Home
LabCollector User`s Manual
Contents
1. I 30 6 3 2 Reagents and supplies epecfcies 30 LabCollector s Quick Reference Guide for v3 9 2 6 4 Wireless access MODIIITV EE 30 6 5 EX DOMING FEDOMING Peer Te EDD T 30 6 6 PANUAO VOC OFS D LT 31 6 7 LAKNO SC OOS E 31 7 Order list management and Alerts cccccececceseeeceeeeeceeeeecseueeeseaeeessseessensessegeeeeas 33 7 1 lge TE Ee Enn EE 33 rm ME el ideE ici mR Tm ETE 33 7 1 2 Ordering from other modules 34 Z3 Order list management geesde Eege 34 T IOHSuaDageuelDbsssussesuatenieie E 35 7 1 5 Primers specific ordering management tool Synthesis order 35 7 2 Expired and finishing lots articles cccccccccsseeeceseeeceeeeeceeeeeseeeeeseesesseneeeeas 36 7 3 Equipment E Hate Cu le EE 36 7 4 VV IRIN ONCE ENTE NU MM 36 8 Users messaging and bookmarks esses enne 38 8 1 lee enge He Te EE 38 8 2 Lab Bookmarks and custom external modules nnannnnannnnnnnnennnnnnnnnennennnnnne 39 Bid ele E E o T m 39 8 2 2 Custom External modules Bookmarks n onannnnnennnnnennnnnennnnnnnnnnnsnnrnnsnreenne 39 9 Updating and UpgradiNG RE 40 9 1 lere ANC EE 40 9 2 Biet 40 LabCollector s Quick Reference Guide for v3 9 3 1 Introduction information LabCollector is an Intranet based totally web based application bringing all the comfort and power of your lab network to access and manage the great variety of information It is installed on one of your lab comp
2. 8 2 Lab Bookmarks and custom external modules 8 2 1 Bookmarks LabCollector can be used to share to lab staff a common set of Internet links and favorites Bookmarks are accessed on Tools gt gt Lab Bookmarks menu Lab s Bookmarks And Favorites E Show Hide all categories JustBio e Online tools for molecular biology htt Awww justhin com AgileBin 3 site http wwe agilebio cam First define categories in Admin gt gt Preferences gt gt Bookmarks Then on each category bookmarks can be added by clicking on the Add New Bookmark icon 59 Categories can be expanded using the magnifying icon Bd 8 2 2 Custom External modules Bookmarks It can be handy to have links to other websites or intranet tools from the LabCollector s homepage panel There are 4 positions for this Manage those links in the Admin gt gt Setup section as administrator you can see an add icon on free positions directly on the home page a JustBio LabCollector s Quick Reference Guide for v3 9 39 9 Updating and Upgrading LabCollector is easily updated and upgraded The procedure is not exactly the same for an update and an upgrade but both are performed from the same package 9 1 Updates Updates are considered for corrective releases and improvements made to the interface while the database structure remains untouched Therefore you just need to replace the software files and folders
3. A list of boxes stored in this level is displayed From there you can define new boxes edit or delete existing ones on the rack you can only delete boxes not currently in use You can also rename the rack Boxes In This Rack Drawer 2 On Tanque Azoto 1 Ref Position Box Name Owner Features TN stored at 80 C freezer q c mg 1 Box C d Common Box YV m This rack has 5 possible box positions Add new box in this rack drawer m m Rename Rack If there are space limitations for the rack it is clearly indicated once reached This rack has 5 possible box positions Q This rack is full and cannot receive more boxes Another interesting feature is the list of all box maps on the rack that allow a quick glance at available tube positions as exemplified in the images below Cell Lirses 1 z Cell Lines 3 SEL en m Cell Lines 2 Cell Lines 4 Box level The final level shows the details and map of the selected box From there you can edit the box parameters if you need to move it for example 4 1 Creating locations or facilities The base level locations or facilities are created and edited from the Admin menu LabCollector s Quick Reference Guide for v3 9 15 Go to Admin gt gt Storage gt gt Individual Storage then click on Locations link al List Existing Boxes ga Create New Box Go Locations piri Options gt Add New Storage Location Equipment Facility Name Notes Number of rack
4. Admin gt gt Setup and choose the number of results you want to see per page 6 2 Primers and sequences cross search see all secondary places bb From primers sequences or plasmids modules you Add secondary storage 45 can make cross search to find primers that match or ff Hybridize Dese hybridize on sequences Locate the cross search launch forms on each record You can set the nucleotide overlap matching limit on the primer 3 end This can be useful for primers containing tags or for detecting primers leakage Furthermore the search engine accepts the universal primer s degenerate code The result gives the list of sequences found or primers depending the way the search is performed Sequences Matching Primer oligo 3 TGTGATCGTGTCAGCTAGCT Hit The Back Button Of Your Browser To Get Back To The Primers List N nt overlap on 3 end Position Orientatior 3061315 j DIRECT 10096 homology on full length primer Tm 3061313 1091 DIRECT 100 homology on full length primer Tm 3061315 96 244 DIRECT Homology limited to 3 selected overhandClick to map this hibridization 3061313 101 1091 DIRECT Homology limited to 3 selected overhang 3061315 4849 REVERSED COMPLEMENT Homology limited to 3 selected overhang The icons m Or acc indicate easily the type of match Furthermore clicking on those icons a graphical display of the localizations on the sequence is shown LabCollect
5. Guide for v3 9 34 ee Price ion et EE E PLE e beer The ongoing ordering list can be printed or exported to Excel It also can be managed The order management process flow is as follows Item order requests gt Cancel or Ordered gt Delivered Once order is marked as Delivered the article is removed from the ongoing order list and placed into the Past orders database The red icon is converted into the green icon on the article record A Lot entries can be added once orders have been marked as delivered except for primers This action is done in a single semi automatic step A table lists all newly delivered articles and gives the possibility to enter extra details to each item before automatically create all lots The past orders database can be listed or searched from the orders search fields on top of page It is possible to switch from past order list to ongoing order list Past Orders delivered amp Canceled Search by keyword O click here to see ongoing order list Optional criteria Hide canceled orders AND from category All categories AND from seller dealer All sellers AND order date range is AND requested by All contacts The past orders database gives a good history and traceability of orders 7 1 4 Lots management When you order items it is interesting to keep a trace of each lot in the Reagents module You can manage quantities and expiration dates this way Users can a
