 minutes or according to the protocol supplied with the reagent Alternatively stain with Ethidium Bromide 0 5 1 0 pg mL Electrophorese at 5 7 volts per centimeter for 30 minutes Visualize the gel on a UV transilluminator The size of the aRNA ranges from 200 to 2000 bases in length Paradise Plus Reagent System User Guide 12872 00 Rev C D WAG RAR E Generation of Labeled aRNA Using Alternative IVT Kits The Paradise Pl Kits can be used with alternative IVT labeling such as Affymetrix labeling kit 900449 to yield suitable RNA sample for hybridizing to GeneChip Probe Arrays as described below These kit reagents and protocol are substituted during the second IVT reaction of the Paradise P 5 Kit protocol Labeled aRNA is subsequently purified with the Paradise Plus Kit and MiraCol Purification Columns as described below 1 Perform Round One of amplification according to the Paradise Plus Amplification Kit protocol starting from the recommended input for the kit It is not recommended to use the minimum input amount
25. 5 minutes Centrifuge at 16 000 x g for one minute 2 Add 225 pL of RB to the transcript labeling reaction sample and mix thoroughly Pipette the entire sample volume into the purification column 72 Paradise Plus Reagent System User Guide 12872 00 Rev C RB 7 D einat BUFFER Store at eps Room Temp Analytical Techecloges Figure C 3 RNA Binding Buffer Centrifuge at 100 x g or lowest speed setting available for 2 minutes immediately followed by a centrifugation at 10 000 x g for 1 minute NOTE Do not use re suspended dye that is over 2 days old DMSO is hygroscopic Store tightly capped NOTE To obtain 15 ug of aRNA in 7 5uL you may dry down 15ug of aRNA and re suspend in 7 5 uL of nuclease free water or concentrate the aRNA to 2 ug uL and use 7 5 uL of the sample NOTE Do not allow the samples to incubate longer than 1 hour Use reagents supplied in the Labeling Purification Reagents box Discard flow through Place the column into the same collection tube Add 250 pL of RNA Wash Buffer RW to the purification column and centrifuge at 10 000 x g for 1 minute RNA RW wasu BUFFER Store at ADS Room Temp Analytical Technologies Figure C 4 RNA Wash Buffer Repeat Step 5 Add 250 pL of fresh RW to the column and centrifuge at 16 000 x g full speed for 2 minutes Check the purification column for any residual wash buffer If any wash buffer remains re centrifuge at 16 000 x g for one m
26. 7 C for the correct time period according to the following table Paradise PIus Reagent System User Guide 12872 00 Rev C 4 3 Protocol Table 4 4 RNA Incubation Times Samples Age Incubation Tin JAE Auf PUE Samples 3 years old 16 hours Samples 3 years old 5 hours For complete extraction this time can be increased to 16 hours NOTE If multiple LCM captures are performed it is recommended that each cap be incubated in Pro K Mix immediately after collection Caps may be incubated up to 24 hours 6 Centrifuge the microcentrifuge tube with the CapSure ExtracSure assembly at 800 x g for two minutes to collect cell extract into the tube 7 After centrifugation the microcentrifuge tube contains the cell extract required to complete the protocol Remove the microcentrifuge tube from the CapSure ExtracSure assembly and save the microcentrifuge tube with the cell extract in it 8 Proceed with RNA isolation protocol or freeze cell extract at 70 C It is okay to stop at this point in the protocol RNA Isolation 1 Pre condition the MiraCol Purification Column as follows a Pipette 200 pL Conditioning Buffer CB onto the purification column filter membrane b Incubate the purification column with Conditioning Buffer for 5 minutes at room temperature c Centrifuge the purification column in the provided collection tube at 16 000 x g for one minute 2 Pipette 11 pL of Paradise Plus Reagen
27. Cycler Program Round 1 D DAE NARHA C Time 15 Strand Synthesis 70 Thour 4 hold 42 1 5 hour 4 hold 37 30 minutes 95 5 minutes 4 hold 2 d Strand Synthesis 95 2 minutes 4 hold 25 10 minutes 37 30 minutes 70 5 minutes 4 hold IVT 42 8 hours 4 hold optional overnight hold 37 15 minutes 4 hold Paradise Plus Reagent System User Guide 12872 00 Rev C 33 5 RNA Amplification Table 5 8 Paradise P S Thermal Cycler Program Round 2 D 3Aat tonmateat C Time 18 Strand Synthesis 70 5 minutes 4 Hold 25 10 minutes 37 1 5 hour 4 Hold 2 d Strand Synthesis 95 5 minutes 4 Hold 37 30 minutes 70 5 minutes 4 Hold IVT 42 8 hours 4 hold optional overnight hold 37 15 minutes 4 Hold NOTE Using a thermal cycler with a heated lid is important The heated lid ensures proper temperature distribution within the reaction tube and prevents evaporative condensation that alters the reaction mixture concentrations 5 2 4 TIME REQUIREMENTS The table below presents typical time requirements for completion of the protocol Times reflect total handling and reaction times of each step Note that there are safe stopping points for pausing the amplification process and the times presented reflect a continuous uninterrupted process Paradise Plus Reagent System User Guide 12872 00 Rev C 5 2 Preliminary Ste
28. Dehydration segment of the protocol in a fume hood Wear clean disposable gloves NOTE Xylene jar a must be changed after processing up to a maximum of 4 slides NOTE 75 Ethanol jar e must be changed after processing up to a maximum of 4 slides Staining times may vary depending on tissue types Performing Laser Capture Microdissection LCM NOTE Please consult the User Guide for the instrument you will use for detailed instructions Paradise Plus Reagent System User Guide 12872 00 Rev C 4 1 4 1 1 D IZEIA 4 RNA Extraction lsolation COMPONENTS REAGENTS AND SUPPLIES The Paradise Plus Reagent System RNA Extraction Isolation components include the following items Table 4 1 Paradise Extraction Room Temperature RA7001 Component Vial Color Vial Label Extraction Conditioning Buffer Blue CB Extraction Ethanol Solution Blue EtOH Extraction Wash Buffer 1 Blue w1 Extraction Wash Buffer 2 Blue W2 Extraction Elution Buffer Blue EB Extraction Binding Buffer Blue BB Pro k Reconstitution Buffer Pro K 0 5 mL Microcentrifuge Tubes Purification columns Table 4 2 Paradise Extraction Frozen RA7007 Component Vial Color Vial Label DNase Buffer Blue DNB DNase Mix Blue DNase Paradise Plus Reagent System User Guide 12872 00 Rev C 17 18 4 RNA Extraction Isolation 4 2 4 2 1 4 3 4 3 1 PRELIMINARY STEPS
29. LightCycler DNA SYBR Green kit Roche 2158817 BD Taqstart Antibody BD Clontech 639251 Paradise Plus Reagent System User Guide 12872 00 Rev C IMPORTANT Depending on the exact model of the real time PCR instrument the protocol may vary Provided are protocols for the ABI PRISM 7900 HT System and the Roche LightCycler VAEVVAA BERI ZA Protocol Extraction Follow the protocol detailed in Section 4 3 3 Tissue Scrape Protocol of this user guide Quantitate the concentration of the RNA extracted see Appendix F aRNA Yield and Purity Determination Reverse Transcription Your experimental design should include gt 100 200 ng of each sample gt 100 ng of universal reference RNA Stratagene cat 740000 to be used later as a standard curve for qRI PCR NOTE Itis not necessary to run the control that comes with the kit That control RNA is an amplification control and is not of high enough concentration for the standard curve NOTE This is the same procedure as Section 5 3 1 Paradise Plus Round one 1 strand cDNA synthesis of this user guide NOTE Head all Detailed Protocol notes in Chapter 5 prior to beginning this procedure 1 Prepare each 100 200 ng RNA sample in a total volume of 10 11 pL in a 0 5 mL or 0 2 mL RNase free microcentrifuge tube and place on 4 8 C block 2 Thaw Primer 1 Gray 1 thoroughly mix and spin down 3 Add 1 0 pL of Primer 1 mix thoroughly by flicking the tu
30. MATERIAL AND PROTOCOL REVIEW To get the most from your extraction reagents take a few momen D DAE NIRA components of the kit and read the information in the following sections Overview Separate protocols are provided for extraction isolation of RNA from Microdissected samples using CapSure LCM Macro caps gt Microdissected samples using CapSure LCM HS caps or gt Tissue scrapes 0 5 cm x 0 5 cm The flow chart illustrates the Paradise PS Reagent System RNA Extraction Isolation procedure 1 Extract RNA from a CapSure LCM Cap or tissue scrape 2 Mix and load cell extract onto a preconditioned purification column 3 Spin the extract through the column to capture RNA on the purification column membrane Wash DNase treat and wash again Wash the column twice with wash buffer and nN of A Elute the RNA in low ionic strength buffer The entire isolation process including incubations can be completed in less than an hour and the isolated total cellular RNA is ready for use in downstream applications The Paradise Plus Reagent System RNA Extraction Isolation reagents are capable of isolating small amounts of RNA It is important not to introduce nucleic acid contamination PROTOCOL PROTOCOL FOR USE WITH CAPSURE MACRO LCM CAPS RNA Extraction 1 Dispense Pro K Mix and incubate as follows a Capture cells using the CapSure Macro Cap Total Prepare Cellular Purification Extract Column
31. NDS Analytical Technologies D 12e TARA Arcturus Paradise PLUS Reagent System FFPE TISSUE STAINING EXTRACTION ISOLATION AMPLIFICATION AND MICROARRAY LABELING IN ONE CONVENIENT KIT Q validation PERFORM GENE EXPRESSION EXPERIMENTS USING ARCHIVED TISSUE BLOCKS UTILIZE MICROARRAYS OR QRT PCR FROM AS LITTLE AS 5 NG OF RNA FROM FFPE MATERIAL REDUCE COST AND SAVE TIME BY PRE QUALIFYING SAMPLES WITH THE QUALITY ASSESMENT KIT USE SAMPLES PREPARED FROM A VARIETY OF FIXATION PROTOCOLS WORK DIRECTLY WITH APPLICATION SPECIALISTS DEDICATED TO YOUR SUCCESS e integrated The Paradise PLUS reagent system from MDS Analytical Technologies Arcturus microgenomics product line enables unprecedented gene expression analysis of formalin fixed paraffin embedded FFPE samples Using the ParadisePLUS reagent system researchers can now measure whole gene expression profiles in these previously inaccessible samples using either microarray or quantitative real time PCR QRT PCR analysis THE ONLY COMPLETE SYSTEM FOR FORMALIN FIXED SAMPLES The ParadisePLUS reagent system provides all the components necessary to prepare RNA from FFPE tissue samples for gene expression analysis To ensure successful microarray results the system includes reagents optimized for exceptional recovery of RNA the most sensitive RNA amplification available and highly efficient RNA labeling labor saving The ParadisePLUS reage
32. RA7001 RA7018 RA7011 RA7008 solvents Arcturus Paradise PIUS 1 5 KIT0321 NS 6 x 1x 1x 1x 1x 1x 1x x x Round 12 ext iso 6 amp No RA7014 RA7007 RA7001 RA7018 RA7011 RA7008 solvents Arcturus Paradise PUS 1 5 KIT0301 48 2x 4x 4x 4x 8x 8x 8x x x Round Bulk 48 reactions RA7013 RA7014 RA7007 RA7001 RA7018 RA7011 RA7008 Arcturus Paradise PlUS 2 round KIT0312 12 1x 1x 1x 1x 2x 2x 2x x x 12 reactions RA7013 RA7014 RA7007 RA7001 RA7018 RA7011 RA7009 Arcturus Paradise PlUS 2 Round KIT0312B 12 1x 1x 1x 1x 2x 2x 2x x 1x with Biotin Labeling 12 RA7013 RA7014 RA7007 RA7001 RA7018 RA7011 RA7009 KITO608 reactions Arcturus Paradise PUS 2 Round KITO312C 12 1x 1x 1x 1x 2x 2x 2x x 1x with Cy3 Labeling 12 reactions RA7013 RA7014 RA7007 RA7001 RA7018 RA7011 RA7009 KITO609 Arcturus Paradise PlUS 2 Round KIT0312D 12 1x 1x 1x 1x 2x 2x 2x x 1x with Cy5 Labeling 12 reactions RA7013 RA7014 RA7007 RA7001 RA7018 RA7011 RA7009 KITO610 Arcturus Paradise PlUS 2 Round KITO322 6 1x 1x 1x 1x 1x 1x 1x x x 12 ext iso 6 amp RA7013 RA7014 RA7007 RA7001 RA7018 RA7011 RA7009 Paradise Plus Reagent System User Guide 12872 00 Rev C 9 10 2 Configurations Paradise P S Kit Configurations with Catalog Solvents Stain Extraction Amp
33. ROPLATE READERS WITH ABSORBANCE MODE AND PATHCHECK SENSOR Introduction This protocol describes how to measure RNA concentration using a 96 well UV clear microplate e g Corning P N 3635 and SpectraMax microplate reader featuring the PathCheck sensor The PathCheck sensor measures the pathlength in each well of the microplate and normalizes absorbance values to a 1 cm pathlength so that they are the same as values obtained in a 1 cm cuvette Please note that some SpectraMax microplate readers are equipped with a cuvette port See the user guide for your instrument for details on use of the cuvette port Method Dilute RNA in RNase free water A total of 200 pL well of diluted RNA will be used for quantitation and diluting the sample more than 1 100 is not recommended Prepare additional diluted sample if multiple wells are desired for analysis Reading samples in triplicate is recommended Pipette samples into a 96 well UV transparent microplate include a set of wells containing 200 pL of RNase free water as blanks Assuming that all well volumes are identical and that all samples are blanked with the same solution water use the following method to subtract background OD due to the microplate itself 1 In the template editor select three or more wells in the microplate to contain the blanking solution typically water Assign the appropriate wells as Blank Designate the appropriate wells as Samples and enter the dilution fa
34. Rotation Figure E 4 Centrifuge 11 Measure the O D of the product at A260 and A280 to determine the yield of labeled aRNA Perform electrophoretic analysis if necessary 12 Proceed to protocols for microarray hybridization Paradise Plus Reagent System User Guide 12872 00 Rev C 81 82 E Generation of Labeled aRNA Using Alternative IVT Kits Paradise Plus Reagent System User Guide 12872 00 Rev C D WAG RHA D TAG AAR F Cleaning the Staining Jars The staining jars can be reused but must be cleaned Rinse jars with 100 ethanol followed by distilled water then treat with RNase AWAY according to the manufacturer s protocol Rinse jars thoroughly with nuclease free water and allow to dry completely in the hood Do not use reservoirs to store solutions Paradise Plus Reagent System User Guide 12872 00 Rev C 83 84 F Cleaning the Staining Jars Paradise Plus Reagent System User Guide 12872 00 Rev C D DAE NARHA D DAE NIAAA G Centrifuge Information The table below shows corresponding centrifugal forces g for selected rotations per minute rpm when working with the tabletop microcentrifuge Eppendorf 5415D Table G 1 Centrifugal Forces g Rotations Per Minute rpm Centrifugal Force g 14 000 13 000 12 000 10 000 10 000 7 000 8 000 4 500 5 500 2 200 5 000 2 000 Paradise Plus Reagent System User Guide 12872 00 Rev C 85
