- Diagenode
Contents
1. Library Amplification Master Mix Component Cap color Volume Reaction Library Amplification Buffer Green 25 0 uL Library Amplification Enzyme Green 1 0 uL Nuclease Free Water plus fluorescent dyes Green 4 0 uL If monitoring in real time Fluorescence dyes for detection and optical calibration are added when monitoring amplification in real time during cycling Please refer to the real time PCR instrument s user manual for calibration dye recommendations The volume of detection and calibration dyes plus nucleasefree water should not exceed 4 uL o Example Mix 90 ul of 20X EvaGreen dye Biotium Cat No 31000 T EvaGreen Dye 20X in water with 10 uL of 1 500 dilution of Fluorescein Bio Rad Laboratories Cat No 170 8780 Fluorescein Calibration Dye Add 2 5 uL of this mix and 1 5 uL of nuclease free water per reaction to prepare the Library Amplification Master Mix If not monitoring in real time If a regular thermal cycler is used there is no need to add the dyes use 4 uL of nuclease free water per reaction in the Library Amplification Master Mix e Remove the seal on the PCR plate or open the tube s Add 30 uL of the Library Amplification Master Mix to each well or tube e Add 5 uL of the appropriate Indexing Reagent to each well or tube Library Amplification Master Mix Component Volume Reaction Library Synthesis Reaction Product 15uL Library Amplification Master Mix 30 uL Indexin2. www diagenode com diagenctie PAGE 10 DIAGENODE MICROPLEX LIBRARY PREPARATION USER MANUAL MicroPlex kit v2 48 rxns 48 indices Indexing Reagents are pre dispensed and sealed in a linear barcoded Index Plate The Index Plate is sealed with foil that can be pierced with a multichannel pipet tip to collect the required amount of index to assemble the reactions Each well of the Index Plate contains sufficient volume for a single use No more than 4 freeze thaw cycles are recommended for the Index Plate 3 7 Using Illumina Experiment Manager Make sure the latest version of the Illumina Experiment Manager IEM is installed version 1 8 or later Prior to starting the MicroPlex Library Preparation kit v2 Protocol Section D create a Sample Sheet in the IEM to select and validate appropriate indexes to use in your experiments Refer to Appendix 1 for guidelines on using the IEM to validate your index combinations 3 8 Target Enrichment MicroPlex v2 is compatible with the major exome and target enrichment products including Agilent SureSelect Roche NimbleGen SeqCap EZ and custom panels 4 MicroPlex Library Preparation kit v2 Protocol 4 1 Template Preparation Step Template Preparation Reagents Template Preparation Reagents Reagent Cap color Template Preparation Buffer Red Template Preparation Enzyme Red NOTE Assemble all reactions in thin wall 96 well PCR plates or PCR tube s that are
3. Thermo Fisher Scientific Inc imbleGen and SeqCap are registered trademarks of Roche icoGreen Quant iT and Qubit are registered trademarks of Life Technologies ippin Prep is a registered trademark of Sage Science Inc vuU zZ Innovating Epigenetic Solutions PAGE 23 MicroPlex Library Preparation kit v2 is intended for Research Use Only It may not be used for any other purposes including but not limited to use in diagnostics forensics therapeutics or in humans MicroPlex Library Preparation v2 may not be transferred to third parties resold modified for resale or used to manufacture commercial products without prior written approval of Diagenode sa The 8nt index sequences were developed by the Wellcome Trust Sanger Institute in Cambridge UK additional information can be found in Nature Methods 7 111 118 2010 Illumina is a registered trademark of Illumina Inc MicroPlex Library Preparation Kit v2 x12 12 indices and MicroPlex Library Preparation Kit x48 48 indices contains ThruPLEX technology developed and RUBICON GENOMICS manufactured by Rubicon Genomics Inc Ann Arbor Michigan USA and covered by US Patent 7 803 550 EP1924704 and US and international patents pending www diagenode com diagenctie diagenctie Innovating Epigenetic Solutions
4. Y adapters MicroPlex uses stem loop adapters to construct high quality libraries in a fast and efficient workflow In the first step Template Preparation the DNA is repaired and yields molecules with blunt ends In the next step stem loop adaptors with blocked 5 ends are ligated with high efficiency to the 5 end of the genomic DNA leaving a nick at the 3 end The adaptors cannot ligate to each other and do not have single strand tails both of which contribute to non specific background found with many other NGS preparations In the final step the 3 ends of the genomic DNA are extended to complete library synthesis and Illumina compatible indexes are added through a high fidelity amplification Any remaining free adaptors are destroyed Hands on time and the risk of contamination are minimized by using a single tube and eliminating intermediate purifications 2 3 MicroPlex v2 workflow The MicroPlex Library Preparation kit v2 workflow is highly streamlined Figure 3 and consists of the following three steps Template Preparation for efficient repair of the fragmented double stranded DNA input Library Synthesis for ligation of patented stem loop adapters Library Amplification for extension of the template cleavage of the stem loop adaptors and amplification of the library lllumina compatible indexes are also introduced using a high fidelity highly processive low bias DNA polymerase The three step MicroPlex v2 workflow t
5. are prepared from similar samples with equivalent input amounts then an equal volume of each individual uniquely indexed library can be pooled into one tube for further processing This pooled library is then purified using AMPure XP to remove unincorporated primers and other reagents Once purified the library should be quantified accurately prior to NGS to ensure efficient clustering on the Illumina flowcell Instructions and recommendations on library pooling purification quantification and sequencing are described in the following sections Innovating Epigenetic Solutions PAGE 15 MicroPlex Library Preparation V2 Processing Workflow To normalize If samples of very different inputs used MicroPlex V2 12201 1 Libraries i Y MENTOR assesses Quantify individual i Libraries qPCR or Bioanalyzer Skip if t i purifying Pool individual i A If low samples Libraries i yield individually ide Additional amplification i t ems gt lt AMPure XP Cleanup NR Gel size selection Quantify Pooled Library qPCR Recommended process iati gt Alternative process Figure 5 Workflow for processing the MicroPlex v2 amplified libraries for lllumina NGS 5 2 Library Quantification There are several approaches available for library quantification including real time PCR UV absorption fluorescence detection or sizing and qu