6. for example 5 5 3 Barcode label series editor LabCollector offers the possibility to print several barcode labels at once This is ideal for printing on label printers Access it from the top menu at 7oo s gt gt Barcode series editor LabCollector m E Barcode Labels Editor Print range from to HEN in module Select Module 4 ree SN Wu 1D symbology Barcode height 20 AND orientation Landscape Y AND J Include record WS Ke name 2D symbology AND top space o AND vertical separator 1 You can set the first and last record ID from a module the type of barcode and some additional parameters Label layout can be refined by defining top spacing and the distance between each label Once all defined the Apply button generates a WYSIWYG screen preview that can be printed immediately LabCollector s Quick Reference Guide for v3 9 24 5 6 Importing data batch In order to facilitate the transition from other applications or databases LabCollector can receive data from external sources The importing feature can also be use to import batch sample lists from equipment or devices for example PP IM f 8 9 Open the Import interface Admin gt gt Data gt gt Import On the Import screen select the module into where you want to import data Carefully read the importing file structure you have to follow Fill the form select the file to import and process
7. in LabCollector s root folder To recognize an update it is when the LabCollector s version changes from X Xn to X Xz for example when it changes from 3 7 to 3 71 PN Do not touch to documents backup and maps folders Also take care not to delete or destroy config php file 9 2 Upgrades Upgrades are evolutions in which the database structure have changed and files also So you need to replace the files and folders as for updates You also need to run the upgrade php file through the internet browser On this page you will select the upgrade level you are doing and it will automatically execute the changes in the database structure Upgrades are identified when LabCollector s version goes from X n to X z for example from 3 6x to 3 7x On the server computer access the following address from the browser http 127 0 0 1 upgrade php A Do not touch to documents backup and maps folders Also take care not to delete or destroy config php file LabCollector s Quick Reference Guide for v3 9 40
8. validity and equipment maintenance This can help your lab maintain routine tasks on time e Goto Admin gt gt Preference gt gt Alerts e Select the alerts that you want to be active e f you want to use the validity alert for reagents you must define the number of days before the expiring date of the product to use as a threshold Manage Alerts here vou can manage options for the alerts system Z1 zu Reagents amp Supplies module Activate alerts on expiration nf validity date Activate alerts on reaching minimum quantity amount alerts will be only valid for items with minimum limit set Days before expiration ao E 2 L Equipment module Activate alerts for equipment maintenance alerts will be only valid For equipment with maintenance intervals set Update Alerts Options NOTE Alert messages will be displayed on LabCollector s home page Alerts are displayed on the home page of LabCollector Order list contains ial Some lots are bd Equipment items finishing maintenance needed LabCollector Modules gm p ECC LabCollector s Quick Reference Guide for v3 9 10 3 4 Customizing modules All modules come ready to use with a predefined data structure fields adapted to its content But you may need some extra fields or numbering options for your lab specific information 3 4 1 Custom Fields LabCollector allows you to add custom fields to all modules in a very easy way
9. Go to Admin gt gt Data gt gt Custom Fields Select the module where you want to add or edit custom fields Add a new field by indicating its name the field size and if it is searchable To edit a field click on the edit icon and do the needed changes To set or update predefined values click on the middle icon between delete and edit ones only for select and checkbox To delete use the trash icon Custom Fields Gi Add Edit Or Delete Use these options to add or remove additional custom fields on the modules Select a module to manage custom fields Strains Samples Chemical Structures Primers Antibodies Equipment Plasmids Reagents amp Supplies Documents Sequences Animals Address Book Custom fields for Samples module Field Name Type Options Actions 1 Customib field 50 searchable YES S D 2 selector select as filter YES Si fo d 3 checkbox checkbox a D Field Name Type vo Freetextfield O Checkbox O select ist Hi 50 v filt Options for each type Length a Searchable YES O NO Types of custom fields available Text fields They can have fixed or unlimited size They produce empty field area on forms Checkbox options These fields can give pre defined options to check to users Multiple choices can be checked Select lists These fields have also predefined values presented as a list Only one choice possible CAUTIONS LabCollector s Quick Refe
10. LabCollector User s Quick Reference LabCollector Microsoft Internet Explorer De Edt Yew Favontes Tos teb Q 63 i9 d G6 Zeep 6 0 5 LabCollector amp oer v X3bet a Licen Ite G Some lots are Pierre on 2000 05 12 wrote gt LIMS manager volunteer needed D Pierre on 2006 05 12 wrote gt Another Message here Pierre on 2000 05 22 wrote gt Lab Meetings LabCollector v 3 9 2006 by AgileBio www agilebio com amp www labcollector com 1 NATE ere Biere EE nce Ein Imt eer LT DD Ot sean antes A E DA CEDE neat REDE eue 4 2 SUING STAN CO ERE DEM 5 2 1 Insee ERE wre Rear ee 5 221 MVVIndoWS AP 2000 Be E Ee A EE 5 2 2 SeCUINIY AMG ACCESS csi fees ge re ee dee 5 cU MEME uo m m em 6 E ee o M HH 6 2 3 FIFSETOGIDU FIESE SUO DS voire deb te tao a Ee Do avo tae oa Eod epa EUR tuos n 6 3 OGP A Ee 8 3 1 SEI TEN ED ER 8 3 2 Users actions WACING e ET ERR 8 3 3 Defining elei 9 SOR OVET EW EMEN 9 3 3 2 Define Sellers management 9 J32 AlenS USE T 10 3 4 CUSTOMIZING Run ele UE 11 34 1 ee LR Ee EE 11 342 GUStOM Dinu len Te mE M 12 3 5 Configure the storage system ccccccccsseeceeceeseceeceeeeeeeseeeeeeseeeeeeeesaaeeeesaaaes 13 4 Storage System Management 14 4 1 Edge Be Tee Tu ER Or Ce 15 4 2 Greatng DOXeS ard Mee 16 4 2 1 Replicating box structures nn nnneennnnnnneennnnennennrensnrrrrnrrnsnrrsrrersnrrnnnrrnsneer 17 4 3 Browse storage system ccc
11. abCollector s Quick Reference Guide for v3 9 27 6 Searching data and retrieve it when and where you need it You can find data from each module using keywords search or from the barcode search field You can also find data through the PDA interface on pocket PC devices IE second more important goal of LabCollector after storing data is to easily find 6 1 Keyword search All modules are built in a similar way The only difference is the fields organization that reflects the specificities of data stored I LabCollector Hu mm j E Strains Database Search by ID or by keyword Any Organism AND related to organism Any related Organism he lq i ored in Full search v E coli You can use none one or several keywords separated by spaces Do not use any logical operator The search method uses AND operator automatically by default between each keyword You can refine the search with specific optional criteria To list ALL data just do a blank search Custom fields are included in the search if they have been defined as searchable Custom list options are presented as additional optional filters if they have been defined as filters If you know the record number you can type it directly in the ID field to access the record directly Results are displayed as a list of one item per line with basic information You can sort results ascending or descending according to severa