35. User Guide 12872 00 Rev C Paradise Plus Reagent System User Guide 12872 00 Rev C D 12e THAT 1 1 D TAG AAR 1 Introduction BACKGROUND The Paradise Plus Reagent System provides an integrated system enabling gene expression studies using Formalin Fixed Paraffin Embedded tissue FFPE Components provided include gt Sample preparation and staining reagents gt RNA extraction and isolation reagents gt RNA amplification reagents The Paradise components have been optimized to work together as a system Alternative components have not been tested and may lead sub optimal results This user guide is divided into sections describing the steps involved using staining extraction isolation and amplification separately To get the most out of the Paradise lus Reagent System please examine the components and read each section of the user guide carefully A principal application of this kit is use in conjunction with Laser Capture Microdissection LCM LCM experiments often involve the analysis of gene expression patterns in cells captured from specimens Obtaining accurate results from gene expression analysis experiments including microarray hybridization and quantitative PCR depends on careful preservation of intact RNA molecules in captured cells Staining The Paradise Reagent System Staining components are part of a series of LCM certified LCM analysis products for preparing and staining tissues whil
36. User Guide the following user guides may be helpful references ArcturusXT Veritas AutoPix or PixCell LCM System User Guide Turbo Labeling kit user guide CapSure HS Caps User Guide Quality Control MDS Analytical Technologies performs functional testing on all components of the Paradise Plus Reagent System The information sheet provided with the system highlights the tests performed Staining MDS Analytical Technologies performs functional testing on the Paradise Plus Reagent System staining components to confirm the absence of nucleic acids and nuclease activity The staining components are functionally tested using LCM to ensure proper dehydration and that good quality RNA is recoverable Extraction Isolation MDS Analytical Technologies performs functional testing on the Paradise Plus Reagent System RNA Extraction Isolation using all components MiraCol Purification Columns are tested by lot to confirm the absence of nucleic acids and nuclease activity Column nucleic acid binding and recovery performance must meet quality standards Amplification Functional Testing MDS Analytical Technologies performs functional testing on each lot of materials using the amplification protocol described in this manual Reagent Testing MDS Analytical Technologies tests each lot of enzymes to confirm activity Buffer components must perform correctly under reaction or nucleic acid purification conditions Purification Column Testing Purification
37. Xylene for 3 minutes Invert the jar gently three or four times IMPORTANT Jar A Xylene must be changed after processing up to a maximum of four slides 6 Transfer the slides to jar B Xylene for 3 minutes Invert the jar gently three or four times 7 Transfer the slides to jar C Xylene for 3 minutes Invert the jar gently three or four times 8 Hold the slides in jar C Xylene until ready to perform tissue scrape IMPORTANT 7he minimum incubation in xylene should be 3 minutes up to a maximum of 2 hours Paradise Plus Reagent System User Guide 12872 00 Rev C 25 26 4 RNA Extraction Isolation 9 When ready to perform tissue scrape remove the slides from the xylene then dry in a fume hood for 5 10 minutes z D IAEA IMPORTANT Perform RNA extraction and isolation within 2 1 slides from the xylene 10 Repeat steps 3 through 9 for any remaining slides 11 Discard the used xylene according to standard procedures and then clean the jars following the procedure Appendix F Cleaning the Staining Jars 12 Proceed to RNA extraction and isolation Scrape and RNA Extraction 1 5 Add 300 pL of Reconstitution Buffer to vial of dried Pro K Mix 600 pg tube Dissolve completely by gently vortexing the tube to mix the reagents and place the tube on ice immediately Excessive mixing may denature Proteinase K Pipette enough Pro K solution to cover entire tissue section 25 pL 50 pL 75 pL 100 uL or
38. acent in the clockwise direction to the last assembly 4 3 2 PROTOCOL FOR USE WITH CAPSURE HS LCM CAPS RNA Extraction 1 Dispense Pro K Mix and incubate as follows a Capture cells and assemble the CapSure HS Cap with the ExtracSure Extraction Device Refer to the CapSure HS Caps User Guide for complete instructions Paradise Plus Reagent System User Guide 12872 00 Rev C 21 22 4 RNA Extraction Isolation b Add 300 pL of Reconstitution Buffer to vial of dried Pro K Mix 600 ug tube Dissolve completely by gently vortexing the tube to mix th tube on ice immediately Excessive mixing may denature Pi gt JAE VAAL Pro K Mix is adequate for 60 extractions All mixed proteinase K solution should be used within one work day up to 12 hours The remaining unmixed Reconstitution Buffer should be stored at 20 C Discard any mixed Proteinase K solution that is not used within one day 2 Place the CapSure ExtracSure assembly in a CapSure HS Alignment Tray and pipette 10 pL Pro K Mix solution into the buffer well Place pipette tip down to the film surface to avoid trapping a bubble Pipettor Tip ExtracSure Sample Extraction Device Figure 4 4 CapSure HS Alignment Tray 3 Place a new 0 5 ml extraction tube not provided onto the CapSure ExtracSure assembly see CapSure HS Caps User Guide for more details about assembly 4 Cover with Incubation Block Figure 4 5 Incubation Block 5 Incubate at 3
39. anada MDS Analytical Technologies Tel 1 800 635 5577 Fax 1 408 747 3601 Australia The ParadisePLUS reagent system includes reagents for sample preparation tissue staining RNA extraction isolation RNA amplification and microarray labeling ParadisePLUS Reagent System Part Number KIT0312 12 two round reactions ParadisePLUS Reagent System with Biotin Labeling Part Number KIT0312B 12 two round reactions ParadisePLUS Reagent System with Cy3 Labeling Part Number KIT0312C 12 two round reactions ParadisePLUS Reagent System with Cy5 Labeling Part Number KIT0312D 12 two round reactions ParadisePLUS Reagent System with Amino Allyl Labeling Part Number KIT0314 12 two round reactions ParadisePLUS Reagent System for Quantitative Real Time PCR Part Number KIT0310 12 one round reactions ParadisePLUS Reagent System for Quality Assessment of FFPE Block QC Kit Part Number KIT0313 12 reactions United Kingdom MDS Analytical Technologies Ltd Tel 44 118 944 8000 Fax 44 118 944 8001 www moleculardevices com JAE NAAT ParadisePLUS Whole Transcript RT Reagent System Part Number KIT0315 12 reactions Note Many other configurations available customized for your research needs Turbo Labeling Biotin Kit Part Number KIT0608 Microarray labeling kit Turbo Labeling Cy3 Kit Part Number KIT0609 Microarray labeling kit Turbo Labeling Cy5 Kit Part Number KIT0610 Mi
40. ation provides efficient reproducible results through protocols reagents and nucleic acid purification technology using MDS Analytical Technologies MiraCol Purification Columns The Paradise RNA Amplification reagents can amplify total cellular RNA to generate sufficient aRNA ready for use in microarray quantitative real time PCR or other applications PERFORMANCE SPECIFICATIONS The Paradise kits should yield enough amplified RNA aRNA to complete multiple microarray experiments when starting with the recommended amount of starting material from a tissue block which contains good quality RNA MASTER MIXES The Paradise 5 kits are designed with the assumption that master mixes will be made when using three or more samples and will not be used for two or less samples The kits have been designed with a 10 overage for 3 samples Exceeding 10 overage for master mixes may result in insufficient material to complete all reactions A suggested master mix size for six samples is included where appropriate RNA INPUT REQUIREMENTS The Paradise kits are designed and optimized for use with Formalin Fixed Paraffin Embedded tissue samples The amplification kit is designed to for use with an expected total RNA input amount of 5 40 ng The amount of total RNA found in a cell varies by cell type length of fixation age of the sample block and quality of the material prior to fixation Different sources of total RNA contain varying amou
41. be and spin down 4 Incubate at 70 C for 1 hour then chill the samples to 4 8 C for at least one minute Spin down the contents and place on 4 8 C block before proceeding to the next step 5 Place 1 Strand Synthesis components at 4 8 C cold block 1 Strand Master Mix Red 1 and Enhancer Yellow must be thawed thoroughly mixed with all solids dissolved and maintained at 4 8 C until used 1 Strand Enzyme Mix Red 2 and SuperScript enzyme do not require thawing and can be placed directly at 4 8 C Mix enzyme thoroughly by inverting several times Spin briefly Le SuperScript III E ENHANCER Enzyme Paradise Plus 1 1st STRANO Paradise Plus 1st 2 STRAND MASTER MIX ENZYME MIX Store at aps 19C te 200 Analytical Technologies Store at Store at ADS cu DS cwac provided by end user Anabyteal Technologies Analytical Technologies Figure B 1 Red 1 Red 2 Yellow Enhancer and SuperScript Ill Enzyme Paradise PIuS Reagent System User Guide 12872 00 Rev C 63 B Sample Assessment Protocol 6 Add 1 Strand Synthesis components in the order listed in the following table If you D WAG ARTA are performing several amplifications you may wish to prepar Synthesis Mix based on the following table and add 9 0 pL C Synthesis Mix to each sample Mix thoroughly by flicking the tube and spin down DO NOT VORTEX Table B 4 Complete 15t Strand Synthesis Mix 6 reaction Master Mix
42. before proceeding Do not allow sections to air dry for longer than 3 hours 1 Prior to starting slide preparation minimize RNase contamination of the equipment by cleaning as follows a Rotary Microtome Remove and discard old disposable microtome blade Use a Kimwipe soaked with RNase Away to wipe down the knife holder Dry holder with a clean Kimwipe Install a new disposable microtome blade into holder b Tissue Floatation Bath Use a Kimwipe soaked with RNase Away to wipe down and clean the interior of the water bath Rinse the interior with Milli Q or RNase free water Fill the water bath with Milli Q or RNase free water Heat water to appropriate temperature for the paraffin used in your laboratory typically 41 C 43 C Do not add any adhesives to the water bath 2 Setcutting thickness to 7 pm on the microtome 3 Place paraffin block into specimen holder Trim off any excess paraffin from the block face Cut and discard the first five sections after trimming 4 From the fresh surface cut 7 um sections from your specimen If you are cutting more than one specimen move to a new section of the blade use gauze soaked in RNase Away to clean blade or use a new disposable blade for each one to avoid cross contamination 5 Remove section s from microtome and float them onto heated water bath Allow section s to flatten Minimize time in water bath to no longer than 2 minutes Mount each section on a room temperature slide 6 Prop
43. cer Yellow to room temperature and thoroughly mix to dissolve all solids IVT Enzyme Mix does not require thawing and can be put directly 4 8 C Mix enzyme thoroughly by inverting several times Spin briefly Paradise PIuS Reagent System User Guide 12872 00 Rev C 51 5 RNA Amplification NOTE IVT reaction components must be thawed thoroughly mixed with all solids dissolved and brought to room temperature just before use D aAEJUCHRSA NT IT Paradise Plus IT E Enhancer 1 BUFFER 2 MASTER MIX 3 ENZYME MIX Store at Seo Store at Store at ADS 1PC 10 20C aps 15C 10 20C DS APC 10 206 ADS APCH I0C Analy Analytical Tececlogies Acht cal Technologies ical Technologies Analytical Technologies Figure 5 26 Normal IVT Blue 1 Blue 2 Blue 3 and Yellow E or INT INT INT Paradise Plus NHAN 1 BUFFER AA AMINO ALLYL ENZYME MIX E ENPANGER MASTER MIX Sore at Soret Store at Store at PC 10 20 BC 0 206 ADS Cuve Analytical Technologies a dre ftical Technolo Analytical Technologies Figure 5 27 Amino Allyl incorporation IVT Blue 1 Light Blue AA Blue 3 and Yellow E 2 Add IVT components in the order listed in the following table If you are performing several amplifications you may wish to prepare a Complete IVT Reaction Mix according to the following table and add 12 pL Complete IVT Reaction Mix to each sample Mix thoroughly by flicking the tube and spin down NOTE IVT reaction components must b
44. cess enzyme and reagents are provided in all vials there is insufficient volume to prepare extra reactions 5 Two IVT Master Mix reagents are provided with kits designed for amino allyl incorporation The amino allyl nucleotide mix should only be used in the second round IVT mix NOTE When making master mixes use only 10 overage per sample to avoid running out of reagent NUCLEIC ACID ELUTION USING SPIN COLUMNS Spin columns and 0 5 ml microcentrifuge tubes are provided for nucleic acid elution Improper orientation of tubes during centrifugation may result in cap breakage or sample loss To correctly use the column tube assembly insert a spin column into the 0 5 ml tube aligning the two cap hinges as illustrated Load Elution Buffer onto the column and incubate as directed Place the column tube assembly into a 2 ml lidless support tube PGC Scientific Catalog 16 8101 06 or similar in the centrifuge rotor alternately retain and reuse the 2 ml lidless collection tubes provided Some varieties of 2 ml tubes will not provide enough support Contact MDS Analytical Technologies Technical Support for other alternatives Skip one rotor position between assemblies and position assemblies with the 0 5 ml tube cap trailing the tube during centrifugation as shown Check for a mark on the centrifuge indicating rotation direction Centrifuge as directed in the protocol Paradise Plus Reagent System User Guide 12872 00 Rev C 5 2 P
45. croarray labeling kit PEN Membrane Frame Slides Part Number LCM0521 50 slides PEN Membrane Glass Slides Part Number LCM0522 50 slides CapSure Macro LCM Caps Part Number LCM0211 48 caps CapSure HS LCM Caps Part Number LCM0214 32 caps MDS Analytical Technologies Pty Ltd Tel 61 3 9896 4700 Fax 61 3 8640 0742 Brazil Molecular Devices Brazil Tel 55 11 3616 6607 Fax 55 11 3871 9994 2008 MDS Analytical Technologies US Inc Printed in U S A 9 08 1K 0120 1431A FOR RESEARCH USE ONLY NOT FOR USE IN DIAGNOSTIC PROCEDURES Specifications subject to change without notice CAPSURE MOLECULAR DEVICES and PARADISE are registered trademarks of MDS Analytical Technologies All other trademarks are the property of their respective owners Polymerase Chain Reaction PCR is a patented process owned by Hoffman La Roche AG MDS Analytical Technologies is the sole manufacturer of Arcturus LCM instruments and microgenomics reagents and sells directly to customers in the United States Canada Australia New Zealand and Brazil Customers in other regions are served by a select group of distributors Visit www moleculardevices com to locate your local representative ISO 9001 2000 D ZE TARA PARADISE PLUS REAGENT SYSTEM User Guide Part of the Arcturus Systems for Microgenomics D Analytical Technologies Science a dvancing health MDS Analytical Technologies Paradise PluS Reagent S