6. to the side of the tube s completely for 2 min until the solution is clear e While keeping the samples in the magnetic stand without disturbing the pellet transfer the supernatant with a pipette into a new tube If not used immediately the purified library can be stored at 20 C 5 6 Library Purification by Gel Size Selection Alternate NOTE Gel size selection is not necessary if AMPure XP purification is performed MicroPlex v2 libraries can be size selected prior to sequencing using agarose gel electrophoresis as described in the lllumina9 Paired End Sample Preparation Guide Illumina Part 1005063 Rev E 2011 Illumina TruSeq DNA Sample Preparation Guide Illumina Part 15026486 Rev C 2012 or by using automated platforms such as LabChip Caliper Life Sciences Pippin Prep Sage Science or a similar technology When using agarose gel electrophoresis extraction of the DNA should be performed with QlAquick Gel Extraction Kit Qiagen Cat No 28704 or MinElute Gel Extraction Kit Qiagen Cat No 28604 following the manufacturer s instructions NOTE The adapters added during the MicroPlex Library Preparation kit v2 process result in an approximately 140 base pair increase in the size of each library 5 7 Sequencing Recommendations The MicroPlex Library Preparation kit v2 generates libraries which are ready for cluster amplification and sequencing on lumina NGS platforms using standard I
7. your library For example for a 200 bp DNA input and taking into account the distribution of fragment size it is recommended to use 300 bp as the approximate size for calculating library concentration NOTE No purification of the template is necessary prior to qPCR due to the large dilution factor Quantify MicroPlex v2 library using the Bioanalyzer Remove an aliquot of each library and dilute as appropriate in TE buffer Load a 1pL aliquot of this diluted sample onto a Bioanalyzer high sensitivity DNA chip Agilent Technologies Cat No 5067 4626 www diagenode com diagenctie PAGE 16 DIAGENODE MICROPLEX LIBRARY PREPARATION USER MANUAL 5 3 Additional Amplification If the results show less than desirable yield the remaining library can be further amplified to attain a higher yield unless a plateau has been reached The additional amplification can only be performed on unpurified libraries MicroPlex v2 libraries can be further amplified with no extra reagents added after storage at 4 C for up to 6 hours or 20 C for up to 7 days To perform this additional amplification spin down a tube or plate containing the library transfer it to a thermal cycler and perform 2 3 PCR cycles as follows Number of Cycles Temperature Time 98 C 20s 2 3 cycles 7220 50s 1 cycle 4 C Hold 5 4 Library Pooling for Purification Individual MicroPlex v2 libraries containing different indexes can be pooled at desired m
8. DIAGENODE MICROPLEX LIBRARY PREPARATION USER MANUAL Product description MicroPlex v2 builds on the innovative MicroPlex chemistry to generate DNA libraries with expanded multiplexing capability and with even greater diversity Kits contain up to 48 Illumina compatible indexes MicroPlex v2 can be used in DNA seq RNA seq or ChIP seq and offers robust target enrichment performance with all of the leading platforms Kit contents MicroPlex Library Preparation kit v2 contains sufficient reagents to prepare up to the specified number of reactions Enough buffers and enzymes are provided for 4 uses or freeze thaw cycles Contents of MicroPlex Library Preparation kit v2 are not interchangeable with other Diagenode products Table 1 MicroPlex Library Preparation kit v2 contents Name Cap color pl rxn 12 reactions 12 indexes 48 reactions 12 indexes 48 reactions 48 indexes Template Preparation Buffer Red 2 24 u 96 u 96 u Template Preparation Enzyme Red 2u 48 u 48 u Library Synthesis Buffer Yellow 2u 484 48 u Library Synthesis Enzyme Yellow 2p 48 u 48 u Library Amplification Buffer Green 25 300 ul 1200 ul 1200 ul Library Amplification Enzyme Green 2u 48 u 48 u uclease Free Water Clear 4 48 u 192 ul 192 ul ndexing Reagents Tube Blue 5 40 u 120 ul ndexing Reagent Plate 5 5 ul The volumes of buffers and enzymes mentioned above are the minimum volumes required t
9. able below To each well or tube add 2 uL of Library Synthesis Reaction Mixture Component Volume Reaction Template Preparation Reaction Product 13 uL Library Synthesis Master Mix 2yuL Total Volume 15 pL e Mix thoroughly with a pipette e Seal the PCR plate using an appropriate sealing film or tightly cap the tube s Centrifuge briefly to collect the contents to the bottom of each well or tube e Return the plate or tube s to the thermal cycler with heated lid set to 101 C 105 C Perform Library Synthesis Reaction using the cycling conditions in the table below Library Synthesis Reaction Temperature Time 22 C 40 min 4 C Hold for lt 30 min www diagenode com diagenctie PAGE 12 DIAGENODE MICROPLEX LIBRARY PREPARATION USER MANUAL e After the thermal cycler reaches 4 C remove the plate or tube s and centrifuge briefly Continue to the Library Amplification Step NOTE Following the Library Synthesis step continue Library Amplification Reaction in the same plate or tube s maintained at 4 C 4 3 Library Amplification Step Multiple stages occur during the Library Amplification Reaction see table in step 8 below Stage 1 and Stage 2 extend and cleave the stem loop adapters Proper programming of the thermal cycler is critical for these steps to be completed correctly with no denaturation step until Stage 3 Illumina compatible indexes are incorporated into t
10. akes place in a single tube or well and is completed in about 2 hours Figure 3 MicroPlex Library Preparation kit v2 workflow overview 3 Getting Started 3 1 Additional Supplies and equipment needed Required supplies and equipment Thermal cycler real time instrument recommended NOTE See thermal cycler considerations below Centrifuge PCR tubes or 96 well PCR plates and seals NOTE Innovating Epigenetic Solutions PAGE 7 DNA samples in a PCR plate or PCR tube Dispense Prepare Template a ES Preparation Master Mix Perform template preparation reaction Dispense Prepare Library mM _ E F synthesis Master Mix Perform Library Indexing reagents i g g synthesis reaction in tubes or index plate nue Dispense Prepare Library A p H 990900008998 L aco amplification Master Mix 0900000000000 000000000000 UNE Perform Library i amplification reaction index to each P well Perform processing purification quantification Select appropriate tubes or plates that are compatible with the thermal cyclers and or real time thermal cyclers used Use appropriate caps or sealing films and seal thoroughly to eliminate evaporation during cycling conditions Evaporation could reduce robustness and reproducibility of the reactions e Low binding aerosol barrier tips e Freshly prepared 80 v v ethanol Agencourt AMPure XP beads Beckman Coulter Cat No A63880 Optiona
11. ample contains unevenly fragmented prior to using the kit Sequencing tecetill DNA of various sizes e g plasma DNA besides the markers recommended After purification of the amplified library Perform fewer PCR cycles at Stage 5 of the Bioanalyzer traces shows broad peak s Library over amplified or Bioanalyzer chip Library Amplification Reaction extending from less than 1 000 bp to greater overloaded common for high sensitivity chips For high sensitivity chips load K 500 pg uL than 1 000 bp Repeat Bioanalyzer run Technical Support For technical support contact custsupport diagenode com or call 1 734 677 4845 9 AM 5 30 PM EST The index sequences correspond to Illumina Index sequences for multiplexing and are copyrighted to Illumina Inc Oligonucleotide sequences 2007 2012 Illumina Inc All rights reserved Agencourt and AMPure are registered trademarks of Beckman Coulter Inc Agilent Bioanalyzer and SureSelect are registered trademarks of Agilent Technologies Inc CFX96 Touch is a trademark of Bio Rad Laboratories Inc EvaGreen is a registered trademark of Biotium Inc lumina 9 HiSeq MiSeq and TruSeq are registered trademarks of Illumina Inc KAPA is a registered trademark of Kapa Biosystems Inc LabChip is a registered trademark of Caliper Life Sciences Inc MinElute and QlAquick are registered trademarks of Qiagen NanoDrop is a trademark of