12. cation Select a box from the resulting list Fill the box grid on the interactive map open the map by clicking the grid icon Close the interactive pop up map window by clicking on the Keep selection button Save the record or the storage P You can have a general view of empty and available box s spaces with the storage browser A direct link is proposed 5 2 2 Define storage on existent records You can assign vials storage on existent records V E e UL Add secondary storage eH Search for the record to manage Expand the record data On the right a storage table is provided Click on the Add main storage link if available only managers and record owner can add main storage Follow steps indicate above 5 2 3 Secondary storage Each record can have one main storage place But any lab member can have his own backup or secondary storage locations other than the record owner Follow these steps LabCollector s Quick Reference Guide for v3 9 19 Search for the record Expand the record data On the right follow Add secondary storage link Follow steps as above as for main storage Add secondary storage gar To see or list the secondary storage boxes click on the small magnifier icon Secondary Storage The additional boxes will automatically be displayed or hidden with a second click boite 1 D 9 A5 Ab B2 B3 B4 Bb B7 BB 69 o piece 117 frigo 3 Geh Ll Click ta lis
13. cccccesceceececeeeecceecceueecsueeecseeeceesesueessaeeesaeesseeens 17 5 Entering anc managing ala usas se datos uota o ditte Prec co ea tae Le voto Eve oec US er ete dca 18 5 1 EE NEW RCC ORG ettet NT T 18 5 2 Storage SION Ogden aM redu tet ead as eae fra heces DA aie ae 18 5 2 1 Define storage at data entry time ENER ENEE 18 5 2 2 Define storage on existent recorde uk 19 5 2 9 Secondary Storage EE 19 5 2 4 Editing Deleting a storage location nsnesnneeneeeennnennnrrrrnrrrrerrrrnrrrrerrreernee 20 5 3 Removing and adding aliquots or tubes cccccsecceceeeeeseeeeeeseeeeeseeeeesaeeeeeas 20 Hiss REMOVING TUDES arrali a NN 20 5 3 2 Addihg new le EE 21 5 4 Editing and deletlngEecOFedSs uus cocer e x x en S aeu deat cu ett tanta tabe ut ese becal 21 5 4 1 Multiple record deleions 21 5 4 2 Data Transfer between users n nnnonnneeennnennennrensnrrrrnrnnsrrrrrrersnrrennrrneneee 22 5 5 Barcodes COMING M RE D ROOTED 23 5 021 Pinno INE re Le 23 5 0 2 Barcode e 24 5 5 3 Barcode label series edtor 24 5 6 IMPOMUNG Cala DAICMI NEN E OE EO OT LT 25 ou WER e E e Reie 25 5 5 2 Jmported Gata ee ER enam od bote een eee 26 5 7 BACKUDS EE 26 Sr Database GQUIMPING E Tm 26 5 7 2 Automatic full backups with LabCollector Manager 26 S rein nie Re DET 28 6 1 KeyWord Seale BEE 28 6 2 Primers and sequences CrOoSg Search 29 6 3 Barcode SCAN CIN sires cc rt 30 sm MEO IU
14. ctical messaging system allows users to post messages addressed to everybody on the main page piring Gel Some lots are Equipment finishing 9 maintenance needed oWsesPoss o S Pierre on 2006 05 12 wrote gt LIMS manager volunteer needed ee 1 Pierre on 2006 05 12 wrote gt Another Message here t9 Pierre on 2006 03 22 wrote gt Lab Meetings Animals 6 more Address Book 4 v 3 8 AgileBio Users can add new messages by clicking on the L icon located in the Users Post bar Message Post LM Post a new message p penu a Er zoom et le ee E C3 a 1 Link the message to the following records in memory e ID Title of Record to link from Module 1 ThermoCycler Speed 1 Equipment HIY Meeting 1 Documents ra y Wey a Submit Messages can be formatted as on any word processor Message can have a time limit expressed in days A small icon can be selected to give some extra visibility to the message title on the messages list LabCollector s Quick Reference Guide for v3 9 38 Finally messages can have links to LabCollector records This can be useful to link to additional information or data commented in the message For example you may want to link to a registration form for a meeting reminder message To use this users must first memorize records using the memorization icon on search results to link before creating a new message
15. cts Equipment maintenance Ordering list alerts and awaiting data alerts are automatic and built in The remaining alerts need to be activated in the preferences menu Admin gt gt Preferences gt gt Alerts Manage Alerts here you can manage options for the alerts system aac Reagents amp Supplies module Activate alerts on expiration of validity date Activate alerts on reaching minimum quantity amount alerts will be only valid for items with minimum limit set Days before expiration days as Equipment module Activate alerts for equipment maintenance alerts will be only valid for equipment with maintenance intervals set Update Alerts Options NOTE Alert messages will be displayed on LabCollector s home page Alerts are shown on the LabCollector s home page According to user permissions the messages are clickable to allow a rapid alert handling emo moade Gers Lap Ka Order list contains E Some lots are expiring val Some lots are Q Equipment items finishing maintenance needed 7 1 Order list management 7 1 1 Ordering articles The reagents and supplies and primers modules are linked to an order management system read also alerts part LabCollector s Quick Reference Guide for v3 9 33 DA mecs S g m d Ae Re sco Canhaday 210n 9 1 T NN UN E Chamicale e Ss eh m LL Each record has an ordering icon Item is already in the order list o
16. e activity registry log 5 4 Editing and deleting records Once records have been added to the database you can edit or delete and make data La changes Search the record you want and on the icon tray you ll see the edit M and delete 5X icons They are only accessible to administrators and data owners P Data deletion has limitations The delete icon will only be accessible if the record has no storage assignments and no links to other records You ll have to remove the links and the storage previously to record deletion 5 4 1 Multiple record deletions You can delete several records at once by two distinct methods Both are only accessible to administrator and higher levels Delete record sets You can delete record ranges from inside a module at once Go to Admin Data Delete Multiple Records LabCollector s Quick Reference Guide for v3 9 21 You are about to delete multiple records at once This action is definitive and cannot be reversed Be sure you have a recent database backup from record id to included from module Select Module A Click here to DELETE records 1A Note Records with links to other records will NOT be deleted Enter the first and last record numbers from the range to delete and choose the module containing those records A Range Data deletion has limitations The records within the selected range will only be deleted if the record has no storage assignmen