46. ctions RA7007 RA7001 RA7018 Paradise Plus Reagent System User Guide 12872 00 Rev C 2 1 Kit Components NOTE Customers who order KITO313 should follow the sample assessment protocol otuline in Appendix B D DAE NAAR Paradise Plus Reagent System User Guide 12872 00 Rev C 11 12 2 Configurations Paradise Plus Reagent System User Guide 12872 00 Rev C D DAE NARHA D VAG NARA 3 Sample Preparation and Staining 3 1 COMPONENTS 3 1 1 REAGENTS AND SUPPLIES The Paradise Pus Reagent System Staining components include Table 3 1 Staining Solvents RA7013 Component Size 100 Ethanol 0 5L 95 Ethanol 0 5L 75 Ethanol 1L Nuclease free Water 1L Xylene 0 5L Table 3 2 Staining Components RA7014 Component Size Paradise PlUS Stain 6 ml Slide jars 10x 3 2 PRELIMINARY STEPS 3 2 1 MATERIAL AND PROTOCOL REVIEW To get the most from your staining reagents take a few moments to examine the components of the kit and read the information in the following sections Paradise Plus Reagent System User Guide 12872 00 Rev C 13 3 Sample Preparation and Staining 3 3 PROTOCOL 3 3 1 SLIDE PREPARATION gt JZE YA EH NOTE Wear clean disposable gloves throughout the Slide Prepara clean RNase free instruments NOTE Depending on humidity in the environment drying may take longer for the sections to dry The section must be dry
47. ctor 2 Inthe instrument settings dialogue box make sure that the box for PathCheck is checked the Water Constant button is on and the box for Plate Background Constant is not checked 3 Pipette blanks and RNA samples into the appropriate wells of the microplate 4 Read the plate When the plate is read as indicated SoftMax Pro automatically applies PathCheck to all samples and blanks and also subtracts the average of the blanks from each well of the microplate Provided that all sample and blank path lengths are identical potential error from applying path length normalization to ODmicroplate is cancelled out Paradise Plus Reagent System User Guide 12872 00 Rev C 75 76 D aRNA Analysis D 2 D 3 Table D 1 SpectraMax microplate reader settings for RNA quantitation Other instrument settings not listed here should be left on the default D 12e Read Mode Absorbance Wavelengths Lm1 260 nm Lm2 280 nm PathCheck PathCheck box is checked Water Constant button is checked Plate background constants box is not checked Assay Plate Type 96 Well Standard clrbtm Wells To Read or Strips Highlight wells to be read aRNA YIELD AND PURITY DETERMINATION aRNA quantitation by ultraviolet light absorbance is the simplest approach to determining amplification yield An absorbance reading at 260 nm A569 using a spectrophotometer is taken on a diluted aliquot of aRNA Typica
48. d below Table A 2 First Strand Master Mix 1x First Strand Buffer 10 uL 0 1 M DTT 5 uL 25 mM dNTP 1 uL 1 mM dUTP Cy3 or Cy5 2uL 1 mM dTTP 2uL RNAsin 2uL SuperScript II RT 4 uL Total 26 uL Paradise Plus Reagent System User Guide 12872 00 Rev C A 3 Generation of Template for ORT PCR A 3 10 11 12 13 14 15 16 17 18 19 20 21 When incubation is complete mix the tube well by flicking and then briefly spin D TAG RARt down by centrifugation Add 26 pL of the above first stand master mix to each reaction t Mix well by flicking and then briefly spin down by centrifugation Incubate at 27 C for 10 minutes followed by 37 C for 2 hours in the thermal cycler Treat with 2 units of RNase H for 20 minutes at 37 C in the thermal cycler Immediately proceed to PCR product purification using QiaQuick PCR Purification Kit Pre treat the columns placed in collection tube by incubating 100 pL of QiaQuick PB buffer for 5 minutes and then centrifuge at 13200 rpm or full speed on a 5415C Eppendorf Centrifuge for 1 minute Add 260 pL of QiaQuick PB buffer to the sample tube Mix well by flicking and then briefly spin down by centrifugation Load the sample onto the pre treated columns Centrifuge at 6000 rpm for 1 minute Discard flow through Place the column into the same collection tube Wash with 750 pL of QiaQuick PE buffer Centrifuge at 13200 rpm for 1 minute
49. dispensing the elution buffer to ensure maximum absorption of DE into the membrane Gently tap the purification column to distribute the buffer if necessary Incubate for one minute at room temperature ONA D E ELUTION BUFFER Stove ot NDS Room Temp Analytical Techrckogies Figure 5 10 Elution Buffer DE Place the assembly into the centrifuge as shown and centrifuge at 1 000 x g for one minute and then at 16 000 x g for one minute Discard the column and retain the elution containing the cDNA in the microcentrifuge tube for further processing NOTE Avoid splashing flow through in the collection tube onto the column If flow through waste liquid wets the outside of the purification column re centrifuge the column at16 000 x g to remove liquid Paradise Plus Reagent System User Guide 12872 00 Rev C 5 3 Protocol D WAG NAKA Figure 5 11 Centrifuge NOTE To avoid potential breakage of the microcentrifuge tube cap during centrifugation insert the purification tube 0 5 mL tube assembly into a lidless 1 7 2 0 mL tube Insert this assembly into adjacent rotor holes as illustrated Rest the tube cap against the tube immediately clockwise to it Place an empty lidless 1 7 2 0 mL tube into the rotor hole adjacent in the clockwise direction to the last assembly It is safe to stop at this point in the protocol You may store the sample overnight at 20 C 5 3 4 PARADISEG PLUS ROUND ONE IN VITRO TRANSCRIPTION 1
50. e challenges of cross linked Step 5 Profile Gene Expression Generate gene expression data using various compatible microarray platforms templates INTEGRATE SEAMLESSLY INTO CURRENT WORKFLOW The ParadisePLUS reagent system is compatible with all major microarray platforms The RNA obtained using the ParadisePLUS reagent system can be used in the same fashion as RNA generated from frozen tissue sources Robust and reproducible results are achieved using tools and techniques commonly employed in today s research laboratories COMPLETE WORKFLOW FOR GENE EXPRESSION The ParadisePLUS reagent system contains all the materials needed for a complete gene expression experiment The kit includes components for gt Staining the tissue to identify the cells of interest amp integrated Extraction and isolation of total RNA from the cells of interest gt Amplification of isolated RNA to generate more material for gene expression assays gt Labeling for microarray experiments optional SUPERIOR APPLICATIONS AND TECHNICAL SUPPORT MDS Analytical Technologies employs a team of highly qualified and expertly trained application scientists and technical support specialists Our dedicated staff offers personalized training and application support enabling researchers to thrive in any research area e time saving labor saving better results Superior Performance D VAG NAAR a
51. e preserving intact nucleic acid and protein species from captured cell populations The saine components work with the additional modules provided in this reagent system Paradise lus extraction and isolation reagents and RNA amplification reagents provide a complete solution for studying RNA from cells isolated by LCM The reagents and protocol have been optimized for use with Formalin Fixed Paraffin Embedded FFPE samples Extraction isolation The Paradise ls Reagent System RNA Extraction Isolation reagents enable researchers to recover total cellular RNA from formalin fixed paraffin embedded samples They are optimized for use with cells acquired using Laser Capture Microdissection LCM on CapSure LCM Caps Total cellular RNA isolated using the Paradise 5 Reagent System RNA Extraction Isolation reagents produces RNA in a small volume of low ionic Paradise Plus Reagent System User Guide 12872 00 Rev C 1 1 Introduction 1 2 1 3 1 4 1 5 strength buffer ready for use in linear amplification using the Paradise pus Reagent System RNA amplification reagents The Paradise PIS Reagent Sy Isolation Kit contains RNA extraction and purification reagents a gt JAE NAAT Purification Columns Amplification The Paradise Reagent System RNA Amplification reagents enable the production of large quantities of amplified antisense RNA aRNA from small quantities of total cellular RNA This process for linear amplific
52. e thawed thoroughly mixed with all solids dissolved and brought to room temperature just before use Table 5 15 Complete IVT Reaction Mix Component Amount pL Vial gc ra IVT Buffer 2 Blue 1 13 2 IVT Master Mix 6 Blue 2 39 6 IVT Enzyme Mix 2 Blue 3 13 2 Enhancer 2 Yellow E 13 2 Total per sample 12 79 2 f doing Amino Allyl incorporation substitute Amino Allyl IVT Master Mix light blue AA here 52 Paradise Plus Reagent System User Guide 12872 00 Rev C 5 3 Protocol 3 Incubate at 42 C for 8 hours Chill the sample s to 4 8 C D DAE TRAIT e At this point in the protocol you may hold the reaction m thermal cycler overnight 4 Move the samples directly to a 4 8 C block IVT 4 DNASE MIX Stove at DS 6630 Analytical Technologies Figure 5 28 Blue 4 5 Add 1 pL DNase Mix Blue 4 Mix thoroughly and spin down Incubate at 37 C for 15 minutes Chill the sample s to 4 8 C Proceed immediately to aRNA purification 5 3 10 PARADISE PLUS ROUND TWO aRNA PURIFICATION 1 Add 250 pL of RNA Binding Buffer RB to a new purification column seated in the collection tube provided Incubate for five minutes at room temperature Centrifuge at 16 000 x g for one minute RNA RB BINDING BUFFER Store at DS Room Temp Analytical Technologies Figure 5 29 RNA Binding Buffer Note RNA Binding Buffer RB must be at room temperature and thoroughly mixed be
53. eaction Ensure that all pipettes are properly calibrated to dispense correct volumes Concentrations of Primer 1 Primer 2 Primer 3 or 15t Strand Nuclease Mix are incorrect due to inadequate mixing or reaction volume collection inside the reaction tube Thoroughly mix and spin down the sample after adding the primers or 1 Strand Nuclease Mix into the reaction mix and prior to incubation This ensures the correct concentration of primers or nuclease in each respective reaction mix Input RNA was not isolated using the PicoPure RNA Isolation Kit and no nucleic acid carrier was added Low molecular weight material may result from lack of RNA and carrier Using the Paradise Plus Isolation Kit is recommended to prepare formalin fixed samples Paradise Plus Reagent System User Guide 12872 00 Rev C JAE VAAL H 4 Quality Assessment Protocol H 4 QUALITY ASSESSMENT PROTOCOL D DAE NAAR Symptom Cause 1 Tissue homogenate There was insufficient Limit the extraction to 1 mm2 of tissue is viscous and disruption or lysis of cells scrape per 1 uL of PK solution difficult to pipet resulting in low RNA Use a minimum of 25 mm2 of tissue yield area in 25 uL of PK solution per extraction Do not use over 150 uL of PK solution per sample for isolation e For 2150 uL of PK solution perform multiple isolations Rn No template Inappropriate reaction Optim
54. en and FFPE samples D compared to replicate frozen A or FFPE B However the correlation is sufficiently high r 0 937 to enable reliable gene expression profiling of FFPE samples to represent expression levels in the tissue s native state d Q validation amp integrated e time saving labor saving better results CMDS Analytical Technologies The Paradise LUS reagent system is available with options customized for your research Biotin Labeling Cy3 Labeling Cy5 Labeling Amino allyl incorporation Natural nucleotides QRT PCR For Probe Arrays Requiring Biotin Labeled Material Part Number KIT0312B Perform 2 rounds of amplification generating amplified aRNA Use Arcturus Turbo Labeling kit to biotin label enough material to hybridize to array Remaining aRNA is unlabeled for further comparison or validation QRT PCR or alternative array platforms For Fluorescent and 2 color Arrays Part Number KIT0312C and or KIT0312D Perform 2 rounds of amplification generating amplified aRNA Use Arcturus Turbo Labeling kit to Cy3 or Cy5 label enough material to hybridize to array Remaining aRNA is unlabeled for further comparison or validation QRT PCR or alternative array platforms For QRT PCR Analysis Perform 1 round of amplification Convert amplified RNA to cDNA cDNA is ready for QRT PCR reactions Other labeling options also available SALES OFFICES United States amp C
55. er 2 W2 into column and centrifuge at 16 000 x g for 2 minutes Paradise Plus Reagent System User Guide 12872 00 Rev C 27 28 4 RNA Extraction Isolation 13 Transfer column to a 0 5ml microcentrifuge tube provided in the Kit 14 Pipette 12 pL of Elution Buffer EB direction onto the memt IAE RL column NOTE Gently touch the tip of the pipette to the surface of the membrane while dispensing the elution buffer to ensure maximum absorption of EB to the membrane 15 Incubate for 1 minute at room temperature 16 Centrifuge at 1 000 x g for 1 minute and then at 16 000 x g for 1 minute The sample maybe used immediately or stored at 70 C or below Paradise Plus Reagent System User Guide 12872 00 Rev C D VAG NARA 5 RNA Amplification 5 1 COMPONENTS 5 1 1 REAGENTS AND SUPPLIES Table 5 1 Paradise P S cDNA kit RA7018 Component Vial Color Vial Label 15t Strand Master Mix Red 1 13 Strand Enzyme Mix Red 2 Enhancer Yellow E 15t Strand Nuclease Mix Gold 2 d Strand Master Mix White 1 2 d Strand Enzyme Mix White 2 Primer 1 Grey 1 Primer 2 Grey 2 Primer 3 Grey 3 Control RNA White C Also requires SuperScript lll enzyme not included In Vitro Transcription IVT Table 5 2 In Vitro Transcription IVT 1 round RA7008 Component Vial Color Vial Label IVT Buffer Blue 1 IVT Master Mix Blue 2 IVT Enzyme Mix Blue 3 DNase Mix Blue 4
56. er Guide 12872 00 Rev C 37 5 RNA Amplification 5 3 PROTOCOL 5 3 1 PARADISEG PLUS ROUND ONE 1ST STRAND cDNA SYN JAtJUC CHBR C NOTE Read all Detailed Protocol notes on the previous pages pric g 1 Prepare RNA sample in a total volume of 10 11 pL in a 0 5 mL or 0 2 mL RNase free microcentrifuge tube and place on 4 8 C block 2 Thaw Primer 1 Gray 1 thoroughly mix and spin down Arcturus Paradise Plus 1 PRIMER 1 Store at ADS AVC 9 200 Analytical Techecloges Figure 5 3 Gray 1 3 Add 1 0 pL of Primer 1 mix thoroughly by flicking the tube and spin down 4 Incubate at 70 C for 1 hour then chill the samples to 4 8 C for at least one minute Spin down the contents and place on 4 8 C block before proceeding to the next step 5 Place 1 Strand Synthesis components Red at 4 8 C cold block 1st Strand Master Mix Red 1 and Enhancer Yellow must be thawed thoroughly mixed with all solids dissolved and maintained at 4 8 C until used 1 Strand Enzyme Mix Red 2 and SuperScript III enzyme do not require thawing and can be placed directly at 4 8 C Mix enzyme thoroughly by inverting several times Spin briefly SuperScript III Enzyme Paradise Plus 1 1st STRANO MASTER MIX Paradise Plus 1st Paradise Plus 2 STRAND E ENHANCER ENZYME MIX Store at os ree Anabytcal Technologies Store a DS cwac provided by end user Analytical Technologies nos Anal