12. and thermal cycler used When starting with fragmented reference DNA with an average size of 200 bp and following the recommended number of amplification cycles the typical yields range from 300 ng to 700 ng NOTE Over amplification could result in higher rate of PCR duplicates in the library Library Amplification Reagents Library Synthesis Reagents Reagent Cap color Library Amplification Buffer Green Library Amplification Enzyme Green Nuclease Free Water Clear Fluorescent Dyes Indexing Reagents Tubes Blue or Index Plate NOTE It is critical to handle the Index Plate following the provided instructions to avoid cross contamination of indexes If the entire Index Plate will not be used please refer to Appendix 1 for Index Plate handling instructions Innovating Epigenetic Solutions PAGE 13 No more than 4 freeze thaw cycles are recommended for the Index Plate Library Amplification Protocol e Prepare the Indexing Reagents o Remove the Indexing Reagents from freezer and thaw for ten minutes on the bench top o Spin the Indexing Reagents in a table top centrifuge to collect contents at the bottom of the well o Thoroughly wipe the Indexing Reagent Tubes or Index Plate foil seal with 70 ethanol and allow it to dry Prepare the Library Amplification Master Mix as described in the table below for the desired number of reactions Mix thoroughly with a pipette Keep on ice until used
13. antification using the Agilent Bioanalyzer It is important to understand the benefits and limitations of each approach Real time PCR based approaches such as the KAPA Library Quantification Kit from Kapa Biosystems quantify the library molecules that carry the Illumina adapter sequences on both ends and therefore reflect the quantity of the clustering competent library molecules This approach assumes a relatively uniform size of sheared or fragmented starting gDNA inserts used for library construction On the other hand UV absorption fluorescence detection based methods i e Nanodrop Thermo Scientific Qubit 2 0 Fluorometer Life Technologies or Quant iT PicoGreen dsDNA Assay Kit Life Technologies simply quantify total nucleic acid concentration These methods do not discriminate adapter presence and offer no information about the size of the library molecules The Agilent Bioanalyzer system provides sizing and quantitation information about the library analyzed but not about the clustering competency Quantify MicroPlex v2 library by real time qPCR Use the appropriate instrument specific KAPA Library Quantification Kit for Illumina Sequencing Platforms Kapa Biosystems Dilute 2 5 uL of the library using a 100 000 fold dilution and use this as the template for quantification Since the adapters result in an approximately 140 bp increase in the DNA fragment size adjust the length accordingly to calculate the concentration of
14. cles 1 72 C 3 min 1 50 5 Extension amp Cleavage 2 85 C 2 min 1 20 6 Denaturation 3 98 C 2 min 1 10 7 98 C 20s Addition of Indexes 4 67 C 20s 4 5 8 72 C 40s As 98 C 20s A 51016 see 2 10 Library Amplification 72 C 50s table on right 6 4 C Hold 1 1 i Acquire fluorescence data at this step if monitoring amplification in real time 0 2 14 0 05 16 e Remove the PCR plate or tube s from the thermal cycler and centrifuge briefly to collect the contents to the bottom of each well NOTE At this stage samples can be processed for next generation sequencing NGS immediately or stored frozen at 20 C for later processing For instructions and recommendations on library pooling purification quantification and sequencing please refer to Section E 5 Library Processing for Illlumina Next Generation Sequencing 5 1 Overview This section contains guidelines for processing MicroPlex v2 libraries for Illumina NGS In some cases recommended protocols are listed Library Purification by AMPure XP beads while in others general guidelines are given For more information contact technical support at techsupport diagenode com Libraries prepared from each sample will contain the specific indexes selected at the time of the amplification Follow the recommended workflow solid arrows in Figure 5 to process the libraries for lllumina NGS Alternative workflow paths dashed arrows may be followed as needed If libraries
15. compatible with the thermal cycler and or real time thermal cycler used Template Preparation Protocol Prepare samples as described below gt Samples Dispense 10 uL of fragmented doubled stranded DNA into each PCR tube or well of a PCR plate Positive control reactions using reference DNA If necessary assemble reactions using 10 uL of a reference gDNA e g fragmented DNA 200 300 bp average size at an input amount comparable to that of the samples Negative control reactions No Template Controls NTCs If necessary assemble NTCs with 10 uL of nuclease free water or TE buffer e g 10 mM Tris 0 1 mM EDTA pH 8 0 NOTE The maximum volume of DNA cannot exceed 10 uL Prepare Template Preparation Master Mix as described in the table below for the desired number of reactions Mix thoroughly with a pipette Keep on ice until used Template Preparation Master Mix Component Cap color Volume Reaction Template Preparation Buffer Red 2 0 uL Template Preparation Enzyme Red 1 0 uL e Assemble the Template Preparation Reactions Mixture as shown in the table below To each 10 uL sample from step 1 above add 3 uL of the Template Preparation Master Mix Template Preparation Reaction Mixture Component Volume Reaction Template Preparation Buffer 2 0 uL Template Preparation Enzyme 1 0 pL nnovating Epigenetic Solutions e Mix thoroughly with a pipette PAGE 11 e S
16. dexes will be prepared and pooled it is critical that compatible index combinations are used to fulfill Illumina requirements Illumina sequencers use a green laser to sequence G T nucleotides and a red laser to sequence A C nucleotides At each sequencing cycle of the index read at least one of the two nucleotides for each colored laser should be present to ensure proper image registration and ensure accurate demultiplexing of the pooled samples Follow the steps below before beginning the MicroPlex Library Preparation v2 Protocol if using less than the full set of indexes included with the kit Determine the number of libraries that will be pooled for sequencing Select the appropriate index combinations for multiplexing and pooling e Use the Illumina Experiment Manager IEM to create a Sample Sheet which will be used during the sequencing run The IEM can detect and warn of sub optimal index combinations allowing re design before library preparation starts Innovating Epigenetic Solutions PAGE 19 Appendices 1B to 1D provide index sequences plate handling instructions multiplexing and index pooling guidelines and Sample Sheet setup instructions specific for each MicroPlex Library Preparation kit v2 o For MicroPlex v2 12 rxns 12 indices proceed to point 2 9 For MicroPlex v2 48 rxns 48 indices proceed to point 3 2 MicroPlex Library Preparation kit v2 x12 12 indices Single Index Sequences MicroPlex v2 single index