17. ed LabCollector s Quick Reference Guide for v3 9 25 5 6 2 Imported data owner Administrators can import data under any name Staff and users can import under their own name only A Import action in 2 steps Data to import will firstly be browsed and displayed on screen for check purposes This way you can visually confirm that data is correctly parsed and can be permanently saved into the database 5 7 Backups Data integrity is crucial to maintain information accuracy Administrators should perform regular backups at least if database changes Those backups should be stored on distinct media like secondary hard drives CD R DVD R etc 5 1 Database dumping LabCollector provides an easy to do backup tool Go to Admin gt gt Data gt gt Backup Then you just have to click on the Start New Backup button i Database Backup To backup the database you just need to click the following button This will generate a SQL file an the server that you can download and keep on a safe media E Do a new backup K i start Mew OB Backup Backup files too Unix Linux only documents maps Ki Download backup 2 Select backup file to download labcollector_02122005 sql 969 22 kb D labcollector_O3012006 sql 991 40 kb Tf A UNIX LINUX systems only Check the Backup files too checkbox to create a compressed archive of the documents and maps folders Windows You ll have to backup manua
18. ern Lxplrer He dk wem Fgexbes Took pep m AN t E 1 Q O Hid G P 3 e060 S 8 e 8 ME Hes Mee abel adenins ahg hira Eb Coogle w d Baa co gno Duet Tap palate P ootoyxhe Keen FO Tes LabCollector i Some options are predefined like primer labels others are completely empty and need to be defined in order to enter data lt is recommended to go though all preference sections to create a minimum LabCollector environment You can always add more or edit current preferences 3 3 2 Define Sellers management Select the sellers database system used on the reagent s and equipment modules Go to Admin gt gt Preferences gt gt Address Book options or Admin gt gt Preferences gt gt Sellers LabCollector s Quick Reference Guide for v3 9 9 Address Book Options Add Or Edit Use these fields to manage the address book categories Use Address Book category instead of the built in sellers table A When checking this option and if you already have sellers data from built in table associated to reagents or equipment you will have to recreate those associations The same applies if you uncheck this option M A It is recommended using the Address Book module to manage sellers contacts used on reagents and equipment modules 3 3 3 Alerts Use LabCollector has an internal alert system for lots minimum quantities lots
19. es can be reassigned to another single user or selected modules can be indicated and assign to different users LabCollector s Quick Reference Guide for v3 9 22 S Transfer Data Between Users S wp S You are aboutto transfer data from a userto another one You can transfer all data or data from specific modules This transfer can be useful when people lives the lab and data should be managed by someone else This action is definitive and cannot be reversed Be sure you have a recent database backup Transfer data CI From ALL modules Or Strains Plasmids Primers sequences samples v CTRL click to select multiple modules From User select staff name gt To User select staff name e A Click here to TRANSFER records A Go to Admin gt gt Data gt gt Transfer Data 5 5 Barcodes editing All data and records saved into LabCollector have a unique barcode You can use it to quickly access records To obtain a barcode label click on the barcode icon on the II record icon tray A new window will open with different barcode choices Barcode 1D Barcode 2D C Add Name to label Add tree text CS You can generate a label with a barcode only or with text on it Check the Add name to have the record s name and or add a free text on the field beneath 5 5 1 Printing the barcodes On Windows computers you can simply print the barcode image directly to a thermal label printer For this righ
20. f the Installation Wizard for Windows This wizard also provides a server manager i LabCollector Manager File Activity Configuration n Start Web Server a This manager provides an easy interface for configurations stop and start and automatic backups It must be started at least one time in order to have LabCollector running To keep LabCollector accessible in permanence you can accept to keep it as active Windows Service The question will be asked each time you close the manager So the server can be let in logout position and still LabCollector and automatic backups see further below in this manual will remain active The manager is to be installed on the main computer server You don t have to install it on any other computer of the lab 2 2 Security and access LabCollector is a network based system like an Intranet It can be accessed from all computers from the same local network It can even be accessed through the Internet Therefore data access and management can be password protected There are two access modes defined in Admin gt gt Setup menu LabCollector s Quick Reference Guide for v3 9 5 Please Enter Your Login SI of 2 2 1 Semi Open In this configuration data browsing is open to anyone accessing LabCollector However administration tasks are always password protected 2 2 2 Fully locked Any access to LabCollector requires login authentication LabCollector is accessed wit
21. h a recent Internet browser Internet Explorer Firefox etc On the LabCollector server you have to call for example http localhost or http 127 0 0 1 or http computer name or http computer IP On remote computers you have to call the server name or IP address like http computer name or http computer IP This may change according to manual installation variations but applies exactly like this if you installed from the setup wizard 2 3 First login First steps When logging into the program for the first time you must enter Admin for the User Name You may use this default User Name for future logins or you may configure individual User Names and Passwords for each user First Time user login password admin Remember to change this later The main User name is the Super Administrator It has full powers Change current user One of the first steps is to manage users and change the super administrator information Go to Admin gt gt Users amp Staff gt gt Manage Staff Enter your basic contacts and other lab staff members Go to Admin gt gt Users amp Staff gt gt Manage Users Edit Super administrator login information change password associate to your staff contact FS Gabi za LabCollector s Quick Reference Guide for v3 9 6 pn Super Administrator p a cere E a contact F Permissions LT aa Mous D accurnrer Here is a quick overview for the first action
22. i fi networking support providing quick and real time access to data On the PDA device use the built on Internet browser and get the page http IP or network address of server pda php This page is especially formatted to the screen size of PDA devices You can do barcode searches and storage manipulations like removing tubes 6 5 Exporting reporting LabCollector s Quick Reference Guide for v3 9 30 If you need to use information stored in Labcollectors database you can export it You can export all or specific items as export action is linked to the keyword s search engine On the top of the search result list you have two report icons On screen listing or Excel export Listing Report zi MEE s m mm Only the search results will be exported to export all data perform a blank search 6 6 Printing records Each record can be printed Use the printer icon on the item you want to print A new window will open with special printer layout formatting All fields are printed 6 7 Linking records s z You may need to link several records between them For example you can link e different reagents to a home made culture media Or you can link sequence records to a sample You may also link a sample to a client a reference manual to an equipment record Combinations are endless and unlimited To link records between them you can use the memorization tool by clicking on the clipping icon on the rec