57. f amplification NOTE MDS Analytical Technologies recommends this protocol to customers who are starting a new set of FFPE samples or new type of FFPE samples Experiments should be done on scraped sections The RNA quantity derived from the 3 primer set 1650 1717 should be used as the quantity measurement of the RNA in the FFPE sample The ratio of the RNA yield obtained from both sets of PCR primers is the 3 5 used as an indication of RNA quality Paradise Plus Reagent System User Guide 12872 00 Rev C 61 62 B Sample Assessment Protocol Materials Needed Table B 1 Materials needed D VAG NARA Component Vendor Catalog RNase free water Invitrogen 18054 015 Universal Human Reference RNA Stratagene 740000 Poly l Sigma P4154 Uracil DNA Glycosylase Roche 1444646 Thermal cycler MLS Table B 2 Primer sequences HBAC1650 TCCCCCAACTTGAGATGTATGAAG 50 uM HBAC1717 AACTGGTCTCAAGTCAGTGTACAGG 50uM HBAC1355 ATCCCCCAAAGTTCACAATG 50 uM HBAC1472 GTGGCTTTTAGGATGGCAAG 50 uM Stock concentration Table B 3 Materials needed for qrtPCR Component Vendor Catalog For ABI PRISM 7900HT QuantiTect SYBR Green PCR Master Mix Qiagen 204143 ABI optical Reaction Plate ABI 4314320 Optical Adhesive covers ABI 4311971 Splash Free Support Base for 96well plate ABI 4312063 Microseal F foil MJ Research MSF 1001 For Roche Light Cycler
58. f the sample to a concentration of 200 300 ng pL 3 Store the sample on ice or in a cold block until ready to load on to the RNA chip 4 Follow the RNA 6000 Nano Assay Kit protocol loading 1 pL of the prepared sample dilution from step 2 For details of data interpretation refer to the bioanalyzer instruction manual The aRNA appears on the bioanalyzer as a single broad peak The size of the aRNA ranges in length from 200 to 2000 bases ANALYSIS OF aRNA BY AGAROSE GEL ELECTROPHORESIS Analysis of aRNA using agarose gel electrophoresis is one method to visualize the RNA profile and relative quantity after amplification Standard protocols for agarose gel electrophoresis can be used The following is a suggested protocol using commercially available reagents Materials gt 1 25 Agarose Portrait Gel or 1 25 Agarose Medium Gel gt EmbiTec cat GE 6010 or GE 6030 gt 10X RNA MOPS Running Buffer EmbiTec cat EC 1020 2X Gel Loading Buffer various RNA Ladder various SYBR Gold Nucleic Acid Gel Stain Molecular Probes cat S 11494 or Ethidium Bromide Stain gt Nuclease free Water Protocol 1 Determine the concentration of the aRNA by UV absorbance with a spectrophotometer Refer to Appendix A 2 Dilute the aRNA sample s with nuclease free water Each gel well can be loaded with 1 3 pg of aRNA 3 Prepare aRNA gel sample by mixing 6 pL of diluted aRNA with 6 pL of 2X Gel Loading Buffer 4 Incubate for
59. five minutes at room temperature Centrifuge at 16 000 x g for one minute DNA DB BINDING BUFFER Analytical Technologies Figure 5 8 Binding Buffer DB Paradise Plus Reagent System User Guide 12872 00 Rev C 41 42 5 RNA Amplification NOTE DNA Binding Buffer DB must be at room temperature and thoroughly mixed by shaking before use A precipitate may form during long terr MEME precipitate prior to use by mixing If necessary warm the DB vi VAEVVAA RATNASAL Add 200 pL of DNA Binding Buffer DB to the 2 4 Strand synthesis sample tube mix well and pipette the entire volume into the purification column To bind cDNA to column centrifuge at 100 x g for two minutes or lowest speed setting available immediately followed by a centrifugation at 10 000 x g for one minute to remove flow through Add 250 pL of DNA Wash Buffer DW to the column and centrifuge at 16 000 x g for two minutes Check the purification column for any residual wash buffer If any wash buffer remains re centrifuge at 16 000 x g for one minute DNA DW wis BUFFER Sho at ADS Room Temp Analytical Techrcloges Figure 5 9 Wash Buffer DW Discard the flow through and collection tube Place the column into the provided 0 5 mL microcentrifuge tube and carefully add 11 uL of DNA Elution Buffer DE onto the center of the purification column membrane Gently touch the tip of the pipette to the surface of the membrane while
60. fore use A precipitate may form during long term storage Dissolve precipitate prior to use by mixing If necessary warm the RB vial to re dissolve 2 Add 120 pL of RB to the IVT reaction sample and mix thoroughly Pipette the entire volume into the purification column 3 To bind aRNA centrifuge at 100 x g or lowest speed setting available for two minutes immediately followed by a centrifugation at 10 000 x g for 1 minute 4 Add 200 pL of RNA Wash Buffer RW to the purification column and centrifuge at 10 000 x g for one minute Paradise Plus Reagent System User Guide 12872 00 Rev C 53 54 5 RNA Amplification D TAG AAR RNA RW iasa BUFFER Store at pem Analytical Technologies Figure 5 30 RNA Wash Buffer NOTE Avoid splashing flow through in the collection tube onto the purification column If flow through waste liquid wets the outside of the purification column re centrifuge the column at 16 000 x g to remove the liquid Add 200 pL of fresh RW to the purification column and centrifuge at 16 000 x g for two minutes Check the column for any residual wash buffer If any wash buffer remains re centrifuge at 16 000 x g for one minute Discard the collection tube and flow through Place the purification column into a new 0 5 mL microcentrifuge tube provided in the Kit and carefully add 30 pL of RNA Elution Buffer RE directly to the center of the purification column membrane Gently touch the tip
61. gure A 10 RNA Wash Buffer NOTE RNA Binding Buffer RB must be at room temperature and thoroughly mixed before use A precipitate may form during long term storage Dissolve precipitate by mixing lf necessary warm the RB vial to re dissolve 5 Add 200 pL of fresh RW to the column and centrifuge at 16 000 x g for two minutes Check the purification column for any residual wash buffer If any wash buffer remains re centrifuge at 16 000 x g for one minute 6 Discard the collection tube and flow through 7 Place the purification column into a new 0 5 mL microcentrifuge tube provided in the kit and carefully add 30 pL of RNA Elution Buffer RE directly onto the center of the purification column membrane Gently touch the tip of the pipette to the surface of the membrane while dispensing RE to ensure maximum absorption of RE into the membrane Gently tap the purification column to distribute the buffer if necessary RNA RE ELUTION BUFFER Store at Ri T pi rmm Analytical Technologies Figure E 3 Figure A 11 RNA Elution Buffer 8 Incubate at room temperature for one minute 80 Paradise Plus Reagent System User Guide 12872 00 Rev C 9 Place the assembly into the 2 mL support tube in the rotor with the 0 5 mL tube cap trailing the tube JEJA 10 Centrifuge at 1 000 x g for one minute immediately followed b 2 B eA ANES minute Discard the purification column and retain the elution containing the labeled aRNA
62. ifuge the column for one minute at 1 000 x g to distribute EB in the column and then spin for one minute at 16 000 x g to elute RNA The entire sample may be used immediately or stored at 70 C NOTE Flow through waste following centrifugation is usually present as only a small volume and therefore it is not necessary to discard the flow through waste after every centrifugation step Make sure that the accumulated flow through waste does not make contact with the purification column Flow through waste should be discarded when the waste fluid level approaches the surface of the purification column NOTE Prior to use mix Binding Buffer BB thoroughly Binding Buffer BB may form precipitate upon storage Dissolve precipitate prior to use by mixing thoroughly If necessary warm the BB vial to re dissolve Binding Buffer prior to use NOTE Remove all traces of wash buffer prior to transferring purification column to the new microcentrifuge tube To remove wash buffer discard flow through waste and re centrifuge the column for one minute at 16 000 x g Rotation Figure 4 3 Centrifuge NOTE To avoid potential breakage of the microcentrifuge tube cap during centrifugation insert the purification column 0 5 mL tube assembly into a lidless 2 0 mL tube Insert this assembly into adjacent rotor holes as illustrated Rest the tube cap against the tube immediately clockwise to it Place an empty lidless 2 0 mL tube into the rotor hole adj
63. imer 50 uM 0 25 625 nM 3 R actin Reverse Primer 50 uM 0 25 625 nM Water nuclease free 11 94 Table B 9 For the 5 R actin Primers Amount for Each Reaction Component Volume pL a Final Conc SYBR Green PCR Master Mix 2 BD Taqstart Antibody 0 16 25 mM MgCI2 2 4 Uracil DNA Glycosylase 1 0 5 R actin Forward Primer 50 uM 0 25 625 nM 5 R actin Reverse Primer 50 uM 0 25 625 nM Water nuclease free 11 94 2 For each reaction add 18 uL of the PCR mix into a LightCycler capillary 3 Add 2 pL of the cDNA 4 Spin the capillaries at 500g for 5 second in their adaptor Load the capillaries into LightCycler Paradise Plus Reagent System User Guide 12872 00 Rev C 5 Run the LightCyder following programs as listed below set temperature transition rate to 20 D DAE NAAR Step Target temp Time Acquisition 1 Denaturation 95 1 min none 2 Amplification 95 0 sec none eee 58 5 sec none 72 10 sec single 3 Melting 95 0 sec none 65 10 sec none 99 0 sec cont 4 Cooling 40 1 min none 6 Obtain Ct1650 Ct 1355 for the testing sample and the uRNA dilutions 7 Quantify the input RNA a Plot the standard curve of log uRNA amount vs Ct For each pair of primers one standard curve is generated b Obtain the uRNA equivalent of the testing sample from the corresponding standard curve Standard curve 165
64. inute Discard the collection tube and flow through Paradise PIuS Reagent System User Guide 12872 00 Rev C 73 C Amino Allyl aRNA Labeling 9 10 1 12 Place the purification column into a new 0 5 mL microcentrifuge tube provided in the kit and carefully add 50 pL of RNA Elution Buffer RE H of the purification column membrane Gently touch the tip c JAE VAAN AL surface of the membrane while dispensing RE to ensure maximum absorption ot KE into the membrane Gently tap the purification column to distribute the buffer if necessary RNA RE ELUTION BUFFER Store at NDS Room Temp Anaha Technologies Figure C 5 RNA Elution Buffer Incubate at room temperature for one minute Place the assembly into the 2 mL support tube in the rotor with the 0 5 mL tube cap trailing the tube Centrifuge at 1000 x g for one minute immediately followed by 16 000 x g for one minute Discard the purification column and retain the elution containing the labeled aRNA Rotation Figure C 6 Centrifuge 13 Measure the O D of the product at A260 A280 and A550 A650 to determine the yield and frequency of incorporation FOI by making a dilution of 1 10 5 pL sample 45 pL nuclease free water 14 Store any remaining samples at 709C until ready for hybridization 74 Paradise Plus Reagent System User Guide 12872 00 Rev C D TAG AAR D aRNA Analysis RNA QUANTITATION USING SPECTRAMAX MIC
65. ion In Vitro Transcription MiraCol aRNA Purification Amplified aRNA vw NC vw NA VA 7A ROUND 1st and 2nd TWO Strand Synthesis ds cDNA mm Imm mm HN KITO301 KITO311 KITO302 KITO312 MiraCol cDNA Purification In Vitro Transcription MiraCol aRNA Purification Commercially available Transcript Labeling Kit Labeled Amplified aRNA Amplified aRNA ready for Labeling NA wA NT NA NA uN NA wR yin vy NA wR NA wy NA NA NA NA NA NA Figure 5 1 Paradise Amplification Schematic NOTE Using a thermal cycler with a heated lid is important The heated lid ensures proper temperature distribution within the reaction tube and prevents evaporative condensation that alters the reaction mixture concentrations THERMAL CYCLER PROGRAMMING Thermal cyclers provide a convenient and reproducible method of incubating reactions according to specified temperatures and times in the protocol A thermal cycler program for use appears on page 3 12 The program is not intended for automatic progression from one time and temperature set to another The program lists a 4 C hold after each incubation or incubation cycle when it is necessary to remove the reactions from the thermal cycler to add reagents After the addition of reagents place the sample back into the thermal cycler and resume the program Paradise Plus Reagent System User Guide 12872 00 Rev C D TAG AAR 5 2 Preliminary Steps Table 5 7 Paradise P S Thermal
66. ion For troubleshooting purposes try starting with 40 000 cells Paradise Plus Reagent System User Guide 12872 00 Rev C 87 88 H Troubleshooting H 2 EXTRACTION AND ISOLATION Symptom Isolated RNA is of Poor Quality RNA Yield is Low Cause Source tissue is of compromised quality JAE VAAL Suggc Verify quality of source tissue of LCM cells The greatest factor affecting the quality of isolated RNA is the integrity of the RNA in the original tissue sample RNA degradation due to RNase activity occurs rapidly especially upon tissue removal such as through biopsy and needle aspiration For suggestions on verifying quality please call Technical Support RNA degradation during staining process Use the Paradise Plus Reagent System Staining components to prepare slides for LCM Specialized staining protocols and reagents are required for optimal RNA preservation in LCM samples MDS Analytical Technologies has developed and validated the Paradise Plus Reagent System Staining components for preparing and staining tissues for LCM while maintaining RNA integrity RNA degradation during LCM RNA quality compromised during slide storage RNA integrity has been compromised Perform LCM immediately after preparing LCM slides LCM sample slides are dehydrated in the final step of preparation so RNase activity is minimized However the risk of moisture and RNa
67. is protocol will enable estimation of RNA quantity and quality using a quantitative real time PCR assay with primers designed to R acting The assumption is that the R actin mRNA in the sample represents the average status of other RNA molecules in the same sample The total estimated RNA amount in a given sample is expressed as an equivalent of universal RNA that contains the same amount of f actin mRNA The protocol measures the average R actin cDNA length by quantification of the PCR product yield from the 3 end primer 1650 1717 and another relative 5 sequence primer 1355 1472 If all cDNA contains both the 3 and 5 sequence target the ratio of the PCR product for 3 5 would be 1 As the RNA from FFPE samples tends to exhibit some degradation the 3 5 ratio is usually greater than one Depending on the ratio an estimation of the quality of the RNA can be made It is recommended to perform the reverse transcription steps with 100 200 ng of total RNA Be sure to determine the yield of the total RNA following isolation and make the appropriate dilutions to ensure your samples are within this concentration range Perform necessary dilutions of total RNA in 10 ng uL Poly I In parallel to the testing sample a control of 10 ng pL uRNA 100 ng in 10 pL Stratagene 740000 needs to be carried through the complete analysis as the quantitation standard for EVERY experiment Dilution factor may vary for aRNA generated after one round o