17. diagenctie Innovating Epigenetic Solutions MicroPlex Library Preparation kit v2 High Performance Library Preparation for lllumina NGS Platforms Cat No C05010012 12 rxns 12 indices C05010013 48 rxns 12 indices C05010014 48 rxns 48 indices Contacts DIAGENODE HEADQUARTERS Diagenode s a BELGIUM EUROPE LIEGE SCIENCE PARK Rue Bois Saint Jean 3 4102 Seraing Belgium Tel 32 4 364 20 50 Fax 32 4 364 20 51 orders diagenode com info diagenode com Diagenode Inc USA NORTH AMERICA 400 Morris Avenue Suite 101 Denville NJ 07834 Tel 1 862 209 4680 Fax 1 862 209 4681 orders na diagenode com info na diagenode com For a complete listing of Diagenode s international distributors visit http www diagenode com company distributors php For rest of the world please contact Diagenode sa Diagenode website www diagenode com PAGE 3 Content Product description oso can cae eee ee css sec Be c E REI 4 Kit CONTENTS ep e e tI bu LE 4 tro dte OP EET t ML UE 5 2 MicroPlex library preparation Kit V2 eem ca eem e onere i etn eee 6 Ads EM 6 VA esc 6 2 3 MicroPlex library preparation v2 workflow Re 6 3 Getting Started aes eire te bete vetu inion seeded es beim Deed 6 3 1 Additional supplies and equipment needed 6 3 2 Thermal Cycler on sider HONS ue dee o ee e t tmi ven seeds 7 3 9 Starting material eee een tc reete ei
18. e structure shown in Figure 11 NOTE Information about the Sanger index sequences can be found in Nature Methods 7 111 118 2010 MicroPlex v2 x48 48 indices Well Sanger Tag Sequence Well Sanger Tag Sequence A1 iPCRtagT1 ATCACGTT B1 iPCRtagT13 TGGTTGTT A2 iPCRtagT2 CGATGTTT B2 iPCRtagT14 TCTCGGTT A3 iPCRtagT3 TTAGGCAT B3 iPCRtagT15 TAAGCGTT A4 iPCRtagT4 TGACCACT B4 iPCRtagT16 TCCGICTT A5 iPCRtagT5 ACAGTGGT B5 iPCRtagT17 TGTACCTT A6 iPCRtagT6 GCCAATGT B6 iPCRtagT18 TTCTGTGT A7 iPCRtagT7 CAGATCTG B7 iPCRtagT19 TCTGCTGT A8 iPCRtagT8 ACTTGATG B8 iPCRtagT20 TTGGAGGT A9 iPCRtagT GATCAGCG B9 iPCRtagT21 TCGAGCGT A10 iPCRtagT10 TAGCTTGT B10 iPCRtagT21 TGATACGT A11 iPCRtagT11 GGCTACAG B11 iPCRtagT22 GTGCTACC A12 iPCRtagT12 CTTGTACT B12 iPCRtagT99 GGTTGGAC 1 iPCRtagT25 TGCGATCT D1 iPCRtagT102 GGCACAAC C2 iPCRtagT26 TTCCTGCT D2 iPCRtagT38 TCTCACGG C3 iPCRtagT27 TAGTGACT D3 iPCRtagT39 TCAGGAGG C4 iPCRtagT28 TACAGGAT D4 iPCRtagT40 TAAGTTCG c5 iPCRtagT29 TCCTCAAT D5 iPCRtagT41 TCCAGTCG C6 iPCRtagT30 TGTGGTTG D6 iPCRtagT42 TGTATGCG C7 iPCRtagT31 TAGTCTTG D7 iPCRtagT43 TCATTGAG C8 iPCRtagT32 TTCCATTG D8 iPCRtagT44 TGGCTCAG cy iPCRtagT33 TCGAAGTG D9 iPCRtagT45 TATGCCAG C10 iPCRtagT34 TAACGCTG D10 iPCRtagT46 TCAGATTC C11 iPCRtagT35 TTGGTATG D11 iPCRtagT47 TACTAGTC C12 iPCRtagT36 TGAACTGG D12
19. eal the PCR plate using an appropriate sealing film or tightly cap the tube s Centrifuge briefly to ensure the entire volume of the reaction is collected at the bottom of each well Reaction using the conditions in the table below e Place the plate or tube s in a thermal cycler with heated lid set to 101 C 105 C Perform the Template Preparation Template Preparation reaction Temperature Time 22 C 25 min 55 C 20 min 4 C Hold for lt 2 hours e After the thermal cycler reaches 4 C remove the plate or tube s and centrifuge briefly NOTE Proceed to the Library Synthesis Step Following the Template Preparation Step continue to Library Synthesis Step in the same plate or tube s 4 2 Library Synthesis Step Library Synthesis Reagents Library Synthesis Reagents Reagent Cap color Library Synthesis Buffer Yellow Library Synthesis Enzyme Yellow Library Synthesis Protocol Prepare Library Synthesis Master Mix as described in the table below for the desired number of reactions Mix thoroughly with a pipette Keep on ice unti Library Synthesis Master Mix used Component Cap color Volume Reaction Library Synthesis Buffer Yellow 1 0 uL Library Synthesis Enzyme Yellow 1 0 uL e Remove the seal on the plate or open the tubes the Library Synthesis Master Mix e Assemble the Library Synthesis Reaction Mixture as shown in the t
20. equirements the AMPure purification step following the final step Library Amplification can be replaced with a size selection step to remove unwanted fragments Input volume The maximum input sample volume is 10 uL If a sample is in a larger volume the DNA must be concentrated into 10 uL or less Alternatively the sample may be split into 10 uL aliquots processed in separate tubes and the corresponding products pooled prior to the purification step preceding sequencing Input buffer Input DNA must be eluted or resuspended in a low salt and low EDTA buffered solution The preferred buffer is low TE 10 mM Tris 0 1 mM EDTA pH 8 0 The concentrations of Tris and EDTA must not exceed 10 mM and 0 1 mM respectively Avoid phosphate containing buffers 3 4 Positive and Negative Controls If necessary include appropriate positive and negative controls in the experimental design to help verify that reactions proceed as expected If the experimental samples contain any carryover contaminant s in the buffer the downstream reactions may be impacted and inclusion of controls would help elucidate such problems A suitable positive control reference DNA is sheared purified genomic DNA 200 300 bp of comparable input amount Always prepare fresh dilutions of reference DNA Include a negative control No Template Control NTC with low TE buffer 10 mM Tris 0 1 mM EDTA pH 8 0 or nuclease free water The positive control and experimental sampl
21. es should perform equivalently while the NTC should not amplify 3 5 Preparation of Master Mixes A master mix with appropriate buffers and enzymes must be prepared at each workflow step based on the number of reactions to be performed Transfer the enzymes to ice just prior to use and centrifuge briefly to collect contents at the bottom of the tube Thaw the buffers vortex briefly and centrifuge prior to use Keep all the components and master mixes on ice Once the master mix is prepared thoroughly mix the contents several times with a pipette while avoiding introduction of excessive air bubbles and briefly centrifuge prior to dispensing into the PCR plate or tube s 3 6 Indexing reagents MicroPlex Library Preparation kit v2 includes all necessary reagents including Indexing Reagents for multiplexing samples The Indexing Reagents consist of amplification primers containing lllumina compatible indexes Index sequences can be downloaded as CSV files at the MicroPlex v2 Product Page Before starting the MicroPlex Library Preparation v2 Protocol Section D refer to Appendix for information on index sequences Index Plate handling instructions and multiplexing and index pooling guidelines MicroPlex kit v2 12 rxns 12 indices Indexing Reagents are pre dispensed in 12 individual tubes with blue caps Each tube contains sufficient volume for up to 8 uses No more than 4 freeze thaw cycles are recommended for the Indexing Reagent Tubes