23. in gt gt Storage gt gt Individual Storage Here you can create boxes list and manage existing boxes define new locations and facilities and temperature options See next chapter for more details Manage Storage System Add Or Edit Use these fields to manage and define your storage system Create or edit boxes names and features Al List Existing Boxes EH Create New Box Ks Locations p Options 2 Go to Admin gt gt Storage gt gt Reagents storage Here you can define the list of reagents storage places Rooms shelfs fridges cold rooms powder hoods etc Reagents amp Supplies Storage Add Edit Or Delete Use these fields to manage the chemicals and reagents storage locations H Powders room door 117 G Fridge 1 of room 11 4 C Freezer 2 in room 11 20 C H Freezer 3 in room 118 20 C sl Fridge 4 in room 117 4 C 6 Freezers in room joyce 25C w storage room 123 freezer 20 w Etagere 1 w KS SW i a Update amp Save LabCollector s Quick Reference Guide for v3 9 13 4 Storage System Management There is a storage browser tool to visualize in a graphical tree like manner the storage organization of your lab The hierarchy tree can be expanded or collapsed There are 3 levels Facility gt Rack drawer gt Box The image below shows how it looks Logout logged as Super Administrat
24. it Format Current Ref unique sep NAME sep GENOTYPE sep DESCRIPTION sep CUSTOM sep CUSTOM lt linefeed Step 1 Select file to upload and import Organism Choose Organism required Related to Organism Choose Organism vi 2 Owner Pierre Y 2 required Field Separator Comma semicolon TAB Custom separator must be unique gt gt Go to Step 2 to Import data Validate the import form BS Import Strains Data Result Importing Step 1 successful Temporary Import Step 2 Temporary Data Must Be Validated VALIDATE save data DISCARD cancel importing Strains to IMPORT Ref Name eng Carefully check the temporary import data displayed on screen This helps you decide if data have been well parsed and can be definitively saved on database Submit Step 2 form to Validate the data M Genotype pea pea R o O pee 10 Data import is completed A DISCARD invalid temporary data Always remember to discard temporary data which is invalid Temporary data is stored on temporary database tables that need to be deleted when you discard or cancel the import action This way you avoid accumulating unnecessary temporary tables 5 6 1 Required options Some option fields are required In this case you need to import sub lists for each option or category select
25. l criteria 934 results found A Show Hide all results on page sort results by Id v ASC vi Listing Report EE BP Does we wns UETCICCEMNCTEENMNMECIT IT I a OY EL Q s 69 0600 amp SS EN A 4 42 KL 16 6 E coli ayeye amp amp B mm You can expand one or more items by clicking on the magnifier icon e in from o each item name You can also expand all results on the page on the small magnifier icon 4 on top of the results page Show Hide all results on page LabCollector s Quick Reference Guide for v3 9 28 934 results found A Show Hide all results on page sort results by Id w ASC B Listing Report RS Q Organism E coli Related Organism E coli 19 rpsL200 recA galK2 inversion rrnd rmE 1 SmR N99 recA recA par mutag n se MM152 derive de W3102 B Bachman chart 14 via Michael Yarmolinsky cccddd c Owner Jean AgileBio contact amp agilebio com See all secondary places WG Custom xx22 Add secondary storage e Custom1 XXX22 Related Strains o Hir Cy A221 CA 7901 Related Data gb zz I SCHER ec Aa II mim at D ana sm a _ Once expanded you have all information available for the chosen item including storage places logs etc Data may be presented as sub folders You have additional information by clicking on the side icons logs secondary storage lots etc PN You can change the number of results displayed per page Go to
26. lly the documents and maps folders They are located in the LabCollector s root folder The files generated from the backup are listed on this screen and you can save them anywhere you want 5 7 2 Automatic full backups with LabCollector Manager An easier manual and automatic backup can be done through the Server Manager on Windows platforms Open the LabCollector Manager application on the LabCollector server and go to the Configuration gt gt Automatic Backup LabCollector s Quick Reference Guide for v3 9 26 LabCollector Manager ell x File Activity Configuration Ed EA jj Stop Web Server Stop Database Server Automatic backup settings Backup directory CAB ackup_Lab Choose directory Database name labcollector Backup every H Days v Delete previous backup Last backup 05 12 2006 09 57 24 v Activate automatic backup Save Cancel Save and backup now This backup utility will compress mysql database folder directly mysql data labcollector and the www folder located in c Program Files AgileBio LabCollector to the destination and with the periodicity defined in the settings A Network backup With this utility you can backup directly to any storage device over the network Recover backup Compressed backup files from the manager backup utility can be recovered simply by uncompressing them and replacing the original folder www and mysql data labcollector L
27. lso add and edit comments on lots to provide experience comments and quality assessments for the reagents used on the lab Date stamps are also stored each time a unit is removed to give some view on the products usage rhythm KI Click on this icon on the left part of the record data to list and manage the corresponding lots 7 1 5 Primers specific ordering management tool Synthesis order Primers can be ordered like any other reagent see above or be ordered through the specific ordering icon LabCollector s Quick Reference Guide for v3 9 35 S This icon inserts an ordering request on the primers synthesis order list T x x This icon means that a synthesis order has been placed and links to the order list The synthesis order list looks the same way as for reagents but includes the sequence and eventual primer labels Primer supplier is not mentioned as it is usually unique for all the lab or institution It also does not generate lots Primer Synthesis Orders e Print OR Export a Sequence 5 3 Qty Request date NCHE by Ordered NH Received NEN O imported31 tgcagcacgatcgatggttttctacgagtcgtacg 100 OD 2006 03 28 gtagtackacgactacacgac oligo 1 10 OD 2006 09 27 Pierre Label 5 Amin Label 3 Biotin 7 2 Expired and finishing lots articles Lots management is linked to the alerts system Once activated alerts will be printed on LabCollector s home page Quantities alerts are calculated based on