68. ith the Paradise Ps Reagent System Substitution of reagents or Kit components may adversely affect yields or introduce RNases gt Use only new plasticware that is certified nucleic acid free Paradise Plus Reagent System User Guide 12872 00 Rev C 7 1 Introduction gt Use only new sterile RNase free pipette tips and microcentrifuge tubes gt Clean work surfaces with commercially available RNase deco gt JAE INA RAAT prior to performing reactions Amplification RNase contamination will cause experimental failure Minimize RNase contamination by adhering to the following recommendations throughout your experiment gt Wear disposable gloves and change them frequently gt After putting on gloves avoid touching surfaces that may introduce RNases onto the glove surface gt Do not use reagents not supplied Substitutions of reagents or components may adversely affect yields or introduce RNases gt Use only new sterile RNase free pipette tips and microcentrifuge tubes gt Work surfaces should cleaned with commercially available RNase decontamination solutions prior to performing reactions Amplified aRNA Contamination Stray amplified aRNA and cDNA in work area can contaminate precious samples if the work area is routinely used for performing amplifications To ensure a work area free of amplified aRNA please do the following 1 Irradiate the work area hood with UV overnight every three to four days
69. ize QRT PCR with positive Control Rn and there conditions controls to monitor the ORT PCR is no amplification performance plot Poor quality PCR Contact the vendor supplier of the PCR mastermix master mix Incorrect dye Check dye component prior to data components were analysis chosen The reaction component Check that all the correct reagents was omitted were added Incorrect primer or probe Verify primer and probe sequences If sequence necessary re synthesize with the appropriate sequence PCR is not optimized Optimize PCR with cDNA standard curves to obtain a slope of 3 1 to 3 7 when plotting CT against the concentration of cDNA Degraded template or no Repeat the extraction and RT reaction template added with fresh template Reaction inhibitor Repeat with purified template present Rn No Template Contamination of Check technique and equipment to Control Rn and both reagents or work area confine contamination Repeat the reactions show an reaction with fresh reagents Run amplification plot negative controls along with the samples to monitor template contamination Paradise Plus Reagent System User Guide 12872 00 Rev C 91 92 H Troubleshooting Paradise Plus Reagent System User Guide 12872 00 Rev C D DAE NARHA
70. k onto the cold block or refreeze immediately after dispensing the reagent Do not leave reagents at room temperature for any extended period of time It is safe to stop at this point in the protocol You may store the sample overnight at 20 C IMPORTANT qRT PCR Kit Customers KITO300 KITO300 NS KITO310 amp KITO310 NS STOP HERE and continue with qRT PCR protocol as directed by instrument manufacturer 5 3 7 PARADISE PLUS ROUND TWO 2ND STRAND cDNA SYNTHESIS 1 Place sample on 4 8 C block and allow to thaw if frozen at 4 8 C 2 Thaw Primer 3 Gray 3 thoroughly mix spin down and place on 4 8 C block Arcturus Paradise Plus 3 PRIMER 3 Figure 5 20 Gray 3 3 Add 1 0 pL of Primer 3 to the sample Mix thoroughly by flicking the tube and spin down 48 Paradise Plus Reagent System User Guide 12872 00 Rev C 5 3 Protocol 4 Incubate the sample at 95 C for five minutes then cool sample to 4 8 C for at least one minute Hold the sample at 4 8 C until ready to proceed and place on 4 8 C block before proceeding to the next step JAE VAAL 5 Thaw 2 Strand Master Mix a 4 8 C cold block White 1 Thoroughly mix and spin 2 4 Strand Master Mix 2 4 Strand Enzyme Mix White 2 does not require thawing Mix enzyme thoroughly by inverting several times spin briefly and place at 4 8 C Arcturus 1 Paradise Plus 2 Paradise Plus 2nd STRAND 2nd STRAND MASTER MIX ENZYME MIX Stove
71. ks and ARCTURUS T TURBO LABELING VERITAS EXTRACSURE MIRACOL are trademarks of MDS Analytical Technologies Other trademarks used in this manual are the property of their respective owners The PCR process is covered by patents owned by Hoffmann La Roche Inc and F Hoffman La Roche Ltd Some uses of the Paradise Plus Reagent System may require licenses from third parties Purchase of the Paradise Plus Reagent System does not include any right or license to use develop or otherwise exploit the product commercially Any commercial use development or exploitation of the Paradise Plus Reagent System or development using the product without the express written authorization of MDS Analytical Technologies is strictly prohibited This RNA Amplification product and or its use may be covered by one or more U S Patent numbers 5 716 785 5 891 636 and 5 958 688 which are licensed exclusively to Incyte Corporation The purchase of this product conveys to the buyer the limited non exclusive non transferable right under these patents to use this product for laboratory use as a General Purpose Reagent as an Analyte Specific Reagent or to provide gene expression services The purchase of this product does not include or carry any right or license to use the product in a clinical diagnostic test for which the FDA Premarket Approval PMA and or Premarket Notification under section 510 k of the FFDCA is obtained or required The buyer of this product acquires
72. l have a combined volume of approximately 206 pL 4 Tobind RNA centrifuge for 2 minutes at 100 x g immediately followed by a centrifugation at 16 000 x g for 1 minute 5 Pipette 100 pL Wash Buffer 1 W1 into column and centrifuge for 1 minute at 8000 xg 6 Mix 2 pL DNase Mix DNase with 18 pL of DNase buffer DNB Add 20 pL mixture to the column and incubate at room temperature for 20 minutes 7 Pipette 40 pL Wash Buffer 1 W1 into the purification column and centrifuge for one minute at 8000 x g 8 Pipette 100 pL Wash Buffer 2 W2 into the purification column and centrifuge for one minute at 8000 x g 9 Pipette another 100 pL Wash Buffer 2 W2 into the purification column and centrifuge for two minutes at 16 000 x g NOTE Check the purification column for any residual wash buffer If wash buffer remains re centrifuge at 16 000 x g for one minute 10 Transfer the purification column to a new 0 5 mL microcentrifuge tube provided Paradise Plus Reagent System User Guide 12872 00 Rev C 4 3 Protocol 11 Pipette 12 pL Elution Buffer EB directly onto the membrane of the purification column Gently touch the tip of the pipette to the surface of dispensing the elution buffer to ensure maximum absorption JAE NAAT membrane 12 Incubate the column for one minute at room temperature 13 Place each column tube assembly into the 2 ml support tube in the rotor with the 0 5 ml tube cap trailing the tube 14 Centr
73. late with an optical cap or optical a TREIA RSA Vortex the tube or reaction plate for 20 seconds then spin quickly to collect the reactions at the bottom of the tube or wells Proceed to Running the ABI PCR Reactions on page 67 Running the ABI PCR Reactions 1 2 Place the tube or reaction plate in your real time PCR instrument Program the thermal cycling conditions as follows Table B 7 Thermal Cycling Conditions 4 5 Temperature Step 5 Time C 1 Hold 50 2 minutes 2 Hold 95 15 minutes 3 PCR 95 15 seconds 40 cycles 58 30 seconds 72 32 seconds IMPORTANT The thermal cycling conditions listed above have been optimized for use on the Applied Biosystems 7900HT Fast Real Time PCR System Optional If your instrument has the ability include a dissociation curve When the run is completed export the results into Microsoft Excel software Proceed to Interpreting the Results on page 69 For Roche Light Cycler Preparing the PCR reactions 1 Prepare the PCR reaction mix according to the table below Paradise Plus Reagent System User Guide 12872 00 Rev C 67 B Sample Assessment Protocol Table B 8 For the 3 R actin Primers Amount for Each JAt JH RARE Component Volume pL a Final Conc SYBR Green PCR Master Mix 2 BD Tagstart Antibody 0 16 25 mM MgCl2 2 4 Uracil DNA Glycosylase 1 0 3 R actin Forward Pr
74. lids dissolved prior to use Reagent concentrations in the reaction mixtures are incorrect due to inadequate reaction volume collection in the reaction tube Thoroughly thaw and mix all reagents prior to dispensing Ensure all reagents are dispensed at proper volumes Briefly spin down the reaction mix prior to incubation to ensure all reagents are collected in the reaction volume and the reaction mix has the proper concentrations of reagents Reagent concentrations in reaction mixtures are incorrect due to evaporative condensation onto the wall of the reaction tube during incubation Briefly spin down the sample following incubation steps to maintain proper volumes and concentrations of reagents and ensure that all nucleic acid templates are mixed with reaction components Use a thermal cycler with a heated lid Incubation temperatures are incorrect Verify the accuracy of all incubation temperatures If you are using a thermal cycler make sure that the programmed temperatures read correctly and the instrument has been calibrated to establish and maintain accurate temperature settings RNA yield is diminished during column purification Message content is low within the total RNA being used in your study Verify centrifugal force used during nucleic acid purification Improper binding washing and elution centrifugal forces can decrease the recovery of nucleic acid from the purification column Mic
75. lification IVT Turbo Numbers Isolation gt p FA Description Catalog of Room Room Frozen Room Frozen Room 9 J A t J 47 IT nett Number Samples temp temp temp temp ire Arcturus Paradise PUS 2 Round KIT0322 A 6 x x x x 1x 1x 1x x x 6 Amplification only RA7018 RA7011 RA7009 Arcturus Paradise P S 2 Round KIT0312 NS 12 x 1x 1x 1x 2x 2x 2x x x 12 reactions No solvents RA7014 RA7007 RA7001 RA7018 RA7011 RA7009 Arcturus Paradise PUS 2 Round KIT0322 NS 6 x 1x 1x 1x 1x 1x 1x X x 12 ext iso 6 amp No solvents RA7014 RA7007 RA7001 RA7018 RA7011 RA7009 Arcturus Paradise PUS 2 Round KIT0312B 12 x 1x 1x 1x 2x 2x 2x x 1x with Biotin Labeling 12 NS RA7014 RA7007 RA7001 RA7018 RA7011 RA7009 KITO608 reactions No solvents Arcturus Paradise PlUS 2 Round KIT0312C 12 x 1x 1x 1x 2x 2x 2x x 1x with Cy3 Labeling 12 reactions NS RA7014 RA7007 RA7001 RA7018 RA7011 RA7009 KITO609 No solvents Arcturus Paradise PlUS 2 Round KIT0312D 12 x 1x 1x 1x 2x 2x 2x x 1x with Cy5 Labeling 12 reactions NS RA7014 RA7007 RA7001 RA7018 RA7011 RA7009 KITO610 No solvents Arcturus Paradise P S 2 round IT0314 12 1x 1x 1x 1x 2x 2x 2x 2x x Amino Allyl 12 reactions RA7013 RA7014 RA7007 RA7001 RA7018 RA7011 RA7010 RA7012 Arcturus Paradise PUS 2 Round IT0324 6 1x 1x 1x 1x 1x 1x 1x 1x x Amino Allyl 12 ext iso 6 amp RA7013 RA7014 RA7007 RA7001 RA7018 RA7011 RA7010 RA7012 Arc
76. lly a 1 25 to 1 50 dilution of aRNA in nuclease free water is sufficient For single stranded RNA a measurement of A 60 1 0 corresponds to 40 pg mL The yield can by calculated by A260 dilution factor 40 pg mL RNA Measuring Aygo and calculating the A 60 A280 ratio indicates the purity of the RNA sample An A 60 A280 ratio between 2 0 2 6 indicates very pure aRNA ASSESSMENT OF RNA QUALITY USING THE AGILENT BIOANALYZER The Agilent Lab on a Chip system provides a fast and effective approach to assessing the integrity of an aRNA sample The system requires very small quantity of sample Refer to the Agilent 2100 bioanalyzer and RNA LabChip Kit Instruction Manuals for details Equipment and Materials Required Agilent 2100 bioanalyzer System Agilent RNA 6000 Nano Assay Kit Agilent Ice or cold block 4 8 C Spectrophotometer Before you begin refer to the instruction manual for the RNA 6000 Nano Assay Kit Prepare necessary reagents and supplies as required by the kit Use RNase free technique Wipe all surfaces and equipment with RNase decontamination solution use RNase free solutions and plastic ware and wear disposable gloves Paradise Plus Reagent System User Guide 12872 00 Rev C D 4 Analysis of aRNA by Agarose Gel Electrophoresis D 4 Protocol 1 Determine the concentration of the aRNA generated through spectrophotometry gt IAE TARA 2 Based on the optical density reading prepare a dilution o
77. lutions chart Solution Volume pL Cell extract PK Solution 25 50 75 100 150 Binding Buffera 27 159 Ethanol Solutionb 52 309 The volume of Binding Buffer is 1 06 x the volume of cell extract PK solution d The volume of Ethanol Solution is 2 06 x the volume of cell extract PK solution rounded up Pipette up to 210 pL of the cell extract mixture onto the preconditioned purification column IMPORTANT Do not load more than 210 uL of the cell extract mixture onto the purification column at one time Centrifuge the purification column for 2 minutes at 100 x g to bind the RNA on the column membrane Repeat steps c and d until all of the cell extract mixture has been loaded and bound to the purification column Once all of the cell extract mixture has been bound onto the purification column centrifuge the column for 1 minute at 16 000 x g to pellet the debris Repeat step d until all of sample mixture has been loaded and centrifuged Pipette 100 pL Wash Buffer 1 W1 into column and centrifuge at 16 000 x g for 1 minute Mix 2 uL DNase Mix DNase with 18 pL of DNase buffer DNB Add 20 pL mixture to the column and incubate at room temperature for 20 minutes 10 Pipette 40 pL Wash Buffer 1 W1 into the purification column and centrifuge for 1 1 N one minute at 8000 x g Pipette 100 pL Wash Buffer 2 W2 into column and centrifuge at 16 000 x g for 1 minute Pipette 100 pL Wash Buff
78. ly by flicking the reaction tube unless noted otherwise in protocol to ensure process performance Spin down before proceeding DO NOT VORTEX REACTION SAMPLES 5 Use a microcentrifuge to spin down all components and samples following each mixing step 6 Clean all amplification process equipment with an RNase eliminator such as RNase AWAY Life Technologies to minimize the risk of RNase contamination Paradise Plus Reagent System User Guide 12872 00 Rev C 35 36 5 RNA Amplification 5 2 6 5 2 7 7 During enzyme and buffer dispensing keep the reaction tube with sample on ice or chilled in a 4 C cold block Do not freeze samples unless to do so in the protocol gt JIXE Y1A REAL SAMPLE AND REAGENTS PREPARATION 1 Thaw frozen kit components as needed and mix with gentle vortexing or by inverting the tubes several times spin down and place on ice When enzyme mixtures must be removed from 20 C storage for use always keep them in a cold block or in an ice bucket at the lab bench 2 Allow In Vitro Transcription IVT Buffer Blue labeled Vial 1 Master Mix Blue labeled Vial 2 and Enhancer Yellow labeled Vial to assume room temperature 22 25 C and mix by inverting or flicking the tube Spin down if necessary Dissolve all visible solids prior to use 3 The Paradise Plus Reagent System RNA Amplification reagents are optimized for the input of formalin modified total cellular RNA 4 Although ex