22. es use Illumina compatible 8nt sequences developed by the Wellcome Trust Sanger Institute in Cambridge UK Each Indexing Reagent Tube contains a unique single index sequence The 12 MicroPlex v2 single indexes share the same sequences in the first 6 bases as the Illumina TruSeq LT indexes AD001 through ADO12 Figure 8 The prepared library has the structure shown in Figure 9 NOTE Information about the Sanger index sequences can be found in Nature Methods 7 111 118 2010 MicroPlex v2 x12 12 indices Tube Sanger Tag Sequence TruSeq LT Index TruSeq LT Sequence 1 iPCRtagT1 ATCACGTT AD001 ATCACG 2 iPCRtagT2 CGATGTTT AD002 CGATGT 3 iPCRtagT3 TTAGGCAT AD003 TTAGGC 4 iPCRtagT4 TGACCACT AD004 TGACCA 5 iPCRtagT5 ACAGTGGT AD005 ACAGTG 6 iPCRtagT6 GCCAATGT ADO006 GCCAAT 7 iPCRtagT7 CAGATCTG AD007 CAGATC 8 iPCRtagT8 ACTTGATG ADO008 ACTTGA 9 iPCRtagT GATCAGCG AD009 GATCAG 10 iPCRtagT10 TAGCTTGT AD0010 TAGCTT 11 iPCRtagT11 GGCTACAG AD0011 GGCTAC 12 iPCRtagT12 CTTGTACT AD0012 CTTGTA Figure 7 MicroPlex v2 Single Indexes Each Indexing Reagent Tube contains a unique Illumina compatible 8nt Sanger index sequence The 12 MicroPlex v2 single indexes share the same sequence in the first 6 bases shown in BOLD as the Illumina TruSeq LT indexes AD001 through ADO12 Figure 8 MicroPlex v2 single indexed library structure MicroPlex V2 Single I
23. esktop tool that allows you to create and edit Sample Sheets for Illumina sequencers Index combinations may be validated using the IEM which notifies user when improper combinations are used Make sure the latest version of IEM version 1 8 or later is installed www diagenode com diagenctie PAGE 22 DIAGENODE MICROPLEX LIBRARY PREPARATION USER MANUAL In the IEM on the Workflow Parameters page select TruSeq HT in the dropdown menu for Sample Prep Kit Add indexes to be used on the Sample Selection page by clicking Add Blank Row and then choosing the appropriate indexes from the index 1 17 and index 2 15 dropdown menus Appendix 2 Troubleshooting guide Problem Potential Cause Suggested Solutions Sample amplification curve looks like No No input DNA added Quantitate input before using the kit Template Control NTC amplification curve or Incorrect library template used Adhere to DNA Sample Requirements does not produce amplified product e g RNA ssDNA Section C II Use a fresh control sample and check all reagents replace kit if necessary Clean area thoroughly and use PCR dedicated plastics and pipettes NTC amplification curve appears early or produces a yield similar to sample reaction NTC contaminated with DNA products After purification of the amplified library Bioanalyzer traces shows multiple peaks If possible quantify and check input DNA Input s
24. g Reagent 5 HL Total Volume 50 uL For MicroPlex Library Preparation kit V2 48 rxns 48 indices containing Index Plate o Make sure the two corner notches of the Index Plate are on the left and the barcode label on the long side of the Index Plate is facing you 9 Use a clean pipet tip to pierce the seal above the specific Indexing Reagent on the Index Plate discard the tip used for piercing o Use a clean pipet tip to collect 5 uL of the Indexing Reagent and add to the reaction mixture NOTE Follow the Index Plate handling instructions in Appendix 1 to avoid cross contamination Mix thoroughly with a pipette Avoid introducing excessive air bubbles e Seal the PCR plate or tube s tightly and centrifuge briefly to collect the contents to the bottom of each well or tube NOTE Use optical sealing tape if a real time thermal cycler is used e Return the plate or tube s to the real time PCR thermal cycler thermal cycler with heated lid set to 101 C 105 C Perform Library Amplification Reaction using the cycling conditions in the tables below CAUTION Ensure that the thermal cycler does not have a denaturing step programmed until Stage 3 www diagenode com diagenctie PAGE 14 DIAGENODE MICROPLEX LIBRARY PREPARATION USER MANUAL Library Amplification Reaction Stage 5 Amplification Guide Stage Temperature Time Number of Cycles DNA Input ng Number of Cy
25. he template library in Stage 4 using 4 amplification cycles In Stage 5 the resulting template is amplified the number of cycles required at this stage is dependent on the amount of input DNA used Samples are cooled to 4 C in Stage 6 after which they are pooled and purified or stored at 20 C NOTE Refer to Appendix 1 for selecting the appropriate indexes to use for your experiments Selection of the optimal number of cycles for library amplification Stage 5 A The number of PCR cycles required at Stage 5 of the Library Amplification Reaction is dependent on the amount of input DNA and thermal cycler used Use the table below as a guide for selecting the number of PCR cycles A Stage 5 Amplification Guide DNA Input ng Number of Cycles 50 5 20 6 10 7 5 8 2 10 1 11 0 2 14 0 05 16 Optimization experiment Performing an optimization experiment to identify the appropriate number of PCR cycles needed is recommended Use the desired amount of input DNA and allow the library amplification reaction to reach plateau Determine the optimal number of amplification cycles by constructing PCR curves and identifying the midpoint of the linear phase as illustrated in Figure 5 Use the optimal amplification cycle number in the actual experiment for sequencing Yield The amount of amplified library can range from 100 ng to 1 ug depending upon many variables including sample type fragmentation size
26. iPCRtagT48 TTCAGCTC nnovating Epigenetic Solutions PAGE 21 Figure 9 MicroPlex v2 Single Indexes Each well of the Single Index Plate contains a unique Illumina compatible 8nt Sanger index sequence The first 12 MicroPlex v2 single indexes share the same sequence in the first 6 bases shown in BOLD as the Illumina TruSeq LT indexes AD001 through AD012 MicroPlex V2 Single Indexed Library Structure 5 AATGATACGGCGACCACCGAGATCTACACAGGCGAAGACACTCTTTCCCTACACGACGCTCTTCCGATCT Insert Insert AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCCTTCTGCTTG 3 Sanger index Figure 10 MicroPlex v2 single indexed library structure Libraries prepared from the MicroPlex Library Preparation kit v2 contain the 8nt Sanger index on the 3 end Plate Handling Instructions for Low Throughput Applications MicroPlex v2 48S Kit is designed for high throughput applications therefore the experiment should be designed to pool and sequence the full set of 48 libraries using the entire plate of Indexing Reagents If Indexing Reagents from the entire plate are not used at the same time it is critical to follow the instructions below to avoid cross contamination o After removing Indexing Reagents of choice cover any pierced or used index wells with scientific tape e g VWR Cat No 89097 920 General Purpose Laboratory Labeling Tape 0 5 o Thoroughly wipe the seal with 70 ethanol and allow it to dry completely 9 Replace the