28. nce Guide for v3 9 17 5 Entering and managing Data ou have already made major preferences definitions Now you re ready to enter new records into the modules EAM mo 5 1 Enter new record All modules are constructed in a similar way To add new records click on the top right link Add New Record in the menu bar A form will be displayed to enter data according to the module Strains Database Management Add Or Edit Optional Reference Name Genotype Notes Organism Selectthe organism v Related to organism K Select the organism EN Owner K Pierre v Custom Custom1 BIET eee Select storage location x Locate empty places E A es w Select Box diem Position in Box Save new Strain This example illustrates the form for entering new strains or cells Some fields are required They are usually marked with a Multiple records can be added successively 5 2 Storage stocks 5 2 1 Define storage at data entry time You can assign storage tubes or vials to the new record at entering time or on existent records On the new record form you can indicate vials coordinates on the storage selector LabCollector s Quick Reference Guide for v3 9 18 Select Storage Place Ey Locate empty places Ecco ue f des Position in Box Select Box test Pierre ze Generic steps for assigning tubes vials Select the lo
29. or LabCollector mum e ED Storage Browser amp Manager ff Lab Storage Tree Boxes In This Rack Drawer 1 On Tanque Azoto 1 GR Floating i jw aze Ref Position Box Name Owner Features m Lk eee TTT gt EE hep be Re je Larei 0 09 box2 Jc Cy Mum Lp box Danial ro cenines3 mme Gic pt T mk o peee be eee r piest f Q iest eoxpiene ep pese me INO f en Rack is 1 This rack has 5 possible box positions Tanque azoto ER GE 1 This rack is full and cannot receive more boxes R Cell lines 1 id Rename Rack eH Cell lines 2 Cell lines 3 Cell Lines 1 rH Cell lines 4 Laco EERE EEE ESE DR Rack 2 e a hh me Cong lo 2 ESI EN E EN E EN RS EN Emp EE BEER EE minus wa z Facilities level The main level gives details about the equipment You can define new racks or boxes inside this location Equipment Facility Freezer 1 d Notes etage 1 piece Number of racks drawers 2 1 defined Positions per rack drawer i 80 C Add new rackidrawer with a new bosin Freezer 1 e LabCollector s Quick Reference Guide for v3 9 14 When you click on Add new rack you get to a form to create a new box You also have details about the equipment used if you have linked it to a corresponding equipment record in equipment module Racks Drawers level Inside each location you have the list of all racks already defined
30. or s Quick Reference Guide for v3 9 29 6 3 Barcode search 6 3 1 Overview LabCollector generates unique barcodes for any information stored in the database Those codes can be read from any barcode scanner The barcode search engine has a search field always on focus on the top right of the screen So anywhere in LabCollector you can access directly to any specific record when you scan a barcode Bi 49 blaqu e s rj Orthographe wj Options gt E E 4 You can also access to a storage box contents from the box s barcode 6 3 2 Reagents and supplies specificities The reagents module has some specific search features You can find articles with the original product barcode using a barcode reader If barcode reference is different for each lot enter the barcode reference of the new lot on the lot s reference field Then you can find lots directly from the module s keyword search field you need to place the cursor in the keyword field then point the barcode reader to the product s barcode 6 4 Wireless access Mobility It is sometimes interesting to get information near the storage source For example you may want to have a content list and map of a box that you get in the freezer and you have no computer near and don t want to go forth and back to get this information If your lab has access to a wireless network you can use Palm or Pocket PC devices You can even user PDA devices that harbor a barcode scanner and w
31. ords you want to associate Search all records to memorize from any module Then go to the record from which you want to make the links You l see one or two fields like Related Data Click on the Add icon green plus like on the image below Features parentale dna tarl Related Strains d Related Data di You ll be redirected to a page that lists current links and a list of memorized items to link You can verify them eventually discard some and then click the update button to validate the new links A This screen can also be used to remove existent links LabCollector s Quick Reference Guide for v3 9 31 Link To Other Data Add Or Edit Use these fields to manage the links between records Link to the following records in memory e ID Title of Record to link from Module 4 KL 15 5 Strains 12 HfrG amp malB Strains Manually link to record ID EN of module strains v Update Links slit LET ad P Links on a record are useful to jump to related records Just click on the link s on a record to see the details of the related record You can also delete from memory one or all records LabCollector s Quick Reference Guide for v3 9 In Tools gt gt Manage memory you can see at any moment what records are kept in memory for linking 7 Order list management and Alerts LabCollector includes an alerts system for Ordering items Data awaiting for validation Expiring products Finishing produ
32. quipment Full Automatic ID O Yes no INT 9 ON Be carefull to not reduce the size of the O Semi Automatic ID editable field below the current values already in or you will truncate the references DoUpdate DoUpdate A CAUTION This customization is very sensitive Use it with care and only if you know what you are doing We have limited some of its usage to reduce risk ID SETTING You can define it as Full automatic default situation or Semi Automatic In this last case referencing can be manually altered at each record entry Only administrators can however alter this field Usages You can set a new incrementing start like to include the year enter data with passed ID not filled etc RISKS auto incrementing uses the last and bigger value already entered So the major risk is to have records always being numbered after a wrong starting ID ZEROFILL This option formats record ID with zeros filling non used digits Ex 15 would be written like 000015 for a 6 sized field FIELD SIZE Determines the incremental capacity of the ID field Used in conjunction with ZeroFill it can give numberings like 060001 size 6 and zerofill and manual start set to 60001 LabCollector s Quick Reference Guide for v3 9 12 3 5 Configure the storage system LabCollector comes with an empty storage system You need to configure it to reflect your lab facilities equipment and organization Go to Adm
33. r himself only 4 Users Manage own data but new records need validation from an administrator 5 Visitors Can only search and see data Permissions can be altered at any time 3 2 User s actions tracing The system always stores actions made by any user The super administrator can check the actions history at any time The history is accessed on the Admin gt gt Users amp Staff gt gt Manage Users menu Click on the View users history log LabCollector Manage Users Se View users history log LabCollector s Quick Reference Guide for v3 9 8 History can be displayed for all or a particular user and for a defined time period LabCollector SH mu 8 Users History Log View log for past 15 days Optional criteria restrict to user See all users See all users 3 demo Are gU Est New main storage n 5 demo aqjuser HS ET New main storage n 5 demo 21 fe ST New main storage n 5 demo 2 sas ee Sill New main storage n 5 demo ajfoo 6 ST New main storage n 5 demo 2l 9 ST Edited main storage n 5 demo 2l visitor S Sm New main storage n 5 3 3 Defining preferences 3 3 1 Overview references are the first level of customization of LabCollector to your lab reality They are used to define modules options like organisms sample categories etc Preferences are defined on Admin Preferences menu Y LabCellecior Micresedt Int