79. n of the RNA quality can be made For studies in which a known set of genes is being evaluated ratios that are in a higher range 20 to 40 can be tolerated In cases where the FFPE samples are being used to discover gene sets to maximize the success and enable discovery of the maximum number of genes samples with lower ratios 20 are optimal NOTE MDS Analytical Technologies does not have a strict cut off for ratios from which no data will be obtained As individual studies will have different tolerance levels MDS Analytical Technologies recommends running a few samples with a variety of ratios to determine where the cut off should be for a specific study It is also important to remember that in addition to the ratio the overall quantity reported for the 3 Primer Set can be helpful in determining the quality of the sample Ifa ratio of lt 10 is reported but the quantity for that sample is lt 5 pg there is likely not enough RNA in the sample to produce a quality result in a subsequent assay The quantity reported can serve as a guide for determining how much of the original sample should be used to meet the input requirements for further sample processing Paradise Plus Reagent System User Guide 12872 00 Rev C D WAG NARA C Amino Allyl aRNA Labeling This protocol is intended for use with amino allyl modified aRNA which was generated using the optional Amino Allyl IVT components of RA7010 and RA7012 Table C 1 Amin
80. no rights to resell or repackage for resale the product or components thereof No other license is granted to the buyer whether expressly by implication by estoppel or otherwise Disclaimer MDS Analytical Technologies reserves the right to change its products and services at any time to incorporate technological developments This manual is subject to change without notice Although this manual has been prepared with every precaution to ensure accuracy MDS Analytical Technologies assumes no liability for any errors or omissions nor for any damages resulting from the application or use of this information Paradise Plus Reagent System User Guide 12872 00 Rev C Warranty MDS Analytical Technologies warrants that the products described in t s EA performance standards non in literature published by the compan TAL VARA these performance standards MDS Analytical Technologies will replace the product or issue credit for the full purchase price including delivery charges MDS Analytical Technologies provides no other warranties of any kind expressed or implied MDS Analytical Technologies warranty liability shall not exceed the purchase price of the product and shall not extend to direct indirect consequential or incidental damages arising from the use results of use or improper use of its products The Paradise Plus Reagent System is intended for laboratory use Related Documents When using the Paradise Plus Reagent System
81. nt system has been validated as a key component of MDS Analytical Technologies Systems for Microgenomics This reagent system has also been validated with all Arcturus Laser Capture Microdissection LCM instruments which incorporate the most advanced technologies for automated isolation of pure cell populations ENSURE DOWNSTREAM SUCCESS Not all FFPE samples contain high quality RNA Using the ParadisePLUS QC Kit FFPE tissue samples can be qualified before performing amplification and microarray experiments The QC kit s simple QRT PCR assay ensures that the FFPE block contains usable RNA prior to investing the time and expense of LCM and RNA amplification Researchers can then proceed in their study with confidence using these pre qualified tissue samples better results Q validation Seamless Workflow Integration D DAE NARHA Gene Expression Profiling in 5 Easy Steps Step 1 Prepare Samples Cut a 7 micron section from a paraffin block Deparaffinize stain and dehydrate tissue sections while keeping RNA intact Isolate 5 000 to 10 000 pure cells from FFPE tissue samples using either Arcturus LCM Instruments or use full tissue scrapes from a slide Step 2 Identify Cells of Interest Step 3 Extract and Isolate RNA Recover high quality total RNA using optimized extraction and isolation reagents Step 4 Amplify RNA Amplify as little as 5 ng of fixed RNA using methods that over com
82. ntation often associated with formalin fixed tissue The kit provides RNA isolation and reverse transcription reagents optimized for use with archived ffpe samples at small sample input amounts and delivers unparalleled yield fidelity and representation the kit effectively designed with exon spanning primers at varying distances from the 3 end of the transcript and allow the study splice variants in archived or degraded samples the Paradise WT RT system also allows the use of gene specific primers for RT to suit specific assay requirements KITO315 12 Samples Turbo Labeling Kits The TURBO Labeling Kits provide a proprietary non enzymatic technology for labeling of unmodified aRNA for Gene Expression profiling The unmodified aRNA is labeled post amplification thereby avoiding the need to incorporate modified nucleotides The use of natural nucleotides in the amplification step results in unmodified aRNA with higher yields and longer aRNA fragments thus providing better representation of the mRNA transcript for downstream analysis KITO608 Biotin 12 samples KITO609 Cy3 12 samples KITO610 Cy5 12 samples ADDITIONAL EQUIPMENT AND MATERIALS REQUIRED Ensure that you have ready access to the following laboratory equipment and materials before you begin These items are not included with the Paradise Reagent System Staining Equipment Rotary Microtome Fume hood 70 C freezer Tweezers oov Vv x
83. nts of mRNA consequently the total RNA input needed to obtain microgram quantities of aRNA depends on the total RNA source For example RNA from rapidly dividing cells may be relatively mRNA rich and thus may result in higher output of aRNA In general one can expect anywhere from 1 10 pg of total RNA per cell based on factors mentioned above We recommend brining in a minimum of 5 ng of total RNA into the Paradise P S system amplification reaction STORAGE AND STABILITY MDS Analytical Technologies makes recommendations for storage temperatures throughout this document Realizing that not ever laboratory has a freezers set at these Paradise PIuS Reagent System User Guide 12872 00 Rev C 1 6 Material Safety and Data Sheet MSDS 1 6 temperatures we have defined the acceptable temperature ranges for our D DAE NIRA recommendations Acceptable ranges for storage 70 C 65 C to 80 C 20 C 15 C to 30 C 4C 2 C to 8 C Room Temperature 10 C to 30 C Vv Vv ox Staining Inspect all kit components upon receipt Ethanol and xylene are flammable and should be unpacked and stored at room temperature in a fireproof storage cabinet or fume hood with adequate ventilation Cap bottles tightly between uses Store remaining kit supplies at room temperature in a clean dust free environment Extraction and Isolation Store the Paradise Ys Reagent System RNA Extraction Isolation components at room tempera
84. o allyl aRNA Labeling Purification RA7012 Component Vial Color Vial Label RNA Binding Buffer Blue RB RNA Wash Buffer Blue RW RNA Elution Buffer Blue RE 0 5 mL Microcentrifuge Tubes Purification columns Table C 2 Fluorescent dyes not supplied with the kit Reagent Maker Catalog Cy3 mono reactive dye Amersham PA23001 Cy5 mono reactive dye Amersham PA25001 Alexa Fluor 647 reactive dye Molecular Probes A 32756 decapacks for microarrays Alexa Fluor555 reactive dye Molecular Probes A 32757 decapacks for microarrays Paradise Plus Reagent System User Guide 12872 00 Rev C 71 C Amino Allyl aRNA Labeling Protocol Labeling Reaction Re suspend 1mg monoreactive dye in 51 pL of DMSO Save unu JAE AAR 2 69C Figure C 1 DMSO 1 Take 15 pg of amino allyl aRNA in 7 5 pL of nuclease free water NOTE Sample should be maintained on a cold block 2 Add 2 5 pL of Labeling Buffer LB to the sample IVT L B LABELING BUFFER Figure C 2 Labeling Buffer Add 10 pL of the re suspended dye into 10 pL of the sample Mix thoroughly by flicking the tube Spin down briefly Incubate at room temperature in the dark for 1 hour oO 0 A Proceed directly to purification of labeled aRNA aRNA Purification 1 Pre treat column by adding 250 pL of RNA Binding Buffer RB to a new purification column Incubate the column at room temperature for
85. of the pipette to the surface of the membrane while dispensing RE to ensure maximum absorption of RE into the membrane Gently tap the purification column to distribute the buffer if necessary RNA RE ELUTION BUFFER Store at abe Rom Tene MDS Analytical Technologies Figure 5 31 RNA Elution Buffer Incubate for one minute at room temperature Place each column tube assembly into the 2 mL support tube in the rotor with the 0 5 mL tube cap trailing the tube 10 Centrifuge at 1000 x g for one minute followed immediately by 16 000 x g for one minute Discard the column and retain the elution containing the aRNA Paradise Plus Reagent System User Guide 12872 00 Rev C 5 3 Protocol Rotation D DAE THAT Figure 5 32 Centrifuge NOTE To avoid potential breakage of the microcentrifuge tube cap during centrifugation insert the purification tube 0 5 mL tube assembly into a lidless 1 7 2 0 mL tube Insert this assembly into adjacent rotor holes as illustrated Rest the tube cap against the tube immediately clockwise to it Place an empty lidless 1 7 2 0 mL tube into the rotor hole adjacent in the clockwise direction to the last assembly 11 Measure the O D of the product at A260 and A280 12 Analyze the aRNA using the Agilent Bioanalyzer or by gel electrophoresis 13 The purified aRNA is ready for use in a labeling reaction with the TURBO Labeling microarray kit see Appendix A 1 Application 1 or in a re
86. or Cy5 labeled cDNA from aRNA generated using the Paradise P S Reagent System RNA Amplification Kit for hybridization to cDNA microarrays This protocol provides labeled probe of sense orientation from 5 10 micrograms of aRNA a sufficient quantity for replicate hybridizations on cDNA microarrays However such probes are typically not used for oligonucleotide arrays since the targets on such arrays are also generally in the sense orientation Paradise Plus Reagent System User Guide 12872 00 Rev C 57 A Applications of aRNA Table A 1 Suppliers D VAG AAR Reagents Used Maker C RNase AWAY Invitrogen 10328 011 Cy3 labeled dUTP Amersham PA53022 Cy5 labeled dUTP Amersham PA55022 RNAsin Ribonuclease Inhibitor Promega N2515 SuperScript Ill RT and Buffer Invitrogen 18080 044 Nuclease Free Water Invitrogen 10977 023 Rnase H Invitrogen 18021 071 Random Hexamer Operon custom made QiaQuick PCR Purification Kit Qiagen 28106 Protocol 1 Take 5 10 pg of amplified aRNA and adjust the volume to 22 pL with nuclease free water NOTE Adjust to 22 uL using a vacuum concentrator paying attention to not completely dry down the aRNA sample Add 2 pL of 5 mg ml random hexamer 2 3 Mix well by flicking then briefly spin down by centrifugation 4 Heat the tube to 70 C for 10 minutes then 4OC for 2 minutes in the thermal cycler 5 During incubation prepare the first strand master mix as describe
87. ot Store at ADS 1 Clo 0C ADS 19C 10 30 C Anabytical Technologies Analytical Technologies Figure 5 21 White 1 and White 2 6 Add 2 Strand Synthesis components separately in the order listed in the following table If you ae performing several amplifications you may wish to prepare a Complete 2 4 Strand Synthesis Mix based on the following table and add 30 pL Complete 2 4 Strand Synthesis Mix to each sample Mix thoroughly by flicking the tube and spin down Table 5 14 Complete 2 Strand Synthesis Mix 6 reaction Master Mix with Component Amount uL Vial 10 overage pL 2 d Strand Master Mix 29 White 1 191 4 2 d Strand Enzyme Mix 1 White 2 6 6 Total per sample 30 198 0 Store at 4 C until use 7 Incubate the sample s as follows 37 C 30 minutes 70 C 5 minutes e 4 8 C Hold until ready to proceed up to a maximum of 30 minutes NOTE Place components back onto the cold block or refreeze immediately after dispensing the reagent Do not leave reagents at room temperature Paradise Plus Reagent System User Guide 12872 00 Rev C 49 50 5 RNA Amplification 5 3 8 PARADISE PLUS ROUND TWO cDNA PURIFICATION 1 Add 250 pL of DNA Binding Buffer DB to a new purificati e collection tube provided Incubate for five minutes at room te TREIA ARAA at 16 000 x g for one minute DNA D B BINDING BUFFER Sweat Aos Room Temp Acalytical Technologies Figure 5
88. pendix section II 9 Thoroughly mix and spin down 1 Strand Nuclease Mix Place on ice 10 Add 2 0 pL of 1 Strand Nuclease Mix Gold to the sample mix thoroughly by flicking the tube and spin down Paradise Plus 1st STRAND NUCLEASE MIX Store at 1 C 10 309C Figure 5 5 15t Strand Nuclease Mix Gold Paradise Plus Reagent System User Guide 12872 00 Rev C 39 40 5 RNA Amplification 11 Incubate the sample at 37 C for 30 minutes followed by 95 C for five minutes 12 Chill the sample to 4 8 C for at least one minute JAE NVA RUA e It is okay to stop at this point in the protocol Sample may be stored at 20 C overnight NOTE Removal for qrtPCR confirmation may not be suitable for low RNA inputs 5 3 2 PARADISE PLUS ROUND ONE 2ND STRAND CDNA SYNTHESIS 1 Place sample on 4 8 C block and allow to thaw if frozen at 4 8 C 2 Thaw Primer 2 Gray 2 thoroughly mix and spin down Arcturus Paradise Plus 2 PRIMER 2 Store at 19C 10 206 Analytical Technologies Figure 5 6 Gray 2 3 Add 1 0 pL of Primer 2 Mix thoroughly by flicking the tube and spin down 4 Incubate sample at 95 C for 2 minutes then chill and maintain the sample at 4 8 C for at least 2 minutes 5 Thaw 2 Strand Master Mix at 4 8 C cold block White 1 Thoroughly mix and spin 27d Strand Master Mix 2 Strand Enzyme Mix White 2 does not require thawing Mix enzyme thoroughly by inverting several times s
89. perScript III Reverse Transcriptase 200 U pL Enzyme only Invitrogen part number 18080 093 18080 044 or 18080 085 RECOMMENDATIONS FOR NUCLEASE FREE TECHNIQUE Staining RNase contamination will cause experimental failure Minimize RNase contamination by adhering to the following recommendations throughout your experiment gt Wear disposable gloves and change them frequently gt Use RNase free solutions glassware and plasticware Do not re purify Paradise Bus Reagent System Section Staining Kit components They are certified Nuclease Free gt Wash scalpels tweezers and forceps with detergent and bake at 210 C for four hours before use gt Use RNase AWAY Life Technologies according to the manufacturer s instructions on the horizontal staining rack and any other surfaces that may come in contact with the sample gt Use Kimwipe soaked in RNase Away to wipe down and clean the interior of tissue flo tation water bath Extraction and Isolation RNase contamination will cause experimental failure Minimize RNase contamination by adhering to the following recommendations throughout your experiment gt Always handle RNA in a manner that avoids introduction of RNases gt Wear disposable gloves and change them frequently to prevent the introduction of RNases from skin surfaces gt After putting on gloves avoid touching surfaces that may introduce RNases onto glove surfaces gt Do not use reagents not supplied w