27. icroPlex v2 Libraries were prepared from 50 pg DNA 200 bp using the MicroPlex Library Preparation kit v2 Following library amplification an aliquot of each library was diluted at 1 4 in TE buffer and 1uL of this diluted sample was loaded onto a Bioanalyzer high sensitivity DNA chip Agilent Technologies Subsequent AMPure XP purification step would remove fragments around and below 100 bp Appendix 1 Indexing Reagents 1 Overview MicroPlex Library Preparation kit v2 contains all necessary reagents to generate amplified and indexed NGS libraries including Indexing Reagents for multiplexing up to 96 samples Table 3 below summarizes the characteristics of the included Indexing Reagents which consist of amplification primers containing lllumina compatible indexes Indexing Reagents should be stored at 20 C and should not be subjected to more than 4 freeze thaw cycles NOTE Indexing Reagents provided with MicroPlex Library Preparation kit v2 cannot be substituted with indexing reagents from any other sources Table 2 MicroPlex Library Preparation kit v2 Indexing Reagents 12 rxns 12 indices 48 rxns 48 indices Number of Reactions 12 48 umber of Indexes 12 48 ndex Type Single Single Length of Indexes 8nt 8nt Format 12 Tubes 96 Well Plate Number of Uses Up to 8 Single Gee ce TruSeq LT or Manual Input Manual Input only When libraries with less than the full set of MicroPlex v2 in
28. l Supplies e KAPA Library Quantification Kit lllumina Kapa Biosystems Cat No specific to real time PCR system used e EvaGreen Dye 20X in water Biotium Cat No 31000 T e Fluorescein Calibration Dye Bio Rad Laboratories Cat No 170 8780 3 2 Thermal cycler considerations Thermal cycling and heated lid Use a thermal cycler equipped with a heated lid that can handle 50 uL reaction volumes Set the temperature of the heated lid to 101 C 105 C to avoid sample evaporation during incubation and cycling Thermal cycler ramp rates We recommend a ramp rate of 3 C s 5 C s higher ramp rates are not recommended and could impact the quality of the library Monitoring amplification during the Library Amplification Reaction Amplification can be monitored using a real time thermal cycler with the addition of fluorescent dyes not provided with the kit see Optional Supplies above to the reaction Figure 4 If a regular thermal cycler is used instead there is no need to add the dyes use an appropriate amount of nuclease free water to prepare the Library Amplification Master Mix In www diagenode com diagenctie PAGE 8 DIAGENODE MICROPLEX LIBRARY PREPARATION USER MANUAL the absence of real time monitoring library amplification can be analyzed by gel or by analysis of an aliquot of the library using the Agilent Bioanalyzer see Library Quantification Section E II Depending on the real time instrument used select an a
29. licabased filters for purification as this will result in incomplete removal of primers The ratio of AMPure XP beads to library DNA will determine the size selection characteristics of the library The ratio is also application dependent For most NGS based applications a 1 1 bead to sample ratio is recommended For more information please refer to the vendor s recommendations on AMPure XP protocols for DNA purification Library purification reagents supplied by the user Library Purification Reagents AMPure XP beads Magnetic rack for 1 5 mL centrifuge tubes Freshly prepared 8096 v v ethanol TE buffer pH 8 0 AMPure XP Protocol NOTE o It is important to bring all the samples and reagents to be used to room temperature o Always use freshly prepared 8096 v v ethanol for Step 3 and Step 4 below o Resuspend the AMPure XP reagent by gentle vortexing until no visible pellet is present at the bottom of the container Innovating Epigenetic Solutions PAGE 17 AMPure XP Protocol Continued e Ina 1 5 mL tube mix 100 uL of AMPure XP reagent with a 100 uL aliquot of the pooled library ensuring a 1 1 v v ratio Mix by pipette 10 times to achieve a homogeneous solution and incubate the tube at room temperature for 5 min Pulse spin the sample s on a bench top centrifuge and place the tube in a magnetic stand Wait for 2 min or until the beads are completely bound to the side of the tube s and the sol
30. llumina reagents and protocols for multiplexed libraries Libraries prepared using the MicroPlex Library Preparation kit v2 result in a size distribution of library fragments that is dependent on the input DNA fragment size Figure 6 To achieve optimal cluster density on the Illumina flow cell it is important to adjust he DNA concentration used for clustering based on these preferences For example for sequencing on the Illumina MiSeq v3 load 14 15 pM of MicroPlex v2 libraries with an average size of 300 bp llumina recommends adding 196 PhiX control for most libraries For low diversity libraries and if experiencing sequencing issues increase the PhiX control spike in to at least 596 PhiX is a small genome that can be quickly aligned to calculate error rates It provides a balanced and diverse library to prevent sequencing problems For sequencing on the HiSeq please refer to Illumina s technical note Using a PhiX Control for HiSeq Sequencing Runs Illumina Pub No 770 2011 041 For sequencing on the MiSeq instructions for preparing a PhiX control can be found in Illumina s guide on Preparing Libraries for Sequencing on the MiSeq Illumina Part 15039740 Rev D 2013 www diagenode com diagenctie PAGE 18 DIAGENODE MICROPLEX LIBRARY PREPARATION USER MANUAL Fu 50pg 13 cyc 2 250 200 150 100 50 35 100 200 300 400 600 2000 10380 bp Figure 6 Bioanalyzer analysis of libraries prepared using M
31. ndexed Library Structure 5 AATGATACGGCGACCACCGAGATCTACACAGGCGAAGACACTCTTTCCCTACACGACGCTCTTCCGATCT Insert Insert AGATCGGAAGAGCACACGTCTGAACTCCAGTCACNNNNNNNNATCTCGTATGCCGTCCTTCTGCTTO 3 Sanger index Libraries prepared from the MicroPlex Library Preparation kit v2 contain the 8nt Sanger index sequence on the 3 end Multiplexing and Index Pooling t is very important to select appropriate single indexes such that they are unique and meet the Illumina recommended compatibility requirements In general to ensure proper image registration on the sequencer any low plex combination should include Indexing Reagent Tube 6 iPCRtagT6 and Indexing Reagent Tube 12 iPCRtagT12 these correspond to he Illumina TruSeq LT indexes AD006 and AD012 For additional lowplex 2 to 11 plex pooling guidelines please refer o lllumina s TruSeq Sample Preparation Pooling Guide Illumina Part 15042173 Rev B 2014 NOTE For MiSeq RTA v1 17 28 and later base pair diversity of indexes is no longer checked by IEM because low plexity index reads can be processed for all applications any combination of indexes can be pooled for sequencing on MiSeq www diagenode com diagenctie PAGE 20 DIAGENODE MICROPLEX LIBRARY PREPARATION USER MANUAL Sample Sheet Setup The Illumina Experiment Manager IEM is a desktop tool that allows you to create and edit Sample Sheets for Illumina sequencers To use this tool with MicroPlex indexe
32. o complete 12 or 48 reactions However an excess is included in each tube to cover pipetting loss In the case of the 12 Indexing Reagent tubes 12 rxns it allows up to 8 uses of a particular index In the case of the 12 Indexing Reagent tubes 48 rxns it allows up to 24 uses of a particular index In the case of the Indexing Reagent Plate it allows a single use of a particular index Component volume is target total fill volume to ensure customer can achieve Essential Volume including pipetting loss variation in pipettors in order to perform the specified number of reactions For every component we are supplying at least 15 overfill Shipping and storage MicroPlex Library Preparation kit v2 is shipped on dry ice The kit should be stored at 20 C upon arrival Quality control MicroPlex Library Preparation kit v2 is functionally tested using Next Generation Sequencing NGS to ensure product quality and consistency Safety information Follow standard laboratory safety procedures and wear a Suitable lab coat protective goggles and disposable gloves to ensure personal safety as well as to limit potential cross contaminations during the sample preparation and subsequent amplification reactions Innovating Epigenetic Solutions PAGE 5 1 Introduction Next Generation Sequencing NGS is a dynamic field with rapidly evolving needs Regardless of sample type or application a DNA library must be prepared from each sample in o