34. rdered The red color gives a quick visual way to know that the item may be finished and waiting for delivery order Put item in the order list Green color means also that item is available When you click on the ordering icon you get a pop up window to define quantity units to order and order urgency E Add to Cart Microsoft Internet MBR ks Add to Shopping Cart Options KCl Enter quantity E Urgency Urgent 9 Normal Once validated ordering request is entered in the order list 7 1 2 Ordering from other modules It is possible to use the order system from Strains Plasmids Primers Antibodies Animals and Chemical Structures molecules Each record from these modules can be associated and replicated into Reagents amp Supplies module Then ordering can be performed from within reagents module as any other reagent or directly from the parent record This icon gives access to ordering and reagent information taken from the reagents module directly into the parent record When no reagent association has been defined it will prompt for it It can create an automatic entry in reagents module or you can indicate which existent reagent record to use with this record Ki This icon lists the lots as from the reagents module directly into the parent module 7 1 3 Order list management To open view the order list you must be logged in and go to Jools gt gt Order List LabCollector s Quick Reference
35. rence Guide for v3 9 11 If you delete a field all data stored on that field will obviously be lost When editing a field if you reduce its size longer data may be truncated e Some field names can induce mysql errors If such problem happens just edit the field name click on the pencil icon in front of the corresponding field 3 4 2 Custom ID numbering In some cases your lab could need a specific incrementing numbering for records identification Some selected modules can support customization of the internal reference field Only administrators can access this page Go to Admin gt gt Data gt gt Custom Fields Edit Record ID Options here you can manage how records are dealt references etc Note 1 Records references ID Options ZEROFILL FIELD SIZE Use Semi automatic ID with care Only use it if Full Automatic ID you and all users are perfectly aware of this Strains O Yes No INT EM MB Semi Automatic ID editable Only administrators are however allowed to set and use semi automatic feature The auto increment feature will always take the Full Automatic ID last ID used manually or automatically entered Plasmids A EEN O Yes No INT 9 D Read the manual for details on risks of this Use ZEROFILL to have ID formatted with leading zeros Antibodies eati iba Im O NTE DD ex 00156 for 156 the ID min 5 ex size 6 will give 000001 for ID 1 and ZEROFILL e
36. s 1 Create staff members and users Admin gt gt Users gt gt Staff then gt gt users Associate staff contacts to user logins 2 Check and set preferences Admin gt gt Preferences specially for the modules you wish to use first 3 Check sellers preferences in order to choose from Address book module or the old internal sellers db for managing sellers contacts recommend the address book 4 Define storage locations Admin gt gt Storage 5 Define optional extra fields in modules if necessary 6 Create or import records LabCollector s Quick Reference Guide for v3 9 7 3 Setup amp Preferences abCollector system comes with as much as possible ready to use environment but some setup and configurations are needed to adapt it to your lab scheme 3 1 Users 1 Goto Admin gt gt Users amp Staff gt gt Manage Staff 2 Enter basic contacts for lab staff members 3 Goto Admin Users amp Staff Manage Users 4 Create or edit user s login change password associate user names to staff contact PES ETC P Permissions New Password Leer wi Person Choose aname Insert New User Repeat this step for all users that are intended to use LabCollector Users Levels available 1 Super Administrator only one Have full powers Manage any data manage system and users etc 2 Administrators Manage any data validates data from users etc 3 Staff Can enter and manage data fo
37. s drawers rn empty ar zero unli mited Positions per rack drawer empty or zero unlimited Equipment Data Please Choose from equipment module Storage Temperature Please Choose See Fill the form If you want to manage available rack s space and box positions on racks you ll have to tell this information You can link to an equipment record from the Equipment s module Then click Save Once saved the location will be automatically available on the storage browser 4 2 Creating boxes and racks On the storage browser or the storage admin page you can create boxes The same form may be used to create a bix and a new rack drawer at the same time For this just indicate the number or reference of the rack The new rack will be created along with the new box If the rack already exists it will be automatically filled on the form If you leave the rack field empty the box will be assumed to be floating Add New Box Goen 1 Box Description ssi Size ext Al IS Editor for special format Location Freezer 1 v Tower Rack Drawer N or reference EE leave empty if Aoating Position in Tower Rack Drawer EE Owner Pierre bul Save Bax Special format non square boxes Boxes can be of any format For square boxes just indicate the size coordinates If you need a special format click on the editor icon to close box positions by point amp click see image below LabCollec
38. t click on the image with your mouse then select Print Image on the contextual menu You may need to rotate the image before printing Final result depends on your printer hardware specificities To print the label including text like the name you print the full page directly to the printer laser printer or transfer label printer LabCollector s Quick Reference Guide for v3 9 23 Barcode 1D Barcode 2D LLL amp ST open Link B Add Nan oo tena Res ZC Open Link in New Window Save Picture As E mail Picture Print Picture tight click ona Go to My Pictures mage You can also click on the image to open Another wayi Set as Background paste it into any drawing or label software Set as Desktop Item Strains PL Pla es CH Chemicals amp Reagents SP Samples E Copy Copy Shortcut ab Collector ollector com Add to Favorites Properties 5 5 2 Barcode types You can choose from two types of barcodes Linear or 1D barcodes These are classic barcodes and the simplest They are read from any CCD or laser barcode reader They can be large so they only can be placed on sufficiently large surfaces Eppendorf and cryo tubes may be too small to hold them DataMatrix or 2D barcodes 2D barcode are small and square They are more recent and can only be read by imager devices which are more expensive They hold more information and best of all are usually sufficiently small to be placed on tube caps