90. pin briefly and place at 4 8 C Arcturus Arcturus Paradise Plus Paradise Plus 2nd STRAND 2nd STRAND MASTER MIX ENZYME MIX Stove at Stove at MOS cree pog Analytical Technologies Analytical Technologies Figure 5 7 White 1 and White 2 Paradise PIuS Reagent System User Guide 12872 00 Rev C 5 3 Protocol 6 Add 2 Strand Synthesis components separately in the order listed in the following table If you are performing several amplifications you may w Complete 2 Strand Synthesis Mix based on the following tz gt JAE AAR AL Complete 2 2 Strand Synthesis Mix to each sample Mix thoroughly by tlicking the tube and spin down Table 5 11 Complete 2 Strand Synthesis Mix 6 reaction Master Mix with Component Amount uL Vial 10 overage uL 2 d Strand Master Mix 29 White 1 191 4 2 d Strand Enzyme Mix 1 White 2 6 6 Total per sample 30 198 0 Store at 4 C until use 7 Incubate the sample as follows 25 C 10 minutes e 37 C 30 minutes e 70 C 5 minutes e 4 8 C Hold until ready to proceed up to a maximum of 30 minutes NOTE Place components back onto the cold block or refreeze immediately after dispensing the reagent Do not leave reagents at room temperature for any extended period of time 5 8 3 PARADISEG PLUS ROUND ONE cDNA PURIFICATION 1 Add 250 pL of DNA Binding Buffer DB to a DNA RNA Purification Column seated in the collection tube provided Hold for
91. ps Table 5 9 Paradise P S Time Requirements JAE VAAL Paradise Plus 15t Round 2 Rou Steps hours hours 13 Strand Synthesis 3 5 2 2 d Strand Synthesis 1 1 cDNA Purification 0 5 0 5 Total before IVT 5 3 5 In Vitro Transcription 8 8 aRNA Purification 0 5 0 5 Total 13 5 12 NOTE Samples requiring labeling for microarrays biotin Cy3 Cy5 labeling protocol will take an additional 30 45 minutes NOTE For samples processed using the optional IVT Master Mix an additional 2 5 hours will be required for amino allyl aRNA labeling NOTE Do not allow incubation times and temperatures to deviate from the protocol NOTE The 4 C steps in the thermal cycler program allow for buffer and reagent addition and mixing steps at certain points during the amplification process and are not intended for indefinite hold unless noted 5 2 5 PROTOCOL NOTES 1 When adding reagent to samples or master mixes pipette mixtures up and down several times to ensure complete transfer of reagent from the pipette tip 2 Prior to the first use of an enzyme gently mix do not vortex and briefly microcentrifuge the vial to ensure that all enzyme is mixed and collected at the bottom of the vial Enzyme may collect on the vial wall or cap during shipment 3 Keep thawed reagents and reaction tubes in cold blocks at 4 C while adding reagents to samples 4 Prior to each incubation mix samples thorough
92. r two minutes Check the purification column for any residual wash buffer If any wash buffer remains re centrifuge at 16 000 x g for one minute NOTE Avoid splashing flow through in the collection tube onto the purification column If flow through waste liquid wets the outside of the purification column re centrifuge the column at 16 000 x g to remove the liquid Discard the collection tube and flow through Place the purification column into a new 0 5 mL microcentrifuge tube provided in the kit and carefully add 12 pL of RNA Elution Buffer RE directly to the center of the purification column membrane Gently touch the tip of the pipette to the surface Paradise PIus Reagent System User Guide 12872 00 Rev C 45 5 RNA Amplification of the membrane while dispensing RE to ensure maximum absorption of RE into the membrane Gently tap the purification column to distribute t UM D TAG AAR RNA RE ELUTION BUFFER Store at D om Teen MDS Aralytcal Technologies Figure 5 16 Elution Buffer RE 8 Incubate at room temperature for one minute 9 Place each column tube assembly into the centrifuge rotor with the 0 5 mL tube cap trailing the tube 10 Centrifuge at 1 000 x g for one minute immediately followed by 16 000 x g for one minute Discard the purification column and retain the elution containing the aRNA NOTE Tubes must be properly oriented in the rotor during elution See Section 5 2 7 Rotation
93. r Guide 12872 00 Rev C 4 3 Protocol 4 3 3 NOTE To avoid potential breakage of the microcentrifuge tube cap during centrifugation insert the purification column 0 5 mL tube asse un mL tube Insert this assembly into adjacent rotor holes as illustr gt VAESVA7t ATK AS4AL against the tube immediately clockwise to it Place an empty i the rotor hole adjacent in the clockwise direction to the last assembly TISSUE SCRAPE PROTOCOL NOTE One vial of proteinase K is adequate for 3 tissue scrape samples NOTE Use a new scalpel blade for each sample to avoid cross contamination NOTE Discard flow through waste when the waste fluid level approaches the bottom surface of the purification column Slide preparation Follow slide prep protocol Section 3 3 1 Deparaffinization Staining and Dehydration no staining IMPORTANT f you are not staining your tissue use the following protocol Otherwise if you are staining you tissue use the deparaffinization staining and dehydration protocol found in Chapter 3 section Ill part b 1 Label three plastic slide jars as follows a Xylene b Xylene c Xylene 2 Fill each of the three jars with 25 mL of certified histology grade Xylene 3 Retrieve up to four of the prepared slides 4 Ifthe slides have been frozen place them in a 50 60 C incubation oven for 2 minutes NOTE Do not perform this step if the slides have been at room temperature 5 Place the slides in jar A
94. re performed on the samples using the house keeping gene GAPDH The same amount of RNA for frozen and FFPE RNA was input into each reaction The ParadisePLUS reagent system gave the lowest delta Ct difference values between the frozen material and the FFPE material Ct FFPE Ct Frozen indicating that RNA extracted from the ParadisePLUS reagent system most accurately represents the RNA extracted from pristine frozen material Data provided by M Davey and R Oullette Atlantic Cancer Research Institute Moncton NB Canada FFPE LCM 2 FFPE LCM 1 H 12 LL Frozen LCM 8 FFPE LCM Log2 scatter plots generated using raw fluorescence intensity data from Affymetrix GeneChips with Pearson correlation coefficients calculated for A frozen LCM replicates r 0 970 B FFPE LCM replicates r 0 961 C FFPE scrape compared to LCM r 0 932 and D frozen LCM to FFPE LCM r 0 937 Genes that fall on the green line have equal intensities on both arrays and ones falling outside the red lines have two fold or greater differ ence in intensity between the two chips The technical reproducibility of FFPE samples in almost identical to that of frozen samples The decrease in correlation between scrape and LCM reflects the gene expression differences between mixed cells and pure cells highlighting the benefit LCM provides over tissue scrapes to isolate more pure samples A similar decrease in correlation is seen between froz
95. reliminary Steps 5 2 8 5 2 9 5 2 10 Rotation D WAG RAR Figure 5 2 Centrifuge CONTROL AMPLIFICATIONS A control RNA sample is provided along with each kit to be used as a control template to verify amplification efficacy Use 10 pL of this RNA for control amplifications 10 pL of this RNA contains 5 ng of formalin fixed total RNA Enough control RNA is provided for three control reactions per six reaction kit The control RNA provides a good positive control to assess amplification efficiency and success when run in parallel with samples following the procedures outline in the Appendix WORK SPACE RECOMMENDATIONS Due to the high sensitivity of the reagents it is very important to prevent RNA DNA and nuclease contamination Work surfaces should be cleaned before and after each use Perform all dispensing in a work hood that has been irradiated with UV to remove contaminants from previous amplification experiments IMPORTANT ADDITIONAL CONSIDERATIONS MDS Analytical Technologies strongly recommends performing quality assessment of FFPE samples In order to complete the Sample Assessment Protocol a universal reference RNA Stratagene must also be run in parallel in addition to the FFPE samples Please see the Appendix for protocol details NOTE MDS Analytical Technologies recommends using quantitative real time PCR for the most accurate measurement of RNA quantity of FFPE samples Paradise Plus Reagent System Us
96. rface of the membrane while dispensing the elution buffer to ensure maximum absorption of EB into the membrane 12 Incubate the column for one minute at room temperature 13 Place each column tube assembly into the 2 ml support tube in the rotor with the 0 5 ml tube cap trailing the tube 14 Centrifuge the column for one minute at 1 000 x g to distribute EB in the column and then spin for one minute at 16 000 x g to elute RNA The entire sample may be used immediately or stored at 70 C or below NOTE Flow through waste following centrifugation is usually present as only a small volume and therefore it is not necessary to discard the flow through waste after every centrifugation step Make sure that the accumulated flow through waste does not make contact with the purification column Flow through waste should be discarded when the waste fluid level approaches the surface of the purification column NOTE Prior to use mix Binding Buffer BB thoroughly Binding Buffer BB may form precipitate upon storage Dissolve precipitate prior to use by mixing thoroughly If necessary warm the BB vial to re dissolve Binding Buffer prior to use NOTE Remove all traces of wash buffer prior to transferring purification column to the new microcentrifuge tube To remove wash buffer discard flow through waste and re centrifuge the column for one minute at 16 000 x g Rotation Figure 4 6 Centrifuge Paradise PIus Reagent System Use
97. rocentrifuges should be calibrated to deliver the correct centrifugal force Check amplification efficiency using control RNA Use higher RNA inputs to compensate for lower message content Paradise Plus Reagent System User Guide 12872 00 Rev C JAE VAAL 89 90 H Troubleshooting Symptom Low Molecular Weight Product Appears ona Gel Cause Occasionally a predominant band below the expected aR Suggr gel This band will lead to improper estimation of yield and may result in high backgrounds on microarrays The Paradise Plus Kit components are formulated and tested to avoid the synthesis of this material However if low molecular weight material is present one of the following may be occurring Quality of the starting RNA is inadequate Poor RNA quality can lead to the formation of the reaction artifact visible as a low molecular weight band Check the quality of your input RNA One approach is to utilize the Agilent Bioanalyzer System with an RNA LabChip Kit For additional recommendations to check for the quality of the input RNA contact Technical Support Concentrations of Primer 1 Primer 2 Primer 3 or 15t Strand Nuclease Mix are incorrect due to inadequate thawing or dispensing Thaw and thoroughly mix each reagent vial prior to dispensing If incompletely thawed and mixed the concentrations of these reagents may not be dispensed at optimal concentrations for the r
98. s when using an alternative labeling kit due to IVT efficiency 2 Perform Round Two of amplification through cDNA Purification according to the Kit protocol Stop at the end of Chapter 5 Section 3 Step H Round Two cDNA Purification 3 Perform RNA transcript labeling according to the protocol of the IVT labeling kit using the sample from step 2 above as the cDNA template Adjust the final volume of the cDNA sample as necessary Antisense RNA Purification NOTE Use the remaining components from RA7011 used during the amplification process 1 Add 250 pL of RNA Binding Buffer RB to a new purification column and incubate for five minutes at room temperature Centrifuge at 16 000 x g for one minute RNA RB BINDING BUFFER Store at RDS Room Temp Analytical Technologies Figure E 1 RNA Binding Buffer Paradise Plus Reagent System User Guide 12872 00 Rev C 79 E Generation of Labeled aRNA Using Alternative IVT Kits 2 Add 200 pL of RB to the Transcript Labeling Reaction sample and mix thoroughly Pipette the entire sample volume into the purification column M D TAG AAR 3 Centrifuge at 100 x g or lowest speed setting available for twe AE REN followed by a centrifugation at 10 000 x g for 1 minute 4 Add 200 pL of RNA Wash Buffer RW to the purification column and centrifuge at 10 000 x g for one minute RNA RW wes BUFFER Store at RDS Room Temp Analytical Technologies Figure E 2 Fi
99. ses entering the sample following preparation increases with the amount of time between slide preparation and RNA isolation Use FFPE sections that are within 2 weeks of cutting Extended storage of sections after being cut from blocks may result in RNA degradation Verify quality of initial tissue sample or LCM slide see A 1 Poor quality RNA may not bind effectively to the purification column membrane decreasing overall RNA yield Paradise Plus Reagent System User Guide 12872 00 Rev C H 3 Amplification H 3 AMPLIFICATION Symptom Amplification yield is Poor Cause Starting RNA sample quality varies Suggest If you observe low yields with different RNA samples run an amplification control using the Control RNA provided in the Paradise Plus Kit to verify kit functionality Starting RNA sample quality has been compromised The greatest factor affecting amplification efficiency is the integrity of the RNA used in the Paradise Plus amplification process Suspend RNA in nuclease free water prior to amplification Avoid using organic solvents such as phenol in RNA isolation protocols There is no RNA in the input sample Run acontrol RNA sample with a known quantity of RNA to ensure that amplification is successful Reagent concentrations in reaction mixtures are incorrect due to inadequate thawing or mixing Ensure all reagents are completely thawed mixed and all so
100. sfer the slides to plastic slide jar c containing 100 ethanol for 2 minutes Invert jar gently Transfer the slides to plastic slide jar d containing 95 ethanol for 1 minute Transfer the slides to plastic slide jar e containing 75 ethanol for 1 minute Transfer the slides to plastic slide jar f containing nuclease free water for 30 seconds 10 Using an RNase free pipette tip apply 100 pL of the Paradise iu Staining Solution 11 so that it covers the entire section Stain for 15 45 seconds at room temperature Tap off excess stain before proceeding with the following steps Transfer the slides to plastic slide jar g containing 75 ethanol for 30 seconds 12 Transfer the slides to plastic slide jar h containing 95 ethanol for 30 seconds 13 Transfer the slides to plastic slide jar i containing 10096 ethanol for 1 minute 14 Transfer the slides to plastic slide jar j containing xylene Hold slides in xylene until ready for microdissection The minimum incubation in xylene should be 5 minutes or up to a maximum of 2 hours Paradise Plus Reagent System User Guide 12872 00 Rev C 15 16 3 Sample Preparation and Staining 15 Place the slides on a Kimwipe to dry in the hood for five to ten minutes prior to LCM LCM should be performed within 2 hours after remov D 2e ART 16 Discard all used staining and dehydration solutions according NOTE Carry out the Staining and