33. olar ratios to allow multiplex sequencing of the pooled library If libraries are prepared from similar input amounts they can be pooled by combining equal volume aliquots of each library each containing a unique index or index combination Typically a 10 uL aliquot from each library is adequate and the remainder of the library can be stored at 20 C The total volume obtained at the end of pooling will vary depending on the number of libraries pooled For example if 12 libraries are pooled then the final volume of the pool is 120 uL if 48 libraries are pooled then the volume is 480 uL A 100 uL aliquot of this pooled library is sufficient for AMPure XP purification purposes Illumina sequencers use a green laser to sequence G T nucleotides and a red laser to sequence A C nucleotides At each sequencing cycle of the index read at least one of the two nucleotides for each color channel should be present to ensure proper image registration and accurate demultiplexing of pooled samples Color balance for each base is maintained by selecting index combinations that display this green red channel diversity at each cycle Please see Appendix I for guidelines on selecting the appropriate indexes for pooling and multiplexing 5 5 Library Purification by AMPure XP beads NOTE AMPure XP purification is not necessary if gel size selection is performed AMPure XP is the recommended method of library purification Do not use GlAquick cleanup or other si
34. on kit v2 is designed to provide up to 48 indexed libraries for higher multiplexing capabilities on Illumina NGS platforms The MicroPlex v2 chemistry is engineered and optimized to generate DNA libraries with high molecular complexity from the lowest input amounts Only 50 pg to 50 ng of fragmented double stranded DNA is required for library preparation The entire three step workflow takes place in a single tube or well in about 2 hours No intermediate purification steps and no sample transfers are necessary to prevent handling errors and loss of valuable samples Providing high library diversity MicroPlex v2 libraries excel in target enrichment performance and deliver high quality sequencing results The MicroPlex Library Preparation kit v2 includes all necessary reagents including indexes for multiplexing up to 48 samples Once purified and quantified the resulting library is ready for lllumina NGS instruments using standard Illumina sequencing reagents and protocols The kit provides excellent results for high coverage deep sequencing such as de novo sequencing whole genome resequencing whole exome sequencing and or other enrichment techniques It is ideally suited for use in ChIP seq and for use with small fragments of DNA such as cell free plasma DNA 2 2 Principle The MicroPlex Library Preparation kit v2 is based on the patented MicroPlex technology Figure 3 Unlike other NGS library preparation kits which are based on ligation of
35. plastic lid return the SIP to its sleeve and store at 20 C The Index Plate should not be frozen and thawed more than 4 times Multiplexing and Index Pooling Multiplexing and pooling less than the full set of 48 libraries is possible on the MiSeq NOTE For MiSeq RTA v1 17 28 and later base pair diversity of indexes is no longer checked by IEM because low plexity index reads can be processed for all applications any combination of indexes can be pooled for sequencing on MiSeq 1234567890 12 0eo0000050000000 KREERET ET ceoeoocooeccc oo0 00000000000 E F 6 H Figure 11 Single Index Plate maps with well locations The 48S Single Index Plate contains Illumina compatible indexes with 8nt Sanger sequences The colored wells indicate well positions containing Indexing Reagents Sample Sheet Setup The Illumina Experiment Manager IEM is a desktop tool that allows you to create and edit Sample Sheets for Illumina sequencers Make sure the latest version of IEM version 1 8 or later is installed Create a Sample Sheet using the IEM then manually copy and paste the appropriate 8nt single index sequences to be used to the CSV file of the Sample Sheet Index sequences can be downloaded as a CSV file at the MicroPlex v2 product page NOTE The IEM will not check for color balanced index combinations when indexes are entered manually from the CSV file Sample Sheet Setup The Illumina Experiment Manager IEM is a d
36. ppropriate calibration dye and mix with EvaGreen dye to prepare the dye mix see Library Amplification Step Section D III For some real time instruments calibration dye may not be needed please refer to the real time thermal cycler instrument s manual Figure 4 Example of real time analysis of library amplification using MicroPlex v2 A typical real time amplification analysis of libraries prepared with MicroPlex Library Preparation kit v2 using 20 ng 2 ng or 200 pg of sheared human DNA GM 10851 Coriell Institute 200 bp relative to a No Template Control NTC Results were obtained using a CFX96 Touch Real Time PCR Detection System Bio Rad with EvaGreen as the dye for detection and fluorescein as the calibration dye The red line marks the midpoint of the linear phase of the amplification curves and is used to determine the optimal number of amplification cycles at Stage 5 of the Library Amplification Reaction Section D III It is recommended to stay within one cycle above or below the optimal number of cycles For example for a 2 ng input the optimal number of amplification cycles is 10 1 cycles or 9 to 11 cycles The Relative Fluorescence Unit RFU values on the y axis may vary based on the instrument used 3 3 Starting material DNA Sample requirement Nucleic acid Fragmented double stranded DNA or cDNA Source Cells plasma urine other biofluids FFPE tissues frozen tissues Type Mechanically sheared enz
37. rder to be sequenced on lllumina NGS platforms The process of library preparation Figure 1 involves placing lllumina sequencing adapters on DNA fragments and adding lllumina compatible indexes to allow pooling of multiple samples multiplexing This library preparation is a critical step in the NGS workflow and has direct impact on the quality of sequencing results Illumina NGS workflow Purif Shear Prepare library AMPure XP DNA DNA Repair add adaptaters amplify Cleanup Pool amp Quantify Sequence Figure 1 Illumina NGS workflow DNA samples are first purified and sheared Library preparation follows consisting of repair Illumina adapter addition and DNA fragment amplification Indexed libraries are purified pooled and quantified prior to sequencing on lllumina NGS platforms As NGS clinical applications emerge and as NGS instruments become more powerful researchers and clinicians are increasingly investigating more difficult and challenging samples which are present in limited quantities used in small amounts and or damaged In many applications such as cell free DNA from plasma the sample DNA material is limited and highly degraded In cases where DNA is not limited such as analysis of tumor tissues the ability to use low input amounts is important for conserving samples for multiple uses Clinical samples also necessitate careful tracking of samples a protocol in which the sample never leaves the tube is ad