39. t other storage places GE X 4 tubes S G4 G5 H4 H5 Qu stored at dot in room 123 owner Pierre 5 2 4 Editing Deleting a storage location Any main or secondary storage can be edited and deleted Use the specific icons provided in the box table This can only be done by administrators and the record owner 5 3 Removing and adding aliquots or tubes 5 3 1 Removing tubes When storage coordinates are defined single tubes vials or aliquots can be removed or added Any identified user can remove tubes The action is looged on the history or the activity log registry for strain records boite 1 X 9 tubes fy A5 Ab 62 B3 B4 Bb B7 B8 PO Qi piece 117 frigo 3 To remove one ore more tubes a quick icon is provided c When you click on it a pop up appears LabCollector s Quick Reference Guide for v3 9 20 Z Easy tubes removal Microsoft m m P Remove tubes You are about to remove tubes KL 16 6 Strains Select Position AS AB B2 B3 B4 B6 B7 B8 BY Remove selected position s 1 Cancel There you can select one or more tubes to remove from the box You can see the box map using the magnifier icon to help you visualize the coordinates to remove You can also do this by editing the box 5 3 2 Adding new tubes vials To add new tubes to the box use the Box Edit icon on the box table On the strains and cells module the new tubes added will be saved as an action on th
40. tor s Quick Reference Guide for v3 9 16 3l few Grid Viewnr Microsoft Internet Explorar Sehect ve hatt cell positions bo Gechsk ich from bom map Keep this selection and clone the window Click on the green butions to ealect grid positions Ta cancal a position click on fhe red check ican Once all positions Ihave been defined just click on the button Keep this salection 5 Positions will be passed back to the l new racord form X El cene Ad Local inis t 4 2 1 Replicating box structures To speed up the box definitions process complete box structures can be replicated automatically Boxes In This Rack Drawer 2 On Tanque Azoto 1 Ref Position Box Name Owner Features Box C stored at 80 C freezer 1 stored at 80 C freezer 1 GH SH T p NM This rack has 5 possible box positions Add new box in this rackidrawerl gU d Rename Rack To replicate a box you need first to display the box list in a given rack and then click on the replication icon S3 All settings from the original box will be predefined including the special grid format You just need to give a new name and rack location 4 3 Browse storage system Once locations racks and boxes begin to be entered into LabCollector the storage browser will prove to be a useful visualization and management tool Access the storage browser manager from Tools gt gt Storage Browser LabCollector s Quick Refere
41. total units on valid lots Then the total amount available is compared to the alert threshold of the product Expiration alerts are also interesting to avoid letting products expire See also Alerts section above 7 3 Equipment maintenance Another kind of alerts is linked to equipment database If you activate the equipment alerts feature youll get warnings each time equipment needs maintenance Maintenance intervals are defined for each record and alerts are calculated according to the date stamp of the last maintenance entry log 7 4 Waiting data When data is entered by users with User level it is flagged on the database as temporary An alert is displayed on the homepage indicating that some data awaits validation by an administrator Open waiting list Admin gt gt Data gt gt Waiting List This page gives a list of records waiting validation per module Each record can be marked for deletion to be rejected or manually edited Validation is done per module in batch LabCollector s Quick Reference Guide for v3 9 36 aS em Ce Set r be Led We DR 8 og adig Cg ae eee A me L Jj pum pmo meom EE LabCollector mm ie wo Manage Awaiting Data Here you can approve delete or edit new data entered by users No data awaiting No data awaiting l Diacmirc LabCollector s Quick Reference Guide for v3 9 37 8 Users messaging and bookmarks 8 1 Instant Messaging An easy and pra
42. ts and no links to other records You ll have to remove the links and the storage previously to record deletion Delete multiple discrete records from multiple modules Use the modules search engine to find records to delete Use the memory selector icon to memorize all records you want to delete Once done go to the Manage Memorized items section from the Tools menu Records In Memory Manage Records selected in memory Title of record in memory ID from Module Strain 1 1460 Strains C E coli B MF541 Jb Strains C pRS1 4 Plasmids C pPR 03 8 Plasmids X CLEAN selected items from memory CLEAN wW DELETE selected items from DATABASE DELETE Note Action cannot be reversed Records with links ta other records and storage defined will MOT be deleted On this screen you can check confirm the records to delete Take care to use the Kam DELETE button W to permanently delete records from the database The Clean button will only remove records from memory A Multiple Data deletion has limitations The memorized records will only be deleted if the record has no storage assignments and no links to other records You ll have to remove the links and the storage previously to record deletion 5 4 2 Data Transfer between users There are situations where lab members move out of the team Data managed by such users can therefore be migrated or transferred to other existent users All data from all modul
43. uter which will play the role of a server for the remaining computers in the lab Ts you for choosing LabCollector system for the management of your lab LabCollector have been conceived using Open Source tools and languages to keep it as much as possible a low cost solution It is cross platform and so can be installed on any operating system Furthermore the use of web technology makes it a light solution as no client application have to be installed on each computer The interface is accessed through a simple and recent Internet browser Therefore lab information and data is reachable from anywhere and close to where you need it The support of wireless devices brings even more mobility LabCollector is a copyrighted product from AgileBio LabCollector s Quick Reference Guide for v3 9 4 2 Getting Started receiving its CD ROM LabCollector can be installed on any operating system from Windows to MacOS X The easiest way to install it is to use the Easy LabCollector Server Installation Wizard This setup program will do all the required steps and configurations automatically Required software will be installed automatically like Apache web server PHP scripting language mysql database server Y can get LabCollector simply by downloading from www labcollector com or by 2 1 Installation To install LabCollector refer to the installation manuals or documents provided 2 1 1 Windows XP 2000 installation We recommend the use o
Download Pdf Manuals
Related Search
Related Contents
OpenCV-RTC取扱説明書 (ユーザ編) - HI APC 2x1x16 IP KVM w/ 17" Rack LCD & USB VM Server Module Bundle ECOR264-4F1/ECOR264-4D1 ECOR264-8F1/ECOR264-8D1 Harbor Freight Tools 60238 User's Manual the JetTest User`s Manual here. (352Kb in PDF Format) Installazione, funzionamento e manutenzione pdp-42xs1_sm9.3 MB 1 RET B-RF USB2088 User`s Manual downloadable PDF Training Manual Copyright © All rights reserved.
Failed to retrieve file