101. slide on end in a vertical not horizontal position to allow water to drain away from section Air dry the slide for a minimum of 30 minutes at room temperature Discard any slides that have wrinkles or folds in the section 7 Proceed immediately to the Deparaffinization Staining and Dehydration segment of the protocol or store slides at 70 C in a microslide box for up to two weeks 8 After completion of the slide preparation process remove any paraffin debris from the microtome Clean surfaces with a Kimwipe soaked with RNase Away and dry all surfaces Discard water from water bath and clean the interior with RNase Away and dry all surfaces 14 Paradise Plus Reagent System User Guide 12872 00 Rev C 3 3 Protocol 3 3 2 DEPARAFFINIZATION STAINING AND DEHYDRATION 1 Label 10 plastic slide jars as follows ce D DAE NIA a Xylene b Xylene c 100 ethanol d 9596 ethanol e 75 ethanol h Nuclease free water g 75 ethanol h 95 ethanol i 100 ethanol j Xylene Using the LCM certified solutions provided fill the labeled plastic slide jars with 25 ml of the appropriate solution Remove up to four slides from the slide box or from the 70 C freezer and place in a 50 60 C oven for 2 minutes Place the slides in plastic slide jar a containing xylene for 2 minutes Invert jar gently Transfer the slides to plastic slide jar b containing xylene for 2 minutes Invert jar gently Tran
102. stoGene LCM Frozen Section Staining Kit The HistoGene LCM Frozen Section Staining Kit is used to process tissue sections for LCM that maximizes the quality and yield of RNA from LCM cells The kit comes with all dehydration and staining reagents disposable staining jars specially treated slides and detailed protocol and troubleshooting guide KITO401 72 slides HistoGene LCM Immunofluorescence Staining Kit The HistoGene LCM Immunofluorescence Staining Kit is the only kit designed to enable retrieval of high quality RNA from immunofluorescently stained frozen tissue It enables convenient and reliable staining dehydration and LCM of tissue sections with protocols streamlined and optimized both for optimal LCM captures and maintaining RNA quality for downstream applications that require intact RNA like microarray analysis and RT PCR KITO420 32 slides PicoPure RNA Isolation Kit For extraction and isolation of total RNA from small samples particularly Laser Capture Microdissected LCM cells The PicoPure RNA Kit comes with optimized buffers MiraCol Purification Columns and an easy to use protocol to maximize recovery of high quality total cellular RNA ready for amplification with the RiboAmp PIS RNA Amplification Kits KIT0204 40 isolations PicoPure DNA Extraction Kit The PicoPure DNA Extraction Kit is optimized to maximize the recovery of genomic DNA from 10 or more cells captured by LCM The kit comes with
103. t System binding buffer BB into the cell extract from Part 1 RNA Extraction Mix well by pipetting up and down DO NOT CENTRIFUGE Pipette 21 uL of Ethanol Solution EtOH into tube and mix well 3 Pipette the cell extract mixture into the preconditioned purification column The cell extract mixture will have a combined volume of approximately 42 pL 4 To bind RNA centrifuge for 2 minutes at 100 x g immediately followed by a centrifugation at 16 000 x g for 1 minute 5 Pipette 100 pL Wash Buffer 1 W1 into column and centrifuge for 1 minute at 8000 xg Paradise Plus Reagent System User Guide 12872 00 Rev C 23 4 RNA Extraction Isolation Mix 2 pL DNase Mix DNase with 18 pL of DNase buffer DNB Add 20 pL mixture to the column and incubate at room temperature for AREA Pipette 40 pL Wash Buffer 1 W1 into the purification colur JAt vf NEN one minute at 8000 x g Pipette 100 pL Wash Buffer 2 W2 into the purification column and centrifuge for one minute at 8000 x g Pipette another 100 pL Wash Buffer 2 W2 into the purification column and centrifuge for two minutes at 16 000 x g Check the purification column for any residual wash buffer If wash buffer remains at 16 000 x g for one minute 10 Transfer the purification column to a new 0 5 mL microcentrifuge tube provided 11 Pipette 12 pL Elution Buffer EB directly onto the membrane of the purification column Gently touch the tip of the pipette to the su
104. ture Store the DNase I solution and DNase Buffer at 70 C until use Once the reagents are used storage at 20 C is recommended Amplification The Paradise amplification kits have both room temperature and frozen components The room temperature components should be stored at normal room temperature The frozen components are shipped on dry ice and should be stored at 70 C until initial use After initial use 20 C is recommended to prevent unnecessary freeze thaws of the enzymes The control RNA and any RNA generated from Paradise kits should always be stored at 70 C The Control RNA vial should be stored at 70 C or below immediately upon arrival to ensure maximum stability For optimal results using the reagents as soon as possible after receipt is recommended Expiration All reagents included with the system should be used within six 6 months of receipt MATERIAL SAFETY AND DATA SHEET MSDS Material Safety and Data Sheets MSDS for kit chemical components are available from the MDS Analytical Technologies web site at www moleculardevices com They may also be acquired by calling MDS Analytical Technologies Technical Services 1 800 635 5577 or 1 408 747 1700 or send an email inquiry to support moldev com Paradise Plus Reagent System User Guide 12872 00 Rev C 3 1 Introduction 1 7 RELATED ARCTURUS PRODUCTS Most common part numbers provided Additional configurations individual need Hi
105. ture at 4 8 C in the thermal cycler overnight 4 Move the samples directly to a 4 8 C block 5 Add 1 pL DNase Mix Blue 4 Mix thoroughly and spin down Incubate at 37 C for 15 minutes Chill the sample s to 4 8 C Proceed immediately to aRNA purification IVT 4 DNASE MIX Figure 5 13 Blue 4 44 Paradise Plus Reagent System User Guide 12872 00 Rev C 5 3 Protocol PARADISE PLUS ROUND ONE aRNA PURIFICATION Add 250 pL of RNA Binding Buffer RB to a new purificatic Eas for five minutes at room temperature Centrifuge at 16 000 x JAtJ WO EAE RNA RB BINDING BUFFER Store at aps Room Temp Analytical Technologies Figure 5 14 Binding Buffer RB NOTE RNA Binding Buffer RB must be at room temperature and thoroughly mixed before use A precipitate may form during long term storage Dissolve precipitate prior to use by mixing If necessary warm the RB vial to re dissolve Add 120 pL of RB to the IVT reaction sample and mix thoroughly Pipette the entire volume into the purification column To bind aRNA centrifuge at 100 x g or lowest speed setting available for two minutes immediately followed by a centrifugation at 10 000 x g for one minute to remove flow through Add 200 pL of RNA Wash Buffer RW to the purification column and centrifuge at 10 000 x g for one minute Figure 5 15 Wash Buffer RW Add 200 pL of fresh RW to the purification column and centrifuge at 16 000 x g fo
106. turus Paradise PS 2 Round KIT0324 A 6 x x x x 1x 1x 1x 1x x Amino Allyl 6 Amplification RA7018 RA7011 RA7010 RA7012 only Arcturus Paradise PUS 2 Round KIT0314 NS 12 x 1x 1x 1x 2x 2x 2x 2x x Amino Allyl 12 reactions No RA7014 RA7007 RA7001 RA7018 RA7011 RA7010 RA7012 solvents Arcturus Paradise P S 2 Round KIT0324 NS 6 x 1x 1x 1x 1x 1x 1x 1x x Amino Allyl 12 ext iso 6 amp RA7014 RA7007 RA7001 RA7018 RA7011 RA7010 RA7012 No solvents Arcturus Paradise P S 2 round KITO302 48 2x 2x ax 4x 8x 8x 8x x x Bulk 48 reactions RA7013 RA7014 RA7007 RA7001 RA7018 RA7011 RA7009 Arcturus Paradise P S 2 round KITO304 48 2x 1x ax 4x 8x 8x 8x 8x x Bulk 48 reactions RA7013 RA7014 RA7007 RA7001 RA7018 RA7011 RA7010 RA7012 Arcturus Paradise P 5 qrtPCR kit KITO310 12 1x 1x 1x 1x 2x 1x 2x x x 12 reactions RA7013 RA7014 RA7007 RA7001 RA7018 RA7011 RA7008 Arcturus Paradise PIUS qrtPCR kit KIT0310 NS 12 x 1x 1x 1x 2x 1x 2x x x 12 reactions No Solvents RA7014 RA7007 RA7001 RA7018 RA7011 RA7008 Arcturus Paradise PIUS qrtPCR kit KITO300 48 2x 1x 4x 4x 8x 4x 8x x x Bulk 48 reactions RA7013 RA7014 RA7007 RA7001 RA7018 RA7011 RA7008 Arcturus Paradise P S grtPCR kit KITO300 NS 48 x 1x 4x 4x 8x 4x 8x x x Bulk 48 reactions No RA7014 RA7007 RA7001 RA7018 RA7011 RA7008 solvents Arcturus Paradise PIS QC Kit KIT0313 12 x x 1x 1x 1x x x x x 12 rea
107. verse transcription application with the Paradise cDNA kit see Section 1 7 Related Arcturus Products or www molecualrdevices com for more information END OF ROUND 2 Paradise Plus Reagent System User Guide 12872 00 Rev C 55 56 5 RNA Amplification Paradise Plus Reagent System User Guide 12872 00 Rev C D DAE TARA A 1 A 2 D TAG RAR A Applications of aRNA The Paradise Plus Reagent System can be used to yield a suitable labeled RNA sample for hybridization to nucleic acid in a variety of formats The RNA sample may be labeled in a number of different ways including those listed below DIRECT aRNA LABELING WITH TURBO LABELING KIT After analysis of the aRNA with the Agilent Bioanalyzer see Section G 1 Assessment of Rna Quality Using the Agilent Bioanalyzer or by gel electrophoresis see Section G 2 Analysis of aRNA by Agarose Gel Electrophoresis as described in Round Two Antisense RNA aRNA Purification aRNA may be directly labeled with a biotin or a fluorescent marker Direct mRNA labeling can be accomplished using the Turbo Labeling kits KITO608 Turbo Labeling Biotin 12 reactions KITO609 Turbo Labeling Cy3 12 reactions KITO610 Turbo Labeling Cy5 12 reactions For more information go to www moleculardevices com turbo DIRECT cDNA FLUORESCENT LABELING For use with complete 2 round kits The protocol described here may be used to prepare Cy3
108. y serve as a guide for qRT PCR experi LL we a converted to cDNA as a template Protocol Reverse Transcription 1 MDS Analytical Technologies recommends an aliquot of 100 ng of amplified RNA from each sample in a volume of 10 pL Add 1 pL of 5 mg ml random hexamer Mix well by flicking and then briefly spin down by centrifugation for 2 minutes in thermal cycler Incubate samples at 70 C for 10 minutes Chill sample to 4 C Assemble a master mix with the following components components listed are for one reaction Table A 3 Master Mix Components Item Volume uL Vendor Catalog First Strand Buffer 4 Invitrogen 18080 044 0 1M DTT 2 Invitrogen 18064 044 10 mM dNTP 1 Amersham US77212 500uL Rnasin 1 Promega N2511 Superscript III 1 Invitrogen 18064 044 Total 9 6 When incubation Step 4 is complete mix the tube well by flicking and then briefly spin down by centrifugation 7 Add 9 pL of the First Strand Master Mix to each reaction tube 8 Incubate at 27 C for 10 minutes followed by 37 C for 1 5 hours in the thermal cycler 9 The sample is now ready for Q PCR qRT PCR Please consult the protocol from the system manufacturer 60 Paradise Plus Reagent System User Guide 12872 00 Rev C D TAG RAR B Sample Assessment Protocol MDS Analytical Technologies recommends performing this simple in process protocol to assess the quality of RNA in FFPE tissue blocks Th
109. y tap the purification column to distribute the buffer if necessary Paradise Plus Reagent System User Guide 12872 00 Rev C 5 3 Protocol 5 3 9 D aAEJCCHKCEGE DNA D E ELUTION BUFFER Sho at ADS Room Temp Acalytical Technologies Figure 5 24 Elution Buffer DE 7 Incubate for one minute at room temperature 8 Place each column tube assembly into the 2 mL support tube in the rotor with the 0 5 mL tube cap trailing the tube 9 Centrifuge at 1000 x g for one minute followed immediately by 16 000 x g for one minute Discard the column and retain the elution containing the cDNA Rotation Figure 5 25 Centrifuge NOTE To avoid potential breakage of the microcentrifuge tube cap during centrifugation insert the purification tube 0 5 mL tube assembly into a lidless 1 7 2 0 mL tube Insert this assembly into adjacent rotor holes as illustrated Rest the tube cap against the tube immediately clockwise to it Place an empty lidless 1 7 2 0 mL tube into the rotor hole adjacent in the clockwise direction to the last assembly e It is safe to stop at this point in the protocol You may store the sample overnight at 20 C IMPORTANT 7 5 Round Customer KIT 0301 KITO301 NS KITO311 amp KITO311 NS STOP HERE and proceed to Appendix G 3 Generation of Labeled aRNA Using Alternative IVT Kits PARADISE PLUS ROUND TWO IN VITRO TRANSCRIPTION 1 Thaw IVT Buffer Blue 1 Master Mix Blue 2 and Enhan
110. ystem User Guide D WAG RHA Copyright Copyright 2008 MDS Analytical Technologies All rights reserved No part of this publication may be reproduced transmitted transcribed stored in a retrieval system or translated into any language or computer language in any form or by any means electronic mechanical magnetic optical chemical manual or otherwise without the prior written permission of MDS Analytical Technologies 1311 Orleans Drive Sunnyvale California 94089 United States of America This product is licensed for sale only for research use It is NOT licensed for any other use There is no implied license hereunder for any commercial use Commercial use is any use other than internal life sciences research and development including the sale lease license or other transfer of the material or any material derived or produced from it to any third party the sale lease license or other grant of rights to a third party to use this material or any material derived or produced from it and the use of this material to perform services for a fee for third parties If you require a license to use this material for commercial uses and do not have one please return this material unopened to MDS Analytical Technologies and any money paid for the material will be refunded Trademarks ARCTURUS HISTOGENE RIBOAMP SYSTEMS FOR MICROGENOMICS PICOPURE AUTOPIX CAPSURE PIXCELL PARADISE GENEPIX and ACUITY are registered trademar
111. ytical Technologies Figure 5 4 Red 1 Red 2 Yellow E and SuperScript III 6 Add 1 Strand Synthesis components in the order listed in the following table If you are performing several amplifications you may wish to prepare a Complete 1 Strand Synthesis Mix based on the following table and add 9 0 pL Complete 1 Strand Synthesis Mix to each sample Mix thoroughly by flicking the tube and spin down DO NOT VORTEX 38 Paradise 5 Reagent System User Guide 12872 00 Rev C 5 3 Protocol Table 5 10 Complete 15 Strand Synthesis Mix D WAG RAR Amount 6 reac Component Vial f uL with 10 overage uL Enhancer 2 Yellow E 13 2 15 Strand Master Mix 5 Red 1 33 0 13 Strand Enzyme Mix 1 Red 2 6 6 SuperScriptTM Ill Enzyme 1 6 6 Total per sample 9 59 4 Not included in the kit NOTE Place components back onto the cold block or refreeze immediately after dispensing the reagent Do not leave reagents at room temperature 7 Incubate at 42 C for 1 5 hours then chill the sample to 4 8 C for at least one minute Do not hold samples at this step for a prolonged period of time Keep samples at 4 8 C until next incubation 8 Optional You may remove a 2 0 pL sample at this point in the protocol to assess the integrity of the starting mRNA by Quantitative Real Time PCR qRT PCR NOTE This may reduce your final yield IMPORTANT QC Kit Customers KIT0313 STOP HERE and continue to ap

Paradise Plus Guiide_RevC.book

Contents

Download Pdf Manuals

Related Search

Related Contents