38. s ensure that the latest version of IEM version 1 8 or later is installed There are two options for creating the Sample Sheet Option 1 In the IEM on the Workflow Parameters page select TruSeq LT in the dropdown menu for Sample Prep Kit Add indexes to be used on the Sample Selection page by clicking Add Blank Row and then choosing the appropriate indexes from the index 1 I7 dropdown menu NOTE If TruSeq LT is selected index combinations may be validated using the IEM however only the first 6 bases of the 8nt sequence will be sequenced Option 2 Manually copy and paste the appropriate 8nt single index sequences to be used to the CSV file of the Sample Sheet The 8nt single index sequences can be downloaded as a CSV file at the MicroPlex v2 Product Page NOTE The IEM will not check for color balanced index combinations when index sequences are entered manually from the CSV file 3 MicroPlex Library Preparation kit v2 x48 48 indices Single Index Sequences MicroPlex v2 single indexes use lllumina compatible 8nt sequences developed by the Wellcome Trust Sanger Institute in Cambridge UK Each well of the Single Index Plate SIP contains a unique single index sequence Figure 10 The first 12 MicroPlex v2 single indexes wells A1 through A12 share the same sequences in the first 6 bases as the lllumina TruSeq LT indexes AD001 through AD012 sequences provided in Appendix 1B The prepared library has th
39. t pel botes e hc te d e Dave eed ques heb Lean 8 3 4 Positive and negative controls em ees 9 3 5 Preparation of Master Mixes eene nnne 9 3 6 Indexing reagents eee e en ne enne e lemen eden nnns 9 3 7 Using Illumina experiment manager 10 gg Target enrichie NE EET 10 4 MicroPlex library preparation v2 protocol ees 10 4 1 Template preparation step oo cece cece m REDE at Een iai 10 4 2 Library synthesis step sss e mee e rennen nenne 11 4 3 Library amputation Step eec tt roten ette te e t i en e b eg os 12 5 Library processing for Illumina next generation sequencing 14 soi 14 gZ Library quantiflcatiohi scere pereo hene aree prtge tas er Dune ees Pene pups 15 o 39 Additianal armpliflGatignis ccr rese rite er rey err en espere rer De es ueber Eee 16 5 4 Library POOLING for purifICdtlOD ooo o zr Pen ere es petet pete rie et en er e gute 16 5 5 Library purification by AMPure XP beads es 16 5 6 Library purification by gel size selection alternate sss 17 5 7 Sequencing recommendationS sss eee ees 17 Appendix 1 Indexing reagents ose te ente e OD Er eetetreq hcm epe 18 B cU 18 MicroPlex library preparation kit v2 x 12 12 indices 19 MicroPlex library preparation kit v2 x 48 48 indices 20 Appendix 2 Troubleshooting guide sss sse eese renee 22 www diagenode com diagenctie PAGE 4
40. ution is clear e With the tube s in the magnetic stand and without disturbing the pellet use a pipette to aspirate off and discard the supernatant Add 300 uL of 80 v v ethanol to the pellet With the tube s in the magnetic stand rotate each tube 90 degrees wait until all the beads come to a halt DO NOT INVERT TUBE RACK Repeat this step three more times Without disturbing the pellet use a pipette to aspirate off and discard the supernatant Add 300 uL of 80 v v ethanol to the pellet e With the tube s in the magnetic stand and without disturbing the pellet turn each tube 90 degrees and wait until all the beads come to a halt DO NOT INVERT TUBE RACK Repeat this step three more times Without disturbing the pellet use a pipette to aspirate off and discard the supernatant e Pulse spin the sample s using a low speed bench top centrifuge place into a magnetic stand and wait for 2 minutes or until the beads are completely bound to the side of the tube s With the tube s in the magnetic stand use a pipette to aspirate off and discard any residual ethanol without disturbing the pellet e Leaving the cap open incubate the sample s in a heating block at 37 C for 2 3 min or until the pellet is dry DO NOT OVER DRY THE PELLET S e Elute the DNA by re suspending the beads with 50 uL of 1x TE buffer pH 8 0 Pulse spin the sample s using a low speed bench top centrifuge and place it into a magnetic stand and let the beads bind
41. vantageous to ensure accurate sample tracking and to avoid contamination This growing trend requires library preparation kits which accurately preserve the complexity of the samples and provide higher sensitivity and greater multiplexing capability with a simple workflow The commitment to fulfill these needs is the core of MicroPlex v2 It has been developed to expand multiplexing capability and provide high quality Illumina compatible NGS libraries from low input amounts MicroPlex v2 s three step single tube library preparation workflow Figure 2 is the simplest in the industry and minimizes handling errors and loss of valuable samples MicroPlex Single Tube Workflow 15 min hands on time 1 Repair Add template preparation Master Mix 2 Ligate Add library synthetisis Master Mix 3 Extend cleave amp amplify Add library amplification Master Mix amp indexing reagents Fragmented Double Stranded DNA cDNA e g ChIP genomic DNA gt Purify quantify pool Illumina NGS Figure 2 MicroPlex v2 single tube library preparation workflow The MicroPlex v2 workflow consists of 3 simple steps that take place in the same PCR tube or well and eliminates the need to purify and transfer the sample material www diagenode com diagendtie PAGE 6 DIAGENODE MICROPLEX LIBRARY PREPARATION USER MANUAL 2 MicroPlex Library Preparation kit v2 2 1 Overview The MicroPlex Library Preparati
42. ymatically fragmented ChIP DNA low molecular weight cell free DNA RFU 102 Amplification cycles at stage 5 of library amplification reaction Molecular weight 1 000 bp Input amount 50 pg to 50 ng Input volume 10 uL Input Buffer x 10 mM Tris 0 1 mM EDTA Innovating Epigenetic Solutions PAGE 9 DNA Format Fragmented double stranded DNA gDNA or cDNA chromatin immunoprecipitates ChIP degraded DNA from sources such as FFPE plasma or other biofluids are suitable This kit is not for use with single stranded DNA ssDNA or RNA Input DNA amount Input DNA in the range of 50 pg to 50 ng can be used as starting material For deep Whole Genome Sequencing WGS and Whole Exome Sequencing WES using human gDNA FFPE or plasma DNA greater than 10 ng of input DNA is recommended to achieve a highly diverse library For sequencing samples with reduced 10 complexity such as cDNA ChIP DNA bacterial DNA or targeted genomic regions lower input amounts picogram levels can be used Fragment size The optimal DNA fragment size is less than 1 000 bp The MicroPlex Library Preparation kit v2 is a ligationbased technology and adapters added during the process result in an approximately 140 bp increase in the size of each DNA template fragment Library molecules with shorter inserts 200 300 bp tend to cluster and amplify more efficiently on the Illumina flow cell Depending on the application and r
Download Pdf Manuals
Related Search